Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia
|
|
- Stella Ferguson
- 5 years ago
- Views:
Transcription
1 Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia Tania Fuchs, Rachel Saunders-Pullman,, Ikuo Masuho 4, Marta San Luciano 5, Deborah Raymond, Stewart Factor 6, Anthony E. Lang 7, Tsao-Wei Liang 8, Richard M. Trosch 9, Sierra White, Edmond Ainehsazan, Denis Herve 0,,, Nutan Sharma, Michelle E. Ehrlich 4,5, Kirill A. Martemyanov 4, Susan B. Bressman., Laurie J. Ozelius,4 Department of Genetics and Genomic Sciences, Mount Sinai School of Medicine, New York, NY; Department of Neurology, Beth Israel Medical Center, New York, NY; Department of Neurology, Albert Einstein College of Medicine, Bronx, NY; 4 Department of Neuroscience, The Scripps Research Institute, Jupiter, FL; 5 Department of Neurology, University of California, San Francisco, CA; 6 Department of Neurology, Emory University School of Medicine, Atlanta, GA; 7 Division of Neurology, Toronto Western Hospital, Toronto, Canada; 8 Department of Neurology, Jefferson Hospital for Neuroscience, Philadelphia, PA; 9 Parkinson's and Movement Disorders Center, Southfield, MI; 0 Inserm UMR-S 89, F Paris, France ; Institut du Fer a Moulin, F Paris, France; Universite Pierre et Marie Curie, F Paris, France; Department of Neurology, Massachusetts General Hospital, Boston, MA; 4 Department of Neurology, Mount Sinai School of Medicine, New York, NY; 5 Department of Pediatrics, Mount Sinai School of Medicine, New York, NY
2 Supplementary Figure. Pedigrees of families with GNAL mutations. Filled in black symbols represent affected individuals, filled in grey symbols represent affected, known by history, diamond symbols with numbers represent additional sibs. WT indicates no mutation. Asterisks indicate the samples that were exome sequenced. Mutation status is indicated below the symbols for individuals whose DNA was available for testing. The pedigrees have been modified to protect the identities of the families.
3 Supplementary Table. Sites Involved for 8 GNAL Patients from 8 Families. SITES INVOLVED upper face lower face neck larynx pharynx tongue jaw right arm left arm right leg left leg trunk Dystonia distribution Site of onset FAMILY D*,Larynx,Trunk 4^ G Legs 5 6 7, Face FAMILY P * G Neck 4^ G Leg 5 6 FAMILY S* ^ FAMILY D ^ S Jaw 4 F Tongue FAMILY H ^ FAMILY B ^ FAMILY T ^ S Larynx FAMILY N ^ Dystonia distribution: F focal, S segmental, M multifocal, G generalized ^ Denoted probands * reported previously and updated here: Fam D in,4,60, Fam P in 4 and 5, Fam S in 6. The following are the corresponding identifiers from for the individuals in D: =individual 07, =0, =07, 4=04, 5=7, 6=5, 7=40.
4 Supplementary Table. Single Nucleotide Variants indentified in Exome Sequencing. Family P Variants Shared HZ Novel against Annotation dbsnp MS NS UTRs Others 57,66 56,45 58,54, Family D Variants Shared HZ Novel against Annotation dbsnp MS NS UTRs Others 57,85 59,975 6,4 58,48 4, Supplementary Table. Indels identified in Family exome sequencing. Family P Indel Variants Shared HZ Novel against dbsnp In coding regions,86,55,07 5,48, Supplementary Table 4. Summary of Clinical features in GNAL mutation carriers. Mutation positive (n=8) Women (n,%) 4 (50%) Mean age of onset (years ±SD, range) Mean age at final exam (years ±SD, range).±.9(7-54) 49.8 ±.0 (9-75) Site of onset Arm 0 (0%) Leg (7.4%)
5 Cranial Face Jaw/Tongue Larynx 5 (7.86%) (.57%) (7.4%) (7.4%) Cervical (8.4%) Sites at final examination Arm 9 (.4%) Leg (0.7%) Cranial Face Jaw/Tongue Larynx 6 (57.4%) (48.5%) 0 (5.7%) 5 (7.86%) Cervical 6 (9.86%) Speech (44.44%) Unratable facial, speech and final distribution in GNAL carrier Supplementary Table 5. Primers used in GNAL exon amplification. Exon Forward Primer Reverse Primer Annealing Temp. NM_8978_5UTR GGCTCAGACGGCATTATTTACGGT TCTCCTTCGGCTTGTCTGCTTT 59 NM_8978_ex ATGGGTCTGTGCTACAGTCTGC AGAATCAGCCCGTAGTGTCCTC 59 NM_0049_5UTR AGAAGCTGAGCAGAACAAAGGC AATAGAGAGTTGGAGACGTGTGCG 58 NM_0049_ex- AAACGCCTGCTCTGAATCGGAA ACRTCTGGGAGAGAGACGAAGTTT 59 ex-4 AACCTTTGCRGATGTCTTGG CCTCTTATGCATTTAGAGAGCTGG 55 ex5 TCACACTAAACATAGAGTSGGTGCAT TTATTCATTCCTTGCACTCAAG 57 ex6 ACTCACTTCAGCTTCTTGGCCT ATGACCAATCCACRCACACACA 59 ex7 ATGCTCGGCCAATGTTGGTT TGGGCCATGCAGCTCTTAACAA 58 ex8 ATGTGTGAACGCTGGAACCT GCAGTGCTGAGTGTTAGAATTCAC 56 ex9 TGCAGGCTGKTCTGTGACT AGAGATACTTCGTACGGTTCTGG 56 ex0 ACAGATGGAATGAGGATACTGGTG GGGATCCKATTACAAATAGGACCTTG 56 ex GCTGGGAATATACAGCAGTCTAACR TGAAGTCTAGCCCATCCAAG 57 ex TGCATTGAGACCATTCCTGCCT GGGAGGCYGTATTCAATGACAACA 59
6 Supplementary Note: Human research subjects were recruited through advertisement or referral from movement disorder physicians. All families chosen for the study were multiplex of Northern European ancestry. All study subjects gave informed consent prior to participation, and the study was approved by all institutional review boards. Videotaped examinations and determination of affected status was undertaken as previously published.. Bressman, S.B. et al. Idiopathic dystonia among Ashkenazi Jews: evidence for autosomal dominant inheritance. Ann Neurol 6, 6-0 (989).
Mutations in GNAL cause primary torsion dystonia
Mutations in GNAL cause primary torsion dystonia Tania Fuchs, Mount Sinai School of Medicine Rachel Saunders-Pullman, Beth Israel Medical Center Ikuo Masuho, Scripps Research Institute Marta San Luciano,
More informationIncreased risk for recurrent major depression in DYT1 dystonia mutation carriers
Increased risk for recurrent major depression in DYT1 dystonia mutation carriers G.A. Heiman, PhD; R. Ottman, PhD; R.J. Saunders-Pullman, MD, MPH; L.J. Ozelius, PhD; N.J. Risch, PhD; and S.B. Bressman,
More informationAbstract. Introduction. RBMOnline - Vol 8. No Reproductive BioMedicine Online; on web 10 December 2003
RBMOnline - Vol 8. No 2. 224-228 Reproductive BioMedicine Online; www.rbmonline.com/article/1133 on web 10 December 2003 Article Preimplantation genetic diagnosis for early-onset torsion dystonia Dr Svetlana
More informationDystonia: Title. A real pain in the neck. in All the Wrong Places
Focus on CME at the University of Western Ontario Dystonia: Title in All the Wrong Places A real pain in the neck By Mandar Jog, MD, FRCPC and; Mary Jenkins, MD, FRCPC What is dystonia? Dystonia is a neurologic
More informationCitation for published version (APA): Zutt, R. (2018). Myoclonus: A diagnostic challenge. [Groningen]: Rijksuniversiteit Groningen.
University of Groningen Myoclonus Zutt, Rodi IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document
More informationDOI: /01.wnl d1. This information is current as of April 16, 2009
Etiology of musician s dystonia: Familial or environmental? A. Schmidt, H. -C. Jabusch, E. Altenmüller, J. Hagenah, N. Brüggemann, K. Lohmann, L. Enders, P. L. Kramer, R. Saunders-Pullman, S. B. Bressman,
More informationParkinson's Disease Center and Movement Disorders Clinic
Parkinson's Disease Center and Movement Disorders Clinic 7200 Cambridge Street, 9th Floor, Suite 9A Houston, Texas 77030 713-798-2273 phone www.jankovic.org Dystonia Diagnosis Dystonia is a neurologic
More informationGNAL Mutation in Isolated Laryngeal Dystonia
BRIEF REPORT GNAL Mutation in Isolated Laryngeal Dystonia Gregory G. Putzel, 1 Tania Fuchs, 1 Giovanni Battistella, 1 Estee Rubien-Thomas, 1 Steven J. Frucht, 1 Andrew Blitzer, 1,2 Laurie J. Ozelius, 3
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Parkinson disease 8, automsomal dominant OMIM number for disease 607060 Disease
More informationOnset and progression of primary torsion dystonia in sporadic and familial cases
European Journal of Neurology 2006, 13: 1083 1088 doi:10.1111/j.1468-1331.2006.01387.x Onset and progression of primary torsion dystonia in sporadic and familial cases A. E. Elia a,b, G. Filippini b, A.
More informationSupplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison
Supplementary data Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison with published studies. (MNA = MYCN amplification, A = MYCN amplified, NA = not MYCN amplified, wt = wild-type).
More informationUnderstanding Dystonia
Understanding Dystonia Sand Sharks Anthony Richardsen, Lindsey Rathbun, Evan Harrington, Chris Erzen The Essentials What, Why, How What is Dystonia? Dystonias are movement disorders often characterized
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationNGS in neurodegenerative disorders - our experience
Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation
More informationPreventing BRCA-related cancer: A think tank for innovative strategies, milestone objectives and research priorities
BANBURY CENTER REPORTS Preventing BRCA-related cancer: A think tank for innovative strategies, milestone objectives and research priorities Banbury Center, Cold Spring Harbor Laboratory, Cold Spring Harbor,
More informationDoes Cancer Run in Your Family?
Does Cancer Run in Your Family? Nancie Petrucelli, MS, CGC Clinical Assistant Professor Certified Genetic Counselor/Coordinator Cancer Genetic Counseling Service Karmanos Cancer Institute Wayne State University
More informationGenetics of parkinsonian and dystonic syndromes
Genetics of parkinsonian and dystonic syndromes Enza Maria Valente CSS-Mendel Institute, Rome University of Salerno Genetic forms of Parkinson disease 2 polymorphisms (++ in autosomal dominant PD genes:
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationUvA-DARE (Digital Academic Repository) Genetic architecture of dystonia Groen, Justus. Link to publication
UvA-DARE (Digital Academic Repository) Genetic architecture of dystonia Groen, Justus Link to publication Citation for published version (APA): Groen, J. L. (2014). Genetic architecture of dystonia General
More informationSupplementary information for: Exome sequencing and the genetic basis of complex traits
Supplementary information for: Exome sequencing and the genetic basis of complex traits Adam Kiezun 1,2,14, Kiran Garimella 2,14, Ron Do 2,3,14, Nathan O. Stitziel 4,2,14, Benjamin M. Neale 2,3,13, Paul
More informationAnthony Sin, M.D. Department of Neurosurgery LSUHSC-S 1501 Kings Hwy Shreveport, LA
Anthony Sin, M.D. Department of Neurosurgery LSUHSC-S 1501 Kings Hwy Shreveport, LA 71103 318-573-6906 318-675-6404 Education Emory University School of Medicine 1992-1996 Doctor of Medicine Johns Hopkins
More informationDiagnosis and treatment of dystonia
Diagnosis and treatment of dystonia Professor Tom Warner, Reta Lila Weston Institute of Neurological Studies UCL Institute of Neurology National Hospital for Neurology and Neurosurgery Queen Square What
More informationDiagnosis and treatment of dystonia
Diagnosis and treatment of dystonia Professor Tom Warner, Reta Lila Weston Institute of Neurological Studies UCL Institute of Neurology National Hospital for Neurology and Neurosurgery Queen Square What
More informationGenetic Recruitment. Genetic Coordination Core
Genetic Recruitment Genetic Coordination Core Genetic Arms Recruit for: LRRK2: G2019S, R1441G, I2020T SNCA: A53T, G209A GBA: N370S Other mutations can be found in these genes Limited the range of mutations
More informationQuantifying population dynamics using hidden relatedness. Itsik Pe er Columbia University IGERT, 11/18/2016
Quantifying population dynamics using hidden relatedness Itsik Pe er Columbia University IGERT, 11/18/2016 Population Genomics 101: Data ACTTGTTTTGGGTTGGGTGGGGCATCC ATTTGTTTTGCGTTGGGTGGGGCATCC ACTTATTTTGGGTTGAGTGGGGCATCC
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationPROGRESS: Beginning to Understand the Genetic Predisposition to PSC
PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for
More informationDiagnostic Delays in Spasmodic Dysphonia: A Call for Clinician Education
Diagnostic Delays in Spasmodic Dysphonia: A Call for Clinician Education Francis X. Creighton, Harvard University Edie Hapner, Emory University Adam Klein, Emory University Ami Rosen, Emory University
More informationBackground 11/8/2011. Disclosure. Hereditary Periodic Fever Syndromes Mutations in Idiopathic Acute Recurrent Pericarditis.
Mutations in Idiopathic Acute Recurrent Pericarditis Disclosure I have no relevant financial relationships to disclose Guillaume Geri, Pierre Hausfater, Catherine Dodé, Zahir Amoura, Jean-Charles Piette,
More informationRelative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
More informationChromosome 15 Chromosome 17 Chromosome 20
Chromosome 1 Chromosome 6 Chromosome 11 Chromosome 15 Chromosome 17 Chromosome 20 Supplementary figure 1. Regions of suggestive linkage in PVOD families 1,2 and 3. Six regions were identified with suggestive
More informationRENATA KHELEMSKY, DDS, MD
RENATA KHELEMSKY, DDS, MD EDUCATION: Graduate Doctor of Medicine Albert Einstein College of Medicine New York, NY Alpha Omega Alpha August 2011- May 2014 Doctor of Dental Surgery Columbia University College
More informationAlzheimer s Disease Genetics Consortium ADGC. Alzheimer s Disease Sequencing Project ADSP
Alzheimer s Disease Genetics Consortium ADGC Alzheimer s Disease Sequencing Project ADSP National Institute on Aging Genetics of Alzheimer s Disease Storage site NIAGADS Partners: National Alzheimer Coordinating
More informationNovel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas
Novel Heterozygous Mutation in YAP1 in A Family with Isolated Ocular Colobomas Julius T. Oatts 1, Sarah Hull 2, Michel Michaelides 2, Gavin Arno 2, Andrew R. Webster 2*, Anthony T. Moore 1,2* 1. Department
More informationMoving fast or moving slow: an overview of Movement Disorders
Moving fast or moving slow: an overview of Movement Disorders Mini Medical School October 25, 2018 Heather Rigby, MD, FRCPC 2014 MFMER slide-1 2014 MFMER slide-2 Basal Ganglia Dysfunction - Movement Disorders
More informationFamilial Adolescent-Onset Scoliosis and Segmental Dystonia
EUROPEAN NEUROLOGICAL JOURNAL REVIEW Familial Adolescent-Onset Scoliosis and Segmental Dystonia D. Bradley, S. O Riordan and M. Hutchinson Affiliation: Department of Neurology, St. Vincent s University
More informationHubert H. Fernandez, MD
Hubert H. Fernandez, MD Associate Professor Co-Director, Movement Disorders Center Director, Clinical Trials for Movement Disorders Program Director, Neurology Residency and Movement Disorders Fellowship
More informationGENETICS AND TREATMENT OF DYSTONIA
GENETICS AND TREATMENT OF DYSTONIA Oksana Suchowersky, M.D., FRCPC, FCCMG Professor of Medicine, Medical Genetics, and Psychiatry Toupin Research Chair in Neurology DYSTONIA Definition: abnormal sustained
More informationChildren, Toronto, Ontario, Canada. Department of Laboratory Medicine and Pathobiology Hospital for Sick Children, Toronto, Ontario, Canada, M5G 1X8
Supplementary Information for Clinically Relevant Copy Number Variations Detected In Cerebral Palsy Maryam Oskoui 1, *, Matthew J. Gazzellone 2,3, *, Bhooma Thiruvahindrapuram 2,3, Mehdi Zarrei 2,3, John
More informationInherited Cancer Genomics and Prevention:
Inherited Cancer Genomics and Prevention: How much cancer risk is inherited? Clinical utility of germline genetic testing in precision prevention and targeted therapy Kenneth Offit MD MPH Chief, Clinical
More informationPersonalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
More informationHereditary Aspects of Pancreatic Cancer
Pancreatic Cancer Seminar San Francisco, CA Hereditary Aspects of Pancreatic Cancer Genetic Risk Assessment and Counseling for Familial Pancreatic Cancer February 3, 2016 Amie Blanco, MS, CGC Gordon and
More informationThe Genetics of VHL. Proper tissue growth - controlled traffic. How human cells and tissue grow and die?
How human cells and tissue grow and die? The Genetics of VHL Xia Wang MD PhD Oct, 2017 Proper tissue growth - controlled traffic Normal tissue growth is regulated by many genetic factors Safe traffic is
More informationMovement Disorders- Parkinson s Disease. Fahed Saada, MD March 8 th, th Family Medicine Refresher Course St.
Movement Disorders- Parkinson s Disease Fahed Saada, MD March 8 th, 2019 48 th Family Medicine Refresher Course St. Joseph s Health Disclosure ACADIA Pharmaceuticals Objectives Review the classification
More informationC/PG2 Specialty Desc. C/PG2 Inst Name. Emory Univ SOM-GA. Child Neurology. Massachuset ts Gen Hosp North Shore Med Ctr/Salem Hosp-MA Orange Park
Inst City e e Emory Univ SOM-GA Anesthesiology ATLANTA GA A Anesthesiology Ctr- Anesthesiology BOSTON C Anesthesiology Ctr- Anesthesiology BOSTON C Anesthesiology UC San Francisco-CA Anesthesiology SAN
More informationMOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY
MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY Intellectual disability (ID) or mental retardation is characterized by significant limitations in cognitive abilities and social/behavioral adaptive
More informationBio 100 Guide 08.
Bio 100 Guide 08 http://images.andrewsmcmeel.com/media/3820/medium.jpg http://www.biology.iupui.edu/biocourses/n100/images/11nondisjunction.gif http://www.unm.edu/~vscience/images/hela%20karyotype%203%20(1000x).jpg
More informationSource: *Dystonia facts medically edited by: Charles Patrick Davis, MD, PhD
Source: http://www.medicinenet.com/script/main/art.asp?articlekey=349 Dystonia facts* *Dystonia facts medically edited by: Charles Patrick Davis, MD, PhD Dystonia is a disorder of muscle control; it can
More informationExploding Genetic Knowledge in Developmental Disabilities. Disclosures. The Genetic Principle
Exploding Genetic Knowledge in Developmental Disabilities How to acquire the data and how to make use of it Elliott H. Sherr MD PhD Professor of Neurology & Pediatrics UCSF Disclosures InVitae: clinical
More informationPuschmann, Andreas; Dickson, Dennis W; Englund, Elisabet; Wszolek, Zbigniew K; Ross, Owen A
CHCHD2 and Parkinson's disease Puschmann, Andreas; Dickson, Dennis W; Englund, Elisabet; Wszolek, Zbigniew K; Ross, Owen A Published in: Lancet Neurology DOI: 10.1016/S1474-4422(15)00095-2 2015 Link to
More informationTHE BACHMANN-STRAUSS. Dystonia & Parkinson Foundation, Inc. New Grants Awarded to Further Research
THE BACHMANN-STRAUSS Dystonia & Parkinson Foundation, Inc. Outlook New Grants Awarded to Further Research WINTER 2007 With a sharp focus on advancing understanding of dystonia and Parkinson s disease The
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationCURRICULUM VITAE B.A., State University of New York at Buffalo, New York Summa cum laude
CURRICULUM VITAE NAME: Martin R. Boorin, D.M.D. DATE OF BIRTH: May 24, 1958 EDUCATION: 1976-1980 B.A., State University of New York at Buffalo, New York Summa cum laude 1980-1984 D.M.D., University of
More informationMICHAEL SCHNEIER, MD CURRICULUM VITAE
CURRICULUM VITAE Business Addresses 7301 Medical Center Drive. Suite 301 1301 20 th Street, Suite 470 West Hills CA 91307 Santa Monica CA 90404 Telephone: 818-880-0972 Fax: 818-880-2039 Website: www.michaelschneiermd.com
More informationSo, now, that we have reviewed some basics of cancer genetics I will provide an overview of some common syndromes.
Hello. My name is Maureen Mork and I m a Certified Genetic Counselor in the Clinical Cancer Genetics Program at The University of Texas MD Anderson Cancer Center. I ll be lecturing today on the Cancer
More informationunderlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
More informationRLS Research Review: Then & Now. David Rye, MD, PhD Professor of Neurology Emory University School of Medicine
RLS Research Review: Then & Now David Rye, MD, PhD Professor of Neurology Emory University School of Medicine Disclosures Fees for service from: Individual patients, UCB Pharmaceuticals, Jazz Pharma, Xenoport,
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISORDER/CONDITION POPULATION TRIAD Submitting laboratory: Exeter RGC Approved: Sept 2013 1. Disorder/condition
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Amyotrophic Lateral Sclerosis 10 (ALS10) and Amyotrophic Lateral Sclerosis 6 (ALS6)
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationBrief Reports A Headset Method for Measuring the Visual Temporal Discrimination Threshold in Cervical Dystonia
Freely available online Brief Reports A Headset Method for Measuring the Visual Temporal Discrimination Threshold in Cervical Dystonia Anna Molloy 1,2*, Okka Kimmich 1,2, Laura Williams 1,2, Brendan Quinlivan
More informationNGS Types of gene dossier applications UKGTN can evaluate
NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for
More informationA genetic study of torsion dystonia
Journal of Medical Genetics (1975). 12, 12. A genetic study of torsion dystonia SARAH BUNDEY,* M. J. G. HARRISON,t and C. D. MARSDEN: Summary. A family study of 32 patients with torsion dystonia has shown
More informationCours Pasteur. Molecular Cancer Genetics. September 18-29, 2017
Cours Pasteur Molecular Cancer Genetics September 18-29, 2017 Directors François CLEMENT-BIDARD Co-director, Institut Curie Hospital Jean-Pierre VARTANIAN Co-director, Institut Pasteur PROGRAM 2017-2018
More informationMutationTaster & RegulationSpotter
MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure
More informationNature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years.
Supplementary Figure 1 Brain magnetic resonance imaging in patient 9 at age 3.6 years. (a d) Axial T2-weighted images show a marked degree of ventriculomegaly. Note the diencephalic mesencephalic junction
More informationShould Universal Carrier Screening be Universal?
Should Universal Carrier Screening be Universal? Disclosures Research funding from Natera Mary E Norton MD University of California, San Francisco Antepartum and Intrapartum Management June 15, 2017 Burden
More informationBio 105 Guide 08.
Bio 105 Guide 08 http://images.andrewsmcmeel.com/media/3820/medium.jpg The chromosomes present in 1 cell nucleus! http://www.unm.edu/~vscience/images/hela%20karyotype%203%20(1000x).jpg karyotype http://www.ucl.ac.uk/~ucbhjow/medicine/images/human_karyotype.gif
More informationLynch Syndrome and COLARIS Testing
Lynch Syndrome and COLARIS Testing Webinar Objectives Review of Lynch syndrome as a multi-gene disorder COLARIS Enhancements Technical Overview COLARIS test offerings Test development and validation process
More informationAuthor's response to reviews
Author's response to reviews Title: Dystonia, facial dysmorphism, intellectual disability and breast cancer associated with a chromosome 13q34 duplication and overexpression of TFDP1: Case report Authors:
More informationGenetic Testing: who, what, why?
Genetic Testing: who, what, why? Gina Westhoff MD LMG Gynecologic Oncology March 16, 2019 Disclosures Speaker for Merck (unrelated to today s topic) Objectives Determine who should undergo genetic risk
More informationUsing Sources in the GDP
Using Sources in the GDP The following are five examples of sources that you may encounter while working on your GDP project. The information contained in each of these sources (shown by screen shot) was
More informationRISK OF FMF DEVELOPMENT AMONG HETEROZYGOUS PATIENTS IN ARMENIAN POPULATION
PROCEEDINGS OF THE YEREVAN STATE UNIVERSITY C h e m i s t r y a n d B i o l o g y 2016, 3, p. 48 52 RISK OF FMF DEVELOPMENT AMONG HETEROZYGOUS PATIENTS IN ARMENIAN POPULATION B i o l o g y H. S. HAYRAPETYAN
More informationGenetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report
Genetic diagnosis of limb girdle muscular dystrophy type 2A, A Case Report Roshanak Jazayeri, MD, PhD Assistant Professor of Medical Genetics Faculty of Medicine, Alborz University of Medical Sciences
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationSearch for a Founder Mutation in Idiopathic Focal Dystonia from Northern Germany
Am. J. Hum. Genet. 63:1777 1782, 1998 Search for a Founder Mutation in Idiopathic Focal Dystonia from Northern Germany Christine Klein, 1,* Laurie J. Ozelius, 1,* Johann Hagenah, 2 Xandra O. Breakefield,
More informationGenetics in Primary Care Curriculum Statement 6. Dr Dave Harniess PCME Stockport
Genetics in Primary Care Curriculum Statement 6 Dr Dave Harniess PCME Stockport Learning Objectives Understanding of genetic component of disease Screening for genetic conditions and risk assessment in
More informationMovement Disorders Requisition Form
Movement Disorders Requisition Form The University of Chicago Genetic Services Laboratories 5841 South Maryland Avenue, Room G701/MC0077, Chicago, IL 60637 Toll Free: 888.824.3637 Local: 773.834.0555 Fax:
More informationGenetics of Oncology. Ryan Allen Roy MD July 8, 2004 University of Tennessee
Genetics of Oncology Ryan Allen Roy MD July 8, 2004 University of Tennessee CREOG Objectives Describe the clinical relevance of viral oncogenes Describe the role of aneuploidy in the pathogenesis of neoplasia
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationWhat we know about Li-Fraumeni syndrome
What we know about Li-Fraumeni syndrome Dr Helen Hanson Consultant in Cancer Genetics St Georges Hospital, South-West Thames Regional Genetics Service History of LFS 1969 Li and Fraumeni describe four
More informationWhat is New in Genetic Testing. Steven D. Shapiro MS, DMD, MD
What is New in Genetic Testing Steven D. Shapiro MS, DMD, MD 18th Annual Primary Care Symposium Financial and Commercial Disclosure I have a no financial or commercial interest in my presentation. 2 Genetic
More informationContributors CONSULTING EDITOR EDITORS AUTHORS. Preoperative Patient Evaluation
Preoperative Patient Evaluation CONSULTING EDITOR LEE A. FLEISHER, MD Robert D. Dripps Professor and Chair of Anesthesiology and Critical Care, Professor of Medicine, Perelman School of Medicine, University
More informationTitle:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2)
Author's response to reviews Title:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2) Authors: Sebastian Fröhler (Sebastian.Froehler@mdc-berlin.de)
More informationTalking Genomes with Your Patients. Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology
Talking Genomes with Your Patients Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology Objectives Review the importance of physician familiarity with genomic testing
More informationDNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.
DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each
More informationPSG 30th Annual Meeting & PSG 32nd Annual Symposium. Friday, April 5 - Monday, April 8, 2019
PSG 30th Annual Meeting & PSG 32nd Annual Symposium Friday, April 5 - Monday, April 8, 2019 Sheraton Grand at Wild Horse Pass Phoenix, Arizona DRAFT: 2.26.19 Parkinson s Foundation Centers Leadership Conference
More informationGenetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
More informationProgr am Code Specialty. Preliminary Institution. Emory Univ SOM-GA. Child Neurology
City State Emory Univ SOM-GA Anesthesiology ATLANTA GA A Anesthesiology Ctr- Anesthesiology BOSTON C Anesthesiology Ctr- Anesthesiology BOSTON C Anesthesiology UC San Francisco-CA Anesthesiology SAN FRANCISCO
More informationCurriculum Vitae. Education: Residency - Department of Neurosurgery
Curriculum Vitae Steven A. Dutcher, D.O., Ph.D., FAANS, FACOS Palm Beach Neurosurgery, LLC 3319 State Road 7 601 University Blvd Suite #313 Suite #203 Wellington, FL 33449 Jupiter, FL 33458 (561)433 4444
More informationSupplementary Online Content
Supplementary Online Content Vorstman JAS, Breetvelt EJ, Duijff SN, et al; International Consortium on Brain and Behavior in 22q11.2 Deletion Syndrome. Cognitive decline preceding the onset of psychosis
More informationDystonia Update From the research laboratories of Dr. Xandra O. Breakefield and Dr. Nutan Sharma at Massachusetts General Hospital
M A S S G E N E R A L Dystonia Update From the research laboratories of Dr. Xandra O. Breakefield and Dr. Nutan Sharma at Massachusetts General Hospital An Annual Newsletter Issue No 2 - Winter 2007 DYT1
More informationCURRICULUM VITAE. Emory M. Petrack, M.D., FAAP, FACEP 22 Line Street, Unit E Somerville, MA
CURRICULUM VITAE Emory M. Petrack, M.D., FAAP, FACEP 22 Line Street, Unit E Somerville, MA 02143 epetrack@petrackconsulting.com CURRENT POSITION Attending Emergency Physician, Tufts Medical Center, Boston,
More informationCURRICULUM VITAE. Revised: October 18, Name: Howard Ira Levy, M.D.
CURRICULUM VITAE Revised: October 18, 2012 Name: Howard Ira Levy, M.D. Office Addresss: The Emory Orthopaedics and Spine Center 59 Executive Park South Atlanta, GA 30329 (404) 778-7138 Citizenship: U.S.A.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
More informationThe impact of hereditary breast and ovarian cancer (HBOC) syndrome testing on patient management and your practice
The impact of hereditary breast and ovarian cancer (HBOC) syndrome testing on patient management and your practice Use BRACAnalysis as a guide in your medical and surgical management BRACAnalysis testing
More informationHeadache And Facial Pain: Diagnosis And Management By Alan L. Jacobson READ ONLINE
Headache And Facial Pain: Diagnosis And Management By Alan L. Jacobson READ ONLINE If you are looking for a ebook Headache and Facial Pain: Diagnosis and Management by Alan L. Jacobson in pdf format, in
More information