What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
|
|
- Cecilia Wilkins
- 6 years ago
- Views:
Transcription
1 Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such as added sugars or preservatives. PO can significantly reduce bacterial plaque, tartar build up and malodor. A new study in Beagle dogs. We asked a professional research team in the USA to perform a study on dogs. The aim of the study was to investigate the effect of PO on dental plaque, bleeding, oral malodor, saliva ph, urine ph and blood composition. A control group consisted of 15 dogs with dental plaques when the study began. They received a standard dry diet. Another 15 dogs also with plaques received the same diet plus PO. The dose of PO was based on their body weight. No professional cleaning was undertaken. Experienced examiners used well known criteria when they recorded dental plaque. The amount of dental plaque and gingival bleeding was visually measured with colorimetric methods (Turesky modification of the Quigley-Hein Plaque Index for plaque (13) and Lobene modified gingival index (14) for gum bleeding). Malodor was measured by means of an instrument the Halimeter. The recordings were made at day and day 88 with the changes in the test perameters at day 1 and day 88. In addition the blood content of 39 factors and the ph of both the saliva and the urine were measured at day and day 56. A parallel study investigated the effects on plaque, malodor in another dogs. These dogs had a professional removal of plaque when the study began. The control dogs showed a significant increase of halitosis, plaque scores and urinary ph, but not the PO-supplemented dogs. The salivary ph values decreased in both groups. The effect on ph in saliva and urine was probably caused by the standard food. No significant differences in serum and blood parameters were observed between control and treated groups. These results suggest that the use of a PO-containing food supplement can control: halitosis plaque urinary ph.
2 Effect on plaque Table 1. Increase in plaque scores from day to day 88 Day 7,57 1,7 6,6 2,2 Day 88 8,4 2,22 8,7 1,34 Increase,65 2,1 The increase in plaque was signifi cant in the control group (z= 3,13 p<,1) but not in the group that received PO (Z = 1,25 n.s). Similar results were recorded in the parallel study Increase of mean plaque scores in beagle mouths over 88 days 2,5 2 1,5 1,5 PO n = 15 CTR n = 15 Effect on oral malodor Table 2. Increase of malodor scores from day to day 88 Day 238 9, ,8 Day , ,3 Increase The increase of malodor was signifi cant in the control group (z= 2,57 p<,1) but not in the group that received PO (Z=,42 n.s). Similar results were recorded in the parallel study. Increase of mean oral malodor over 88 days in beagle dogs PO 218 CTR
3 Effect on saliva ph Table 3. Change of saliva ph from day to day 56 Day 8,51,42 8,55,41 Day 56 8,35,77 8,3,96 ph reduction,16,25 The salivary ph decreased signifi cantly in the PO group (z= 7,27 p<,1) and the control group (z= 9,61 p<,1) indicating that diet rather than PO caused the ph drop. Reduction of saliva ph over 56 days 8,6 8,55 Effect on urinary ph Table 4. Change of urinary ph from day to day 56 8,5 8,45 8,4 8,35 8,3 8,25 8,2 8,15 PO CTR PO CTR Day Day 56 Day 8,39,182 8,3,149 Day 88 8,48,78 8,46,12 ph increase,9,43 The urinary ph increased significantly in the control group (z= 8,16 p<,1) but not in the PO group (z=1,76 ns) indicating that the diet but not PO caused an increase of ph. The lack of increase in the PO group suggests that PO prevents an increases of the urinary ph that a diet might cause. High ph environment increase the risk for struvite stones. Increase of urinary ph over 56 days in beagle dogs,5,4,3,2,1 PO CTR
4 Oral effects of Effect on gum bleeding Table Increase of gum bleeding scores from day to day 88 Mean SD Mean SD Day 1,1,16,9,4 Day 88 1,13,32 1,2,43 Increase,12 The increase of gum bleeding was significant in the control group (z= 1,99 p<,5) but not in the group that received PO (Z= 1,65 n.s). Similar results were recorded in a parallel study.,3 Increase of mean gum scores in beagle mouths over 88 days,35,3,25,2,15,1,5 PO n = 15 CTR n = 15
5 Effect on serum chemistry Blood was sampled at day and day 56 and then 39 parameters were analyzed in all groups. All the results were within the normal range of the parameter. No signifi cant difference was observed between groups with and without PlaqueOff. Blood chemistry in beagle dogs before and after eating PlaqueOff for 56 days Mean values Mean values Thus supplementing the diet with PlaqueOff does not change blood chemistry more than a diet without PlaqueOff. Thus PlaqueOff is not harmful in any way. Ktr 1 PO 1 Ktr 2 PO2 Day 1 Day 56 Day 1 Day 56 Day 1 Day 56 Day 1 Day 56 Alkaline Phosphatase (U/l) Alkaline Phosphatase (U/l) BUN/Creatinin Ratio BUN/Creatinin Ratio Platelets 1^3/mm Platelets 1^3/mm Absolute eos Absolute eos ALT (U/l) ALT (U/l) Urea Nitrogen (mg/dl) Urea Nitrogen (mg/dl) Absolute Polysacc Absolute Polysacc AST (U/l) AST (U/l) Phosphorus (mg/dl) 3,4 3,8 3,8 3,8 Phosphorus (mg/dl) 3,5 3,7 3,2 3,5 Changed 5-1 % Changed 5-1 % Absolute Lymphs Absolute Lymphs Cholesterol (mg/dl) Cholesterol (mg/dl) WBC 1^3/mm3 9,6 8,7 8,2 7,7 WBC 1^3/mm3 8,6 8,9 9,2 9,8 Glucose (mg/dl) Glucose (mg/dl) Magnesium (meq/l) 1,6 1,7 1,6 1,6 Magnesium (meq/l) 1,6 1,6 1,5 1,7 RBC 1^6/mm3 7,27 7,17 7,24 7,2 RBC 1^6/mm3 7,57 7,46 7,59 7,19 Changed less than 5 % Changed less than 5 % Creatinin (mg/dl),7,7,7,7 Creatinin (mg/dl),8,7,8,7 Total Protein (g/dl) 6,7 6,5 6,6 6,4 Total Protein (g/dl) 6,7 6,6 6,4 6,4 Albumin (g/dl) 3,1 3,1 3,1 3,1 Albumin (g/dl) 3,2 3,2 3 3 Total Bilirubin (mg/dl),2,2,2,2 Total Bilirubin (mg/dl),2,2,2,2 Calcium (mg/dl) 9,9 1 9,9 1 Calcium (mg/dl) 9,8 9,9 9,4 9,7 Sodium (meq/l) Sodium (meq/l) Potassium (meq/l) 4,4 4,5 4,5 4,6 Potassium (meq/l) 4,5 4,4 4,4 4,5 Chloride (meq/l) Chloride (meq/l) A/G Ratio,9,9,9,9 A/G Ratio,9,9,9,9 Globuline (g/dl) 3,6 3,5 3,4 3,3 Globuline (g/dl) 3,6 3,5 3,4 3,4 Hemoglobin (g/dl) 16,2 16,2 16,3 16,5 Hemoglobin (g/dl) 17,1 16, ,3 Hematocrit % 53 53,5 53,4 54,7 Hematocrit % 55,4 54,5 54,5 51,9 MCV um^ MCV um^ MCH (uug) 22,3 22,6 22,6 22,9 MCH (uug) 22,7 22,5 22,5 22,7 The clinical study was conducted by a research team of Summit Ridge Farms (Susquehanna, Pennsylvania, USA). SDC Swedencare AB Björkstigen 9 SE Kiruna Contactperson. Sune Wikner sune.wikner@bredband.net mobile phone:
Supplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationRound Rock Animal Hospital 404 Chisholm Valley Dr. Round Rock, TX 78661
Round Rock Animal Hospital 404 Chisholm Valley Dr. Round Rock, TX 78661 D.M. Sundbeck, DVM Phone: 512-255-6232 D.A. Hocher, DVM Fax: 512-255-7375 R. Bohmfalk, DVM www.roundrockvet.com L. Mendelzon, DVM
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Chen CL, Lin GA, Bardach NS, et al. Preoperative medical testing
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationResearch Data Available
Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family
More informationSerodos and Serodos plus
Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationManufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationM Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationINSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons
Radiation Therapy Oncology Group Phase III Head & Neck Cancer Treatment Summary Form AMENDED DATA YES INSTRUCTIONS: 1 Use codetable on page 1 for modifications / termination reasons SUMMARY OF SYSTEMIC
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationBiochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats
Biochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats 1 H Krishna*, 2 AV Ramachandran 1 Dhirubhai Ambani Life Sciences Centre, Reliance Life Sciences
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationHEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationPurdue Veterinary Clinical Pathology Laboratory
Order Comments: 8/1/2017 2:27 PM OSA? rinalysis Final - Approved 8/1/2017 2:27 PM Color Turbidity Specific Gravity p Protein Glucose Ketones Bilirubin Blood robilinogen WBC RBC Epithelial Cells Bacteria
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO
ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationGemcitabine & Cisplatin
Gemcitabine & Cisplatin Available for Routine Use in Burton in-patient Derby in-patient Burton day-case Derby day-case Burton community Derby community Burton out-patient Derby out-patient Indication Advanced
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationCLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)
ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More information2010 Miniboard Exam- Clinical Pathology
2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationSeeing is not Believing (13-Nov-2004)
In: 55th Annual Meeting of the American College of Veterinary Pathologists (ACVP) & 39th Annual Meeting of the American Society of Clinical Pathology (ASVCP), ACVP and ASVCP (Eds.) Publisher: American
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Wanner C, Inzucchi SE, Lachin JM, et al. Empagliflozin and
More informationPatient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith
Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when
More informationProvider: TONY BOGGESS DO 1310 S Main St Ann Arbor, MI Account No: Results
DOB: 03.17.1969 Fasting: Yes ACC/AHA Risk Score: BMI: 28.9 Info: 1310 S Main St Ann Arbor, MI 48104 Requisition No: Received Date & Time: 09.09.2017 11:46 AM Collection Date & Time: 09.08.2017 NOT GIVEN
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationFebruary 1, 2016 Body Fluid order changes
February 1, 2016 Body order changes Laboratory will be making the following changes to Body tests: 1. Changing orders in Power plans (see below list). 2. All folders will be updated accordingly: If the
More information