Supplementary Materials for
|
|
|
- Sarah Hood
- 5 years ago
- Views:
Transcription
1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts with RNAi Benjamin E. Housden,* Alexander J. Valvezan, Colleen Kelley, Richelle Sopko, Yanhui Hu, Charles Roesel, Shuailiang Lin, Michael Buckner, Rong Tao, Bahar Yilmazel, Stephanie E. Mohr, Brendan D. Manning, Norbert Perrimon* *Corresponding author. (B.E.H.); (N.P.) This PDF file includes: Published 8 September 2015, Sci. Signal. 8, rs9 (2015) DOI: /scisignal.aab3729 Fig. S1. Analysis of CRISPR specificity using quantitative HRM. Fig. S2. An improved sgrna design tool. Fig. S3. Analysis of GC content in relation to sgrna efficiency. Fig. S4. Sequencing of individual CRISPR mutant cells. Fig. S5. Generation of isogenic mutant cell lines. Fig. S6. Generation of TSC1 and TSC2 mutant cell lines. Fig. S7. Synthetic effects in MEFs and AML cells. Fig. S8. Analysis of knockdown of candidate genes on mtor signaling. Fig. S9. Synthetic effects of candidate genes with TBC1D7. Fig. S10. Analysis of TSC2 addback efficacy in AML cells. Other Supplementary Material for this manuscript includes the following: (available at Table S1 (Microsoft Excel format). sgrna efficiency in relation to GC content data. Table S2 (Microsoft Excel format). Phosphorylation changes common to TSC1 and TSC2 cell lines. Table S3 (Microsoft Excel format). GO analysis of phosphoproteomic data. Table S4 (Microsoft Excel format). Synthetic screen results. Table S5 (Microsoft Excel format). Conservation of synthetic screen candidate genes.
2 Table S6 (Microsoft Excel format). Primers used in this study. Supplementary file 1 (.pdf format). GenBank sequence of CRISPR cell line expression vector (pl018). Supplementary file 2 (.pdf format). GenBank sequence of the luciferase mutation reporter vector.
3 Relative mutation rate No mismatches 1 mismatch 2 mismatches 3-6 mismatches No sgrna Figure S1: Analysis of CRISPR specificity using quantitative HRM Graph showing relative mutation rates from 75 sgrnas used to target a single sequence in the yellow gene. Mutation rate is calculated as integrated area between each experimental HRM curve and a mean control curve. Each bar represents the mean relative mutation rate from three biological replicates using sgrnas with 0 mismatches (blue bar), 1 mismatch (grey bars), 2 mismatches (green bars), 3 mismatches (black bars) or in the absence of sgrna (red bar). Dashes indicate nucleotides that are matched between sgrna and the target sequence. Crosses indicate the position of mismatches. Error bars indicate standard error of the mean.
4 Figure S2: An improved sgrna design tool A: Main search page, allowing the user to search by gene symbol, CG number, FBgn as well as genome coordinates. The user also has the option of choosing the off-target threshold as well as the relevant track(s), which are divided based on whether off-targets are predicted and the genomic location of the sgrna. B: JBrowse view of all relevant CRISPR designs. C: Detailed information page of each sgrna design. Efficiency score predictions as well as restriction enzyme annotations are displayed beside the target gene, sgrna sequence and genome location. D: Efficiency prediction tool. This user interface allows calculation of efficiency scores for user-provided sgrna sequences.
5 A 1/ Normalized luciferase B Percentage GC - 4 PAMP 1/ Normalized luciferase C Percentage GC - 6 PAMP 1/ Normalized luciferase D Percentage GC - total Relative efficiency Efficiency score
6 Figure S3: Analysis of GC content in relation to sgrna efficiency A-C: Comparison of sgrna mutagenesis efficiency to GC content considering the final 4 nucleotides (A), the final 6 nucleotides (B) or the whole sgrna sequence (C). D: Comparison of efficiency scores generated using the matrix shown in Figure 1B (horizontal axis) with efficiency (vertical axis) of sgrnas published by Ren et al. (16).
7 Figure S4: Sequencing of individual CRISPR mutant cells Sequences are shown from 8 individual cells transfected with CRISPR reagents targeting the yellow gene. Samples are numbered 1 to 8, with a minimum of 5 sequence reads shown for each. The top row in each group shows wild-type sequence (marked with asterisks).
8 A B STAT92E Figure S5: Generation of isogenic mutant cell lines A: Workflow showing the major steps required to generate mutant cell lines. B: Schematic of the STAT92E gene. UTRs are represented by thin black boxes, coding exons by thick black boxes and introns by black lines. Arrows superimposed on introns indicate the direction of transcription. CRISPR target site is shown by the grey arrow.
9 GGGATTCACAGGTTACGTGGGCGA* CAATTGGGATTCC TSC2 TGGAGGTACTGGTCAAAGCCCAGGCAC* TSC1 C TGGAGGTACTGGTCAAAGCCCAGGC C TGGAGGTACTGGTCAAAGCCCAGGC C TGGAGGTACTGGTCAAAGCCCAGGC C TGGAGGTACTGGTCAAAGCCCAGGC C TGGAGGTACTGGTCAAAGCCCAGGC TGGAGGTACTGGTCAGTACCCAG TGGAGGTACTGGTCAGTACCCAG TGGAGGTACTGGTCAGTACCCAG TGGAGGTACTGGTCAGTACCCAG TGGAGGTACTGGTCAGTACCCAG TGGAGGTACTGGTCAAAGCCCAG GCAC* TGGAGGTACTGGTCAAAGCCCAGTATGGG TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCACTGGGGTACTTTGTACGTCCAGGATGG ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCAGATGGTACAGCCCTGGATGTACCAAATGT ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCAGTATGGG TGGAGGTACTGGTCAAAGCCCAGTATGGG TGGAGGTACTGGTCAAAGCCCAGTATGGG TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCAGGATGTACGTACAAAGC C TGGAGGTACTGGTCAAAGCCCACTGGGGTACTTTGTACGTCCAGGATGG ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCACTGGGGTACTTTGTACGTCCAGGATGG ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCAGATGGTACAGCCCTGGATGTACCAAATGT ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCAGATGGTACAGCCCTGGATGTACCAAATGT ACGATGGGTACATCTTTGACAA TGGAGGTACTGGTCAAAGCCCAGATGGTACAGCCCTGGATGTACCAAATGT ACGATGGGTACATCTTTGACAA A B C TSC1 TSC2
10 Figure S6: Generation of TSC1 and TSC2 mutant cell lines A: Schematics of the TSC1 and TSC2 genes. Details are as described for Figure S5A. B-C: Sequencing result for at least 20 clones from TSC1 (B) or TSC2 (C) mutant cell lines. Asterisks indicate wild-type sequence.
11 A RNGTT MEF C CCNT1 MEF E CDK11 MEF B RNGTT MEF D CCNT1 MEF F CDK11 MEF G H I RNGTT AML CCNT1 AML CDK11 AML J FRK AML K PRKG1 AML Figure S7: Synthetic effects in MEFs and AML cells A-K: Viability plots over 72 hours relative to control sirna treatments in wild type MEFs (A-F blue lines), TSC2 deficient MEFs (A-F red lines), AML cells (G-K red lines) or AML cells with TSC2 addback (G-K blue lines) treated with sirna targeting the genes indicated. Results are from two biological replicates for MEFs (shown separately) and three biological replicates for AML cells. Error bars indicate standard error of the mean. See Figure 4C-D for summary plots of these data.
12 Figure S8: Analysis of knockdown of candidate genes on mtor signaling Western blots for the indicated proteins in wild-type MEFs (TSC2 +/+ ), TSC2 deficient MEFs (TSC2 -/- ), AML cells (+EV) or AML cells with TSC2 addback (+TSC2) in the presence of sirna targeting CCNT1, RNGTT or CDK11 as labeled. All Western Blots are representative of three biological replicates.
13 Relative viability (CTG) A RNGTT Relative viability (CTG) B CCNT1 Relative viability (CTG) C CDK11 Figure S9: Synthetic effects of candidate genes with TBC1D7 A-C: Viability plots over 72 hours relative to control sirna treatments in wildtype MEFs treated with sirna targeting the genes indicated in combination with sirna targeting TSC1, TSC2 or TBC1D7. Results represent the average of three biological replicates and error bars indicate standard error of the mean.
14 A ps6k S6K TSC2 Gapdh TSC2 addback Serum starvation Insulin B Relative frequency Cell diameter Figure S10: Analysis of TSC2 addback efficacy in AML cells A: Western blots showing changes in p-s6k, total S6K, TSC2 or Gapdh in AML cells with or without TSC2 addback. Experiments were performed under standard culture conditions, serum starvation or with insulin stimulation as indicated. Westerns are representative of at least three biological replicates. B: Plot showing the distribution of cell diameters of AML cells with (blue line) or without (red line) TSC2 addback. Results show the average from three biological replicates and error bars indicate standard error of the mean.
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/398/rs12/dc1 Supplementary Materials for Quantitative phosphoproteomics reveals new roles for the protein phosphatase PP6 in mitotic cells Scott F. Rusin, Kate
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Modulation of Host Learning in Aedes aegypti Mosquitoes
Current Biology, Volume 28 Supplemental Information Modulation of Host Learning in Aedes aegypti Mosquitoes Clément Vinauger, Chloé Lahondère, Gabriella H. Wolff, Lauren T. Locke, Jessica E. Liaw, Jay
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication
Manuscript EMBO-2010-74756 Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication Tsai-Ling Liao, Chung-Yi Wu, Wen-Chi Su, King-Song Jeng and Michael Lai Corresponding
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
Supplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Figures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
Supplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus
0 0 CRISPR/Cas cleavage of viral DNA efficiently suppresses hepatitis B virus Authors: Vyas Ramanan,, Amir Shlomai,, David B.T. Cox,,,, Robert E. Schwartz,,, Eleftherios Michailidis, Ankit Bhatta, David
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors
Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,
SUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
SUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION Supplementary Figure 1. Q-Q plot of RE/NIMH autism family TDT results. The quantile-quantile plot of the expected and observed P-values is shown. The blue circles represent the
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Supplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
* * A3027. A4623 e A3507 A3507 A3507
a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary
Supplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
For all of the following, you will have to use this website to determine the answers:
For all of the following, you will have to use this website to determine the answers: http://blast.ncbi.nlm.nih.gov/blast.cgi We are going to be using the programs under this heading: Answer the following
P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Introduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Information. Table of contents
Supplementary Information Table of contents Fig. S1. Inhibition of specific upstream kinases affects the activity of the analyzed readouts Fig. S2. Down-regulation of INCENP gene induces the formation
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB
SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. Schematic of Ras biochemical coupled assay.
Mechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
WDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad