Original Article. Acute and subchronic toxicity study of the water extract from the fruits of Piper chaba Hunter in rats
|
|
- Loreen Bruce
- 5 years ago
- Views:
Transcription
1 International Journal of Applied Research in Natural Products Vol. 3 (4), pp , Dec 2010-Jan 2011 Directory of Open Access Journals IJARNP-HS Publications Original Article Acute and subchronic toxicity study of the water extract from the fruits of Piper chaba Hunter in rats Jaijoy K 1, Vannasiri S 2, Piyabhan P 2, Lerdvuthisopon N 3, Boonraeng S 4, Khonsung P 5, Lertprasertsuke N 6, Sireeratawong S 7* 1 Department of Pharmacology, Faculty of Medicine, Chiang Mai University, Muang, Chiang Mai 50200, Thailand. 2 Division of Physiology, Department of Preclinical Science, Faculty of Medicine, Thammasat University, Rungsit Campus, Klongloung, Pathumthani 12120, Thailand. 3 Division of Biochemistry, Department of Preclinical Science, Faculty of Medicine, Thammasat University, Pathumthani 12120, Thailand. 4 Division of Agro-industry, Faculty of Agricultural Technology, Chiang Mai Rajabhat University, Chiang Mai, Thailand. 5 Department of Pathology, Faculty of Medicine, Chiang Mai University, Muang, Chiang Mai 50200, Thailand. 6 Department of Pathology, Faculty of Medicine, Chiang Mai University, Muang, Chiang Mai 50200, Thailand. 7 Division of Pharmacology, Department of Preclinical Science, Faculty of Medicine, Thammasat University, Rungsit Campus, Klongloung, Pathumthani 12120, Thailand. Summary: The water extract from the fruits of Piper chaba Hunter was evaluated for acute and subchronic toxicity in both male and female rats. For the study of acute toxicity, a single oral dose of 5,000 mg/kg body weight was administered in rats (five females, five males). The results showed no signs of toxicity such as general behavior change, mortality, or change in gross appearance of internal organs. Subchronic toxicity was studied by daily oral doses (ten females, ten males) of 300, 600 and 1,200 mg/kg body weight for consecutive 90 days. The satellite group was treated with the extract at the dose of 1,200 mg/kg/day for 90 days and kept for other 28 days after treatment. The results showed no abnormalities in treated groups as compared to the controls. Although significantly different, all of the values were within normal limits. Neither gross abnormalities nor histopathological changes were observed. The results suggest that P. chaba extract does not produce acute or subchronic toxicity in either female or male rats. Industrial relevance: Herbal medicines are popular and extensively used in the developing world. In many places, they offer a more wide available and more affordable alternative to pharmaceutical drugs and natural food supplements. The data of the acute and subchronic toxicity studies on medicinal plants or preparations derived from them should be obtained in order to increase the confidence in its safety to human, particularly for use in the development of pharmaceutical. Keywords: Piper chaba Hunter; acute toxicity; subchronic toxicity Introduction Piper chaba Hunter is a plant of Piperaceae family, locally known as pepper, long pepper, and also known as Dee Plee. The dried fruit are extensively used for flavouring a variety of foods. In Thai traditional medicine, the decoction of dried mature unripe fruits (1 handful or fruits) are used to reduce gas and motion sickness, as well as help improving appetite and stopping diarrhea. Due to oxytocic effect for post-labor, it is not recommended for women during pregnancy (Saralamp et al., 1996). Chemical studies of P. chaba fruit reveal *Corresponding Author: Sireeratawong S: seewaboon@gmail.com Tel: Available online
2 Jaijoy et al several bioactive compounds such as piperine, piperlongumine (Wu et al., 2004; Park et al., 2007), piperrolein B, piperchabamide D (Lee et al., 2008), piperchabamide B, piperundecalidiene (Zhang et al., 2008), piperchabamide C, piperchabamide E (Matsuda et al., 2008). Pharmacological importance of P. chaba fruit extract have been reported as gastroprotective (Morikawa et al., 2004), cytotoxicity, antitumor (Sunila & Kuttan 2004), analgesic, anti-inflammatory, antidiarrhoeal (Taufiq-Ur-Rahman et al., 2005), chemopreventive (Selvendiran et al., 2006), antiangiogenesis (Sunila & Kuttan 2006), immunomodulator (Devan et al., 2007), hepatoprotective (Matsuda et al., 2008), and adipogenesis (Zhang et al., 2008). Despite long record of usage for various purposes, little information on P. chaba toxicity is currently available. The purposes of the present study are to investigate acute and subchronic oral toxicities of the water extract from fruits of P. chaba in rats. Materials and methods Plant material: The fruits of Piper chaba were collected from Songkhla, Thailand. The voucher specimen (SBK 0013) was kept and identified by the National Park, Wildlife and Plant Conservation Department, Ministry of Natural Resources and Environment, Bangkok, Thailand. Preparation of plant extract: One of the effective methods in Ayurvedic and Thai traditional medicine is water decoction of herb (Farnsworth et al., 1992). In the present study, a decoction of P. chaba dried fruit was prepared. Dried fruit powder of P. chaba 500 grams was wrapped in a calico bag and put into a stainless boiler. Ten liters of water were added, then boiled for 3-4 h to extract the substance in P. chaba, and filtered when it cooled down. The residue from the filtration was boiled and filtered again with the same ratio. The filtrates were collected and evaporated in a rotary evaporator until concentrated. P. chaba water extract was stored at -20 C after preparation. Experimental animals: Male and female Sprague-Dawley rats, weighing g were obtained from the National Laboratory Animal Center, Nakorn Pathom, Thailand. Animals were randomly assigned to control and treated groups. They were housed under standard environmental conditions of temperature at 24 ± 1 C under a 12 h dark-light cycle, and allowed free access to drinking water and standard pellet diet. Rats were acclimated to holding facilities for 1 week prior to dosing. All experimental protocols were approved by the Animal Ethics Committee of Faculty of Medicine, Thammasat University, Pathumthani, Thailand (No. 0004/2005). Acute toxicity: Acute toxicity test was performed according to the World Health Organization (WHO) guideline (WHO 2000) and the Organization of Economic Co-operation and Development (OECD) guideline for testing of chemicals (OECD 2001). Five rats per sex were administrated a single oral dose of 5,000 mg/kg body weight while the control group received water vehicle. Body weight, signs of toxicity and mortality were observed after the administration at the first, second, fourth and sixth hour and once daily for next 14 days. On the 15 th day, all rats were kept fasted for h, and then sacrificed for necropsy examination. The internal organs were excised and weighed. The gross pathological observations of the tissues were performed. Subchronic toxicity: According to WHO guideline (WHO 2000) and the OECD (OECD 1981), rats were divided into 5 groups of 20 animals (10 male and 10 female). According to Ayurvedic medicine, 500 mg to 1 g of powdered fruits are used for treatment of the several symptoms including anti-diarrheal, carminative, etc. In the present study, the doses of P. chaba water extract were 300, 600 and 1,200 mg/kg/day, which are equivalent to times of the normal human dose (10-20 mg/kg). The extracts were dissolved in distilled water and orally given to each group of rats daily for 90 days, while the control group received the water vehicle. In order to assess reversibility effect, the extract at the dose of 1,200 mg/kg was given once daily to the fifth group of rats for 90 days, and kept for another 28 days post treatment (satellite group). Toxic manifestations such as signs of toxicity, mortality and the body weight changes were monitored daily. At the end of the study, all animals were fasted for h and then anesthetized with intraperitoneal injection of pentobarbital sodium at a dose of 50 mg/kg on day 91 st and 118 th (satellite groups). Blood samples for hematological and blood chemical analyses were taken from common carotid artery. All rats were sacrificed after the blood collection. The internal organs and some tissues were weighed to determine relative organs weights, and observed for gross lesions. All tissues were preserved in 10% neutral buffered formaldehyde solution for histopathological examination. Statistical analysis: Results were expressed as mean ± standard error of mean (S.E.M.). Statistical significance was determined by one-way analysis of variance (ANOVA) and post hoc least-significant difference (LSD) test. The data obtained from acute toxicity studies were analyzed using Student s paired t-test. P values less than 0.05 were considered significant. Results Acute Toxicity: The water extract from fruits of P. chaba at a single dose of 5000 mg/kg was orally given to rats. Neither sign of toxicity nor death of rats was observed during the 14 days of the experimental period. Toxicity evaluation was further carried out by observing both body weight gain and internal organ weight. In male rats, P. chaba extract caused a significant difference in body weight gain when compared with their control group. In addition, the liver and testis weight were slightly difference from the control group (p<0.05). 30
3 Acute and subchronic toxicity of Piper chaba Furthermore, gross examinations of the internal organs of treated rats revealed no pathological abnormality as compared with those of the control (data not shown). Subchronic toxicity: Neither changes in animal behaviors nor toxic signs were detected in the treatment rats. The body weight and body weight gain on day 90 of female and male treatment groups were significantly lower than those of the control group (Table 1). As shown in Table 2, the female treatment group with the extract at the dose of 300 mg/kg/day had the heart and kidney weight significantly lower than the control. The dose of 600 mg/kg caused a significant decrease in the weights of lung, heart and kidney. At the dose of 1,200 mg/kg, a significant lower of kidney weight was detected. Moreover, the satellite female group showed a significant decline in the kidney and ovary weights when compared with the control (p<0.05). In the male group (Table 3), the weights of heart, spleen, and kidney were significantly decreased in the group treated with 300 mg/kg/day, while those of lung, heart, spleen, kidney and testis decreased in the treatment group with 600 mg/kg/day. At the dose of 1,200 mg/kg/day, a significant weight decrease was found not only in lung, heart and liver, but also spleen and kidney as compared with those of the controls. The weight of heart was significantly changed in the male satellite group. Necropsy and histopathology examinations were further confirm whether or not the organs or tissue had been damaged. The results showed no macroscopic or microscopic changes in the internal organs of any of the treatment rats. Table 4 listed the hematological values of female and male rats. In the female treatment group with 300 mg/kg/day, mean corpuscular volume (MCV) was significantly higher than the control values. At the dose of 600 mg/kg, a significant weight decrease was found in mean corpuscular hemoglobin concentration (MCHC). In the satellite female and 300 mg/kg male treatment group, a slight but significant different of MCV and MCHC were shown. The differential white blood cell count values of female and male treated groups are shown in Table 5. A significant decrease in monocyte was observed in the female treatment with 300 mg/kg/day. In the female satellite group, the monocyte and eosinophil were significantly changed from the control group. In the male satellite rats, eosinophil was significantly decreased from the control values. Blood chemistry values of the female and male rats are summarized in Table 6. The data indicates a significant increase in total protein and albumin in the female satellite rats. Moreover, the concentrations of alkaline phosphatase (ALP) was significantly decreased as compared with those of the controls (p<0.05). In addition, the results of the histopathological assessment showed no significant histopathological change in the internal, especially vital, organs. Table 1. Body weights of rats in the subchronic toxicity test of the water extract from fruit of P. chaba. Body weight (g) Day 0 Day 90 Day 118 Weight gain on day 90 Female Control P. chaba 300 mg/kg * P. chaba 600 mg/kg * P. chaba 1,200 mg/kg a * P. chaba 1,200 mg/kg b Male Control P. chaba 300 mg/kg * * P. chaba 600 mg/kg * * P. chaba 1,200 mg/kg a * * P. chaba 1,200 mg/kg b * *. 31
4 Jaijoy et al Table 2. Organ weights of female rats in the subchronic toxicity test of the water extract from fruit of P. chaba. Dose Organ weight (g) mg/kg Lung Heart Liver Spleen Adrenal Kidney Ovary gland * * * * * ,200 a * ,200 b * *. Table 3. Organ weights of male rats in the subchronic toxicity test of the water extract from fruit of P. chaba. Dose Organ weight (g) mg/kg Lung Heart Liver Spleen Adrenal Kidney Testis gland * * * * * * * * 1,200 a * * * * * ,200 b * Table 4. Hematological values of female and male rats in the subchronic toxicity test of the water extract form fruit of P. chaba. Dose Red blood cell Hemoglobin Hematocrit MCV MCH MCHC Platelet (mg/kg) (x10 6 /µl) (g/dl) (fl) (pg) (g/dl) (x10 5 /µl) * * ,200 a ,200 b * * * * ,200 a ,200 b
5 Acute and subchronic toxicity of Piper chaba Table 5. Differential white blood cell count values of female and male rats in the subchronic toxicity test of the water extract from fruit of P. chaba. Group Dose (mg/kg) White blood cell (x10 3 /µl) Neutrophil Lymphocyte Monocyte Eosinophil Basophil Female Control P. chaba * ,200 a ,200 b * * Male Control P. chaba ,200 a ,200 b * Table 6. Clinical blood chemistry values of female and male rats in the subchronic toxicity test of the water extract from fruit of P. chaba. Female Glucose mg dl BUN mg dl Creatinine mg dl Total protein g dl Albumin g dl Total bilirubin mg dl Direct bilirubin mg dl SGOT U l SGPT U l ALP U l Male Glucose mg dl BUN mg dl Creatinine mg dl Total protein g dl Albumin g dl Total bilirubin mg dl Direct bilirubin mg dl SGOT U l SGPT U l ALP U l Control P. chaba (mg/kg),200 a,200 b Discussion In acute toxicity study, P. chaba extract at a single dose of 5,000 mg/kg did not show any toxicity signs (body weight, internal organ weight, and general behaviors). The results suggest that P. chaba extract is practically not toxic after an acute exposure in rats. Commonly, P. chaba has been used over long time periods; little toxicity information is available regarding safety following repeated exposure. From the evaluation of its subchronic toxicity at the doses of 300, 600 and 1,200 mg/kg/day for 90 days, both female and male rats treated doses presented no signs of behavior changes and toxic signs as shown by the normal appearance of respiration pattern, color of body surfaces, frequency and nature of movement, both involuntary and voluntary (Chan et al., 1982; Auletta 2002). The differences in body 33
6 Jaijoy et al weight and body weight gain may have resulted from physiological variation in rats such as food intake, and metabolism. Furthermore, neither morbidity nor disease was observed during the entire experimentation period. In hematological examinations, the significant changes are within normal ranges (Feldman et al., 2000; Inala et al., 2002). Likewise, the significant changes of blood chemical values fall within the normal ranges (Caisey & King 1980; Levine 2002; Angkhasirisap et al., 2002). Besides, the physical examination during the experimental period indicated that all animals are healthy. In the last experiment, necropsy and histopathological examinations were performed to further confirm whether or not the internal organs or tissues had been damaged. The results showed no macroscopic or microscopic changes in these internal organs or tissues in any treated rats. Thus, these results indicated the healthy status of liver and kidney in the treatment rats. In summary, the water extract from the fruit of P. chaba administered orally did not cause acute and subchronic toxicities in female or male rats. A chronic toxicity study should be further carried out to assess the long-term safety of the extract. Acknowledgements The authors are thankful to the Department for Development of Thai Traditional and Alternative Medicine, Ministry of Public Health, Bangkok, Thailand, and Dr. Somboon Kietinun for financial support. Deep appreciation is especially extended to the National Park, Wildlife and Plant Conservation Department, Ministry of Natural Resources and Environment, Bangkok, Thailand, for the plant material identification. Bibliography Angkhasirisap W, Inala P, Sirimontaporn A, Inpunkaew R, Rungrojejinda K, Kengkoom K, Ratanasak W, Lawson BD Blood chemistry profiles of outbred Sprague-Dawley rat in The Facility of National Laboratory Animal Centre. 28th Congress on Science and Technology of Thailand. Auletta CS Acute, Subchronic and Chronic Toxicology. In: Derelanko MJ, Hollinger MA, editors. Handbook of Toxicology. USA: CRC Press Inc. p Bailey SA, Zidell RH Perry RW Relationships between organ weight and body/brain weight in the rat: what is the best analytical endpoint? Toxicol Pathol 32(4): Caisey JD, King DJ Clinical chemical values for some common laboratory animals. Clin Chem 26: Chan PK, O Hara GP, Hayes AW Principles and methods for acute and subchronic toxicity. In: Hayes AW, editor. Principles and Methods of Toxicology. New York: Raven Press. p Devan P, Bani S, Suri KA, Satti NK, Qazi GN Immunomodulation exhibited by piperinic acid through suppression of proinflammatory cytokines. Int Immunopharmacol 7: Inala P, Sirimontaporn A, Inpunkaew R, Rungrojejinda K, Kengkoom K, Ratanasak W, Buripakdi Lawson D Hematological analysis of outbred Sprague-Dawley rat in The Facility of National Laboratory Animal Centre. 28th Congress on Science and Technology of Thailand. Lee SW, Kim YK, Kim K, Lee HS, Choi JH, Lee WS, Jun CD, Park JH, Lee JM, Rho Mc Alkamides from the fruits of Perper longum and Piper nigrum displaying potent cell adhesion inhibition. Bioorg Med Chem Lett 18: Matsuda H, Ninomiya K, Morikawa T, Yasuda D, Yamaguchi I, Yoshikawa M Protective effects of amide constituents from the fruit of Piper chaba on D-galactosamine/TNF-alpha-induced cell death in mouse hepatocytes. Bioorg Med Chem Lett 18(6): Morikawa T, Matsuda H, Yamaguchi I, Pongpiriyadacha Y, Yoshikawa M New amides and gastroprotective constituents from the fruit of Piper chaba. Planta Med 70(2): Park BS, Sonb DJ, Park YH, Kim TW, Lee SE Antiplatelet effects of acidamides isolated from the fruits of Piper longum L. Phytomedicine 14: Saralamp P, Chuakul W, Temsiririrlkul R, Clayton T Medicinal Plant in Thailand Volume I. Department of Pharmaceutical Botany, Faculty of Pharmacy, Mahidol University, Thailand. Selvendiran K, Singh JPV, Sakthisekaran D In vivo effect of piperine on serum and tissue glycoprotein levels in benzo(a)pyrene induced lung carcinogenesis in Swiss albino mice. Pulmonary Pharmacology & Therapeutics 19: Sunila ES, Kuttan G Immunomodulatory and antitumor activity of Piper longum Linn. And piperine. J Ethnopharmacol 90(2-3): Sunila ES, Kuttan G. Piper longum inhibits VEGF and proinflammatory cytokines and tumor-induced angiogenesis in C57BL/6 mice. Int Immunopharmacol. 2006; 6(5): Taufiq-Ur-Rahman M, Shilpi JA, Ahmed M, Faiz Hossain C Preliminary pharmacological studies on Piper chaba stem bark. J Ethnopharmacol 99(2): The Organization of Economic Co-operation and Development (OECD) The OECD guideline for testing of chemical: 408 Subchronic Oral Toxicity-Rodent: 90-day Study. France. 34
7 Acute and subchronic toxicity of Piper chaba The Organization of Economic Co-operation and Development (OECD) The OECD guideline for testing of chemical: 420 Acute Oral Toxicity. France. World Health Organization (WHO) General guidelines for methodologies on research and evaluation of traditional medicine. Switzerland. Wu S, Sun C, Pei S, Lu Y, Pan Y Preparative isolation and purification of amides from the fruits of Piper longum L. by upright counter-current chromatography and reversed-phase liquid chromatography. J Chromatogr A 1040: Zhang H, Matsuda H, Nakamura S, Yoshikawa M Effects of amide constituents from pepper on adipogenesis in 3T3-L1 cells. Bioorg Med Chem Lett 18:
Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels in rats
Songklanakarin J. Sci. Technol. 30 (5), 611-619, Sep. - Oct. 2008 http://www.sjst.psu.ac.th Original Article Acute and subchronic toxicity study of the water extract from Tiliacora triandra (Colebr.) Diels
More informationAcute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats
Songklanakarin J. Sci. Technol. 30 (6), 729-737, Nov. - Dec. 2008 Original Article Acute and subchronic toxicity study of the water extract from root of Sida rhombifolia Linn. in rats Seewaboon Sireeratawong
More informationAcute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb.
Mahidol University Journal of Pharmaceutical Sciences 2005; 32(1-2): 7-14. Original Article Acute and Subacute Toxicities of the Ethanol Extract from Alternanthera philoxeroides Griseb. S. Thanabhorn,
More informationAcute and Subacute Toxicities of the Ethanol Extract from the Fruits of Terminalia belerica (Gaertn.) Roxb.
Mahidol University Journal of Pharmaceutical Sciences 2006; 33(1-4): 23-30. Original Article Acute and Subacute Toxicities of the Ethanol Extract from the Fruits of Terminalia belerica (Gaertn.) Roxb.
More informationAcute and subchronic toxicity study of the water extract from dried fruits of Piper nigrum L. in rats
ORIGINAL ARTICLE Acute and subchronic toxicity study of the water extract from dried fruits of Piper nigrum L. in rats Siharat Chunlaratthanaphorn 1,5 Nirush Lertprasertsuke 2 Umarat Srisawat 3 Amornnat
More informationResearch Article Anti-Inflammatory, Analgesic, and Antipyretic Activities of the Ethanol Extract of Piper interruptum Opiz. and Piper chaba Linn.
International Scholarly Research Network ISRN Pharmacology Volume 212, Article ID 48265, 6 pages doi:1.542/212/48265 Research Article Anti-Inflammatory, Analgesic, and Antipyretic Activities of the Ethanol
More informationSHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH
IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity
More informationAcute and Subchronic Toxicity of Mulberry Fruits
American Journal of Agricultural and Biological Sciences, 2012, 7 (3), 378-383 ISSN: 1557-4989 2012 Science Publication doi:10.3844/ajabssp.2012.378.383 Published Online 7 (3) 2012 (http://www.thescipub.com/ajabs.toc)
More informationACUTE AND SUB CHRONIC TOXICITY STUDY OF ETHANOL EXTRACT OF ANREDERA CORDIFOLIA (TEN.) V. STEENIS LEAVES
Innovare Academic Sciences International Journal of Pharmacy and Pharmaceutical Sciences ISSN- 0975-1491 Vol 6, Issue 5, 2014 Original Article ACUTE AND SUB CHRONIC TOXICITY STUDY OF ETHANOL EXTRACT OF
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationINTERNATIONAL JOURNAL OF PHYTOTHERAPY RESEARCH ISSN Research article
Research article EVALUATION OF SAFETY OF VETTUMARAN GUTIKA THROUGH SUB ACUTE TOXICITY STUDY IN WISTAR RATS Sanjaya Kumar Y.R*, Sushant S Parekar, Thamizh Selvam N, Sanal Gopi C.G and Sudarsanan Nair PK
More informationINTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE
INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE EVALUATION OF ACUTE AND SUB ACUTE TOXICIY STUDY OF KANDANGKATHIRI KIRUTHAM (GHEE OF SOLANUM XANTHOCARPUM) IN ANIMAL MODEL. DR. S. CHITRA
More informationAcute Dermal Toxicity and Repeated Dose 90-Day Oral Toxicity Studies of the Bioinsecticide from Stemona curtisii Hook. F.
CMU. J. Nat. Sci. (2011) Vol. 10(1) 15 Acute Dermal Toxicity and Repeated Dose 90-Day Oral Toxicity Studies of the Bioinsecticide from Stemona curtisii Hook. F. Natthakarn Chiranthanut, 1 Parirat Khonsung,
More informationRepeated-Dose Dermal Toxicity of Topical Formulation of Hyptis suaveolens oil
CMU. Journal (2006) Vol. 5(3) 369 Repeated-Dose Dermal Toxicity of Topical Formulation of Hyptis suaveolens oil Kanokporn Niwatananun 1*, Wirat Niwatananun 1, Nirach Lertprasertsook 2 and Siriporn Okonogi
More informationSubchronic toxicity of Cissus quadrangularis Linn.
ORIGINAL ARTICLE Aimmanas Attawish 1, Pranee Chavalittumrong 2, Songpol Chivapat 3, Anchalee Chuthaputti 4, Sadudee Rattanajarasroj 5 and Somkiat Punyamong 6 Abstract Attawish, A., Chavalittumrong, P.,
More informationSafety assessment of hydroethanolic rambutan rind extract: Acute and sub-chronic toxicity studies
Indian Journal of Experimental Biology Vol.52, October 2014, pp. 989-995 Safety assessment of hydroethanolic rambutan rind extract: Acute and sub-chronic toxicity studies Aree Thinkratok 1, Parin Suwannaprapha
More informationAcute and chronic toxicities of Bacopa monnieri extract in Sprague-Dawley rats
Sireeratawong et al. BMC Complementary and Alternative Medicine (2016) 16:249 DOI 10.1186/s12906-016-1236-4 RESEARCH ARTICLE Acute and chronic toxicities of Bacopa monnieri extract in Sprague-Dawley rats
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationToxicological Assessments of Piper nigrum on Alloxan Induced Diabetic Rats
American-Eurasian Journal of Toxicological Sciences 6 (2): 30-34, 2014 ISSN 2079-2050 IDOSI Publications, 2014 DOI: 10.5829/idosi.aejts.2014.6.2.8490 Toxicological Assessments of Piper nigrum on Alloxan
More informationCHRONIC TOXICITY STUDY OF GARBHPAL RAS, AN AYURVEDIC MEDICINE
Journal of Herbal Medicine and Toxicology 3 (1) 13-17 (2009) ISSN : 0973-63 Original Article CHRONIC TOXICITY STUDY OF GARBHPAL RAS, AN AYURVEDIC MEDICINE D. MISHRA 1, M. SINHA 1, M. KUMAR 2 AND V. KUMAR
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationA Subchronic Toxicity Study of Spirulina platensis
Food Sci. Technol. Res., 14 (4), 351 358, 2008 A Subchronic Toxicity Study of Spirulina platensis Nongporn HuTAdilok-ToWATAnA 1, 2*, Wantana reanmongkol 3, Siva satitit 2, Pharkphoom PAnichAyuPAkArAnAnT
More informationInternational Journal of Medicine and Health Profession Research
Research Article ISSN: 2394 7403 International Journal of Medicine and Health Profession Research Journal home page: www.ijmhpr.com TOXICITY STUDY OF VAIVILANGAM CHOORANAM E. M. Manikgantan* 1 and R. Pattarayan
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationThe volunteers were divided into three parts to study the effect of BESEB.
Brahmi is an important drug known for its memory enhancing property. In Ayurveda this drug is described as a Rasayana drug. The Rasayana therapy (rejuvenating therapy) aims specially at the promotion of
More informationSubchronic Oral Toxicity Study of Morinda citrifolia (Mengkudu) in Spraque Dawley Rats
Pertanika J. Trop. Agric. Sci. 34 (2): 341-349 (2011) ISSN: 1511-3701 Universiti Putra Malaysia Press Subchronic Oral Toxicity Study of Morinda citrifolia (Mengkudu) in Spraque Dawley Rats Rosly, S.M.
More informationAcute and Sub-acute Toxicity of Amalakyadi Churna
Acute and Sub-acute Toxicity of Amalakyadi Churna Uma Reddy B. Department of Botany, Gulbarga University, Gulbarga- 585 106, India E-mail drumareddy11@yahoo.co.in, Cell Number: +91-9449329266 Summary The
More informationToxicological Studies of the Aqueous Leaves Extracts of Combretum micranthum on Rats
International Journal of Biotechnology and Biochemistry ISSN 0973-2691 Volume 12, Number 2 (2016) pp. 167-171 Research India Publications http://www.ripublication.com Toxicological Studies of the Aqueous
More informationAsian Journal of Biomedical and Pharmaceutical Sciences 1 (3) 2011, 26-31
Asian Journal of Biomedical and Pharmaceutical Sciences 1 (3) 2011, 26-31 RESEARCH ARTICLE ISSN 2249-622X Hepatoprotective Potential of Abutilon Hirtum Sweet Leaves In Carbon Tetrachloride Induced Hepatotoxicity.
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationSAFETY ASPECTS OF MIDAZOLAM
Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg
More informationAcute and Sub-Acute Toxicity Study of Compound Siddha Drug Lagu Seena Chooranam for the Management of Scabies
Human Journals Research Article September 2015 Vol.:4, Issue:2 All rights are reserved by A.Silambarasan et al. Acute and Sub-Acute Toxicity Study of Compound Siddha Drug Lagu Seena Chooranam for the Management
More informationof 3-Aminophenol in B6D2F1 Mice
Summary of Drinking Water Carcinogenicity Study of 3-Aminophenol in B6D2F1 Mice July 2012 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationTranslatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal
Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationH.6.G.2 Non-MAC Studies
Page 63 H.6.G.2 Non-MAC Studies H.6.G.2.A Non-MAC Studies at the 600 mg dose A 600 mg dose of azithromycin was given in two non-mac studies (354/354A and 167). Please note: Study 354/354A enrolled a mixture
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationPharmacologyonline 1: (2009) HYPOGLYCEMIC EFFECT OF PHOEBE LA CEOLATA O ALLOXA -I DUCED DIABETIC MICE
HYPOGLYCEMIC EFFECT OF PHOEBE LA CEOLATA O ALLOXA -I DUCED DIABETIC MICE SEMWAL DK 1 *, RAWAT U 1, SEMWAL R 2, SINGH K 3, SINGH R 3, SAINI B 3, KRISHAN P 3, SINGH M 4 1 Department of Chemistry, University
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationPharmacologyonline 2: (2009) ewsletter Kumar et al.
A TIUROLITHIATIC ACTIVITY OF AQUEOUS EXTRACTS OF ASPARAGUS RACEMOSUS WILLD. A D TAMARI DUS I DICA LI. I RATS Satish Kumar M. C 1, Udupa A.L 2, Sammodavardhana K 1, Rathnakar U.P 3, Shvetha Udupa 1, Prabhath
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationSoursop (Anona muricata L.): Blood hematology and serum biochemistry of Sprague-Dawley rats
International Food Research Journal 19 (3): 955-959 (2012) Soursop (Anona muricata L.): Blood hematology and serum biochemistry of Sprague-Dawley rats 1,2 Syahida, M., 2 Maskat, M. Y., 1 Suri, R., 2* Mamot,
More informationEffect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study
Effect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study Vd. Hitesh Vyas Dr. Anil D. Avhad Department of Basic Principles Institute for Post Graduate Teaching and Research
More informationAcute toxicity investigation of polysaccharide extracts of Lentinus polychrous in rats
Songklanakarin J. Sci. Technol. 37 (4), 433-439, Jul. - Aug. 2015 http://www.sjst.psu.ac.th Original Article Acute toxicity investigation of polysaccharide extracts of Lentinus polychrous in rats Catheleeya
More information210 Vol 37 (suppl 3) 2006
Effect of Kaempferia parviflora Wall. Ex. Baker on Sexual Activity of Male Rats and its Toxicity Paiwan Sudwan 1,2, Kanokporn Saenphet 1, Supap Saenphet 1 and Songkiet Suwansirikul 2 1 Department of Biology,
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationOPTIMIZATION OF MICROWAVE-ASSISTED EXTRACTION OF BIOACTIVE COMPOUNDS FROM LEAVES AND STEMS OF THAI WATER SPINACH (Ipomoea aquatic var.
OPTIMIZATION OF MICROWAVE-ASSISTED EXTRACTION OF BIOACTIVE COMPOUNDS FROM LEAVES AND STEMS OF THAI WATER SPINACH (Ipomoea aquatic var. aquatica) Boonnet Koonchanok 1, Thadsaneeya Cheunchob 1, Nisakorn
More informationEvaluation of Acute and Subacute toxicity of Siddha Polyherbal formulation Chitramutti Nei
International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 5, Issue 9-2018 Research Article DOI: http://dx.doi.org/10.22192/ijarbs.2018.05.09.002
More informationANTI-DIABETIC ACTIVITY OF HELICTERES ISORA ROOT
ANTI-DIABETIC ACTIVITY OF HELICTERES ISORA ROOT Sama Venkatesh *1, G.Dayananda Reddy 1, B.Madhava Reddy 1, M.Lakshman 2. 1 Department of Pharmacognosy, G.Pulla Reddy College of Pharmacy, Mehdipatnam, Hyderabad
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationMolluscicide from Tobacco Waste
Vol. 1, No. 1 Journal of Agricultural Science Molluscicide from Tobacco Waste Rochana Tangkoonboribun (Corresponding author) Agricultural Technology Department Thailand Institute of Scientific and Technological
More informationScholars Research Library
Available online at www.scholarsresearchlibrary.com Scholars Research Library Der Pharmacia Lettre, 2010, 2(5): 358-362 (http://scholarsresearchlibrary.com/archive.html) ISSN 0975-5071 USA CODEN: DPLEB4
More informationInternational Journal of Pharma and Bio Sciences
Research Article Pharmacognosy International Journal of Pharma and Bio Sciences ISSN 0975-6299 HEPATOPROTECTIVE ACTIVITY OF SEMECARPUS ANACARDIUM FRUIT EXTRACTS AGAINST CARBON TETRACHLORIDE INDUCED HEPATOTOXICITY
More informationSummary of Inhalation Carcinogenicity Study. of Isopropyl Acetate. in F344 Rats
Summary of Inhalation Carcinogenicity Study of Isopropyl Acetate in F344 Rats March 2009 Japan Bioassay Research Center Japan Industrial Safety and Health Association PREFACE The tests were contracted
More informationPharmacologyonline 3: (2009) I VESTIGATIO OF A TIHYPERGLYCEMIC EFFECT OF MORUS IGRA O BLOOD GLUCOSE LEVEL I STREPTOZOTOCI DIABETIC RATS
I VESTIGATIO OF A TIHYPERGLYCEMIC EFFECT OF MORUS IGRA O BLOOD GLUCOSE LEVEL I STREPTOZOTOCI DIABETIC RATS Hassan Fallah Hoseini 1, Soodabeh Saeidnia 2, Ahmad R. Gohari 2*, Mojgan Yazdanpanah 2, Abbass
More informationToxicological Profiling of Novel Siddha Formulation Kalladaippu Chooranam by Acute and Sub-Acute Toxicity Studies
International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com DOI: 10.22192/ijarbs Coden: IJARQG(USA) Volume 5, Issue 9-2018 Research Article DOI: http://dx.doi.org/10.22192/ijarbs.2018.05.09.008
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationHYPOGLYCAEMIC ACTION OF THE FLAVONOID FRACTION OF ARTOCARPUS HETEROPHYLLUS LEAF
42 Research Paper ISSN 0189-6016 2006 Afr. J. Traditional, Complementary and Alternative Medicines www.africanethnomedicines.net HYPOGLYCAEMIC ACTION OF THE FLAVONOID FRACTION OF ARTOCARPUS HETEROPHYLLUS
More informationAcute Toxicity Profiling of Siddha Drug Oma Kudineer in Wistar Rats
Human Journals Research Article September 2017 Vol.:10, Issue:2 All rights are reserved by Dr. D. S. LAVANYA et al. Acute Toxicity Profiling of Siddha Drug Oma Kudineer in Wistar Rats Keywords: Oma kudineer,
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationAcute and sub-acute (28-days) oral toxicity studies of Eraippu noi chooranam
International Journal of Advanced Research in Biological Sciences ISSN: 2348-8069 www.ijarbs.com Volume 3, Issue 6-2016 Research Article Acute and sub-acute (28-days) oral toxicity studies of Eraippu noi
More informationEVALUATION OF ACUTE AND SUB-ACUTE TOXICITIES OF GANODERMA LUCIDUM
EVALUATION OF ACUTE AND SUB-ACUTE TOXICITIES OF GANODERMA LUCIDUM Sheena.N Studies on the thekapeutic potential of Ganoderma lucidum P. Karst Reishi, occurring in Kerala Thesis. Amala Cancer Research Centre,
More informationAcuteand Sub-Acute28-Day OralToxicityStudiesofEthanolicExtractofCeltisTimorensisLeavesin Rodents
: B Pharma, Drug Discovery, Toxicology and Medicine Volume 14 Issue 3 Version 1.0 Year 2014 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Inc. (USA) Online
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationPharmacological and Toxicological study of Medicinally Important Plants: Solanum virginianum (kantakari)
Pharmacological and Toxicological study of Medicinally Important Plants: Solanum virginianum (kantakari) Submitted By Fatema Akther ID No. 2014-1-79-033 Department of Pharmacy East West University Research
More informationAcute and Sub-Chronic Oral Toxicity Studies of Hibiscus esculentus Mucilage on Swiss Albino Mice
Acute and Sub-Chronic Oral Toxicity Studies of Hibiscus esculentus Mucilage on Swiss Albino Mice Mulchand A. Shende* and Rajendra P. Marathe 1 * Department of Pharmaceutics, Government College of Pharmacy,
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationSafe Dosage of Caprine CSN1S2 Protein from Fresh Local Goat Milk for Rats Evaluated by Acute and Sub-Chronic Toxicity Testing
90 J. Math. Fund. Sci., Vol. 49, No. 1, 2017, 90-103 Safe Dosage of Caprine CSN1S2 Protein from Fresh Local Goat Milk for Rats Evaluated by Acute and Sub-Chronic Toxicity Testing Fatchiyah 1,5, Bambang
More informationInternational Journal of Pharma and Bio Sciences V1(2)2010
AJAY KSHIRSAGAR* 1, PURNIMA ASHOK 1, KAUSHIK NARGOLKAR 2, AMOL BHANDARE 2, ANURAG DODAL 2 AND TANMAY DODAL 2 1 Department of, K.L.E.S s College of Pharmacy, Bangalore-560010, Karnataka, India. 2 AISSMS
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationIdentification and Determination of Synthetic Dyes in Grape Juice in Closed Package
CMU. J. Nat. Sci. (2008) Vol. 7(2) 231 Identification and Determination of Synthetic Dyes in Grape Juice in Closed Package Khesorn Nantachit *, Somporn Putiyanan and Prapart Phooviang Department of Pharmaceutical
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationRESEARCH ARTICLE. Received on: 08/02/2017 Published on:27/03/2017
RESEARCH ARTICLE Received on: 08/02/2017 Published on:27/03/2017 Corresponding Author Anuradha VivekanandPhatak, Department of Pharmacology, Dr.BhanubenNanavati College of Pharmacy, Vile Parle (West),
More informationAvailable online through
Pingale S S et al / IJRAP 2010, 1 (2) 433-438 Research Article Available online through www.ijrap.net PROTECTIVE ABILITY OF MOMORDICA CHARANTIA L AGAINST CCL 4 INDUCED HEPATIC DAMAGE IN RATS Pingale Shirish
More informationBone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
More informationKeywords: antioxidant; extraction; paper flower; phenolic compound
PHENOLIC ANTIOXIDANTS FROM Bougainvillea SPP. Punyawatt Pintathong 1, *, Prisana Pinket 1, Monthira Papoodplook 1, Natthawut Thitipramote 1,2, Phanuphong Chaiwut 1 1 School of Cosmetic Science, Mae Fah
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationANTIPYRETIC EFFECT OF BEN-CHA-MOON-YAI REMEDY
Original Article 181 ANTIPYRETIC EFFECT OF BEN-CHA-MOON-YAI REMEDY Somkit Bansuttee 1, Rawiwan Manohan 2, Chanida Palanuvej 2, Nijsiri Ruangrungsi 2,3 and Pasarapa Towiwat 1, 1Department of Pharmacology
More informationBiochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats
Biochemical alterations induced by the acute exposure to combination of chlorpyrifos and lead in Wistar rats 1 H Krishna*, 2 AV Ramachandran 1 Dhirubhai Ambani Life Sciences Centre, Reliance Life Sciences
More informationResearch Article GALLIC ACID AND FLAVONOID ACTIVITIES OF AMARANTHUS GANGETICUS
ISSN 2395-3411 Available online at www.ijpacr.com 238 Research Article GALLIC ACID AND FLAVONOID ACTIVITIES OF AMARANTHUS GANGETICUS G. Jyoti Jain 1* and S. Ramachandra Setty 2 1 Department of Pharmacology,
More informationResearch Article Thirteen-Week Study of PM014 Subchronic Oral Toxicity in Rats
Hindawi Publishing Corporation Evidence-Based Complementary and Alternative Medicine Volume 214, Article ID 189673, 8 pages http://dx.doi.org/1.1155/214/189673 Research Article Thirteen-Week Study of PM14
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationGotmi Sharwan 1, Parag Jain 2, Ravindra Pandey 3, Shiv Shankar Shukla 4 *
ISSN 2093-6966 [Print], ISSN 2234-6856 [Online] Journal of Pharmacopuncture 2016;19[3]:253-258 DOI: http://dx.doi.org/10.3831/kpi.2016.19.027 Original article Toxicity and Safety Profiles of Methanolic
More information-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e
-1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood
More informationChronic toxicity study of Hyptis suaveolens (L.) Poit in rats
ORIGINAL ARTICLE Chronic toxicity study of Hyptis suaveolens (L.) Poit in rats Aimmanas Attawish 1, Songpol Chivapat 2, Pranee Chavalittumrong 3, Songpol Phadungpat 4, Jaree Bansiddhi 5 and Bunjong Chaorai
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationAfrican Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp (2012)
African Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp.16-19 (2012) Effects of Antimalarial Herbal Mixture (Abc 123) on the Liver of Rats *Iliya HA, Wannang NN, Andrew MM, Ibrahim H Department
More informationComparison between Manual and Automated Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration
Kasetsart J. (Nat. Sci.) 4 : 655-659 (8) Comparison between and d Methods for Determination of Canine and Feline Hematocrit and Hemoglobin Concentration Kreangsak Prihirunkit *, Chalermpol Lekcharoensuk
More information