Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison
|
|
- Asher Carson
- 5 years ago
- Views:
Transcription
1 Supplementary data Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison with published studies. (MNA = MYCN amplification, A = MYCN amplified, NA = not MYCN amplified, wt = wild-type). The last column describes the source from where the cell lines were obtained : 8 cell lines from the lab of Peter White (The Children s Hospital of Philadelphia, Philadelphia, PA), 1 cell line from the lab of Valérie Combaret (Department of Cellular Biology, Lyon, France), 17 cell lines from the lab of ogier Versteeg (Department of Human Genetics, Amsterdam, The Netherlands), 3 from the lab of Susan agsdale (St. Jude Children s esearch Hospital, Memphis, TN), 1 from the lab of Susan L. Cohn (Department of Pediatrics, Chicago, IL), 1 from the lab of Sven Påhlman (Center for Molecular Pathology,Malmö, Sweden), 1 from the lab of John Lunec (Northern Institute for Cancer esearch, Newcastle upon Tyne, UK), 5 from the lab of Peter Ambros (Cancer esearch Institute, Vienna, Austria), 1 from the lab of Frank Speleman (Center for Medical Genetics, Ghent, Belgium), 1 from Panarello (Istituto Giannina Gaslini, Genova, Italy), 1 from the Japan Health Sciences Foundation (JHSF) and 1 from the American Type Culture Collection (ATCC). All cell lines tested negative for Mycoplasm in September 2008.
2 ID MYCN status ALK amplification? ALK mutation? Mutation confirmed in other studies? Source of cell lines CHP-134 A no wt White CHP901 A no wt White CHP902 A no wt White CLB-GA NA no 1275Q Combaret GICIN gain no wt Panarello Gl-ME-N NA no wt Versteeg IM32 A partial amplification wt Versteeg LAN-1 A no F1174L Versteeg LAN-2 A no wt Versteeg LAN-5 A no 1275Q 8 Versteeg LAN-6 NA no D1091N 7 White N206 A no F1174L 10 Versteeg NB-1 NA amplification wt JHSF NB-5 A no wt agsdale NB-13 A no wt agsdale NB-14 A no F1174L agsdale NBL-S NA no wt White NGP A no wt Versteeg NLF A no wt White NMB A no wt White SK-N- SH/SHEP/SH- SY5Y NA no F1174L 10 7,8,10 7,8,10 Versteeg/ Cohn/ Pålman SJNB-1 NA no wt Versteeg SJNB-6 A no wt Versteeg SJNB-8 A no wt Versteeg SJNB-10 A no wt Versteeg SJNB-12 NA no wt Versteeg SK-N-AS NA no wt ATCC SK-N-BE A no wt Versteeg SK-N-BE(2c) A no wt Lunec SK-N-FI NA no wt Versteeg SMS-KAN A no wt White SMS-KCN A no F1174L 10 / George et al. (1275Q) Versteeg STA-NB-3 A no wt Ambros STA-NB-8 A no F1174L Ambros STA-NB-9 A no wt Ambros STA-NB-10 A no wt Ambros STA-NB-12 NA no wt Ambros T14 A no wt Versteeg UHG-NP A no wt Speleman
3 Supplementary Table 3: Primers used for amplification and sequencing of the ALK gene. Exon Forward or everse Primer sequence 5 3 Exon 1 F CGCGGCTCGCTAGCTC GAACTGCGTTCAGGGAGAAAAC Exon 2 F GGGTCCTGAGGTCAACTCAGTC CATATAGGGAGCTGAGGGAATGC Exon 3 F AAGGCCAACCTCCTAGTGTGG AGAGCAGAACAGGAGTGAAGTCTCAT Exon 4 F GCAGAGAAGGAGATAATGGCCTC GGACCTACCGATTAAAGGACAATC Exon 5 F CCTGAAGTCCCTGCAAGGA AAACATGGTTGCAGGTTATTGAC Exon 6 F TCAGGCCTTGGAGTGTGAATG GCTTTGCCATGAGAGGAGTCA Exon 7 F CAGTGTCATTAGTCATCCAGCATTC AAGCTTTGGTCAGACACCCG Exon 8 F TTGACAGGTGGGCTTTCTTCTC CCAGCCAGCTAGGCTACTTTCT Exon 9 F TCCAGCTCTTCTCACCAGGC CTGCATGTGTGTCTTGGGTAAAA Exon F GGTGATCAGCACACACCTGC AGCACCAATCTTTCTTCTGCCT Exon 12 F TCGATGGCTGATTGGTGTTTC CTATGGGCCTGAGTCTGTTGC Exon 13 F TAAACTTGATCGTCCTTTCCTGAA TTGCTGTCTCATTCTCCTGGTATG Exon 14 F ATTTTTCTGCCTCCTCAACTCAA CTGTACCTGGCCCTGCTCAT Exon 15 F GTAACAAGGGTTCAGAGCCCG AGTGACTAAGATGCCCTCAGGC Exon 16 F TTTCCTAGTGTGGATCTGAAGCC TCACAGTCCACACTTGGGCA Exon 17 F CCCCAGTGACCCCCTAACTT CTGCGCCATAGGAAGCTTG Exon 18 F ACAGTTGTGCTTCCAGTGGCT TTTACAAAACCGAATCCAGGGT Exon 19 F CTGTCAAATCGGGATGAGTCTG AATTCCAGGGACTAGCATAACGAA Exon 20 F GGAAAGGTTCAGAGCTCAGGG GGCCTTTTGTGGCTAGAGGAGT Exon F GTGTGTATGTTACCCCCGCCT ACATGCTAGGGACAACACGATTT Exon 23 F GGAGCCTGCTGTGGTTCTTC AGTTGACACCCTGGGTTCC Exon 24 F CCCCTGGTGTAGCTGCATGT GAAATGTGAGCCCTTGAGATCTG Exon 25 F GGAAATATAGGGAAGGGAAGGAACTA TGATGTAAGGGACAAGCAGCC Exon 26 F ATTTCAGACCTTTAATGGGTAGACTATATTGT CCCGGCTTAGAGTATAGAGTCCTTT
4 Exon 27 F TTTAAGAGTTCTATGTTATGGAAAAGGGTA AAGAAGCATATGTGGCTCTGGATA Exon 28 F TCCTTGACCAATCAGCAGGG CTTGTACTCTGACTGGCTTGACCTAT Exon 29 F TGACTTCCCATTCATTTTGTATGC GTGGGCTTGTTTCTGGATCC
5 Supplementary Figure 1: ALK mutation and amplification frequencies and type in the different published studies and this study (wt = wild type, amp = amplification).
6 P < P < % 18% 16% 14% 12% 10% 8% 6% 4% 2% wt amp 1275 F1174 Y1278 F1245 T % Supplementary Figure 2: Frequencies and types of ALK mutations according to MYCN status and genomic subgroups (wt = wild-type ALK, amp = ALK amplification, MNA = MYCN amplification).
7 Supplementary Figure 3: Alignment of 2p gained regions present in 49 out of 254 neuroblastoma tumors, detected using arraycgh. Co-occurrence with MYCN amplification is marked with a star.
8 Supplementary Figure 4: Comparison of Affymetrix exon array ALK expression with arraycgh copy number data at the ALK position of 101 neuroblastoma tumors (X- and Y-axis = log scale, DOD = dead of disease).
9 Supplementary Figure 5: Correlation plots of ALK mna levels (A) or ALK protein levels (B) versus phospho-alk (palk) status. The black dot represents the NB1 cell line which has an ALK amplification, red dots represent F1174L mutated cell lines, green dots 1275Q mutated cell lines and blue dots ALK wild-type cell lines. Only wild-type cell lines with a clear ALK protein expression on Western blot were included.
10 Supplementary Figure 6: Western blot analysis of ALK (A) and phospho-alk (palk) (B) status in 22 neuroblastoma cell lines. 7 cell lines are ALK mutated (underlined), 1 has an ALK amplification (NB1) and 14 are ALK wild-type. Anti-EK2 was used as loading control (C). ALK blots were exposed for 5 minutes and palk blots for 20 minutes. ( cell lines with F1174L mutation, _ cell lines with 1275Q mutation).
11 amp F wt Supplementary Figure 7: Box-plots representing relative phospho-alk levels (palk/alk) in NB cell lines with different mutation status. (amp = amplification, wt = wild-type)
Emergence of new ALK mutations at relapse of neuroblastoma
Emergence of new ALK mutations at relapse of neuroblastoma Gudrun Schleiermacher MD PhD Institut Curie, Paris JCO, in press Background Cancer : frequent secondary progression, resistance to conventional
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplemental Data. Supplemental Material and Methods
Supplemental Data Supplemental Material and Methods Determining GI50 values for compounds in neuroblastoma cell lines In order to determine GI50 values in neuroblastoma cell lines for the compounds used,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationNature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
More informationAuthor Manuscript Faculty of Biology and Medicine Publication
Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but dos not include the final publisher proof-corrections
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationUsing droplet digital PCR to analyze MYCN and ALK copy number in plasma from patients with neuroblastoma
/, 2017, Vol. 8, (No. 49), pp: 85234-85251 Using droplet digital PCR to analyze MYCN and ALK copy number in plasma from patients with neuroblastoma Marco Lodrini 1, Annika Sprüssel 1, Kathy Astrahantseff
More informationA novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
More informationHER2 FISH pharmdx TM Interpretation Guide - Breast Cancer
P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment
More informationSupplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared
More informationSupplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia
Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia Tania Fuchs, Rachel Saunders-Pullman,, Ikuo Masuho 4, Marta San Luciano 5, Deborah Raymond, Stewart Factor 6,
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationR2: web-based genomics analysis and visualization platform
R2: web-based genomics analysis and visualization platform Overview Jan Koster Department of Oncogenomics Academic Medical Center (AMC) UvA, the Netherlands jankoster@amc.uva.nl jankoster@amc.uva.nl 1
More informationChallenges and opportunities for the application of ctdna in neuroblastoma
Challenges and opportunities for the application of ctdna in neuroblastoma * tumor ctdna Investigación Traslacional Tumores Sólidos Profª Rosa Noguera Universidad de Valencia/INCLIVA/CIBERONC ctdna in
More informationGenome-wide promoter methylation analysis in neuroblastoma identifies prognostic methylation biomarkers
RESEARCH Open Access Genome-wide promoter methylation analysis in neuroblastoma identifies prognostic methylation biomarkers Anneleen Decock 1, Maté Ongenaert 1, Jasmien Hoebeeck 1,2, Katleen De Preter
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationSupplementary Figure 1 Weight and body temperature of ferrets inoculated with
Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with
More informationMultiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma
RESEARCH ARTICLE Open Access Research article Multiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma Candy Kumps
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationIs Multiplex Ligation-dependent Probe Amplification a good method for screening formalin fixed paraffin embedded neuroblastoma tumors?
Is Multiplex Ligation-dependent Probe Amplification a good method for screening formalin fixed paraffin embedded neuroblastoma tumors? Bachelor Degree Project in Biomedicine (2011-03-28 2012-01-11) 30
More informationWESTERN EUROPE PREVALENCE AND INCIDENCE OF PERIPHERAL ARTERY DISEASE AND CRITICAL LIMB ISCHEMIA 2017
WESTERN EUROPE PREVALENCE AND INCIDENCE OF PERIPHERAL ARTERY DISEASE AND CRITICAL LIMB ISCHEMIA 2017 Mary L. Yost 404-520-6652 , LLC 23 Ridge Rd. Beaufort, SC 20097 Copyright Pending 2017 All rights reserved,
More informationProtein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationJ Clin Oncol 29: by American Society of Clinical Oncology INTRODUCTION
VOLUME 29 NUMBER 33 NOVEMBER 11 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T Prognostic Value of the Stage 4S Metastatic Pattern and Tumor Biology in Patients With Metastatic Neuroblastoma
More informationPublished Ahead of Print on October 3, 2011 as /JCO J Clin Oncol by American Society of Clinical Oncology INTRODUCTION
Published Ahead of Print on October 3, 11 as 10.10/JCO.11.35.9570 The latest version is at http://jco.ascopubs.org/cgi/doi/10.10/jco.11.35.9570 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T
More informationSupplementary information. Supplementary figure 1. Flow chart of study design
Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationWKH$F02( (R539T( 957( 005( 24# 17# 32# 26# 30# 21# 21# 9# 14# 18# 9# 13# 21# 14# 14# 2# 42# 17#
20 KH$C(( WT( WKH$F02( (R539T( WKH$F04( (Y493H( WKH$F03( C580Y( 18 027( 004( 010( 967( 005( 0.94 957( 0.96 887( 818$2( 0.98 829( 1.00 1.02 1.04 16 14 12 10 8 6 4 2 0 n 113 142 170 140 158 143 244 217 78
More informationAtaxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism
/, Vol. 6, No. 21 Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism Stefano J. Mandriota 1, Linda J. Valentijn 2, Laurence Lesne 1, David
More informationFigure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET
Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from
More informationAuthor's response to reviews
Author's response to reviews Title: Specific Gene Expression Profiles and Unique Chromosomal Abnormalities are Associated with Regressing Tumors Among Infants with Dissiminated Neuroblastoma. Authors:
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationPredicting clinical outcomes in neuroblastoma with genomic data integration
Predicting clinical outcomes in neuroblastoma with genomic data integration Ilyes Baali, 1 Alp Emre Acar 1, Tunde Aderinwale 2, Saber HafezQorani 3, Hilal Kazan 4 1 Department of Electric-Electronics Engineering,
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationFrom reference genes to global mean normalization
From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationSbarrato_Supplementary_Fig1
Sbarrato_Supplementary_Fig1 Supplementary Figure 1. Translatome analysis of CLL patients based on IGVH mutational status ) Profile for the translatome of unmutated IGVH CLL versus mutated IGVH CLL pa9ents.
More informationThe influence of societal individualism on a century of tobacco use: modelling the prevalence of smoking Appendices A and B
The influence of societal individualism on a century of tobacco use: modelling the prevalence of smoking Appendices A and B J.C. Lang, D.M. Abrams, and H. De Sterck A Additional Tables and Figures Table
More informationSupplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
More informationSupplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
More informationCONTRACTING ORGANIZATION: Children s Hospital Los Angeles Los Angeles, CA 90027
AD Award Number: TITLE: Studies of the Tumor Microenvironment in Pathogenesis of Neuroblastoma PRINCIPAL INVESTIGATOR: Shahab Asgharzadeh, M D CONTRACTING ORGANIZATION: Children s Hospital Los Angeles
More informationChanging demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationTITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN
AWARD NUMBER: W81XWH-13-1-0220 TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN PRINCIPAL INVESTIGATOR: Rani E. George, MD, PhD CONTRACTING ORGANIZATION: Dana-Farber
More informationPBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ)
Oncotarget, Supplementary Materials www.impactjournals.com/oncotarget/ SUPPLEMENTRY FLES ndividuals factor map (P) FT_ FT_ FT_ Dim (.%) Dim (.%) >% peripheral brain zone () around % interface zone () FT
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Generation of cetuximab-resistant cells and analysis of singlecell clones. Cetuximab-sensitive cells (LIM1215 and OXCO-2) were chronically treated with cetuximab
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationRelative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationFigure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation
Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation with a range of concentrations of chemotherapy agents
More informationSupplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
More informationSUPPLEMENTARY INFORMATION
Table of Contents Supplementary Materials and Methods... 1 1 Patients and control subjects for SNP genotyping... 2 1.1 Neuroblastoma patients in discovery case series... 2 1.2 Control subjects... 3 2 Whole-genome
More informationA20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationGuangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Expression deviation of the genes mapped to gene-wise recurrent mutations in the TCGA breast cancer cohort (top) and the TCGA lung cancer cohort (bottom). For each gene (each pair
More informationDual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma
/, 2017, Vol. 8, (No. 34), pp: 57047-57057 Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma Alan Van Goethem 1,2, Nurten Yigit 1,2, Myrthala Moreno-Smith 3, Sanjeev A. Vasudevan
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases.
Supplementary Figure 1 Clinical timeline for the discovery WES cases. This illustrates the timeline of the disease events during the clinical course of each patient s disease, further indicating the available
More informationPerspective on performance: The Haemoglobinopathies. Barbara Wild
Perspective on performance: The Haemoglobinopathies Barbara Wild Perspective on Performance: Performance assessment process DNA diagnostics for Haemoglobinopathies scheme Outcomes of shadow scoring exercise
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationMPS for translocations
MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Divergent effects of intrinsically active MEK variants on developmental Ras signaling Yogesh Goyal,2,3,4, Granton A. Jindal,2,3,4, José L. Pelliccia 3, Kei Yamaya 2,3, Eyan Yeung
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationartus EBV QS-RGQ Kit Performance Characteristics May 2012 Sample & Assay Technologies Analytical sensitivity plasma
artus EBV QS-RGQ Kit Performance Characteristics artus EBV QS-RGQ Kit, Version 1, 4501363 Check availability of new electronic labeling revisions at www.qiagen.com/products/artusebvpcrkitce.aspx before
More informationSupplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationNature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationFigure S1. Analysis of endo-sirna targets in different microarray datasets. The
Supplemental Figures: Figure S1. Analysis of endo-sirna targets in different microarray datasets. The percentage of each array dataset that were predicted endo-sirna targets according to the Ambros dataset
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationPreliminary programme ESLCCC September 2016
Preliminary programme ESLCCC 2016 22-23 September 2016 1 st day - Thursday 22 September 2016 8.45 17.00 Registration starts at 7.30 in the morning Welcome and Introduction By the ESLCCC 16 Committee Female
More informationChildren, Toronto, Ontario, Canada. Department of Laboratory Medicine and Pathobiology Hospital for Sick Children, Toronto, Ontario, Canada, M5G 1X8
Supplementary Information for Clinically Relevant Copy Number Variations Detected In Cerebral Palsy Maryam Oskoui 1, *, Matthew J. Gazzellone 2,3, *, Bhooma Thiruvahindrapuram 2,3, Mehdi Zarrei 2,3, John
More informationMolecular Diagnosis Future Directions
Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular
More information* #$#$ ! "#$ # % &' $ +,-$ $ %! && . ## # " $## ( )$$ $! " # $% / - - ") () ' $*( # +
! "#$ # % &' $ #$#$ ( )$$ $! " # $% * #$#$ +,-$ $ %! &&. ## # " $## -$# ' / - - ") () ' $*( # + Percutaneous or open surgical biopsy in NB? Recommendations for percutaneous needle biopsy Claudio Granata
More information31 countries (117 registries, 20 national) Increased coverage in countries with regional registries 50% European population Overall >20 million
31 countries (117 registries, 20 national) Increased coverage in countries with regional registries 50% European population Overall >20 million cancer cases Adult patients (age 15+) 45 major cancer sites
More informationAcquired Drivers of Disaese ahus and autoantibodies: their role in disease and their impact on patient management
Acquired Drivers of Disaese ahus and autoantibodies: their role in disease and their impact on patient management Veronique Fremeaux-Bacchi Cordeliers Research Center and Européen Georges Pompidou Hospital,
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationHD-SNP Microarray Analysis of the Study 9 High Risk ALL Patients -
HD-SNP Microarray Analysis of the Study 9 High Risk ALL Patients - Increased Yield of Important Prognostic Information Nadine K Berry 1,2,4, Rodney J. Scott 1,4, Rosemary Sutton 5, Toby N Trahair 5, Philip
More informationNature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More information