MARK AARON BARNES, JR. Submitted in partial fulfillment of the requirements. For the degree Doctor of Philosophy

Transcription

1 MACROPHAGE MIGRATION INHIBITORY FACTOR AND LIVER DISEASE: THE ROLE OF MIF IN ALCOHOL-INDUCED LIVER INJURY AND CARBON TETRACHLORIDE (CCI 4 )-INDUCED LIVER FIBROSIS by MARK AARON BARNES, JR Submitted in partial fulfillment of the requirements For the degree Doctor of Philosophy Thesis Advisor: Dr Laura E. Nagy, PhD Clinical Mentor: Dr Pierre Gholam, MD Department of Molecular Medicine CASE WESTERN RESERVE UNIVERSITY May, 2014

2 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of Mark Aaron Barnes, Jr Candidate for the Molecular Medicine PhD degree*. (signed) Maria Hatzoglou, PhD (Thesis Committee Chair) Laura E. Nagy, PhD (Thesis Advisor) Pierre Gholam, MD (Clinical Mentor) Booki Min, PhD Xiaoxia Li, PhD (date) 03/21/14 *We also certify that written approval has been obtained for any proprietary material contained therein. 1

3 Dedication To my family: Thank you for all of the love and support you have shown me since the first day I arrived at 2664 Diane Place. To my mother, Clintonia M. Constant, my sister, Bronshay A. Barnes, and my grandparents, Robert L. and Mary M. Patterson: Thank you for providing the best collective parenting a guy could ever ask for. I d say y all have done a fine job raising me and helping guide my transition from childhood to adulthood. For that, I say thank you. ~M.A.B. Jr 2

4 Table of Contents List of Figures... 5 Abstract CHAPTER Ethanol metabolism Prevalence and spectrum of Alcoholic Liver Disease Extrahepatic consequences of ALD Animal Models of ALD Cellular Mediators of Liver Disease Soluble Mediators of Liver Disease Macrophage migration inhibitory factor (MIF) Summary CHAPTER Material and Methods CHAPTER Macrophage migration inhibitory factor contributes to ethanol-induced liver injury by mediating cell injury, steatohepatitis and steatosis CHAPTER Macrophage migration inhibitory factor is required for recruitment of Scarassociated macrophages and Matrix metalloproteinase 13 activity during carbon tetrachloride induced-liver fibrosis Chapter Conclusions and Future Directions References

5 List of Tables Table 1: Animal models of ethanol-induced liver injury and liver fibrosis Table 2: MIF expression in various diseases Table 3: Western blot and Immunohistochemistry antibody sources Table 4: Flow cytometry antibody sources Table 5: Quantitative Real-Time PCR primer sequences

6 List of Figures Figure 1: Mechanism of ethanol metabolism and liver injury Figure 2: Natural progression of Alcoholic Liver Disease Figure 3: Kupffer cell activation during ALD Figure 4: MMP expression during liver fibrogenesis and resolution of fibrosis Figure 5: MIF signaling in macrophages Figure 6: Ethanol feeding increased MIF expression in liver and plasma Figure 7: MIF-/- mice were protected from chronic ethanol-induced liver injury. 66 Figure 8: Wild-type and MIF-/- mice have similar blood ethanol concentrations. 68 Figure 9: Early immune responses in liver after 4d, 11% ethanol feeding Figure 10: Leukocyte recruitment after chronic ethanol feeding in wild-type and MIF-/- mice Figure 11: Neutrophil trafficking to the liver involves MIF-independent processes Figure 12: MIF-/- mice were protected from increased expression of proinflammatory mediators after chronic ethanol feeding Figure 13: MIF-/- mice were protected from ethanol-sensitized LPS-induced inflammation Figure 14: Proposed interaction between ethanol, MIF and innate immune responses Figure 15: MIF expression is decreased in liver of CYP2E1-/- mice Figure 16: Acute challenge with carbon tetrachloride (CCl 4 ) increases MIF expression in liver and plasma Figure 17: αsma expression after chronic CCl 4 exposure is lower in MIF-/- mice compared to C57BL/ Figure 18: Chronic CCl 4 administration increases ALT and AST activity in the plasma of wild-type and MIF-/- mice, but does not increase expression of CYP2E1 protein

7 Figure 19: Hepatic fibrosis C57BL/6 and MIF-/- mice exhibit similar extracellular matrix deposition and liver injury after chronic CCl 4 challenge Figure 20: Temporal infiltration of leukocytes after chronic CCl 4 challenge in C57BL/6 and MIF-/- mice Figure 21: Analysis of matrix metalloproteinase protein (MMP) expression and enzymatic activity after Chronic CCl 4 challenge to C57BL/6 and MIF-/- mice Figure 22: Proposed role for MIF and restorative SAMs during CCl 4 -induce liver fibrosis Figure 23: Temporal analysis of various leukocyte populations in liver of C57BL/6 and MIF-/- mice after chronic CCl 4 administration

8 Acknowledgements First and foremost, I would like to thank Laura for the guidance and support she provided to me during my time in her lab. I have grown so much, both personally and professionally, under her mentorship. When I first entered graduate school, I was unsure of my ability/desire to pursue a career in academic research, however, as I prepare for the next stage in my career, I feel very confident that I will be successful as long as I follow the excellent example she has set for me. Laura, thank you so very much! Thanks to everyone who has been through the Nagy lab during my tenure. I would especially like to thank Michele, Megan, Becky and Manoa. I couldn t have done it without you ladies! I also want to thank my thesis committee members for their support and encouragement over the years. The diversity of research skills and interests of the committee allowed me to learn so much more about ALD, macrophages and MIF than I would have with a more scientifically homogenous group. Jarod, Anabelle, Laura, Dan, Mari, Amanda, Yutaro, Lucas, Bethany, Jason, Mandy, Amanda, Alvaro, Dave, and everyone else... Thank you! 7

9 List of Abbreviations 4HNE AIH ALD ALH/AH ALT αsma ASO AST CAP CCl 4 CREB CYP2E1 DDT ECM ER GC HBV HCV HE HRS HSC 4-hydroxynonenal Autoimmune Hepatitis Alcoholic Liver Disease Alcoholic Hepatitis Alanine Aminotransferase Alpha Smooth Muscle Actin Antisense Oligonucleotide Aspartate Aminotransferase Community-acquired Pneumonia Carbon Tetrachloride camp Response Element Binding Protein Cytochrome P450 2E1 D-dopamine Tautomerase Extracellular Matrix Endoplasmic Reticulum Glucocorticoids Hepatitis B Virus Hepatitis C Virus Hepatic Encephalopathy Hepatorenal Syndrome Hepatic Stellate Cell 8

10 IFNγ IκB IL KC LPS MAP K MCP-1 MHC II MIF MKP MMP NAD NF-κB NK NK T cell NPC PBC PDGF PPARα ROS SAM SLE Interferon Gamma Inhibitor of NF-κB Interleukin Kupffer Cell Lipopolysaccharide Mitogen-activated Protein Kinase Monocyte Chemotactic Protein-1 Major Histocompatibility Class II Macrophage Migration Inhibitory Factor MAP Kinase Phosphatase Matrix Metalloproteinases Nicotinamide Adenine Dinucleotide Nuclear factor kapp-light-chain-enhancer of B cells Natural Killer Cell Natural Killer T cell Nonparenchymal Cell Primary Biliary Cirrhosis Platelet-derived Growth Factor Peroxisome Proliferator-activated Receptor Alpha Reactive Oxygen Species Scar-associated Macrophage Systemic Lupus Erythematosus Sp1 Specificity Protein 1 9

11 SPG TAA TGF-bβ TIMP Schizophyllan Thioacetamide Transforming Growth Factor Beta Tissue Inhibitor of Metalloproteinases TLR4 Toll-like Receptor 4 TNFα Tumor Necrosis Factor Alpha TNR1 TNFα Receptor 1 Treg WT Regulatory T cell Wild-type 10

12 Macrophage Migration Inhibitory Factor and Liver Disease: The Role of MIF in Alcohol-induced Liver Injury and Carbon tetrachloride (CCI 4 )-Induced Liver Fibrosis Abstract by MARK AARON BARNES, JR Macrophage migration inhibitory factor (MIF) exhibits both cytokine and chemotactic properties and is expressed by many cell types, including hepatocytes and nonparenchymal cells. Excessive alcohol abuse can lead to alcoholic liver disease (ALD), which has multiple stages of pathogenesis including hepatic steatosis and hepatic fibrosis. During steatohepatitis, several precipitating events, including triglyceride accumulation in the liver, hepatocyte damage and leukocyte infiltration, lead to further pathogenesis of ALD. Hepatic fibrosis is dependent on interactions between hepatocytes, hepatic stellate cells (HSC) and leukocytes. Recruitment of monocytes to the liver is a key contributor to hepatic fibrosis. Due to MIF s chemotactic properties, we hypothesized that MIF would be a key contributor to ALD pathogenesis. Female C57BL/6 or MIF-/- mice were fed an ethanol-containing liquid diet or pair-fed control diet for 25 days. Expression of MIF messenger RNA was induced after 25 days of ethanol feeding. After chronic ethanol feeding, chemokine expression and monocyte recruitment was increased in wild-type mice, but not MIF-/- mice. In a model of 11

13 liver fibrosis, female C57BL/6 or MIF-/- mice were challenged with carbon tetrachloride (CCl 4 ). Expression of mrna for MIF, as well as plasma MIF content, were increased in female wild-type mice in response to an acute dose of CCl 4. α Smooth muscle actin (αsma) mrna and protein, indicators of HSC activation, were increased in liver of wild-type after chronic CCl 4 challenge. This response was dampened in MIF-/- mice. Despite lower activation of HSC, MIF deficient mice developed similar fibrosis after CCl 4 exposure when compared to wild-type mice. Inflammatory scar-associated macrophages (SAMs) were recruited to the liver from the periphery in response to chronic CCl 4 in wild-type and MIF-/- mice, but later converted to a restorative SAM phenotype during fibrosis resolution. Fewer inflammatory and restorative monocytes were recruited in MIF-/- mice compared to wild-type mice. Fewer restorative macrophages were associated with lower MMP13 enzymatic activity in MIFdeficient mice. Taken together, these data indicate that MIF is an important mediator of chemokine production and leukocyte infiltration in the liver during ethanol feeding. However, during resolution of hepatic fibrosis, MIF is a key mediator for recruiting SAMs, which are critical for extracellular matrix degradation. 12

14 CHAPTER 1 Introduction Macrophage migration inhibitory factor (MIF) was initially described as a T cellderived mediator that inhibited movement of macrophages. (1, 2) Since its original discovery, MIF has been shown to be a multipotent innate immune mediator that is involved in many diseases, including multiple liver diseases. (3) Although MIF has previously been associated with alcoholic liver disease (ALD) (4), its precise role(s) in the progression of ALD have not been well established. Because MIF is an important immune mediator and there is an undeniable immune-dependent component to ALD (5), the following work aimed to explicate the role of MIF in ALD. Ethanol metabolism Chronic ethanol consumption/abuse can lead to development of ALD. Excessive ethanol consumption is considered 40-80g/day for males and 20-40g/day for females for an extended period of time, usually years. (6) Ethanol is metabolized in the liver parenchymal cells, hepatocytes, primarily in the area near the central vein. (7) Alcohol dehydrogenase metabolizes ethanol to acetaldehyde, and subsequently, acetaldehyde is converted to acetate via acetaldehyde dehydrogenase (Figure 1). Furthermore, during instances of excessive alcohol intake ethanol can also be metabolized by cytochrome P450 2E1 (CYP2E1) to acetaldehyde. Acetaldehyde is a highly reactive aldehyde, therefore production 13

15 of this metabolite can lead to oxidation of lipids and nucleic acids, as well as the formation of protein adducts. Additionally, excessive alcohol metabolism can lead to inordinate reduction of nicotinamide adenine dinucleotide (NAD), which shifts NADH/NAD ratio, and promotes generation of reactive oxygen species (ROS). (6, 8) The resultant oxidative stress causes changes in fatty acid synthesis, metabolism of fatty acids and other macromolecules, and can also lead to mitochondrial dysfunction and cellular stress, which can cause hepatocyte death. (9, 10) 14

16 Figure 1: Mechanism of ethanol metabolism and liver injury. Ethanol is metabolized in hepatocytes leading to formation of reactive oxygen species and reactive aldehydes. These metabolites cause lipid peroxidation and formation of protein adducts, leading to cellular stress and injury. 15

17 Prevalence and spectrum of Alcoholic Liver Disease Repeated, chronic hepatocyte damage resulting as a consequence of alcohol abuse initiates ALD. ALD is a major cause of deaths related to liver disease and has a mortality rate of 4.4/100,000 in the United States. (11) ALD is the second leading cause of liver cirrhosis, as well as liver transplantation, after hepatitis C virus infection. Additionally, ALD is one of the leading etiologies for preventable death. (12) The rate and severity of disease progression is multifactorial, and depends on gender, co-morbidities, such as metabolic dysfunctions and viral hepatitis infection, ethnicity, genetics. Furthermore, amount and pattern of ethanol consumption also contribute to disease progression. (6) ALD has many faces and manifests as a range of disease pathologies (Figure 2). Clinical manifestations of ALD patients include hepatic steastosis, steatohepatitis, liver fibrosis, cirrhosis, and hepatocellular carcinoma. The majority of patients that chronically abuse ethanol develop steatosis. Steatosis is characterized by accumulation of triglyceride droplets in the liver. Accumulation of hepatic triglycerides can be attributed to increased expression of proteins that promote lipogenesis, as well as suppression of proteins important for β-oxidation, such as peroxisome proliferator activated receptor α. (13) This stage of ALD is usually symptomless and reversible if the patient ceases further alcohol intake. (14) However, further consumption of ethanol may lead to the development of steatohepatitis, which is characterized by hepatic infiltration of leukocyte concomitant with excess lipid accumulation. In humans, polymorphonuclear cells 16

18 are the predominant infiltrating cell population during steatohepatitis. (15) Patients with extreme liver injury and inflammation in addition to underlying chronic liver disease may be diagnosed with alcoholic hepatitis, a condition that carries poor prognosis and often leads to mortality. (12, 16) This stage acts as bridging event between steatosis and fibrosis. (17) Liver fibrosis develops when wound healing, a normal physiological responses, proceeds unchecked in response to chronic or repeated hepatic insults, such as ethanol consumption. During fibrosis, excess extracellular matrix (ECM) proteins are deposited within interstitial spaces of the liver architecture. ECM proteins include laminins, elastin, fibronectin and various collagens, the most abundant matrix proteins. (18, 19) Under normal physiological conditions the predominant collagens are non-fibrillar collagens, such as collagen IV, which comprise the basement membrane in the liver. On the other hand, type I collagen, a fibrous collagen, become the most abundant ECM protein produced during fibrosis. (20) Collagen molecules can be stabilized by crosslinking with one another and this occurrence contributes to liver stiffness observed in fibrosis and cirrhosis. (21, 22) Until recently, hepatic fibrosis was thought to be an irreversible, end stage of liver disease. However, recent reports indicate fibrosis is potentially reversible. (23-25) 17

19 During fibrosis, the liver can develop nodules that contain regenerating hepatocytes. Once the fibrotic scar(s) is severely advanced and the liver is multinodular, this condition is termed cirrhosis. Cirrhotic patients can be described as having compensated or decompensated cirrhosis. Decompensated cirrhosis is characterized by development of ascites, jaundice, gastrointestinal bleeding, or encephalopathy, whereas patients with compensated cirrhosis do not experience additional adverse events on top of their underlying liver cirrhosis. (26, 27) 18

20 Figure 2: Natural progression of Alcoholic Liver Disease. Chronic ethanol consumption cause hepatic steatosis. Continued alcohol abuse may lead to fibrosis, cirrhosis, and potentially, hepatocellular carcinoma (HCC). Development of alcoholic hepatitis can drive progression of ALD at any stage- steatosis, fibrosis, or cirrhosis. Adapted from Altamirano and Bataller. (14) 19

21 Extrahepatic consequences of ALD Pathogenesis of ALD is complex. At later stages of ALD non-hepatic are also observed. ALD may lead to the development of ascites, hepatorenal syndrome, sarcopenia (loss of skeletal muscle), changes to intestinal physiology, hepatic encephalopathy and changes in neuroimmune signaling. Ascites is noted by fluid retention and build up within the peritoneal cavity, and is a common outcome in patients with advanced liver disease, including ALD. Cirrhosis accounts for 80% of patients who experience ascites. Consequences of ascites include increased risks of: peritoneal infection, malnutrition, hernias and sarcopenia. Generally, ascitic fluid is drained from the abdomen to relieve discomfort, as well as tested for presence of infection. Although ascites can be treated by draining excess fluid and using diuretics, to expel excess water and salt, treatment doesn t generally prolong the life of a cirrhotic patient. (28) Reduced kidney function is also a frequent phenomenon in patients with advances liver disease. Hepatorenal syndrome (HRS) describes a condition in which kidney function deteriorates as a consequence of portal hypertension. Several factors place a patient at risk for developing HRS including presence of ascites, peritoneal infection, gastrointestinal bleeding, and acute alcoholic hepatitis. These events may act as a second hit to underlying liver disease. Prognosis is generally poor in patients with HRS as the 90 day predicted survival is 15%. (29) 20

22 Gastrointestinal varices refer to enlargement of blood vessels in the esophagus, stomach, and rarely, small and large intestines due to portal hypertension. The formation of varices leads to the risk of ruptured vessels and subsequent hemorrhaging. Patients with severe liver disease are at greater risk of developing multiple varices and acquiring infection due to gastrointestinal bleeding. (28, 30, 31) It has been established that chronic ethanol exposure leads to bacterial overgrowth in the gut, as well as increased intestinal permeability, by disrupting the intestinal barrier. Increased intestinal permeability leads to translocation of macromolecules, including bacterial endotoxin, into the circulation. ALD patients, at all stages, have increased presence of bacterial endotoxin in plasma, notably lipopolysaccharide (LPS), compared to healthy individuals. (32, 33) In mice, loss of toll-like receptor 4 (TLR4), the primary cellular sensing mechanism for LPS, doesn t not alleviate endotoxin translocation, suggesting that physical disruption of the intestinal barrier, but not TLR-4 signaling, is responsible for translocation of endotoxin. Decreased barrier function after ethanol exposure is linked to disruption of intestinal tight junctions, which normally act as selective pores for molecules. Disruption of tight junctions most likely occurs through several avenues including increased pro-inflammatory cytokines (e.g. tumor necrosis factor α (TNFα)), a shift in the ratio of commensal to noncommensal bacterial populations, as well as direct effects of ethanol and its metabolites. (33) 21

23 Chronic liver disease can lead to malnutrition, and subsequent loss of skeletal muscle, also known as sarcopenia. Maintaining muscle mass depends on regulating protein synthesis and degradation. Use of animal models has revealed that ethanol can inhibit synthesis of skeletal muscle. (34, 35) Additionally, a recent study demonstrates that another potential mediating factor for sarcopenia is increased ethanol-induced autophagy, which leads to reduced muscle mass in human and rodent skeletal muscle. (36) ALD, while primarily affecting liver function and physiology, produces effect within the nervous system and can be considered a brain-controlled disease pathology. Ethanol abuse can lead to changes in synaptic function by modulating activity of various neurotransmitter receptors and ion channels. These changes lead to dysfunction in motor skills, learning and memory. For example, long term alcohol consumption can contribute to dementia, a severe loss of cognitive function. (37) Hepatic encephalopathy (HE) is a neurological condition that may develop secondary to ALD. HE occurs in response to acute liver failure, chronic liver disease, as well as portal vein shunting without underlying liver disease. However, most cases of HE can be attributed to chronic liver disease. HE causes changes in neuroinflammation, neurotransmitter signaling, fluid accumulation in the brain, behavior, and general cognitive abilities. The exact mechanisms that lead to development of HE are not well understood, but increased plasma levels of ammonia are associated with the appearance of HE. (38-40) 22

24 In addition to changes in cognitive abilities, ALD can also influence neuroinflammation. Long term ethanol exposure in mice leads to persistent induction of nuclear factor kappa-light-chain-enhancer of active B cells (NF-κB) and of pro-inflammatory genes. Additionally, ethanol exposure activates microglia, brain resident macrophages. (41, 42) In humans, chronic ethanol abuse leads to increased expression of interleukin 1 β (IL-1β) and monocyte chemotactic protein 1 (MCP-1). (43) Animal Models of ALD There are multiple methods used to replicate ALD in mice, however, none of the currently used ethanol exposure paradigms fully capture ALD pathogenesis as seen in humans. Most ethanol feeding methods involve providing alcohol in water (44) or a specialized liquid diet for short-term (days) and/or long-term (weeks) feeding (45). These models have been useful in studying development of steatosis and liver leukocyte immune responses, particularly those of Kupffer cells. A recently described acute on chronic feeding paradigm will be important for future ALD research because neutrophils infiltrate the liver in this model, a hallmark of ALD in humans and an observation missed in other models of oral ethanol feeding. In addition, it may more accurately mimic drinking habits of ALD patients, long-term ethanol consumption with episodic binging. (46) One disadvantage of oral ethanol feeding is that mice do not progress past steatosis and mild to moderate inflammation, and do not develop liver fibrosis. Another mechanism to deliver ethanol is by implanting a feeding tube directly to the 23

25 enteric system. Intragastric feeding leads to steatosis, inflammation and mild fibrosis in mice, however, it is difficult to perform because it requires a great deal of surgical skill. Additionally, it doesn t account for the effect of ethanol on the upper gastro-intestinal tract and affect the microbiota. (15, 47, 48) Liver fibrosis is a frequent outcome of ALD; however, current ethanol feeding models do not produce adequate hepatic fibrosis in mice that is comparable to humans. There are multiple mechanisms used to induce fibrosis in animals including surgical interventions, genetic modification, diet-induced injury, and injection of hepatotoxins. Two frequently used hepatotoxins include carbon tetrachloride (CCl 4 ) and thioacetamide (TAA). (49) CCl 4 is bioactivated via CYP2E1-dependent metabolism in hepatocytes and its toxic chloride metabolites cause cell death. (50) TAA is metabolized in hepatocytes to form a reactive oxygen molecule which leads to hepatocyte injury. (51) Using CCl 4 or TAA to model liver fibrosis has been very important for fibrosis research because: 1) when injected, these molecules rapidly induce fibrosis, 2) the results are highly reproducible, and 3) the resultant liver fibrosis shares characteristics with hepatic fibrosis in humans. A drawback of using hepatotoxins to model liver disease, particularly ALD, is that mice do not develop steatosis/steatohepatitis, a precipitating event during ALD pathogenesis. 24

26 Table 1: Animal models of ethanol-induced liver injury and liver fibrosis. This table summarizes commonly used advantages and disadvantages of commonly used animal models of liver injury. 25

27 Cellular Mediators of Liver Disease Many cells types contribute to ALD pathogenesis, however, this section will focus primarily on monocytes/macrophages and hepatic stellate cells. Kupffer cells (KC) are resident macrophages of the liver. Kupffer cells carry out many immune responses in the liver such as clearance of toxins, production of ROS, production of inflammatory cytokines, and promoting immune tolerance. (52) During ALD, one of the most important actions of KCs is to produce TNFα (Figure 3). Depletion of hepatic macrophages prevents early ethanol-dependent induction of TNFα. Furthermore, production of TNFα is dependent on an intact TLR-4 signaling complex- including CD14 and LPS-binding protein. Mice deficient in LBP exhibit reduced TNFα mrna and less liver injury compared to wild-type mice. Engulfment of apoptotic hepatocytes by KCs can lead to further KC-dependent TNFα production and hepatocyte injury. (53) Moreover, activation of the complement system is required for macrophage activation during ALD. (45, 54) The specific role of infiltrating monocytes in progression of the steatohepatitis stage of ALD will be explored in chapter 3. Scar-associated macrophages (SAM) are another type of macrophage important for liver disease. Unlike KCs, which are constantly present in the liver, SAMs appear in the liver during active fibrogenesis and fibrosis resolution. Two types of SAMs have been described in mice: Ly6C HI pro-inflammatory SAMs and Ly6C LO tissue restorative SAMs. Pro-inflammatory SAMs are required for progression of 26

28 fibrosis, as mice deficient in CCR2, a major receptor utilized during monocyte chemotaxis, are less susceptible to experimental liver fibrosis compared to wildtype mice. Additionally, SAMs can directly activate HSCs. (55) Once proinflammatory SAMs encounter cellular debris they switch to a restorative SAM phenotype. Restorative SAMs are major producers of matrix metalloproteinases (MMPs). (56) MMPs are enzymes that specialize in degrading extracellular matrix proteins. Twenty four MMPs have been described, and generally, they are involved normal turnover of ECM protein, as well as, matrix degradation during fibrosis (Figure 4). Activity of MMPs is regulated by tissue inhibitors of metalloproteinases (TIMPs). In humans, MMP1 is considered the most important MMP for degrading collagen, while in mice MMP13 may act as a functional homolog of MMP1. MMP13 is involved in matrix degradation during fibrogenesis, as well as fibrotic scar degradation during fibrosis resolution. Restorative SAMs are the major source of MMP13 during fibrosis and are critical to scar resolution. (57, 58) 27

29 Figure 3: Kupffer cell activation during ALD. Ethanol exposure causes activation of the complement system, as well as translocation of LPS across the gut barrier. LPS and complement proteins activate Kupffer cells, which produce TNFα and induce apoptosis of hepatocytes. Injury to hepatocytes leads to liver damage. 28

30 Figure 4: MMP expression during liver fibrogenesis and resolution of fibrosis. MMP expression is important for extracellular matrix remodeling during fibrogenesis, as well as during resolution of fibrosis. Expression of MMP 2, 9 and 13 is increases during early fibrogenesis. MMPs 2 and 9 remain elevated throughout fibrosis progression. However, MMP13 exhibits a biphasic response, increasing during remodeling of normal matrix, and then again during degradation of fibrotic scar. Adapted from Hermann et al. (58) 29

31 Hepatic stellate cells are the major cellular source of ECM during hepatic fibrosis. Non-activated HSCs reside in the space of Disse, between hepatocytes and sinusoidal endothelial cells, and represent a relative small proportion of hepatic cells. (59) These cells act as the primary storage compartment for Vitamin A and contribute to homeostasis of liver ECM. (22, 60) Upon activation, HSCs undergo multiple phenotypic changes including loss of Vitamin A, increased contractility, chemotaxis and proliferative ability. The most important characteristic alteration is that HSCs adapt a myofibroblastic phenotype, and become fibrogenic after activation. (61) Multiple mechanisms exist to activate HSCs including hepatocyte death, ROS production, and growth factor signaling. As HSCs exhibit some properties of phagocytic cells, cellular debris from hepatocytes can directly promote a fibrogenic phenotype in HSCs by inducing production of collagen 1 and transforming growth factor β (TGF-β). (62) Activation of HSCs by ROS may occur through indirect, general oxidative stress rather than being mediated by specific molecules. Some factors that promote oxidative stress and can induce HSC activation are increased expression of NADPH oxidase, an enzyme that produces toxic superoxide molecules, as well as increased accumulation of free fatty acid in the liver. (63, 64) Growth factors, particularly TGF-β and platelet-derived growth factor (PDGF), are also important for HSC activation and function. TGF-β is involved in many cellular processes in both developing embryos and adults; in the liver, TGF-β influences HSC action through surface receptor signaling that activates Smad proteins. 30

32 Activation of this pathway in HSCs lead to collagen production, migration, and cell survival signals. (65, 66) PDGF is the most potent mitogen of stellate cells. PDGF plays a critical role in angiogenesis (67), but can also activate HSCs via interaction with its membrane bound receptors. PDGF receptors are tyrosine kinases, and induce HSC signaling through activation of Ras-mitogen-activated protein kinase (MAPK) and Protein Kinase B (Akt) signaling pathways. PDGF signaling promotes proliferation, contractility and migration in HSCs. (22, 68, 69) Soluble Mediators of Liver Disease The role of soluble mediators, particularly pro-inflammatory cytokines, in early progression of ALD has been well documented. However, many proteins, such as complement proteins, and more recently described, chemokines, also contribute to promotion, or protection against, disease pathogenesis. The complement system consists of a collection of acute-phase proteins produced by the liver, but also monocytes, T and B cells, and endothelial cells. Complement proteins are important mediators innate and adaptive immune responses, and exhibit opsonization, chemotactic and cell lytic properties. (70) In the context of ALD, complement components C1q, C3, and C5 have been shown to be important for the progression of ethanol-induced liver injury in mice. C1q and C3 bind to apoptotic cells during initiation events in ALD and promote expression of pro-inflammatory cytokines. Furthermore, C1q is required for liver injury during chronic ethanol exposure. (45) C3 is also important early immune 31

33 responses after ethanol exposure. Early expression of pro-inflammatory cytokines, notably TNFα, occurred simultaneously to cleaved C3, C3b, deposition in liver. The effects of C3 in promoting ALD were dependent upon presence of complement receptors, as well as presence of Kupffer cells, but not TLR4- mediated signaling. (54) C3a and C5a are potent chemotactic agents for leukocytes, but may have differing roles in the progression of ALD. C3-/- mice were protected from ethanol-induced hepatic triglyceride accumulation, while C5- /- mice were protected from inflammation associated with ethanol exposure. C3 is also important for liver recovery after acute CCl 4 challenge. C3 promotes hepatocyte proliferation in a C3 receptor-dependent fashion, and proves critical to liver regeneration after hepatic injury.(71) Furthermore, C3 activation is required for IL-4 production from natural killer cells in the liver after partial hepatectomy, a frequently used model of liver regeneration. These data suggest complement could be important regeneration of the liver during fibrosis resolution, or information of nodules during cirrhosis, which contain proliferating hepatocytes. Taken together, these studies suggest a role for the complement system in the progression of ALD. Cytokines are small proteins involved in cell signaling and are primarily important for immune signaling. Since there is an immune component to ALD, it s of no surprise that cytokines play a significant role in disease progression. Some of the most important cytokines in ALD pathogenesis include IL-1β, IL-6, IL-10, and maybe most important, TNFα. 32

34 TNFα is produced by many cells types, however, in the liver, it is primarily produced by Kupffer cells. (72) TNFα production is an important mediator for initiating injury in response to ethanol. Furthermore, LPS-TLR-4 signaling, which leads to production of TNFα, is important for development of ALD (Figure 4). (73) Ethanol disrupts the integrity of intestinal tight junctions leading to increased presence of endotoxin in the liver. LPS is bound by LPS-binding protein and CD14, which then associates with TLR-4. After TLR-4 signaling is initiated, TNFα is produced in an NF-κB-dependent fashion. (5) Ethanol exhibits a sensitizing effect on monocytes, as monocytes from patients with ALD produced increased amounts of TNFα in response to LPS challenge compared to monocytes from healthy individuals. (74) Furthermore, elevated plasma levels of TNFα correlate with disease severity in ALD patients. (75) The critical role of TNFα in ALD was illustrated using TNFα receptor 1 (TNR1) deficient mice. Deficiency of TNR1 leads to reduced liver injury after ethanol exposure. Additionally, neutralizing antibodies against TNFα reduced ethanol-induced liver injury. (76) Despite promising results in pre-clinical models, pharmacological inhibition of TNFα by Infliximab in ALD patients lead to increased mortality due to infection, pointing to the importance of TNFα a critical mediator of host defense. (77) IL-1β is produced when its precursor, IL-1, is cleaved in a caspase-1-dependent manner. IL-1β is a potent pro-inflammatory mediator and is elevated in patients with ALD (78), however, the role of IL-1β in ALD remains elusive. In a study examining the role of IL-1β in ALD, ethanol feeding increased IL-1β activation in 33

35 wild-type mice; however, mice lacking the ability to carry out IL-1β activation or signaling were protected from ethanol-induced liver injury. (79) In contrast, another study demonstrated that mice lacking Nlrp3 inflammasome, a complex necessary to activate caspase-1, and subsequently, IL-1β, exhibited decreased activation of IL-1β. Reduced IL-1β activation was associated with greater liver injury compared to wild-type mice and may act in a protective manner during ALD. (80) A mutli-center clinical trial is currently underway to investigate the effectiveness of Anakinra, an IL-1R antagonist, as a treatment option for patients with alcoholic hepatitis. IL-6 and IL-10 exhibit hepatoprotective effects during ALD pathogenesis in mice. While IL-6 promotes inflammation when its signal is transduced in a monocyte, IL-6 protects against ethanol-induced liver injury in a STAT3-dependent manner in hepatocytes. IL-6 signaling induced expression of anti-apoptotic genes, leading to hepatocyte protection and survival. IL-6 signaling also alleviates ethanol-induced steatosis. (81, 82) IL-10 is a well-known anti-inflammatory cytokine. It is primarily produced by monocytes, such as Kupffer cells, and has potent inhibitory effects on pro-inflammatory cytokines, such as TNFα and interferon γ (IFNγ). (83) During ALD progression in mice, IL-10 decreases proinflammatory innate immune responses, such as production of TNFα, after ethanol exposure thereby modulating liver injury by inhibiting immune responses known to be critical for ALD pathogenesis. (84) 34

36 Multiple cytokines are also involved in the later, fibrogenesis stage of ALD as well. TGF-β is likely the most important cytokine that mediates hepatic fibrosis, however, other cytokines, namely IL-4, IL-13 and IL-17, also contribute to fibrosis. These cytokines are primarily produced by T helper cells, whose primary responsibilities include releasing cytokines that help maximize various immune responses. (85, 86) IL-4 and IL-13 are type 2 T helper cell cytokines. They share many effector functions and both signal through biologically similar receptors. In a mouse model of Schistosomiasis, neutralizing antibodies toward IL-4 decreased hepatic collagen production. Blockade of IL-4 resulted in decreased production of IL-5, another Th2 cytokine, and IL-13. (87) Consequently, INF-γ, a purported antifibrotic mediator (88), was increased. In addition to promoting Schistomiasisinduced liver fibrosis, IL-4 also exhibits the ability to activate a variety of fibroblasts into collagen-producing myofibroblasts. (89, 90) Furthermore, IL-4 is increased in patients with Schistosomiasis.(91) Since IL-4 share many properties with IL-13, it is not surprising that IL-13 can also induce a myofibroblastic phenotype in during fibrotic responses. (92) When both IL-4 and IL-13 are considered, IL-13 may be the more important mediator of fibrosis, as blocking IL- 13 signaling leads to decreased liver fibrosis without any modulation of IL-4. (93) IL-13 pro-fibrogenic signaling activity is suppressed by a decoy receptor, IL- 13Rα2. Mice deficient in IL-13Rα2 exhibited increased liver fibrosis after 35

37 Schistosoma infection. (94) While these observations were made in an infection model of liver fibrosis, there could be a role of Th2 cytokines in ALD. IL-17 is a pro-inflammatory cytokine produced by Th17 cells that acts to increase other pro-inflammatory cytokines and chemokines. In the liver, IL-17 can also be produced by natural killer (NK) T cells, neutrophils and macrophages. (86, 95) In experimental liver fibrosis, IL-17 was increased in liver after bile duct ligation or CCl 4 challenge. IL-17 was necessary for induction of IL-1, TNFα, and TGF-β during fibrosis. Additionally, IL-17 could directly stimulate HSCs and induce collagen production. (96) While the role of cytokines in ALD has been extensively studied, the role of chemokines is not well understood. Chemokines are a subset of cytokines that specialize in recruitment of cells during homeostasis and inflammation through chemotaxis, movement of cells toward a chemical signal or gradient. (97) Mandrekar et al explored the role of MCP-1 (CCL2), a potent chemoattractant for monocytes, in ethanol-induced liver injury. Ethanol feeding to mice increased MCP-1 in both Kupffer cells and hepatocytes of wild-type mice. Increased expression of MCP-1 was associated with increased liver injury, as well as, increased expression of pro-inflammatory mediators. However, MCP-1 deficient mice were protected from liver injury and inflammation. Additionally, MCP-1 promotes hepatic triglyceride accumulation by inhibiting action of peroxisome proliferator-activated receptor-α (PPAR-α), a protein to protein that promotes 36

38 oxidation of fatty acids. (98) This was the first study to establish a role for chemokines in promoting liver injury, and surprisingly, promoting hepatic steatosis. Because MIF exhibits chemotactic properties, the role of MIF as a chemokine will be explored in chapter 3. Macrophage migration inhibitory factor (MIF) MIF is a soluble factor that is involved in many disease processes. Though a functional recombinant protein wasn t produced until the 1990 s, MIF was one of the first cytokines described, with its discovery coming shortly after the discovery of interferons. (1, 2, 99) Determining the exact cellular source of MIF has remained elusive because there are many sources of MIF including macrophages, a major source of MIF, other leukocytes, endothelial cells, epithelial cells, as well as the pituitary gland, which may be responsible for increased systemic expression of MIF. (3, 100) Since its original discovery, much effort has been put toward understanding the biology and genetics of MIF. MIF transcription and expression The MIF promoter contains binding sites for the transcription factors specificity protein 1(Sp1) and cyclic AMP response element-binding protein (CREB). Both Sp1 and CREB positively regulate expression of constitutive MIF, while LPSinduces Sp1 transcription of MIF. In addition, the nucleotides within the MIF gene are hypomethylated, a status generally associated with high basal expression of a gene product. (101, 102) Histone deacetylation may also play a role MIF 37

39 expression, as treatment with histone deacetylase inhibitors represses MIF expression in cells. (103) There are two functional polymorphsims in the promoter region of the MIF gene. Higher or lower expression is dependent upon the copy number of repeated tetranucleotide CATT 5-8 at the -794 promoter position. CATT 5 promotes lower expression of MIF, while CATT 8 leads to higher expression. A guanine (G) to cytosine (C) single nucleotide polymorphism (SNP) at promoter position -173 confers higher MIF expression. This SNP is associated with CATT 7 genotype. Under many circumstances, low MIF expression is beneficial, including malaria infection, arthritis, colitis, asthma, and autoimmune hepatitis. ( ) It is believed low MIF expression protects patients from inflammatory complications associated with those diseases. However, during certain infections, namely community acquired pneumonia (CAP), higher expression of MIF offers protection, as higher MIF levels allow a patient to produce a more robust immune response. (109) Interestingly, MIF plays a dual role in pathogenesis of systemic lupus erythematosus (SLE). Patients without SLE incidence and with high expression MIF polymorphisms are protected from development of SLE. In contrast, low expression polymorphisms offer protection for disease complications in patients with established SLE. (110) 38

40 MIF and Glucocorticoids One of the first described functions of MIF was its ability to inhibit glucocorticoid (GC) action. GCs exhibit potent anti-inflammatory properties, such suppression of inflammation and leukocyte recruitment. One method GCs utilize to reduce inflammation involves activating MAP kinase phosphatase (MKP). MKPs dephosphorylate MAP kinases, which are essential signaling proteins during immune responses, thus inactivating them and suppressing pro-inflammatory immune functions. (111) Another method GCs use to decrease pro-inflammatory signaling is by promoting inhibitor of nuclear factor-κb (IκB) binding to NF-κB. NF-κB is an important transcription factor for many pro-inflammatory immune responses, and must be dissociated from IκB to activate transcription of its target genes. GC signaling mediates IκB binding to NF-κB, thus prevent expression of pro-inflammatory genes. MIF counteracts IκB inhibition of NF-κB by a mechanism that is yet to be determined. In addition, MIF counteracts GCs by activating MAP kinase signaling and promoting leukocyte recruitment. (112, 113) GCs are commonly used to treat patients with ALD. Some patients respond well to treatment, while others do not. (114) It is likely that higher expression of MIF will likely decrease a patient s ability to respond to GC treatment. MIF Receptors and Signaling To date, only CD74, also known as major histocompatibility class II (MHC II) invariant chain, has been identified as a cognate receptor for MIF. As a part of the MHC II antigen presenting complex, the invariant chain prevents MHC II from 39

41 binding proteins in the endoplasmic reticulum (ER) and acts as a protein chaperone in the ER. Though most CD74 is associated with MHC II, a small proportion of protein is located at the cell surface, where it is expressed as a transmembrane protein. CD74 s short cytoplasmic tail is not believed to possess direct signaling capacity, which is likely the reason it forms signaling complexes with CD44 and chemokine receptors CXCR2/4. (115) CD44 is a multifunctional surface protein that acts as a receptor for ECM proteins and is involved with leukocyte activation. CD44 s importance as a component of the MIF signaling complex was demonstrated using immortalized fibroblasts transfected with CD74 and CD44. CD74 alone was able to bind MIF, however, activation of MAP kinase signaling required association and phosphorylation of CD44 to the signaling complex. Additionally, MIF signaling activates MAP kinases via interaction with CXCR4. (116) CD74-CXCR4 complex is also important for endocytosis of MIF and subsequent intracellular signaling. (117) Once MIF-dependent MAP kinase signaling is activated numerous cellular responses are possible, including production of cytokines and other pro-inflammatory mediators, such as TNFα and TLR4, and adhesion molecules, as well as inhibition of p53-dependent apoptosis (Figure 5). MIF can also lead to sustained MAP kinases signaling, which is usually transient. (118, 119) Much less is known about the direct chemotactic properties of MIF, but they are likely linked to its ability to bind CXCR2/4. Interaction between MIF and CXCR2/4 mediates monocyte chemotaxis and arrest. MIF-CXCR signaling promotes expression of integrins that assist in cell migration, arrest and extravasation. (120) 40

42 Figure 5: MIF signaling in macrophages. In unstimulated cells, MIF is associated with Golgi-associated protein 115. Upon stimulation, MIF and P115 are released into the extracellular environment. MIF can then enter the peripheral circulation, auto-stimulate the cell that released it, or act upon other cells in close proximity. MIF can interact with its receptor complex, CD74-CXCR2/4, or be endocytosed into cells. MIF signaling activates MAP kinases signaling, as well as prevents binding of IκB to NF-κB. These events promote inflammation through production of cytokines and other pro-inflammatory molecules. 41

43 MIF and Liver Diseases MIF has been investigated as an associative factor and/or biomarker in multiple liver disease pathologies. In patients with nonalcoholic fatty liver disease (NAFLD), expression of MIF was investigated as an indicator of fibrosis severity. MIF was expressed in both heaptocytes and monocytes in patients without fibrosis, however, monocytes became the predominate MIF expressing cells as stage of fibrosis worsened. (121) A study investigating -173 G/C SNP as an correlate for hepatitis B viral (HBV) infection revealed that the C/C genotype (high expression) was much higher in patients with chronic HBV or HBV-induced cirrhosis. (122) MIF was also recently implicated in autoimmune hepatitis (AIH) and primary biliary cirrhosis (PBC). Circulating and liver MIF levels were increased in patients with AIH and patients with PBC compared to healthy controls. This study also reported the first observation of soluble CD74 in the plasma. In contrast to its functions on the cell surface a signal transducer, soluble CD74 prevents MIF signaling activity, likely acting as a ligand sink. Soluble CD74 was increased in patients with PBC compared to patients with AIH or healthy controls. These data point to a different mode of action for MIF in AIH and PBC. (108) Intragastric ethanol feeding to rats increased expression of MIF, as well as TNFα and IFNγ, in liver. Furthermore, animals with higher circulating endotoxin levels exhibited less expression of MIF in liver, suggesting that MIF may be released from liver into the plasma. (123) Expression of MIF in liver is also detected in patients with alcoholic hepatitis (AH) or cirrhosis (AC). Both hepatocytes and monocytes expressed MIF in liver of AH or AC patients; 42

44 moreover, circulating levels of MIF correlated with plasma aspartate aminotransferase in patients with AH or AC. (4) These studies suggest a role for MIF not only in ALD, but other liver diseases as well. Inhibition of MIF Activity Currently, ISO-1 is the only commercially available MIF inhibitor for use in animal studies and it has been shown to be an effective antagonist in various animal models. ISO-1 exerts its inhibitory function by binding to a nonfunctioning enzymatic pocket on MIF, thereby preventing initiation of MIF signaling. In a mouse model of systemic lupus erythematosus, ISO-1 was effective in reducing production of pro-inflammatory cytokines and leukocyte infiltration to kidney. (124) In another study, mice treated with ISO-1 exhibited protection endometriosis. ISO-1 treatment reduced the expression of cell adhesion molecules, IL8, and MMPs. (125) Furthermore, ISO-1 prevented ROS generation in immortalized hepatocytes and reduced TNFα production in LPS-stimulated monocytes from patients with cystic fibrosis. (126, 127) Since progression of ALD is partially dependent on pro-inflammatory immune responses, gaining further insight into the role of MIF in ALD will allow future research to develop and assess the effectiveness of MIF inhibitors, such as ISO-1, as a viable therapeutic option for patients suffering from liver diseases. 43

45 Summary MIF has been implicated in the pathogenesis of many inflammatory diseases. Additionally, MIF is an important for modulation of expression of pro-inflammatory mediators, such as TNFα, IFNγ, IL-1β, as well as TLR4. MIF is also produced by and exerts its effects upon many different cells types, including directly promoting chemotaxis. Due to its pleiotropic characteristics, we hypothesized MIF would be important for promoting pro-inflammatory immune responses and leukocyte recruitment during ethanol-induced liver injury. In addition, we hypothesized that MIF would be necessary for recruitment of scar-associated macrophages during fibrosis. The following chapters will discuss the materials and methods used to investigate the role of MIF in ALD, the role of MIF in ethanol-induced steatohepatitis, and the role of MIF in experimental liver fibrosis. 44

46 Table 2: MIF expression in various diseases. Table 2 summarizes observations/pathologies associated with high or low expression of MIF. C.A.P, community-acquired pneumonia. S.L.E., systemic lupus erythematosus. NAFLD, nonalcoholic fatty liver disease. HBV, hepatitis B virus. AIH, autoimmune hepatitis. PBC, primary biliary cirrhosis. AH/AC, alcoholic hepatitis or cirrhosis. 45

47 CHAPTER 2 Material and Methods Animal Studies. All experimental procedures involving animals were approved by the Cleveland Clinic Institutional Animal Care and Use Committee. For studies involving ethanol feeding to mice, 8 to 10 week old female mice were used to perform the following studies. C57BL/6 or 129/Sv-C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, Maine). MIF-/- mice on a C57BL/6 background were obtained from Dr. R. Bucala (Yale University, New Haven, Connecticut) (128) and a breeding colony was established at CCF. CYP2E1-/- mice on a 129/Sv-C57BL/6N mixed background were obtained from Dr. A. Cederbaum (Mount Sinai School of Medicine, New York, New York) and used to establish a breeding colony at CCF. Mice were housed in plastic cages with microisolator lids. Ethanol-fed animals were allowed free access to Lieber- DeCarli (Catalog # , Dyets Inc, Bethlehem, PA) ethanol-containing diet after 2 days of being acclimated to the liquid diet. Animals were fed 5.5% (total kcal) ethanol for 2 days, 11% for 2 days (4d), 22% for 1 week (11d), 27% for 1 week (18d), and finally 32% for 1 week (25d). Control mice were pair-fed an identical liquid diet except the diet is iso-calorically substituted with maltose dextrans in place of ethanol. (45, 54) In some experiments, animals were treated with 0.7μg/g body weight of lipopolysaccharide (LPS, lot # 120M4028; strain E. coli 026:B6, Sigma Aldrich, St. Louis, MO) or saline via intraperitoneal injection 46

48 4hrs prior to euthanasia. Mice were euthanized at day 4 (4d, 11%) or day 25 (25d, 32%). For animal experiments that involved carbon tetrachloride (CCl 4 ) administration to mice, 10 to 12 week old female mice were used to perform the studies. C57BL/6 or MIF-/- mice were housed in plastic cages with microisolator lids and fed a standard laboratory chow diet (rodent diet #2918, Harlan-Teklad, Madison, WI). CCl 4 and olive oil were purchased from Sigma-Aldrich (St Louis, MO). CCl4 was diluted 1:3 in olive oil, which was used as a vehicle control. For acute CCl 4 administration, mice received a single intraperitoneal dose of 1μl/g body weight using 100μl Hamilton syringes; mice were euthanized 2-72 hours post-injection. During chronic CCl 4 administration, mice received 2 i.p. injections per week for 5 weeks, culminating in 10 total doses. Two ramping dose were given to the mice (0.25 μl/g body weight, then 0.5 μl body weight) before receving the full 1 μl/g body weight dose. Mice were euthanized at 24, 48 or 72 hours post-injection. Blood Ethanol Quantification. Two hours into the dark cycle, blood was collected into heparinized microcapillary tubes from pair- and ethanol-fed mice via tail vein after 23 days, 32% ethanol feeding. Plasma ethanol concentration was quantified using Ethanol L3K kit (Sekisui Diagnostics, Framingham, MA) according to manufacturer s recommendations. To measure ethanol metabolism in naïve mice, wild-type and MIF-/- mice were fasted hours, and then given 47

49 an oral gavage of 25% ethanol diluted in 0.9% saline. Blood was collected via tail vein after 90 minutes and ethanol was quantified as described above. Plasma ALT/AST activity measurements, liver triglycerides and hydroxyproline liver content. Plasma samples were analyzed for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) via enzymatic assay (Sekisui Diagnostics, Framingham, MA) following the manufacturer s instructions. Flash frozen liver samples were used to quantify triglyceride accumulation using the Triglyceride Reagent Kit (Pointe Scientific Inc., Lincoln Park, MI). Liver hydroxyproline content was determined via colorimetric assay. Briefly, mg of liver tissue was homogenized and hydrolyzed in 6N HCl at 120 C for 16 hours. Hydroxyproline levels were subsequently quantified in the hydrolysates. (129) Plasma MIF. Blood was drawn from mice via the vena cava and placed on ice. Plasma was collected by centrifugation for 2.5 min at 10,000 g. Samples were denatured in Laemmli buffer for Western blot analysis and then stored at 20 C. Plasma (2 μl for ethanol studies, 4μl for CCl 4 studies) samples were loaded onto 4% - 12% reducing SDS-polyacrylamide gradient gels. MIF antibody (Torrey Pines Biolabs, Inc, Secaucus, NJ) was used at 1:500 in 1% bovine serum albumin to detect immunoreactive protein using enhanced chemiluminescence, images were collected, and signal intensities were quantified using Eastman Kodak Co. Image Station 4000R. 48

50 Western blotting. Liver homogenates were prepared for Western blotting as previously described. (130) Homogenate samples in Laemmli buffer were loaded into 10% reducing SDS-polyacrylamide gels. Isolated NPCs and hepatocytes were denatured in Laemmli buffer for Western blot analysis and then stored at 20 C. NPC protein lysates were loaded onto 4% - 12% reducing SDSpolyacrylamide gradient gels. Immunoreactivity was detected using enhanced chemiluminescence; images and signal intensities were obtained using Eastman Kodak Co. Image Station 4000R. Gel Zymography. Zymogram gels containing gelatin were purchased from Bio- Rad Laboratories (Hercules, CA). Collagen-containing gels were formulated as previously described. (131) Briefly, liver homogenates in non-reducing Laemmli buffer were loaded into 10% gelatin-containing or collagen-containing SDSpolyacrylamide gels. After electrophoresis, gels were placed in renaturing buffer (2.5% Triton x-100), and subsequently placed in development buffer (50mM Tris, 200mM NaCl, 5mM CaCl 2, 0.06% Brij-35 in distilled water, ph 8.0) for 20 hours at 37 C. Gels were then stained with 0.5% Coomassie Brilliant Blue G250, and destained with methanol and acetic acid in distilled water (10:10:80). Images were captured using Eastman Kodak Co. Image Station 4000R and areas of clearance were quantified using Kodak Molecular Imaging software. 49

51 Immunohistochemistry. Immunohistochemical analysis of F4/80, C3b/iC3b/C3c, Ly6c, Collagen 1 was performed using optimal cutting temperature (OCT) frozen liver sections. Staining for Sirius Red, MIF and 4- hydroxynonenol adducts, NIMP14 and αsma was performed in paraffinembedded liver sections. Terminal deoxynucleotidyl transferase-mediated dutp nick end labeling (TUNEL) positive staining in liver was analyzed using ApopTag plus In Situ Apoptosis Detection Kit (S7111, Millipore, Billerica, MA). 50

52 Table 3: Western blot and Immunohistochemistry antibody sources. Antibody dilutions are indicated within parentheses. Antibody 4-hydroxynonenol (IHC) Source Alpha Diagnostics Intl Inc., San Antonio, TX (1:250) αsma (WB) Abcam, Cambridge, MA (1:1000) αsma (IHC) Sigma-Aldrich, St Louis, MO (1:1600) C3b/iC3b/C3c Hycult Biotechnology, Uden, Netherlands (1:50) CYP2E1 (WB) EMD Millipore, Billerica, MA (1:5000) F4/80 (WB) ebioscience Inc., SanDiego, CA (1:50) HSC70 (WB) Santa Cruz Biotechnologies, Dallas, TX (1:20,000) Ly6C (IHC) AbD Serotech, Raleigh, NC (1:50) MIF(WB) Torrey Pines Biolabs, Secaucus, NJ (1:500) MIF (IHC) Life Technologies, Grand Island, NY (1:500) MMP9 (WB) Abcam, Cambridge, MA (1:2500) MMP13 (WB) Abcam, Cambridge, MA (1:1000) Collagen1 (IHC) Southern Biotech, Birmingham, AL (1:250) 51

53 NPC Isolation. Livers were digested in RPMI with Type IV Collagenase (Sigma Aldrich, St. Louis, Missouri, Lot# 087K8630) and DNase I (Roche, Mannheim, German) for 45min at 37 C. Digested clumps of liver were pressed through a 70um strainer and washed with RPMI with 10% FBS. Cells were centrifuged at 50g for 10min; supernatant was then centrifuged at 50g for 7min. To pellet the NPC fraction, cells were centrifuged at 300g for 7min. Cells were resuspended in BD Pharm Lyse (BD Biosciences, San Jose, California) for 5 minutes on ice. Cells were washed with RPMI with 10% FBS and centrifuged at 300g for 10min. Cells were subsequently resuspended at an appropriate concentration for particular assays. Flow Cytometry. Liver non-parenchymal cells (NPCs) were isolated from wildtype and MIF-/- mice, resuspended in FACS buffer (1x PBS, 1% BSA, 0.05% sodium azide). Cells were aliquoted into 96 well plates at a concentration of ~1x10 6 cells/ml. Cells were centrifuged at 830 x g for 4 minutes, resuspended in 50ul FACS buffer containing 0.5ug of Fcγ Block (clone 93, ebioscience, San Diego, California), and incubated for 15 minutes at room temperature. After blocking, cells were stained with fluorochrome-conjugated antibodies against antigens of interest for 30 minutes at 4 C in the dark. Cells were washed and centrifuged at 830 x g for 4 minutes twice with FACS buffer. Stained cells were resuspended in 200ul of 1% paraformaldehyde and kept in the dark at 4 C overnight. Stained cells were centrifuged at 830 x g for 5 minutes. Stained cells were resuspended in 300ul of FACS buffer, and data was collected on a LSRII 52

54 flow cytometer (Becton Dickinson Immunocytometry systems, Mountain View, CA). Data collected on the LSRII were analyzed using FlowJo software (Tree Star, Inc., Ashland Oregon). To calculate the total number of CD45 + NPCs per liver, the total number of isolated NPCs was multiplied by the percentage of CD45 + cells in each liver. To obtain the total number of a particular leukocyte population in the NPCs isolation, the total number of CD45 + cells was multiplied by the percentages acquired via FlowJo for that particular population. 53

55 Table 4: Flow cytometry antibody sources. Antibody clone indicated in brackets. Antibody Source CD11b ebioscience [M1/70], San Diego, CA CD11c BD Biosciences [HL3], San Jose, CA CD3ε Biolegend [145-2C11], San Diego, CA CD4 ebioscience [GK1.5], San Diego, CA CD45 Abcam [I3/2.3], Cambridge, MA F4/80 ebioscience [BM8], San Diego, CA Foxp3 ebioscience [FJK-16S], San Diego, CA Ly6C AbD Serotec [ER-Mp20], Raleigh, NC Ly6G ebioscience [RB6-85C], San Diego, CA NK1.1 Biolegend [PK136], San Diego, CA 54

56 RNA Isolation and Quantitative Real-Time PCR. RNA was isolated from liver, reverse transcribed and analyzed via quantitative real-time PCR (qrt-pcr). Data were collected using a Stratagene Mx3000P thermal cycler (Agilent Technologies, Santa Clara, CA). Relative mrna expression was determined by comparing expression levels of target mrna to 18S rrna. Statistical analyses were performed on the ΔCt values (mean Ct from gene of interest - mean Ct from 18S). (132) 55

57 Table 5: Quantitative Real-Time PCR primer sequences. Primers for qrt- PCR were obtained from Integrated DNA Technologies (Coralville, IA). Primer Forward Sequence Reverse Sequence αsma GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA CD11b ATGGACGCTGATGGCAATACC TCCCCATTCACGTCTCCCA CD62E ATGAAGCCAGTGCATACTGTC CGGTGAATGTTTCAGATTGGAGT CD74 GAACCTGCAACTGGAGAGCC GGTTTGGCAGATTTCGGAAG Col 1α1 ATGTTCAGCTTTGTGGACCTC CAGAAAGCACAGCACTCGC CXCL10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA F4/80 CCCCAGTGTCCTTACAGAGTG GTGCCCAGAGTGGATGTCT ICAM-1 GTGATGCTCAGGTATCCATCCA CACAGTTCTCAAAGCACAGCG MCP-1 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG MIF GCCAGAGGGGTTTCTGTCG GTTCGTGCCGCTAAAAGTCA MIP2 GCGCCCAGACAGAAGTCATAG AGCCTTGCCTTTGTTCAGTATC MMP2 CAAGTTCCCCGGCGATGTC TTCTGGTCAAGGTCACCTGTC MMP8 TCTTCCTCCACACACAGCTTG CTGCAACCATCGTGGCATTC MMP9 GCGCCACCACAGCCAACTATG TGGATGCCGTCTATGTCGTCTTTA MMP13 CTTCTTCTTGTTGAGCTGGACTC CTGTGGAGGTCACTGTAGACT TIMP1 TCGGATACTTCAGCGTCAGGA CGGCCCGTGATGAGAAACT TIMP2 TCAGAGCCAAAGCAGTGAGC GCCGTGTAGATAAACTCGATGTC TIMP3 CTTCTGCAACTCCGACATCGT GGGGCATCTTACTGAAGCCTC TLR4 ATGGCATGGCTTACACCACC GTTCTCCTCAGGTCCAAGTTGCCGTTTC TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG 56

58 Inflammatory Score. Hematoxylin and Eosin stained liver sections were examined and assigned an inflammatory score by a liver pathologist Xiuli Liu, MD (Anatomic Pathology, Cleveland Clinic, Cleveland, OH). Total inflammatory scoring included both the degree of lobular inflammation in clusters and mononuclear cell infiltration with a diffuse distribution. Statistical Analysis. Values are reported as means ± standard error of the mean (SEM). Multiple feeding trials were performed and combined for final data analysis. Data were analyzed by ANOVA using general linear models procedure (SAS, Carey, IN). If data were not normally distributed, data were log transformed. Multiple comparisons were analyzed using least square means. 57

59 CHAPTER 3 Macrophage migration inhibitory factor contributes to ethanol-induced liver injury by mediating cell injury, steatohepatitis and steatosis The following work was published in Hepatology 57(5), Introduction Long-term excessive alcohol consumption can lead to alcoholic liver disease (ALD). (133) ALD is one of the leading causes of preventable death and accounts for approximately 4% of global mortality. In the United States, ALD is responsible for more liver-related mortalities than hepatitis C viral (HCV) infection. (11) Clinical presentation of ALD is variable. Most chronic alcohol abusers accumulate fat in their liver, which can lead to further progression to varying degrees of hepatic inflammation, cell death and fibrosis in some individuals. The liver is an important innate and adaptive immune organ with a broad range of actions involving both cellular and soluble factors. This complex, dynamic organ houses a large population of natural killer, natural killer T cells and Kupffer cells and is the principal site of production of complement proteins, as well as other molecules important for orchestrating an immune response. (134) The essential role of Kupffer cell activation and sensitization in ALD has been well characterized. (14) 58

60 In addition to the contribution of cellular components of the innate immune system to ALD, soluble innate immune factors were first identified as key factors in the progression of ALD when Yin et al. found that tumor necrosis factor receptor-1 -/- mice are protected from injury associated with long-term ethanol feeding. (73) Chronic excessive alcohol consumption also leads to increased endotoxin load in the liver, which induces TLR4-TRIF-dependent responses in Kupffer cells. (5) The role of the complement system in the progression of ethanol-induced liver injury has also been investigated. Ethanol exposure increases activation of complement, indicated by increased C3a in the serum and C3b/iC3b/C3c deposition in liver. (135) Mice deficient in C3 or C5 are protected from ethanol-induced liver injury. (54, 135) While these insights into the role of innate immune mediators are critical for understanding the progression of ALD, emerging evidence indicates chemokines also play a critical role in disease pathogenesis. Mandrekar et al. reported that monocyte chemotactic protein-1 (MCP-1) is essential for macrophage activation, production of inflammatory mediators and hepatic steatosis after ethanol feeding in mice. (98) In addition to the strong correlation between ALD and increases in pro-inflammatory mediators, these data bring forth the possibility that additional chemokines may play a major role in disease progression. Here we have investigated the role of one such chemokine, macrophage migration inhibitory factor (MIF), in the development of ethanol-induced liver 59

61 injury. MIF is a multi-potent protein that exhibits cytokine, chemokine and hormonal characteristics. It is constitutively expressed and stored in pre-formed intracellular pools which are rapidly released upon stimulation. MIF binds to CD74, which forms heterodimeric complexes with CD44 and CXCR2/4. (136) MIF released from liver stimulates peritoneal macrophages to release TNFα and IL1β. (137) MIF also stimulates release of MCP-1 from endothelial cells and recruits monocytes via CCR2 signaling. (138) MIF is an important contributor to many diseases including various cancers, sepsis and a number of liver pathologies. (119) Patients with liver cirrhosis and hepatocellular carcinoma have increased serum levels of MIF. Additionally, there is a positive correlation between MIF expression and necro-inflammation in liver of patients with hepatitis B viral infection. (139) Akyildiz et al. provided evidence that increased MIF expression in the liver is due to infiltrating monocytes in patients with nonalcoholic steatohepatitis. (121) Importantly, serum concentration of MIF is increased in ALD patients and positively correlates with concentration of serum transaminases. (4, 140) Since MIF is a multi-potent regulator of innate immune responses, we hypothesized MIF is a critical mediator of ALD pathogenesis. If MIF functions as a chemoattractant during ethanol exposure, recruiting monocytes to the liver and regulating pro-inflammatory responses, then MIF-/- mice should be protected from chronic ethanol-induced liver injury. Indeed, ethanol feeding to wild-type mice increased MIF expression in liver and concentration in the plasma, as well 60

62 as enhanced the recruitment of peripheral monocytes to the liver. In contrast, ethanol feeding to MIF-/- mice decreased F4/80 + cells and did not elicit recruitment of peripheral monocytes. This change in monocyte population in the liver was associated with protection of MIF-/- mice from chronic ethanol-induced hepatic steatosis, pro-inflammatory cytokine production and sensitization to LPS. Results Chronic ethanol feeding induces expression of MIF in the liver and causes liver steatosis and liver injury in mice MIF is produced in the liver and multiple cell types in the liver can respond to MIF via interaction with its receptor CD74. Ethanol feeding to wild-type mice increased the expression of MIF mrna in liver at 4d, 11% (kcal) ethanol compared to pair-fed mice; this increase was maintained over 25d, 32% (kcal) ethanol (Figure 6A/B). In contrast, ethanol feeding had no effect on hepatic expression of CD74 mrna. Content of MIF in the plasma was also increased after 25d, 32% ethanol feeding in wild-type mice (Figure 6C), consistent with previous reports that ethanol feeding to rats increases circulating MIF. (123) MIF was localized to both parenchymal and non-parenchymal cells in the liver indicated by diffuse immunohistochemical staining in both control and ethanol-fed mice (Figure 6D). MIF and CD74 were detected by Western blot in both parenchymal and non-parenchymal cell populations isolated from liver of control and ethanol-fed mice (Figure 6E). 61

63 If MIF contributes to the pathophysiological effects of ethanol, then mice deficient in MIF should be protected from ethanol-induced liver injury. Wild-type and MIF-/- mice were allowed free access to the Lieber-DeCarli ethanol diet for 25d, 32% or pair-fed control diets. Ethanol increased hepatic triglycerides, as well as activity of plasma ALT and AST, in wild-type mice compared to pair-fed controls; this response was reduced in MIF-/- mice (Figure 7A). Chronic ethanol feeding also increased the number of TUNEL positive hepatocyte nuclei in liver of wild-type mice, but not MIF-/- mice (Figure 7B), indicating that MIF was required for chronic ethanol-induced apoptosis of hepatocytes. 62

64 63

65 Figure 6: Ethanol feeding increased MIF expression in liver and plasma. C57BL/6 mice were allowed free access to an ethanol-containing liquid diet or pair-fed control diet. (A/B) Expression of MIF and CD74 mrna was measured in liver by qrt-pcr at two time points of ethanol feeding, 4d, 11% and 25d, 32%, or in pair-fed control mice. Expression of the genes of interest was normalized to 18S (n=4 pair-fed and n=6 for ethanol-fed mice). (C) The relative concentration of MIF in plasma was assessed by Western blot. n=3 pair-fed and n=6 for ethanolfed mice. Immunoreactive MIF was assessed via (D) immunohistochemistry in liver and (E) Western blot in isolated hepatocytes (H) and non-parenchymal cells (N). (E) Relative CD74 was measured by Western blot in hepatocytes and NPCs isolated from pair-fed (P) and 25d, 32% ethanol-fed mice (E). (D) IHC images represent 2 images per liver and were acquired using 20x objective (n=5 pair-fed and n=9 ethanol-fed mice). Values represent means ± SEM. Asterisks represent statistical significance between pair-fed and ethanol-fed groups (P < 0.05). 64

66 65

67 Figure 7: MIF-/- mice were protected from chronic ethanol-induced liver injury. C57BL/6 and MIF-/- mice were allowed free access to ethanol containing diets or pair-fed control diets. Liver injury was characterized at 25d, 32% ethanol feeding compared to pair-fed controls. (A) Hepatic triglycerides were measured by biochemical assay and plasma ALT and AST were quantified enzymatically. (B) TUNEL positive nuclei were visualized and semi-quantified in paraffinembedded liver sections. (C) Induction of CYP2E1 protein was measured by immunoblot and quantified via densitometry. (D) Immunoreactive 4HNE adducts were visualized by immunohistochemistry and semi-quantified in paraffinembedded liver sections. Images were acquired using 10x (4HNE) or 20x (TUNEL) objective. Figures represent 2 images per liver (n=9 pair-fed and n=11 ethanol-fed mice). Values represent means ± SEM, n=4 pair-fed and n=6 for ethanol-fed mice. Values with different superscripts are significantly different from each other (P < 0.05). 66

68 Protection from chronic ethanol-induced liver injury in MIF-/- mice is independent of ethanol intake or metabolism Protection from chronic ethanol-induced liver injury in MIF-/- mice was not due to differences in ethanol intake or metabolism. Wild-type and MIF-/- mice had similar intakes of ethanol-containing diet (data not shown). Plasma ethanol concentrations were similar between wild-type and MIF-/- mice when measured 90 minute after an oral gavage of ethanol to mice never before exposed to ethanol, as well as 2 hours into the dark cycle on 23d, 32% ethanol feeding (Figure 8 A/B). Induction of CYP2E1 in the liver was similar after chronic ethanol feeding in both wild-type and MIF-/- mice (Figure 7C). Consistent with the equivalent increase in CYP2E1 expression between genotypes, accumulation of 4HNE adducts in the liver, an indicator of oxidant stress, during ethanol feeding was independent of genotype (Figure 7D). 67

69 Figure 8: Wild-type and MIF-/- mice have similar blood ethanol concentrations. C57BL/6 and MIF-/- mice were allowed free access to ethanol containing diets or pair-fed control diets, or given an oral gavage of 25% ethanol diluted in 0.9% saline. Blood ethanol was measured after (A) 23 days, 32% ethanol feeding or (B) 90 minute gavage. Values represent means ± SEM, n=4 pair-fed and n=4 ethanol-fed (A) and n =7 wild-type and n=3 MIF-/- (B). 68

70 Maintenance of Kupffer cells and TNFα production are MIF-dependent during early ethanol feeding To understand the mechanisms by which MIF contributes to chronic ethanolinduced liver injury, early inflammatory responses were evaluated in wild-type and MIF-/- mice after 4d, 11% ethanol feeding. Ethanol feeding increased TUNEL positive nuclei in the liver of both wild-type and MIF-/- mice at 4d, 11% ethanol feeding (Figure 9A). In contrast to apoptosis of hepatocytes at 25d, 32% ethanol feeding, the distribution of TUNEL positive cells to the hepatic sinusoid indicated the apoptotic death of Kupffer cells at this early time point. This was confirmed by co-localization of TUNEL + nuclei with F4/80 + cells (Supplemental Figure 9E). These data are similar to previous reports of Kupffer cell apoptosis, rather than hepatocytes, early in the response to ethanol. Complement activation, assessed by the accumulation of immunoreactive C3b/iC3b/C3c in the liver, was also detected after 4d, 11% ethanol in both wild-type and MIF-/- mice (Figure 9B). However, while 4d, 11% ethanol feeding increased TNFα production in wild-type mice, MIF-/- mice were protected (Figure 9C). These results suggest that while apoptosis of Kupffer cells and the activation of complement induced by early ethanol feeding is independent of MIF, increased expression of TNFα by early ethanol feeding resulted from a MIF-dependent mechanism. (45) 69

71 MIF mediates early and chronic ethanol-induced macrophage/monocyte replenishment and recruitment Because of MIF s potent chemokine activity, we hypothesized that decreased TNFα expression in the MIF-/- mice after 4d, 11% ethanol feeding could be due to a failure to repopulate the liver with macrophages after the ethanol-induced apoptosis of resident Kupffer cells. To test this hypothesis, expression of F4/80, a macrophage marker, was measured in wild-type and MIF-/- mice. Quantity of F4/80 mrna and protein expression was not affected by genotype in pair-fed controls (Figure 9D/E). However, the response to ethanol feeding differed by genotype. In wild-type mice, ethanol feeding for 4d, 11% had no effect on F4/80 mrna; however, F4/80 mrna was reduced after ethanol feeding in MIF-/- mice (Figure 9D). Similarly, the number of F4/80 + cells in the liver was not affected by ethanol feeding in wild-type mice, but was reduced in MIF-/- mice (Figure 9E). These data suggest that MIF was required to maintain macrophage populations in the liver during the early response to ethanol. 70

72 71

73 Figure 9: Early immune responses in liver after 4d, 11% ethanol feeding. C57BL/6 and MIF-/- mice were allowed free access to ethanol containing diets or pair-fed control diets. (A) TUNEL positive nuclei, immunoreactive (B) C3b/iC3b/C3c and (C) TNFα were visualized in paraffin-embedded or OCTfrozen liver sections. Values indicate percentage of TUNEL + nuclei/dapi (A), total number of positive punctae for C3c/iC3b/C3c (B) and F4/80 (D), and mean fluorescence intensity for TNFα (C). Black arrows indicate zoom of white boxes to represent sinusoidal TUNEL + nuclei (A) or deposition of C3b/iC3b/C3c (B). (D) F4/80 mrna expression was measured via qrt-pcr and (E) immunoreactive F4/80 was visualized in OCT-frozen liver sections. F4/80 mrna expression was normalized to 18S. Images were acquired using 10x (TNFα) or 20x (TUNEL, C3b/iC3b/C3c, F4/80) objective. Figures represent 2 images per liver. Values represent means ± SEM, n=4 pair-fed and n=6 ethanol-fed. Values with different superscripts are significantly different from each other (P < 0.05). 72

74 If MIF is required to replenish Kupffer cells after ethanol feeding, MIF-/- mice should exhibit sustained depletion of macrophages during chronic ethanol feeding. Similar to 4d, 11% ethanol feeding, both expression of F4/80 mrna and the number of F4/80 + cells was sustained in wild-type mice after 25d, 32% ethanol feeding. However, MIF-/- mice expressed less F4/80 mrna and had fewer F4/80 + cells after 25d, 32% ethanol feeding (Figure 10A and 10B). In order to better characterize the effect of chronic ethanol feeding on monocyte populations in the liver, non-parenchymal cells were analyzed via flow cytometry. The number of CD45 + cells (total leukocytes) was increased in wild-type mice after chronic ethanol feeding, but no increase was seen in MIF-/- mice (Figure 10C). This CD45 + population included large proportions of CD11c + and Ly6C + cells after 25d, 32% ethanol feeding in wild-type mice; however, the number of CD11c + and Ly6C + cells in MIF-/- mice was not affected by ethanol feeding (Figure 10C/D). To determine the cellular origin of the Ly6C + cells, NIMP14, a marker of neutrophils, was examined to distinguish infiltrating mononuclear and polymorphonuclear cells. The number of NIMP14 + cells was not influenced by diet or genotype either after 25d, 32% ethanol feeding (Figure 11A) or in response to 4hr LPS challenge (Figure 11B). These data therefore suggest that infiltrating Ly6C + cells are likely of mononuclear cell origin. 73

75 74

76 Figure 10: Leukocyte recruitment after chronic ethanol feeding in wild-type and MIF-/- mice. Leukocyte phenotype in liver of C57BL/6 and MIF-/- mice was analyzed after 25d, 32% ethanol feeding. (A) Immunoreactive F4/80 was visualized and semi-quantified in liver sections frozen in OCT. Figures represent 2 images per liver. (B) F4/80 mrna expression in liver was measured via qrt- PCR. Images were acquired using 10x objective. F4/80 mrna expression was normalized to 18S. n=4 pair-fed and n=6 ethanol-fed. (C) Total CD45 + leukocytes and monocyte cell markers, CD11c and Ly6C, were quantified in isolated liver non-parenchymal cells via flow cytometry. CD11c and Ly6c graphs represent fold change compared to wild-type pair-fed mice. (D) Ly6c was assessed by immunohistochemistry and semi-quantified in liver sections frozen in OCT. Black arrows indicate zoom of white boxes to represent clusters of Ly6c staining. Values represent means ± SEM, n=10 pair-fed and n=10 ethanol-fed. Values with different superscripts are significantly different from each other (P < 0.05). 75

77 76

78 Figure 11: Neutrophil trafficking to the liver involves MIF-independent processes. C57BL/6 and MIF-/- mice were allowed free access to ethanol containing diets or pair-fed control diets. After 25d, 32% ethanol feeding, mice were challenged with LPS via intraperitoneal injection 4hr prior to euthanasia. (A) Neutrophil infiltration was examined by immunoreactive NIMP14 in liver of pairand 25d, 32% ethanol-fed wild-type and MIF-/- mice. (B) Black arrows indicate positive NIMP14 staining, suggesting the presence of neutrophils after 4hr LPS challenge. Inset represent zoom of positive NIMP14 staining in liver of 25d, 32% ethanol-fed mice. Images were acquired using 20x objective. Figures represent 2 images per liver and 4 mice per experimental condition. Values represent means ± SEM, n= 4 pair-fed and n=6 ethanol-fed. 77

79 Production of pro-inflammatory mediators and chemokines was increased in liver after ethanol feeding in a MIF-dependent manner Increased monocyte infiltration was associated with increased expression of proinflammatory mediators and chemokines after ethanol feeding. TLR4 and TNFα gene expression was elevated in wild-type mice, but not in MIF-/- mice (Figure 12A). MCP-1, a potent chemoattractant of macrophages and dendritic cells, CXCL10, which attracts monocytes, T cells and NK cells, and MIP-2, a chemoattractant produced by monocytes, were investigated as potential contributors to monocyte infiltration. MCP-1, CXCL10 and MIP2 mrna expression was increased in wild-type mice after chronic ethanol feeding (Figure 12B). MIF-/- mice were protected from ethanol-induced expression of these chemokines. 78

80 Figure 12: MIF-/- mice were protected from increased expression of proinflammatory mediators after chronic ethanol feeding. Expression of (A) TLR4, TNFα, (B) MCP-1, CXCL10 and MIP2 mrna was quantified in liver via qrt-pcr. Expression of the genes of interest was normalized to 18S. Values represent means ± SEM, n=4 pair-fed and n=6 ethanol-fed. Values with different superscripts are significantly different from each other (P < 0.05). 79

81 MIF mediates sensitization to LPS challenge in mice after chronic ethanol feeding To determine if MIF contributes to more severe, acute inflammation, similar to that observed in alcoholic steatohepatitis, wild-type and MIF-/- mice were challenged with LPS 4 hours prior to euthanasia after chronic ethanol feeding. After LPS challenge, pair-fed wild-type mice exhibited some total liver inflammation, as measured by mononuclear cell infiltration and lobular inflammation (Figure 13B); chronic ethanol-feeding exacerbated this response (Figure 13A, black arrows). In contrast, MIF-/- mice were less prone to liver inflammation both in pair- and ethanol-fed mice (Figure 13B). Increased liver inflammation in wild-type mice was coupled with enhanced chemotactic activity in LPS-challenged mice. MCP-1, Intercellular Adhesion Molecule 1 and E-selectin (CD62E) mrna expression was exacerbated after chronic ethanol and LPS; however, MIF-/- mice were not sensitized to challenge with LPS after chronic ethanol feeding (Figure 13C). 80

82 81

83 Figure 13: MIF-/- mice were protected from ethanol-sensitized LPS-induced inflammation. C57BL/6 and MIF-/- mice were allowed free access to ethanol containing diets or pair-fed control diets. After 25d, 32% ethanol feeding, mice were challenged with LPS via intraperitoneal injection 4hr prior to euthanasia. (A) Hematoxylin and eosin stained liver sections were examined and (B) assigned an inflammatory score by a pathologist. Inflammatory score was based on mononuclear cell and lobular inflammation. Arrows indicate foci of infiltrating cells (inset represent zoom of lower black arrow). (C) Expression of MCP-1, ICAM-1 and CD62E mrna was quantified in liver by qrt-pcr. Expression of the genes of interest was normalized to 18S. Images were acquired using 10x objective. Figures represent 2 images per liver. Values represent means ± SEM, n= 4 pairfed and n=6 ethanol-fed. Values with different superscripts are significantly different from each other (P < 0.05). 82

84 Discussion MIF was originally described as a T cell derived factor that inhibited macrophage movement. (1) Since its original discovery, it has become clear that MIF is a multi-potent cytokine/chemokine that contributes to many pro-inflammatory responses in various pathogenic states including sepsis, colitis, metabolic disorders, and multiple types of arthritis. (3) Here we provide the first evidence that MIF plays a major role in the progression of ethanol-induced liver injury. Ethanol exposure increased the expression of MIF mrna in the liver, as well as the concentration of MIF in the circulation. MIF was involved in both the early and chronic innate immune responses in the liver after ethanol feeding (summarized in Figure 14). 83

85 Figure 14: Proposed interaction between ethanol, MIF and innate immune responses. Ethanol feeding in mice results in activation of Kupffer cells and increased MIF production. These two phenomena initiate a complex positive feedback loop involving monocyte infiltration, increased production of proinflammatory mediators and chemokines, ultimately leading to chronic inflammation and injury. 84

86 The mechanisms for the progression of ethanol-induced liver injury are complex and dynamically regulated over time and hepatocellular location. Very early in the innate immune response to ethanol, there is an increase in apoptosis of Kupffer cells in the liver. (45) This increase in Kupffer cell apoptosis elicits activation of the classical complement pathway and an increase in inflammatory cytokine production. (54) One important activity of MIF is to decrease activation-induced apoptosis of Kupffer cells via p53 inhibition. (128) However, since TUNEL + nuclei were equivalent between wild-type and MIF-/- mice, it is unlikely that MIF plays a role in this early ethanol-induced apoptosis of Kupffer cells. During chronic ethanol feeding, MIF was required to elicit the infiltration of non- Kupffer cell monocyte populations and to maintain Kupffer cell numbers in the liver. MIF was critical for infiltration of CD11c + and Ly6C + monocytes in wild-type mice after chronic ethanol feeding. Ethanol feeding decreases splenic dendritic cells, without decreasing numbers of dendritic cell precursors, differentiation or turnover in mice (141), suggesting that dendritic cells migrate from the spleen, a major reserve of monocytes (52), to the liver during ethanol feeding. In mouse models of non-alcoholic steatohepatitis, increased MCP-1 production leads to recruitment of bone marrow-derived Ly6C + monocytes to the liver. (142) In ethanol-induced liver injury, expression of MCP-1 mrna was increased in wildtype mice; this response was lost in MIF-/- mice. These data indicate MIF directly, and/or indirectly via MCP-1, recruits monocytes from peripheral immune reservoirs. While we cannot rule out the possibility of Kupffer cell proliferation, it 85

87 is unlikely the maintenance of the Kupffer cell population was due to proliferation, as the data available suggest that proliferation occurs primarily in Th2 responses. (143) MIF is produced by many cell types and may act in an endocrine and/or paracrine fashion. Ethanol feeding in mice increased expression of MIF mrna in liver and protein content in plasma. MIF is expressed in both hepatocytes and infiltrating leukocytes in liver of patients with alcoholic hepatitis. (4) In the present study, MIF and CD74 protein was detected in both hepatocytes and nonparenchymal cells; however, the precise cellular origin of MIF protein in the plasma cannot be determined. Neither MIF nor CD74 protein was increased by ethanol in isolated hepatocytes or nonparenchymal cells after 25d, 32% ethanol feeding, despite the increased mrna expression of MIF in the liver. Because MIF is stored in pre-formed pools and rapidly released, it is likely that during chronic inflammation MIF is expressed and then released into the circulation. The mechanisms by which ethanol increases the expression and release of MIF are likely complex. While regulation of MIF expression and secretion is not well understood, recent studies have provided insights into possible mechanisms of control. For example, microrna-451 directly interacts with the 3 UTR of MIF and regulates MIF expression. (144) Further, Golgi-Associated Protein p115 is essential for releasing MIF from cytoplasmic pools. When p115 was depleted in human monocytes, MIF release into the extracellular environment also 86

88 decreased. (144) Additionally, cells stimulated with LPS in vitro secreted both MIF and p115 into their supernatant. (145) CYP2E1-/- mice did not induce the expression of MIF mrna after chronic ethanol feeding compared to wild-type mice (Figure 15), suggesting that MIF induction is due, at least in part, to the metabolism of ethanol via CYP2E1. Another contributor to induction of MIF during ethanol exposure may be related to localized hypoxia in the liver during ethanol metabolism. (146, 147) Ischemia-reperfusion, which results in hypoxia, is associated with increased serum MIF, as well as increased expression of MIF mrna and protein. (137) Further, MIF enhances its own expression under hypoxic conditions. (146) Taken together, it is likely that ethanol metabolism via CYP2E1, in conjunction with localized ethanol-induced hypoxia in the liver, contribute to increased MIF expression during chronic ethanol feeding.. 87

89 Figure 15: MIF expression is decreased in liver of CYP2E1-/- mice. 129/Sv- C57BL/6N and CYP2E1-/- mice were allowed free access to an ethanolcontaining liquid diet or pair-fed control diets. (A) Expression of MIF mrna was measured in liver by qrt-pcr after 25d, 32% ethanol feeding. Expression of the genes of interest was normalized to 18S (n=4 pair-fed and n=6 for ethanol-fed mice). Values represent means ± SEM. Values with different superscripts are significantly different from each other (P < 0.05). 88

90 MIF contributes to the progression of ethanol-induced liver injury in mice at multiple stages of injury. MIF-/- mice were protected from steatosis and inflammation, as well as hepatocyte injury and hepatocyte apoptosis after chronic ethanol feeding. Interestingly, MIF is the second protein, along with MCP-1 (98), with chemotactic activity to be associated with regulation of hepatic triglyceride accumulation after ethanol feeding. Here, the effect of MIF in decreasing ethanolinduced triglyceride accumulation may be a direct effect of MIF and/or indirect effect via regulation of the expression of MCP-1. These data are consistent with the growing body of evidence indicating a clear and critical link between innate immune function and the regulation of metabolic activity. (148, 149) Here we used multiple models of ethanol exposure to investigate specific aspects of the pathophysiology of ALD. The mouse model of chronic ethanol feeding (25d, 32% kcal) results in hepatic steatosis and modest inflammation, but does not model more severe ethanol-induced liver injury. One important clinical presentation of ALD is acute severe alcoholic hepatitis, which is presented clinically as steatosis, hepatocyte ballooning/injury and acute, severe infiltration of mono/polymorphonuclear cells. (150) Thus, in order to interrogate the role of MIF in more severe inflammation, a model of LPS challenge after chronic ethanol feeding was used to better model severe alcoholic steatohepatitis. Ethanol feeding exacerbated chemokine expression, as well as expression of molecules regulating leukocyte trafficking, in response to challenge with LPS in wild-type mice. However, these responses were attenuated in MIF-/- mice did, suggesting 89

91 that MIF is required to recruit leukocytes to the liver in response to a stimulus with LPS. Enhanced expression of chemokines and cell adhesion molecules after chronic ethanol feeding and LPS challenge was associated with increased mononuclear cell infiltration in a diffuse distribution and lobular inflammation in clusters in wild-type mice. These responses were decreased, but not completely ameliorated, in MIF-/- mice. These data parallel a previous report that demonstrated leukocyte rolling and adhesion to TNFα-stimulated endothelial cells is decreased in the absence of MIF. (151) Here, we provide evidence that MIF is essential for ethanol-induced liver injury progression; MIF contributes to hepatic injury in response to ethanol consumption at multiple stages in the pathophysiology of ALD and ASH. The primary role of MIF is associated with maintenance of resident hepatic macrophages, regulation of expression of pro-inflammatory and chemotactic mediators and recruitment of peripheral monocytes. In summary, these results indicate that MIF contributes to the pathophysiology of ethanol-induced liver injury in mice and suggest that inhibition of MIF activity with small molecule inhibitors of MIF, such as ISO-1 (152), may be an important therapeutic approach to the treatment of ALD. Importantly, polymorphisms in the promoter of the MIF gene, notably -173 G/C and the numbers of CAAT repeats, are associated with increased expression of MIF and are associated with increased risk for numerous inflammatory conditions, including arthritis and ulcerative colitis. (153) MIF is known to be induced by glucocorticoids, as well as act as a negative regulator to 90

92 glucocorticoid mediated responses, working to maintain normal immune function despite increases in anti-inflammatory signals. Therefore, it will also be important to consider whether polymorphisms in the MIF promoter constitute a genetic susceptibility to the development of ALD and/or resistance to glucocorticoid therapies in severe, acute alcoholic steatohepatitis. 91

93 CHAPTER 4 Macrophage migration inhibitory factor is required for recruitment of Scarassociated macrophages and Matrix metalloproteinase 13 activity during carbon tetrachloride induced-liver fibrosis Introduction Wound healing is a naturally occurring physiological response. However, when this process goes unchecked fibrosis can occur. In the context of the liver, chronic or repeated injury can lead to liver fibrosis, characterized by excessive deposition of extracellular matrix (ECM). Insults to liver include chronic alcohol abuse, hepatitis B or C infection, non-alcoholic steatohepatitis, as well as genetic factors and hepatotoxins. (18) Excessive deposition of ECM can eventually lead to fibrotic scar formation. (154, 155) Accumulation of ECM is dependent both on synthesis, primarily via activated hepatic stellate cells, and degradation/remodeling via matrix metalloproteinases (MMPs). Hepatic stellate cells (HSC), which are located in the space of Disse, are the major cellular source of ECM during liver fibrosis. In the healthy liver, HSCs act as a storage compartment for Vitamin A (60) and contribute to homeostatic maintenance of ECM (22). However, during fibrosis HSCs become activated, acquiring migratory and pro-fibrogenic properties. Upon activation, HSCs increase expression of contractile proteins, including α smooth muscle actin 92

94 (αsma), to migrate toward areas of injury and deposit ECM proteins, such as type I collagen. Activation of pro-fibrogenic characteristics by HSCs is achieved, in part, by recognition and signaling of profibrotic mediators such as plateletderived growth factor (PDGF) and transforming growth factor β (TGF-β). (66, 156) Apoptotic hepatocytes can directly activate HSCs, causing them to shift toward a myofibroblast phenotype. (157) Activity of MMPs is regulated by tissue inhibitor of metalloproteinases (TIMPs), and both MMPs and TIMPs can be produced by HSCs. After damage to the hepatocytes, progression of fibrosis is dependent upon interactions between non-parenchymal cells, including hepatic stellate cells, liver resident leukocytes and infiltrating leukocytes. (49, 61) Leukocytes can promote progression or resolution of fibrosis, depending on their specific phenotype. Both myeloid (neutrophils (158) and macrophages (159)) and lymphoid cells (natural killer (NK) and NK T cells (88), as well as T cells (95)) can interact with HSCs. For example, numerous recent reports indicate macrophages play a complex role during fibrosis, as they are involved in both progression and resolution of liver fibrosis. (56, 57, 160) Scar-associated macrophages (SAMs) can adopt either an inflammatory or tissue restorative phenotype. Early in the response to fibrosis, inflammatory SAMs are recruited from the periphery and contribute to the progression of fibrosis by producing proinflammatory cytokines and promoting stellate cell activation. Subsequently, recruited inflammatory macrophages adopt 93

95 a restorative SAM phenotype, and promote fibrosis resolution by secreting MMPs, which are critical for fibrotic matrix remodeling and degradation. (57) On another hand, NK cells can produce interferon gamma (IFN-γ) which can cause HSC apoptosis (161), while NKT cells can promote HSC apoptosis via IFN-γ or promote HSC activation via IL-4 and IL-13. (88, 162) While it is clear that peripheral macrophages are critical to the progression and resolution of fibrosis, little is known of the chemotactic controls elicited during the hepatic response to injury. In the current study, we investigated the role of macrophage migration inhibitory factor (MIF) in the progression of carbon tetrachloride (CCl 4 )-induced liver fibrosis in mice. MIF is a constitutively expressed protein produced in many cell types including hepatocytes and hepatic non-parenchymal cells. MIF is associated with pathology of multiple liver diseases including viral hepatitis, non-alcoholic and alcoholic liver disease, cirrhosis, and hepatocellular carcinoma. (4, 121, 139, 163, 164) Because MIF is an important regulator of immune responses, including hepatic leukocyte infiltration (164), we hypothesized that MIF would be important for recruiting inflammatory SAMs during the progression of CCl 4 -induced liver fibrosis. Indeed, MIF was necessary for the recruitment of inflammatory macrophages, as MIF-/- mice showed less infiltration of inflammatory 94

96 macrophages. MIF was also necessary for the appearance of restorative SAMs during CCl 4 -induced liver fibrosis. Consequently, wild-type mice exhibited increased MMP13 protein expression and activity during experimental liver fibrosis. Results Acute carbon tetrachloride (CCl 4 ) challenge promotes expression of MIF in liver and plasma in mice Expression of MIF mrna was increased in the liver of wild-type mice after a single dose of CCl 4. Both mrna expression of MIF and its cognate receptor, CD74, in liver peaked between 4 and 8 hours, and resolved by 18 hours (Figure 1A). MIF protein was increased in plasma as early as 2 hours after CCl 4 ; however, the peak of MIF content in the plasma occurred 48 hours after a single CCl 4 injection (Figure 16B). 95

97 Figure 16: Acute challenge with carbon tetrachloride (CCl 4 ) increases MIF expression in liver and plasma. C57BL/6 mice were treated with a single dose of olive oil (vehicle) or CCl 4. (A) After 72 h, expression of MIF and CD74 mrna was measured in liver by qrt-pcr and normalized to 18S (n=4 pair-fed and n=6 for ethanol-fed mice). (B)The relative concentration of MIF in plasma was assessed by Western blot. Values represent means ± SEM, n=4 olive oil and n=3-4 for CCl 4 -treated mice, except for 8hrs, where n=2 for CCl 4 -treated mice. Values with different superscripts are significantly different from each other (P < 0.05). 96

98 Expression of αsma mrna and protein in liver after chronic CCl 4 challenge was lower in MIF-/- compared to wild-type mice αsma, a product of activated hepatic stellate cells, is produced in the liver during fibrosis (22). MIF-/- mice exhibited less αsma induction in liver compared to wildtype mice at 72 hours after the final dose. Expression of αsma mrna was increased in liver of wild-type mice after chronic CCl4, whereas MIF-/- were less susceptible to αsma mrna production (Figure 17A). Consistent with decreased expression of αsma mrna, western blot and immunohistochemical analysis revealed MIF-/- mice produced less αsma protein after chronic CCl 4 compared to wild-type mice (Figure 17B/C). ALT and AST activity in the plasma, indicators of hepatocyte injury, were similarly increased wild-type and MIF-/- mice after chronic CCl 4 administration (Figure 18A). Furthermore, expression of CYP2E1, the enzyme responsible for CCl 4 metabolism(165), was equivalent in wild-type and MIF-/- mice after chronic CCl 4 challenge (Figure 18B). 97

99 Figure 17: αsma expression after chronic CCl 4 exposure is lower in MIF-/- mice compared to C57BL/6. C57BL/6 and MIF-/- mice were exposed to CCl 4 two times per week for 5 weeks. (A) Expression of αsma mrna was measured in the liver by qrt-pcr and normalized to 18S. (B/C) Immunoreaction αsma protein was assessed in liver by (B) immunoblot and (C) immunohistochemistry on paraffin-embedded liver section. Images were acquired using 10x objective and are representative of at least 2 images per mouse liver. Values represent means ± SEM, n= 4 for olive oil and n=7 for CCl 4 -treated mice. Values with different superscripts are significantly different from each other (P < 0.05). 98

100 Figure 18: Chronic CCl 4 administration increases ALT and AST activity in the plasma of wild-type and MIF-/- mice, but does not increase expression of CYP2E1 protein. (A) Plasma ALT and AST levels were measured enzymatically. (B) CYP2E1 protein levels were visualized by immunoblot and semi-quantified by densitometry. Values represent means ± SEM, n= 4 for olive oil and n=7 for CCl 4 -treated mice. Values with different superscripts are significantly different from each other (P < 0.05). 99

101 Accumulation of ECM was equal in wild-type and MIF-/- mice in response to chronic CCl 4 exposure Fibrillar collagens, such as collagen 1, becomes the predominate forms of collagen produced in the liver during fibrosis. (22, 61) After chronic CCl 4 challenge, expression of Collagen 1α1 mrna is increased in liver of wild-type mice; however, MIF-/- mice had reduced Collagen 1α1 mrna production after chronic CCl 4 (Figure 19B). Interestingly, expression of type 1 collagen protein was comparable in livers of both wild-type and MIF-/- mice (Figure 19A). Sirius red stains multiple types of collagen and serves as an indicator of hepatic fibrosis. Morphometric analysis of Sirius red revealed equivalent positive staining area in livers of wild-type and MIF-/- mice after chronic CCl 4 challenge (Figure 19B). Additionally, total liver hydroxyproline, a non-traditional amino acid that is incorporated into collagen, was increased to similar levels in both wild-type and MIF-/- mice after chronic CCl 4, thus further indicating that the degree of fibrosis was equivalent in wild-type and MIF-/- mice. 100

102 Figure 19: Hepatic fibrosis C57BL/6 and MIF-/- mice exhibit similar extracellular matrix deposition and liver injury after chronic CCl 4 challenge. (A/B) Extracellular matrix deposition was visualized by (A) Sirius red or (B) anti- Collagen 1 staining in paraffin embedded or OCT-frozen liver sections. (C) Collagen 1α1 mrna expression was measured in liver by qrt-pcr. (D) Liver hydroxyproline content was assessed by a colorimetric assay. Images were acquired using 4x (SR) and 10x (Collagen 1) objective and are representative of at least 2 images per mouse liver. Values represent means ± SEM, n= 4 for olive oil and n=7 for CCl 4 -treated mice. Values with different superscripts are significantly different from each other (P < 0.05). 101

103 MIF is required for recruitment of Scar-associated macrophages Since Collagen 1α1 mrna was increased in wild-type mice but not MIF-/- mice, yet both genotypes exhibited similar expression of collagen 1 protein, as well as other markers of hepatic fibrosis, we hypothesized that extracellular matrix degradation was decreased in MIF-/- mice compared to wild-type. Scarassociated macrophages are an important source for MMPs (56), so we first characterized MIF s role in the recruitment of SAMs during CCl 4 -induced liver fibrosis. Infiltration of leukocytes (CD45 + ), as well as neutrophils (Ly6G + ) and inflammatory macrophages (CD11b +, Ly6G -, Ly6C hi ), into liver of wild-type mice peaked at 24 hours and gradually decreased toward baseline by 72 hours after the last challenge with CCl 4. Leukocyte infiltration was lower in MIF-/- mice at 24 and 48 hours; however, by 72 hours, leukocytes numbers were similar to those observed in wild-type mice (Figure 20A/B). In contrast, restorative macrophages (CD11b +, Ly6G -, Ly6C lo ) increased from 24 to 72 hours after chronic CCl 4 (Figure 20A/B). Compared to wild-type mice, the number of restorative macrophages was lower in MIF-/- mice at 24 and 48 hours, but not 72 hours, after CCl 4 challenge (Figure 20B). 102

104 Figure 20: Temporal infiltration of leukocytes after chronic CCl 4 challenge in C57BL/6 and MIF-/- mice. Hepatic leukocyte infiltration was examined 24, 48 and 72hrs after the final dose during chronic CCl 4 challenge in C57BL/6 and MIF- /- mice. (A) The dynamics of scar associated macrophage (CD11b +, Ly6C hi/lo ) recruitment were characterized in isolated liver non-parenchymal cells via flow cytometry. (B) Total hepatic leukocytes (CD45 + ), neutrophils (CD11b +, Ly6G + ), inflammatory (CD11b +, Ly6C hi ) and restorative macrophages (CD11b +, Ly6C lo ) were quantified in isolated liver non-parenchymal cells. Values represent means ± SEM, n= 4 for olive oil and CCl 4 -treated mice at each time point. Values with different superscripts are significantly different from each other (P < 0.05). 103

105 MIF is required for MMP13 enzymatic activity after chronic CCl 4 -induced liver fibrosis One mechanism for the equal accumulation of ECM protein in MIF-/- mice compared to wild-type, despite their lower expression of αsma and collagen 1 mrna, could be a lower expression of MMPs, enzymes critical to the remodeling and degradation of ECM proteins. Reduced numbers of restorative macrophages, carriers of MMPs to fibrotic septa, in MIF-/- mice is consistent with this hypothesis. Expression of MMP2 and MMP8, but not MMP9, mrna was increased in liver of wild-type and MIF-/- mice 72 hours after chronic CCl4 challenge (Figure 21A). In contrast, MMP13 mrna was increased in liver of wildtype, but not MIF-/- mice after chronic CCl 4. Furthermore, there were no differences in expression of mrna of tissue inhibitors of metalloproteinases (TIMPS) in liver of wild-type and MIF-/- mice after chronic CCl 4 administration (Figure 21A). Consistent with the contribution of genotype in the expression of MMP9 and MMP13 mrna, immunoreactive MMP13, but not MMP9, was increased in wildtype, but not MIF-/-, mice after chronic CCl 4 (Figure 21B). MMP13 enzymatic activity was assessed by collagen gel zymography in liver of wild-type and MIF-/- mice after CCl 4 challenge. Activity of pro and active MMP13 was increased in wild-type after CCl 4 -induced liver fibrosis; MMP13 activity was lower in MIF-/- mice compared to wild-type after CCl 4 challenge (Figure 21C). 104

106 105

107 Figure 21: Analysis of matrix metalloproteinase protein (MMP) expression and enzymatic activity after Chronic CCl 4 challenge to C57BL/6 and MIF-/- mice. (A) Expression of MMP2, MMP8, MMP9, MMP13, TIMP1, TIMP2 and TIMP3 mrna were quantified in liver by qrt-pcr. (B) Expression of MMP9 and MMP13 protein was measured by immunblot and semi-quantified by densitometry. (C) MMP enzymatic activity was assessed by collagen zymography and areas of clearance was semi-quantified by densitometry. Values represent means ± SEM, n= 4 for olive oil and n= 7 for CCl4-treated mice. Values with different superscripts are significantly different from each other (P < 0.05). 106

108 Discussion Scar-associated macrophages are essential for fibrosis resolution. SAMs are recruited to the liver during hepatic fibrosis. Initially, these macrophages exhibit a pro-inflammatory phenotype, producing factors, such as TGFβ and PDGF, which contribute to fibrosis. (166) However, once the resolution phase begins, macrophages exhibit a tissue restorative phenotype. Ramachandran et al. have shown this phenotypic switch occurs in peripherally recruited inflammatory SAMs, rather than Kupffer cells, upon encountering cellular debris in the liver. (57) Here we provide evidence that MIF is required for recruitment of SAMs, and subsequent MMP13 activity in liver during experimental hepatic fibrosis (summarized in Figure 22). 107

109 Figure 22: Proposed role for MIF and restorative SAMs during CCl 4 -induced liver fibrosis. CCl 4 is activated in hepatocytes, leading to cell death. After, expression is increased, inflammatory SAMs are recruited to liver, and HSCs become activated. Activated HSCs produce excessive ECM, which accumulates and leads to scar formation. Inflammatory SAMs engulf cellular debris and switch their phenotype to restorative SAMs. Restorative SAMs produce MMPs that degrade ECM, leading to resolution of fibrosis. 108