Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison

Size: px
Start display at page:

Download "Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison"

Transcription

1 Supplementary data Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison with published studies. (MNA = MYCN amplification, A = MYCN amplified, NA = not MYCN amplified, wt = wild-type). The last column describes the source from where the cell lines were obtained : 8 cell lines from the lab of Peter White (The Children s Hospital of Philadelphia, Philadelphia, PA), 1 cell line from the lab of Valérie Combaret (Department of Cellular Biology, Lyon, France), 17 cell lines from the lab of ogier Versteeg (Department of Human Genetics, Amsterdam, The Netherlands), 3 from the lab of Susan agsdale (St. Jude Children s esearch Hospital, Memphis, TN), 1 from the lab of Susan L. Cohn (Department of Pediatrics, Chicago, IL), 1 from the lab of Sven Påhlman (Center for Molecular Pathology,Malmö, Sweden), 1 from the lab of John Lunec (Northern Institute for Cancer esearch, Newcastle upon Tyne, UK), 5 from the lab of Peter Ambros (Cancer esearch Institute, Vienna, Austria), 1 from the lab of Frank Speleman (Center for Medical Genetics, Ghent, Belgium), 1 from Panarello (Istituto Giannina Gaslini, Genova, Italy), 1 from the Japan Health Sciences Foundation (JHSF) and 1 from the American Type Culture Collection (ATCC). All cell lines tested negative for Mycoplasm in September 2008.

2 ID MYCN status ALK amplification? ALK mutation? Mutation confirmed in other studies? Source of cell lines CHP-134 A no wt White CHP901 A no wt White CHP902 A no wt White CLB-GA NA no 1275Q Combaret GICIN gain no wt Panarello Gl-ME-N NA no wt Versteeg IM32 A partial amplification wt Versteeg LAN-1 A no F1174L Versteeg LAN-2 A no wt Versteeg LAN-5 A no 1275Q 8 Versteeg LAN-6 NA no D1091N 7 White N206 A no F1174L 10 Versteeg NB-1 NA amplification wt JHSF NB-5 A no wt agsdale NB-13 A no wt agsdale NB-14 A no F1174L agsdale NBL-S NA no wt White NGP A no wt Versteeg NLF A no wt White NMB A no wt White SK-N- SH/SHEP/SH- SY5Y NA no F1174L 10 7,8,10 7,8,10 Versteeg/ Cohn/ Pålman SJNB-1 NA no wt Versteeg SJNB-6 A no wt Versteeg SJNB-8 A no wt Versteeg SJNB-10 A no wt Versteeg SJNB-12 NA no wt Versteeg SK-N-AS NA no wt ATCC SK-N-BE A no wt Versteeg SK-N-BE(2c) A no wt Lunec SK-N-FI NA no wt Versteeg SMS-KAN A no wt White SMS-KCN A no F1174L 10 / George et al. (1275Q) Versteeg STA-NB-3 A no wt Ambros STA-NB-8 A no F1174L Ambros STA-NB-9 A no wt Ambros STA-NB-10 A no wt Ambros STA-NB-12 NA no wt Ambros T14 A no wt Versteeg UHG-NP A no wt Speleman

3 Supplementary Table 3: Primers used for amplification and sequencing of the ALK gene. Exon Forward or everse Primer sequence 5 3 Exon 1 F CGCGGCTCGCTAGCTC GAACTGCGTTCAGGGAGAAAAC Exon 2 F GGGTCCTGAGGTCAACTCAGTC CATATAGGGAGCTGAGGGAATGC Exon 3 F AAGGCCAACCTCCTAGTGTGG AGAGCAGAACAGGAGTGAAGTCTCAT Exon 4 F GCAGAGAAGGAGATAATGGCCTC GGACCTACCGATTAAAGGACAATC Exon 5 F CCTGAAGTCCCTGCAAGGA AAACATGGTTGCAGGTTATTGAC Exon 6 F TCAGGCCTTGGAGTGTGAATG GCTTTGCCATGAGAGGAGTCA Exon 7 F CAGTGTCATTAGTCATCCAGCATTC AAGCTTTGGTCAGACACCCG Exon 8 F TTGACAGGTGGGCTTTCTTCTC CCAGCCAGCTAGGCTACTTTCT Exon 9 F TCCAGCTCTTCTCACCAGGC CTGCATGTGTGTCTTGGGTAAAA Exon F GGTGATCAGCACACACCTGC AGCACCAATCTTTCTTCTGCCT Exon 12 F TCGATGGCTGATTGGTGTTTC CTATGGGCCTGAGTCTGTTGC Exon 13 F TAAACTTGATCGTCCTTTCCTGAA TTGCTGTCTCATTCTCCTGGTATG Exon 14 F ATTTTTCTGCCTCCTCAACTCAA CTGTACCTGGCCCTGCTCAT Exon 15 F GTAACAAGGGTTCAGAGCCCG AGTGACTAAGATGCCCTCAGGC Exon 16 F TTTCCTAGTGTGGATCTGAAGCC TCACAGTCCACACTTGGGCA Exon 17 F CCCCAGTGACCCCCTAACTT CTGCGCCATAGGAAGCTTG Exon 18 F ACAGTTGTGCTTCCAGTGGCT TTTACAAAACCGAATCCAGGGT Exon 19 F CTGTCAAATCGGGATGAGTCTG AATTCCAGGGACTAGCATAACGAA Exon 20 F GGAAAGGTTCAGAGCTCAGGG GGCCTTTTGTGGCTAGAGGAGT Exon F GTGTGTATGTTACCCCCGCCT ACATGCTAGGGACAACACGATTT Exon 23 F GGAGCCTGCTGTGGTTCTTC AGTTGACACCCTGGGTTCC Exon 24 F CCCCTGGTGTAGCTGCATGT GAAATGTGAGCCCTTGAGATCTG Exon 25 F GGAAATATAGGGAAGGGAAGGAACTA TGATGTAAGGGACAAGCAGCC Exon 26 F ATTTCAGACCTTTAATGGGTAGACTATATTGT CCCGGCTTAGAGTATAGAGTCCTTT

4 Exon 27 F TTTAAGAGTTCTATGTTATGGAAAAGGGTA AAGAAGCATATGTGGCTCTGGATA Exon 28 F TCCTTGACCAATCAGCAGGG CTTGTACTCTGACTGGCTTGACCTAT Exon 29 F TGACTTCCCATTCATTTTGTATGC GTGGGCTTGTTTCTGGATCC

5 Supplementary Figure 1: ALK mutation and amplification frequencies and type in the different published studies and this study (wt = wild type, amp = amplification).

6 P < P < % 18% 16% 14% 12% 10% 8% 6% 4% 2% wt amp 1275 F1174 Y1278 F1245 T % Supplementary Figure 2: Frequencies and types of ALK mutations according to MYCN status and genomic subgroups (wt = wild-type ALK, amp = ALK amplification, MNA = MYCN amplification).

7 Supplementary Figure 3: Alignment of 2p gained regions present in 49 out of 254 neuroblastoma tumors, detected using arraycgh. Co-occurrence with MYCN amplification is marked with a star.

8 Supplementary Figure 4: Comparison of Affymetrix exon array ALK expression with arraycgh copy number data at the ALK position of 101 neuroblastoma tumors (X- and Y-axis = log scale, DOD = dead of disease).

9 Supplementary Figure 5: Correlation plots of ALK mna levels (A) or ALK protein levels (B) versus phospho-alk (palk) status. The black dot represents the NB1 cell line which has an ALK amplification, red dots represent F1174L mutated cell lines, green dots 1275Q mutated cell lines and blue dots ALK wild-type cell lines. Only wild-type cell lines with a clear ALK protein expression on Western blot were included.

10 Supplementary Figure 6: Western blot analysis of ALK (A) and phospho-alk (palk) (B) status in 22 neuroblastoma cell lines. 7 cell lines are ALK mutated (underlined), 1 has an ALK amplification (NB1) and 14 are ALK wild-type. Anti-EK2 was used as loading control (C). ALK blots were exposed for 5 minutes and palk blots for 20 minutes. ( cell lines with F1174L mutation, _ cell lines with 1275Q mutation).

11 amp F wt Supplementary Figure 7: Box-plots representing relative phospho-alk levels (palk/alk) in NB cell lines with different mutation status. (amp = amplification, wt = wild-type)

Emergence of new ALK mutations at relapse of neuroblastoma

Emergence of new ALK mutations at relapse of neuroblastoma Emergence of new ALK mutations at relapse of neuroblastoma Gudrun Schleiermacher MD PhD Institut Curie, Paris JCO, in press Background Cancer : frequent secondary progression, resistance to conventional

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplemental Data. Supplemental Material and Methods

Supplemental Data. Supplemental Material and Methods Supplemental Data Supplemental Material and Methods Determining GI50 values for compounds in neuroblastoma cell lines In order to determine GI50 values in neuroblastoma cell lines for the compounds used,

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells. Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-

More information

Author Manuscript Faculty of Biology and Medicine Publication

Author Manuscript Faculty of Biology and Medicine Publication Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but dos not include the final publisher proof-corrections

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

Using droplet digital PCR to analyze MYCN and ALK copy number in plasma from patients with neuroblastoma

Using droplet digital PCR to analyze MYCN and ALK copy number in plasma from patients with neuroblastoma /, 2017, Vol. 8, (No. 49), pp: 85234-85251 Using droplet digital PCR to analyze MYCN and ALK copy number in plasma from patients with neuroblastoma Marco Lodrini 1, Annika Sprüssel 1, Kathy Astrahantseff

More information

A novel and universal method for microrna RT-qPCR data normalization

A novel and universal method for microrna RT-qPCR data normalization A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,

More information

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment

More information

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,

Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared

More information

Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia

Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia Supplementary Figure, Tables and Note for: Mutations in GNAL cause primary torsion dystonia Tania Fuchs, Rachel Saunders-Pullman,, Ikuo Masuho 4, Marta San Luciano 5, Deborah Raymond, Stewart Factor 6,

More information

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

R2: web-based genomics analysis and visualization platform

R2: web-based genomics analysis and visualization platform R2: web-based genomics analysis and visualization platform Overview Jan Koster Department of Oncogenomics Academic Medical Center (AMC) UvA, the Netherlands jankoster@amc.uva.nl jankoster@amc.uva.nl 1

More information

Challenges and opportunities for the application of ctdna in neuroblastoma

Challenges and opportunities for the application of ctdna in neuroblastoma Challenges and opportunities for the application of ctdna in neuroblastoma * tumor ctdna Investigación Traslacional Tumores Sólidos Profª Rosa Noguera Universidad de Valencia/INCLIVA/CIBERONC ctdna in

More information

Genome-wide promoter methylation analysis in neuroblastoma identifies prognostic methylation biomarkers

Genome-wide promoter methylation analysis in neuroblastoma identifies prognostic methylation biomarkers RESEARCH Open Access Genome-wide promoter methylation analysis in neuroblastoma identifies prognostic methylation biomarkers Anneleen Decock 1, Maté Ongenaert 1, Jasmien Hoebeeck 1,2, Katleen De Preter

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with

More information

Multiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma

Multiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma RESEARCH ARTICLE Open Access Research article Multiplex Amplicon Quantification (MAQ), a fast and efficient method for the simultaneous detection of copy number alterations in neuroblastoma Candy Kumps

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

Is Multiplex Ligation-dependent Probe Amplification a good method for screening formalin fixed paraffin embedded neuroblastoma tumors?

Is Multiplex Ligation-dependent Probe Amplification a good method for screening formalin fixed paraffin embedded neuroblastoma tumors? Is Multiplex Ligation-dependent Probe Amplification a good method for screening formalin fixed paraffin embedded neuroblastoma tumors? Bachelor Degree Project in Biomedicine (2011-03-28 2012-01-11) 30

More information

WESTERN EUROPE PREVALENCE AND INCIDENCE OF PERIPHERAL ARTERY DISEASE AND CRITICAL LIMB ISCHEMIA 2017

WESTERN EUROPE PREVALENCE AND INCIDENCE OF PERIPHERAL ARTERY DISEASE AND CRITICAL LIMB ISCHEMIA 2017 WESTERN EUROPE PREVALENCE AND INCIDENCE OF PERIPHERAL ARTERY DISEASE AND CRITICAL LIMB ISCHEMIA 2017 Mary L. Yost 404-520-6652 , LLC 23 Ridge Rd. Beaufort, SC 20097 Copyright Pending 2017 All rights reserved,

More information

Protein SD Units (P-value) Cluster order

Protein SD Units (P-value) Cluster order SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

J Clin Oncol 29: by American Society of Clinical Oncology INTRODUCTION

J Clin Oncol 29: by American Society of Clinical Oncology INTRODUCTION VOLUME 29 NUMBER 33 NOVEMBER 11 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T Prognostic Value of the Stage 4S Metastatic Pattern and Tumor Biology in Patients With Metastatic Neuroblastoma

More information

Published Ahead of Print on October 3, 2011 as /JCO J Clin Oncol by American Society of Clinical Oncology INTRODUCTION

Published Ahead of Print on October 3, 2011 as /JCO J Clin Oncol by American Society of Clinical Oncology INTRODUCTION Published Ahead of Print on October 3, 11 as 10.10/JCO.11.35.9570 The latest version is at http://jco.ascopubs.org/cgi/doi/10.10/jco.11.35.9570 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T

More information

Supplementary information. Supplementary figure 1. Flow chart of study design

Supplementary information. Supplementary figure 1. Flow chart of study design Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

WKH$F02( (R539T( 957( 005( 24# 17# 32# 26# 30# 21# 21# 9# 14# 18# 9# 13# 21# 14# 14# 2# 42# 17#

WKH$F02( (R539T( 957( 005( 24# 17# 32# 26# 30# 21# 21# 9# 14# 18# 9# 13# 21# 14# 14# 2# 42# 17# 20 KH$C(( WT( WKH$F02( (R539T( WKH$F04( (Y493H( WKH$F03( C580Y( 18 027( 004( 010( 967( 005( 0.94 957( 0.96 887( 818$2( 0.98 829( 1.00 1.02 1.04 16 14 12 10 8 6 4 2 0 n 113 142 170 140 158 143 244 217 78

More information

Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism

Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism /, Vol. 6, No. 21 Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism Stefano J. Mandriota 1, Linda J. Valentijn 2, Laurence Lesne 1, David

More information

Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET

Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: Specific Gene Expression Profiles and Unique Chromosomal Abnormalities are Associated with Regressing Tumors Among Infants with Dissiminated Neuroblastoma. Authors:

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Predicting clinical outcomes in neuroblastoma with genomic data integration

Predicting clinical outcomes in neuroblastoma with genomic data integration Predicting clinical outcomes in neuroblastoma with genomic data integration Ilyes Baali, 1 Alp Emre Acar 1, Tunde Aderinwale 2, Saber HafezQorani 3, Hilal Kazan 4 1 Department of Electric-Electronics Engineering,

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

From reference genes to global mean normalization

From reference genes to global mean normalization From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Sbarrato_Supplementary_Fig1

Sbarrato_Supplementary_Fig1 Sbarrato_Supplementary_Fig1 Supplementary Figure 1. Translatome analysis of CLL patients based on IGVH mutational status ) Profile for the translatome of unmutated IGVH CLL versus mutated IGVH CLL pa9ents.

More information

The influence of societal individualism on a century of tobacco use: modelling the prevalence of smoking Appendices A and B

The influence of societal individualism on a century of tobacco use: modelling the prevalence of smoking Appendices A and B The influence of societal individualism on a century of tobacco use: modelling the prevalence of smoking Appendices A and B J.C. Lang, D.M. Abrams, and H. De Sterck A Additional Tables and Figures Table

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

CONTRACTING ORGANIZATION: Children s Hospital Los Angeles Los Angeles, CA 90027

CONTRACTING ORGANIZATION: Children s Hospital Los Angeles Los Angeles, CA 90027 AD Award Number: TITLE: Studies of the Tumor Microenvironment in Pathogenesis of Neuroblastoma PRINCIPAL INVESTIGATOR: Shahab Asgharzadeh, M D CONTRACTING ORGANIZATION: Children s Hospital Los Angeles

More information

Changing demographics of smoking and its effects during therapy

Changing demographics of smoking and its effects during therapy Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN

TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN AWARD NUMBER: W81XWH-13-1-0220 TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN PRINCIPAL INVESTIGATOR: Rani E. George, MD, PhD CONTRACTING ORGANIZATION: Dana-Farber

More information

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ)

PBZ FT01_PBZ FT01_TZ FT01_NZ. interface zone (I) tumor zone (TZ) necrotic zone (NZ) Oncotarget, Supplementary Materials www.impactjournals.com/oncotarget/ SUPPLEMENTRY FLES ndividuals factor map (P) FT_ FT_ FT_ Dim (.%) Dim (.%) >% peripheral brain zone () around % interface zone () FT

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Generation of cetuximab-resistant cells and analysis of singlecell clones. Cetuximab-sensitive cells (LIM1215 and OXCO-2) were chronically treated with cetuximab

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Relative activity (%) SC35M

Relative activity (%) SC35M a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation

Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation Figure S1. In vitro drug combinations Growth inhibition assays performed on BE(2)-C neuroblastoma cell line using Alamar Blue after 72 h incubation with a range of concentrations of chemotherapy agents

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Supplementary Materials and Methods... 1 1 Patients and control subjects for SNP genotyping... 2 1.1 Neuroblastoma patients in discovery case series... 2 1.2 Control subjects... 3 2 Whole-genome

More information

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Expression deviation of the genes mapped to gene-wise recurrent mutations in the TCGA breast cancer cohort (top) and the TCGA lung cancer cohort (bottom). For each gene (each pair

More information

Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma

Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma /, 2017, Vol. 8, (No. 34), pp: 57047-57057 Dual targeting of MDM2 and BCL2 as a therapeutic strategy in neuroblastoma Alan Van Goethem 1,2, Nurten Yigit 1,2, Myrthala Moreno-Smith 3, Sanjeev A. Vasudevan

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases. Supplementary Figure 1 Clinical timeline for the discovery WES cases. This illustrates the timeline of the disease events during the clinical course of each patient s disease, further indicating the available

More information

Perspective on performance: The Haemoglobinopathies. Barbara Wild

Perspective on performance: The Haemoglobinopathies. Barbara Wild Perspective on performance: The Haemoglobinopathies Barbara Wild Perspective on Performance: Performance assessment process DNA diagnostics for Haemoglobinopathies scheme Outcomes of shadow scoring exercise

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

MPS for translocations

MPS for translocations MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Divergent effects of intrinsically active MEK variants on developmental Ras signaling Yogesh Goyal,2,3,4, Granton A. Jindal,2,3,4, José L. Pelliccia 3, Kei Yamaya 2,3, Eyan Yeung

More information

Supplementary Information

Supplementary Information Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu

More information

artus EBV QS-RGQ Kit Performance Characteristics May 2012 Sample & Assay Technologies Analytical sensitivity plasma

artus EBV QS-RGQ Kit Performance Characteristics May 2012 Sample & Assay Technologies Analytical sensitivity plasma artus EBV QS-RGQ Kit Performance Characteristics artus EBV QS-RGQ Kit, Version 1, 4501363 Check availability of new electronic labeling revisions at www.qiagen.com/products/artusebvpcrkitce.aspx before

More information

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.

Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency. Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or

More information

Integrated Analysis of Copy Number and Gene Expression

Integrated Analysis of Copy Number and Gene Expression Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose

More information

Figure S1. Analysis of endo-sirna targets in different microarray datasets. The

Figure S1. Analysis of endo-sirna targets in different microarray datasets. The Supplemental Figures: Figure S1. Analysis of endo-sirna targets in different microarray datasets. The percentage of each array dataset that were predicted endo-sirna targets according to the Ambros dataset

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Preliminary programme ESLCCC September 2016

Preliminary programme ESLCCC September 2016 Preliminary programme ESLCCC 2016 22-23 September 2016 1 st day - Thursday 22 September 2016 8.45 17.00 Registration starts at 7.30 in the morning Welcome and Introduction By the ESLCCC 16 Committee Female

More information

Children, Toronto, Ontario, Canada. Department of Laboratory Medicine and Pathobiology Hospital for Sick Children, Toronto, Ontario, Canada, M5G 1X8

Children, Toronto, Ontario, Canada. Department of Laboratory Medicine and Pathobiology Hospital for Sick Children, Toronto, Ontario, Canada, M5G 1X8 Supplementary Information for Clinically Relevant Copy Number Variations Detected In Cerebral Palsy Maryam Oskoui 1, *, Matthew J. Gazzellone 2,3, *, Bhooma Thiruvahindrapuram 2,3, Mehdi Zarrei 2,3, John

More information

Molecular Diagnosis Future Directions

Molecular Diagnosis Future Directions Molecular Diagnosis Future Directions Philip Cunningham NSW State Reference Laboratory for HIV/AIDS & Molecular Diagnostic Medicine Laboratory, SydPath St Vincent s Hospital Sydney Update on Molecular

More information

* #$#$ ! "#$ # % &' $ +,-$ $ %! && . ## # " $## ( )$$ $! " # $% / - - ") () ' $*( # +

* #$#$ ! #$ # % &' $ +,-$ $ %! && . ## #  $## ( )$$ $!  # $% / - - ) () ' $*( # + ! "#$ # % &' $ #$#$ ( )$$ $! " # $% * #$#$ +,-$ $ %! &&. ## # " $## -$# ' / - - ") () ' $*( # + Percutaneous or open surgical biopsy in NB? Recommendations for percutaneous needle biopsy Claudio Granata

More information

31 countries (117 registries, 20 national) Increased coverage in countries with regional registries 50% European population Overall >20 million

31 countries (117 registries, 20 national) Increased coverage in countries with regional registries 50% European population Overall >20 million 31 countries (117 registries, 20 national) Increased coverage in countries with regional registries 50% European population Overall >20 million cancer cases Adult patients (age 15+) 45 major cancer sites

More information

Acquired Drivers of Disaese ahus and autoantibodies: their role in disease and their impact on patient management

Acquired Drivers of Disaese ahus and autoantibodies: their role in disease and their impact on patient management Acquired Drivers of Disaese ahus and autoantibodies: their role in disease and their impact on patient management Veronique Fremeaux-Bacchi Cordeliers Research Center and Européen Georges Pompidou Hospital,

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

HD-SNP Microarray Analysis of the Study 9 High Risk ALL Patients -

HD-SNP Microarray Analysis of the Study 9 High Risk ALL Patients - HD-SNP Microarray Analysis of the Study 9 High Risk ALL Patients - Increased Yield of Important Prognostic Information Nadine K Berry 1,2,4, Rodney J. Scott 1,4, Rosemary Sutton 5, Toby N Trahair 5, Philip

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis. Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information