supplementary information

Size: px

Start display at page:

Download "supplementary information"

Lindsey Porter
5 years ago
Views:

DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3.

1 DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8. IB: Hsp7 Cereellum Thymus Cererum Hert Lung Liver Spleen Kiney Smll intestine Skeletl musle Testis Cereellum Thymus Cererum Hert Lung Liver Spleen Kiney Smll intestine Skeletl musle Testis e Norml neuron Neuro f Norml heptoyte Hep Reltive mrna mount 5 3 Reltive mrna mount 8 CHD8L CHD8L Figure S CHD8 hs two spliing isoforms. () Orgniztion of the mouse Ch8 gene. The region enompssing exons 8 to (re ox) n ontining the lterntive spliing site in exon 9 is expne in the lower sheme. () Domin struture of proteins enoe y the two lterntive trnsripts of Ch8. () Immunolot nlysis of lystes (8 µg of protein) of the inite ell lines with ntichd8 n ntihsp7 (loing ontrol). The positions of CHD8 L (L) n (S) re inite. () Determintion of the mounts of n CHD8 L mrnas in mouse tissues y quntittive RTPCR nlysis. Dt re expresse reltive to the orresponing mount of glyerlehye3phosphte ehyrogense (GAPDH) mrna n re mens ± SD from three inepenent experiments. (e, f) Expression of Ch8 in mouse ner ell lines n orresponing norml ells. The mounts of n CHD8 L mrnas in Neuro neurolstom ells n norml neurons (e) s well s in Hep heptom ells n norml heptoytes (f) were etermine y quntittive RTPCR nlysis. Dt re mens ± SD from three inepenent experiments. 9 Mmilln Pulishers Limite. All rights reserve.

No tretment Etoposie Etoposie: () (+) Vetor IB: Cleve spse3 IB: PARP Vetor Vetor kd 9 5 5 IB:

8 3..8 5. 3 3 87. 9. 5.8.8 3 3 FITCAnnexin V fluoresene e Cell eth (%) 5 3 Control shrna +L

Figure S Inhiition of spseepenent poptosis y CHD8.

not) to etoposie n then stine with Hoehst 3358 for exmintion of nuler morphology y fluoresene

() NIH 3T3 ells trete s in () were lyse n sujete to immunolot nlysis with ntioies to leve spse3,

() HeL ells were infete with retrovirl vetors for +L or EGFP (ontrol) shrnas for 9 h n then

UTPiotin nik enleling (TUNEL) ssy, or stine with Hoehst 3358.

Sle rs, µm (top pnels) or µm (mile n ottom pnels).

propiium ioie (PI) n then nlyze y flow ytometry.

inute in the sene or presene of 5 µm ZVADfmk (Peptie Institute) for h.

2 No tretment Etoposie Etoposie: () (+) Vetor IB: Cleve spse3 IB: PARP Vetor Vetor kd IB: αtuulin 9 Control shrna +L shrna Control shrna +L shrna Hoehst TUNEL Phse ontrst PI fluoresene FITCAnnexin V fluoresene e Cell eth (%) 5 3 Control shrna +L shrna f Cell numer ( 5 ) 5 5 Control shrna +L shrna CHD8 L shrna ZVAD () ZVAD (+) 8 7 Time (h) Figure S Inhiition of spseepenent poptosis y CHD8. () NIH 3T3 ells stly infete with retrovirl vetor for or with the empty vetor were expose (or not) to etoposie n then stine with Hoehst 3358 for exmintion of nuler morphology y fluoresene mirosopy. Arrows inite poptoti ells with onense or frgmente nulei. Sle r, µm. () NIH 3T3 ells trete s in () were lyse n sujete to immunolot nlysis with ntioies to leve spse3, to PARP, or to αtuulin (loing ontrol). () HeL ells were infete with retrovirl vetors for +L or EGFP (ontrol) shrnas for 9 h n then either exmine y phseontrst mirosopy, sujete to the terminl eoxynuleotiyl trnsferse meite UTPiotin nik enleling (TUNEL) ssy, or stine with Hoehst Arrows inite poptoti ells with onense or frgmente nulei. Sle rs, µm (top pnels) or µm (mile n ottom pnels). () HeL ells infete s in () were stine with fluoresein isothioynte (FITC) lele Annexin V n propiium ioie (PI) n then nlyze y flow ytometry. (e) HeL ells were infete with retrovirl vetors for +L or EGFP (ontrol) shrnas for 8 h n then inute in the sene or presene of 5 µm ZVADfmk (Peptie Institute) for h. The perentge of e ells ws etermine y stining with trypn lue. Dt re mens ± SD from three inepenent experiments. (f) HeL ells (.5 5 ) infete with retrovirl vetors for +L, CHD8 L, or EGFP (ontrol) shrnas were ollete fter h n plte in mm ulture ishes. Cell numer ws etermine with hemoytometer fter the inite times. Dt re mens ± SD of triplite ultures from representtive experiment. 9 Mmilln Pulishers Limite. All rights reserve.

7 Vetor CHD8 L Control +L +L shrna CHD8 L CHD8 L kd 5 Cell eth (%) 3 CHD8 L 5 Vetor p53 Hsp7 HeL UOS HCT Cell eth (%) 5 3 Control +L +L

mount 5 3 No tretment No tretment Figure S3 Both n CHD8 L inhiit p53 funtion.

The perentge of e ells ws then etermine y trypn lue stining. Dt re mens ± SD from three inepenent experiments.

After 9 h, the ells were sujete to immunolot nlysis with ntichd8 or nti Hsp7.

etermintion of the perentge of e ells. Dt re mens ± SD from three inepenent experiments.

Sle r, µm. (e) HEK93T ells expressing AGtgge or CHD8 L were inute with µm MG3 for 8 h n then sujete to immunopreipittion with ntiag.

3 7 Vetor CHD8 L Control +L +L shrna CHD8 L CHD8 L kd 5 Cell eth (%) 3 CHD8 L 5 Vetor p53 Hsp7 HeL UOS HCT Cell eth (%) 5 3 Control +L +L CHD8 L CHD8 L +L shrna Control shrna e f AG: AGCHD8 L: kd + + p53 Vetor CHD8 L p Nox IB: AG 8 5 L S Reltive mrna mount 8 Reltive mrna mount 5 3 No tretment No tretment Figure S3 Both n CHD8 L inhiit p53 funtion. () UOS ells were infete with retrovirl vetors for CHD8 L or p53 (or with the empty vetor) for 7 h. The perentge of e ells ws then etermine y trypn lue stining. Dt re mens ± SD from three inepenent experiments. () HeL ells were infete with retrovirl vetors enoing +L, +L, CHD8 L, CHD8 L, or EGFP (ontrol) shrnas. After 9 h, the ells were sujete to immunolot nlysis with ntichd8 or nti Hsp7. () HeL ells infete with retrovirl vetors enoing CHD8 or EGFP (ontrol) shrnas were ollete fter 7 h n stine with trypn lue for etermintion of the perentge of e ells. Dt re mens ± SD from three inepenent experiments. () HeL, UOS, n HCT ells were infete with retrovirl vetors for +L or EGFP (ontrol) shrnas for 7 h n then exmine y phseontrst mirosopy. Sle r, µm. (e) HEK93T ells expressing AGtgge or CHD8 L were inute with µm MG3 for 8 h n then sujete to immunopreipittion with ntiag. The resulting preipittes were sujete to immunolot nlysis with ntip53 or ntiag. (f) UOS ells infete with retroviruses enoing or CHD8 L or with the empty vetor were inute in the sene or presene of etoposie () or oxoruiin () for h n then sujete to quntittive RTPCR nlysis of p n Nox mrnas. Dt re mens ± SD from three inepenent experiments Mmilln Pulishers Limite. All rights reserve.

4 p53bd NLS HHBD 5 Chromoomin 75 p53 ining Nuler loliztion p53 9 Nterminl Centrl ore Cterminl Δ(989) 75 Δ(783) Δ(83) HAp53: AG: kd Δ(989) Δ(989) 9 9 AG: kd Δ(783) Δ(83) Δ(783) Δ(83) IB: HA 37 Δ(989) 989 p53 IB: AG 5 5 IB: AG 9 Δ(783) 75 Δ(83) p53bd NLS HHBD Chromoomin HH ining 5 75 kd Vetor 3AGHH 3AGHH 3AGHH 3AGHH 3AGHHe 75 Δ() 7 IB: CHD8 5 IB: AG 37 3AG HH Δ() Δ(5) IB: CHD8 5 Δ(5) IB: AG 37 3AG HH His: kd HisAGHH: 8 5 IB: His Δ() Δ() 75 Δ() Δ() + Δ() Δ() 75 HH His: kd HisAGHH: 8 5 IB: His 9 37 Δ() Δ(5) Δ(5) Δ() Δ(5) Δ(5) Δ(5) Δ(5) Δ() HH Figure S Moleulr issetion of p53chd8 histone H intertion. () Ientifition of the region of responsile for ining to p53. HEK93T ells trnsiently expressing the inite AGtgge erivtives were sujete to immunopreipittion with ntiag, n the resulting preipittes (s well s 3% of the input ell lystes) were sujete to immunolot nlysis with ntip53 or ntiag (lower pnel). The results for p53 ining n nuler loliztion [etermine y immunofluoresene nlysis (t not shown)] re summrize together with shemti representtions of the erivtives teste (upper pnel). p53bd, p53 ining omin; NLS, nuler loliztion signl; HHBD, histone H ining omin;, fulllength. () Ientifition of the region of p53 responsile for ining to. HEK93T ells expressing the inite HAtgge p53 erivtives n AGtgge were sujete to immunopreipittion with ntiag, n the resulting preipittes (s well s 3% of the input ell lystes) were sujete to immunolot nlysis with ntiha or nti AG. () All five mjor vrints of histone H intert with CHD8 in vivo. HEK93T ells expressing mouse histones H, H, H, H, or He tgge with three opies of the AG epitope, or those trnsfete with the empty vetor, were lyse n sujete to immunopreipittion with nti AG. The resulting preipittes, s well s 3% of the originl ell lystes (input), were sujete to immunolot nlysis with ntichd8 or ntiag. () Ientifition of the region of responsile for ining to histone H. Reominnt His tgge erivtives n His n AGtgge histone H (HH) were mixe n sujete to immunopreipittion with ntiag, n the resulting preipittes s well s % of the originl ining mixtures (input) were sujete to immunolot nlysis with ntihis (right pnels). The results of the ining ssy re summrize together with shemti representtions of the erivtives (left pnel). 9 Mmilln Pulishers Limite. All rights reserve.

5 NIH 3T3 ells Vetor HeL ells Vetor kd kd IB: CHD8 5 IB: CHD8 5 IB: Hsp9 IB: Hsp9 UOS ells Vetor Wiltype p Mutnt p IB: CHD8 kd 5 Reltive luiferse tivity 5 3 IB: Hsp9 p53 (μg):.5 (μg):.5.5 Δ53 (μg):.5.5 e IP: CHD8 kd IB: CHD8 5 IB: AG 5 IB: CHD8 5 Vetor AG AGΔ53 AG AGΔ53 AG AGΔ53 AG AGΔ53 AG f Reltive luiferse tivity 5 3 TRAF (μg): (μg): p53 (μg): CYLD (μg): NFκB IB: AG 5 AGΔ53 Figure S5 CHD8 is speifi inhiitor of p53epenent trnstivtion. ( ) Aunne of p53 n CHD8 in ells overexpressing CHD8 n sujete to genotoxi stress. NIH 3T3 (), HeL (), or UOS () ells infete with retrovirus for or with the empty vetor were inute in the sene ( ) or presene of etoposie () or oxoruiin () for h. The ells were then sujete to immunolot nlysis with ntip53, ntichd8, or ntihsp9. () SOS ells were trnsfete with the inite mounts of expression vetors for p53 n either wiltype or mutnt ( 53) together with luiferse reporter plsmi ontining wiltype or mutnt forms of the p promoter, the ltter of whih hrore muttions in p53re n p53re. The ells were then inute for h efore ssy of reltive luiferse tivity. Dt re mens ± SD of triplites from representtive experiment. (e) HEK93T ells trnsiently expressing AGtgge wiltype or mutnt ( 53) were sujete to immunopreipittion with ntichd8. The resulting preipittes, s well s 3% of the originl ell lystes (input), were sujete to immunolot nlysis with ntichd8 or ntiag. (f) HEK93T ells were trnsfete with the inite mounts of expression vetors for TRAF,, p53, n CYLD together with luiferse reporter plsmi ontining three ining sites for NFκB. The ells were then inute for h efore ssy of reltive luiferse tivity. TRAF expression inrese the luiferse tivity erive from this onstrut, ut this effet of TRAF ws not inhiite y overexpression of or p53. In ontrst, CYLD, euiquitinting enzyme tht is negtive regultor of the NFκB signling pthwy, mrkely inhiite the TRAF effet. Dt re mens ± SD of triplites from representtive experiment Mmilln Pulishers Limite. All rights reserve.

6 Norml IgG CHD8 HH p53 (%) IP 5.5 AntiCHD8 Norml IgG IB: CHD8 (%) IP Norml IgG AntiHH IB: HH (%) IP Antip53 Norml IgG Figure S Antioy speifiity n immunopreipittion effiieny for ChIP. () UOS ells infete with retrovirl vetor enoing were inute with etoposie for h, lyse, n sujete to ChIP with nti CHD8, nti histone H, or ntip53 or with ontrol IgG. The preipitte DNA (s well s % of the input ell lystes) ws sujete to PCR nlysis with primers speifi for p53re of the p promoter. ( ) UOS ells trete s in () were sujete to ChIP with ntichd8 (), nti histone H (), or ntip53 (). The resulting preipittes s well s the inite perentges of the originl ell lystes (input) were sujete to immunolot nlysis with the orresponing ntioies. By ompring the mounts of input n immunopreipitte proteins, we etermine the ChIP effiieny to e ~5% for CHD8 (),.% for histone H (), n 5% for p53 (). 9 Mmilln Pulishers Limite. All rights reserve.

IB: HA IB: HH IB: p IB: Hsp9 Vetor Nfusion Cfusion kd 37 Cfusion Nfusion Vetor Vetor Nfusion Cfusion Cell numer ( ) 5 3 3 5 Time (y) Figure S7

() NIH 3T3 ells were infete with retrovirl vetors enoing histone H tgge t its NH terminus (Nfusion) or COOHterminus (Cfusion) with EGFP (or with

histone H, ntip, or ntihsp9 (loing ontrol). () NIH 3T3 ells infete s in () were exmine y phseontrst mirosopy. Sle r, µm. () NIH 3T3 ells (.

7 IB: HA IB: HH IB: p IB: Hsp9 Vetor Nfusion Cfusion kd 37 Cfusion Nfusion Vetor Vetor Nfusion Cfusion Cell numer ( ) Time (y) Figure S7 Effets of expression of histone H mutnts. () NIH 3T3 ells were infete with retrovirl vetors enoing histone H tgge t its NH terminus (Nfusion) or COOHterminus (Cfusion) with EGFP (or with the empty vetor) for 9 h n were then sujete to immunolot nlysis with ntiha (oth fusion proteins were lso tgge t their NH termini with HA), nti histone H, ntip, or ntihsp9 (loing ontrol). () NIH 3T3 ells infete s in () were exmine y phseontrst mirosopy. Sle r, µm. () NIH 3T3 ells (.5 5 ) infete s in () were ollete fter h n plte in mm ulture ishes. Cell numer ws etermine with hemoytometer fter the inite times. Dt re mens ± SD of triplite ultures from representtive experiment Mmilln Pulishers Limite. All rights reserve.

8 f e Figure S8 Full sns of key immunolots in the inite figures Mmilln Pulishers Limite. All rights reserve.

9 Tle S. Ientifition of CHD8ssoite proteins y proteomis nlysis. Gene symol Protein nme Sequene overge (%) HISTHE/HISTHC/HISTHD Histone ; He or H or H 3.5 KPNA Kryopherin lph (RAG ohort,.3 importin lph ) KPNA Kryopherin lph (importin lph 5) 8. KPNA3 Kryopherin lph 3 (importin lph ). KPNB Kryopherin (importin) et. KPNA Kryopherin lph (importin lph 3).7 HEK93T ells trnsiently expressing AGtgge were sujete to immunopreipittion with ntiag, n the resulting preipittes were sujete to LC MS/MS nlysis. Proteins reprouily etete in four inepenent experiments re liste. The perentge sequene overge for eh protein is lso shown. 9 Mmilln Pulishers Limite. All rights reserve.

10 Tle S. Genotype of emryos from Ch8 +/ p53 +/ mouse interrosses. E7.5 p53 +/+ p53 +/ p53 / Totl Ch8 +/+ 9 3 Ch8 +/ 7 5 Ch8 / 5 3 Totl E8.5 p53 +/+ p53 +/ p53 / Totl Ch8 +/+ 7 3 Ch8 +/ 9 Ch8 / Totl E9.5 p53 +/+ p53 +/ p53 / Totl Ch8 +/ Ch8 +/ 3 5 Ch8 / 8 Totl Emryos from Ch8 +/ p53 +/ mouse interrosses were issete from uteri etween E7.5 n E9.5 n genotype y PCR. 9 Mmilln Pulishers Limite. All rights reserve.

11 Tle S3. Primer sequenes (5 3 ) for neste PCR, RTPCR, n ChIP nlyses. Gene (primer) Forwr primer Reverse primer Neste PCR mp53 (Mutntst) GTGTTCCGGCTGTCAGCGCA AGCGTCTCACGACCTCCGTC mp53 (Wil typest) ACACACCTGTAGCTCCAGCAC AGCGTCTCACGACCTCCGTC mp53 (Mutntn) CCCGGTTCTTTTTGTCAAGAC ATGTGCTGTGACTTCTTGTAG mp53 (Wil typen) TGGGGAGGCCAAAGTGGGAGG ATGTGCTGTGACTTCTTGTAG mch8 (Mutntst) TGCTAAAGCGCATGCTCCAGACTG AACTCCGTAACCATTTGTCTATTC mch8 (Wil typest) TATAGATTTCCTGTTTGATTTTCC AACTCCGTAACCATTTGTCTATTC mch8 (Mutntn) ATGCTCCAGACTGCCTTGGGAAAA GAAACAATGTAAAACAGGCAAATG mch8 (Wil typen) AAAGAATCACACTAGATCTAATCC GAAACAATGTAAAACAGGCAAATG RTPCR mch8 S CAGATGAGACACTTCTTTCATGAA TTCTCCGCGCCCAACTCAC mch8 L CAGATGAGACACTTCTTTCATGAA TTTTACCAGGTAGTAAATTACAGG mp TGTCTTGCACTCTGGTGTCTGAGC TCTTGCAGAAGACCAATCTGCG hp CTGAGACTCTCAGGGTCGAA CGGCGTTTGGAGTGGTAGAA mnox ACTCAGGAAGATCGGAGACAAAGTG ACACTCGTCCTTCAAGTCTGCTGG hnoxa AGAGCTGGAAGTCGAGTGT GCACCTTCACATTCCTCTC mgph GCCTGGAGAAACCTGCCAAGTATG GAGTGGGAGTTGCTGTTGAAGTCG hgapdh GCAAATTCCATGGCACCGT TCGCCCCACTTGATTTTGG ChIP hp (p53re) CAGGCTGTGGCTCTGATTGG TTCAGAGTAACAGGCTAAGG hp (p53re) GGTCTGCTACTGTGTCCTCC CATCTGAACAGAAATCCCAC hp (CR) GGTGCTTCTGGGAGAGGTGAC TGACCCACTCTGGCAGGCAAG hbax (p53re) TTGGAAGGCTGAGACGGGGTTATC AGAAGTTTCGGGCAGGGTTTGAG hbax (CR) CCTGCTGATCTATCAGCACAG GCTGGTCTCTGAACTCCCAGA hp7 CCGCCGCCGCAACCAATGGAT GGAGTCGCAGAGCCGTGAGCA Mouse n humn genes re inite y m n h, respetively. 3 9 Mmilln Pulishers Limite. All rights reserve.

Cos7 (3TP) (K): TGFβ1(h): (K)

Cos7 (3TP) (K): TGFβ1(h): (K) IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity