THE CHARACTERIZATION OF ADAMTS-12 IN THE REGULATION OF HUMAN TROPHOBLAST INVASION IN VITRO

Transcription

1 THE CHARACTERIZATION OF ADAMTS-12 IN THE REGULATION OF HUMAN TROPHOBLAST INVASION IN VITRO by Junxuan Zou A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (REPRODUCTIVE AND DEVELOPMENTAL SCIENCES) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) October 2010 Junxuan Zou, 2010

2 ABSTRACT The distintegrin-like and metalloproteinase with thrombospondin repeats (ADAMTS) are members of a gene family of secreted, multidomain and multifunctional proteinases that are able to proteolytically degrade a diverse array of cellular, extracellular and extracellular matrix (ECM) substrates. We examined the presence of ADAMTS in first trimester human placenta and only ADAMTS-12 was present in cultures of invasive extravillous cytotrophoblast (EVT) at significantly higher levels than in poorly invasive JEG-3 chorocarcinoma cells. Immunohistochemistry staining of chorionic villi derived from first trimester human placenta demonstrated that ADAMTS-12 was intensively immunolocalized in the cytotrophoblast layer but weakly immunolocalized in the poorly-invasive syncytial trophoblast layer. Gonadotropin-releasing hormone (GnRH)-I and -II increased ADAMTS-12 expression in EVT in time- and concentration-dependent manners, and these two hormones exert functions through different pathways. Loss- or gain-of function studies using sirna and stable transfection strategies demonstrated that the ADAMTS-12 promotes trophoblast invasion. Surprisingly, this function of ADAMTS-12 is independent of its catalytic activity. C-terminal sequential deletions of ADAMTS-12 demonstrated that the disintegrin-like domain plays crucial role in cellular localization of ADAMTS-12. Laminin-5 is a component of the ECM, influencing cell migration and adhesion. The ii

3 disintegrin-like domain and ancillary domains of ADAMTS-12 are associated with increased laminin-5 expression in JEG-3 cells through the activation of the ERK/MAPK signaling pathway. The integrin expression repertoire is also modified by ADAMTS-12. In particular, laminin-5 receptor integrin α6β4 is increased by the exogenous expression of ADAMTS-12 in JEG-3 cells. Together, these data support a novel hypothesis that ADAMTS-12 plays a non-redundant role in human trophoblastic cell invasion, which is independent of its catalytic activity but dependent on the disintegrin-like domain and ancillary domains. This role involves alteration of cell-ecm interactions, which leads to a reduction of cell adhesion capability and promotes cell invasion. iii

4 PREFACE C These studies are approved by the Clinical Research Ethic Board. The certificate number is iv

5 TABLE OF CONTENTS ABSTRACT... ii PREFACE... iv TABLE OF CONTENTS... v LIST OF TABLES... viii LIST OF FIGURES... ix ABBREVIATIONS... xi ACKNOWLEDGEMENTS... xiii CHAPTER 1: INTRODUCTION Early human placental development and trophoblast invasion Implantation and early placental development Trophoblast development Control of trophoblast function Pathological pregnancy Models for study of trophoblast invasion Molecular mechanisms underlying trophoblasts invasion Hormones Matrix proteases and their inhibitors Integrins Growth factors, cytokines and inflammatory factors The ADAMTS The ADAMTS domain structure Functions of the ADAMTS proteins Regulation of the ADAMTS expression and activities Characterizations of ADAMTS ADAMTS-12 structure Regulation of ADAMTS-12 expression Function of ADAMTS Roles for ADAMTS-12 in human trophoblastic cell invasion CHAPTER 2: EXPERIMENTAL PROCEDURES Materials Tissues Cell lines v

6 2.1.3 Extravillous trophoblast (EVT) Methods Immunohistochemistry staining Hormone treatments RNA preparation and generation of first-strand cdna Real-time PCR Expression of recombinant human ADAMTS-12 and its C-terminal truncated mutants Expression vector Generation of stably transfected JEG-3 cell lines sirna transfection Immunofluorescence staining Western blot analysis Transwell invasion assay DNA array analysis Statistical analyses CHAPTER 3: RESULTS Distribution and hormone regulation of ADAMTS-12 in first trimester human placenta ADAMTS-12 proteins immunolocalize to the villous cytotrophoblasts and cytotrophoblast columns GnRH I and II regulate ADAMTS-12 mrna and protein levels in EVT Applied bioinformatics to predict transcription factor binding sites in ADAMTS Functional domains of ADAMTS-12 that promote trophoblast invasion ADAMTS-12 promotes human trophoblast invasion through its disintegrin-like domain Disintegrin-like domain plays key role in ADAMTS-12 localization ADAMTS-12 increases laminin-5 expression through the ERK/MAPK signaling pathway DNA array indicates ADAMTS-12 increases laminin β3 subunit expression ADAMTS-12 increases laminin α3 and γ2 subunits mrna levels in JEG-3 cells ADAMTS-12 increases the levels of laminin β3 and γ2 subunits in JEG-3 cells ADAMTS-12 over-expression activates the ERK/MAPK signaling pathway in JEG-3 cells Laminin-5 expression is regulated by ADAMTS-12 activation of the ERK/MAPK signaling pathway ADAMTS-12 modulates integrin expression repertoire CHAPTER 4: DISCUSSION Distribution and function of ADAMTS Regulation of ADAMTS-12 expression Functional domains of ADAMTS-12 that promote trophoblast invasion ADAMTS-12 positively regulates laminin Integrins and ADAMTS vi

7 4.6 Conclusions and future directions REFERENCES vii

8 LIST OF TABLES Table 1.1: Model trophoblast cell lines used for the study of implantation..10 Table 1.2: The known substrates and inhibitors of ADAMTS Table 2.1: Primer sequences for real-time PCR...64 Table 2.2: Primer sequences and PCR conditions 67 Table 3.1: DNA array reveals at least 2-fold regulated genes in JEG-3 cells exogenously expressing ADAMTS Table 3.2: DNA array reveals 2-fold regulated genes in HTR-8/Svneo cells with the silencing of ADAMTS viii

9 LIST OF FIGURES Figure 1.1: Schematic representation of cytotrophoblast differentiation....5 Figure 1.2: Factors involved in the regulation of trophoblast invasion Figure 1.3: Schematic domain structure of ADAMTS..34 Figure 1.4: Domain structure and organization of ADAMTS-7 and ADAMTS Figure 1.5: ADAMTS subtypes present in human placenta and trophoblastic cells. 57 Figure 3.1: Immunolocalization of ADAMTS-12 in chorionic villi derived from human first trimester placenta Figure 3.2: Identification of EVT cells derived from first trimester placenta explants...89 Figure 3.3: Regulatory effects of GnRH-I on ADAMTS-12 mrna and protein expression levels in primary cultures of EVT 91 Figure 3.4: Regulatory effects of GnRH-II on ADAMTS-12 mrna and protein expression levels in primary cultures of EVT 96 Figure 3.5: Prediction of transcription factor binding sites in the ADAMTS-12 promoter. 100 Figure 3.6: Schematic structure of mammalian expression vector, ADAMTS-12 and its C-terminal deletion mutants 104 Figure 3.7: ADAMTS-12 enhancement of JEG-3 cell invasion is dependent on its disintegrin-like domain Figure 3.8: Removal of the disintegrin-like domain results in the release of restrained ix

10 ADAMTS-12 from ECM. 108 Figure 3.9: Immunofluorescence staining demonstrating the cellular localization of ADAMTS Figure 3.10: DNA array reveals ADAMTS-12 increase mrna levels of laminin β Figure 3.11: Laminin α3 and γ2 mrna levels are correlated to ADAMTS-12 expression Figure 3.12: Protein expression of laminin β3 and γ2 are correlated with ADAMTS-12 expression Figure 3.13: ADAMTS -12 positivel y regulates the ERK/MAPK signaling pathway 120 Figure 3.14: Inhibition of ERK/MAPK signaling pathway attenuates ADAMTS-12-induced increase of laminin Figure 3.15: Integrin expression repertoire is altered by ADAMTS-12 in trophoblast cells..122 Figure 4.1: Schematic illustration of the molecular mechanisms of ADAMTS-12 in the regulation of trophoblast invasion x

11 ABBREVIATIONS ADAMTS α2m ART BM ChIP COMP CRD CUB DMEM ECM EDS EGF ER ERK EVT FAK GAG GCM GEP GnRH hcg hpl HRP IGF IGFBP IL IVF JNK KRT LIF MAPK MMP OA PA PE PLAC RER A distintegrin-like and metalloproteinase with thrombospondin repeats α2 macroglobulin Assisted reproduction technologies Basement membrane Chromatin immunoprecipitationassay Cartilage oligomeric matrix protein Cysteine-rich domain Cubilin motif Dulbecco's Modified Eagle's Medium extracellular matrix Ehlers-Danlos syndrome Epidermal growth factor Endoplasmic reticulum Extracellular signal-regulated kinase extravillous cytotrophoblast Focal adhesion kinase Glycosaminoglycan Glial cell missing factor Granulin-epithelin precursor Gonadotropin-releasing hormone Human chorionic gonadotropin Human placental lactogen Horseradish peroxidase Insulin-like ggrowth factor Insulin-like growth factor binding protein Interleukin In vitro fertilization c-jun N-terminal kinase Cytokeratin Leukaemia inhibitory factor Mitogen-activated protein kinases Matrix metalloproteinase Osteoarthritis Plasminogen activator Preeclampsia Protease and lacunin module Rough endoplasmic reticulum xi

12 TFBS TGF TIMP TNF tpa TSP TTP upa UTR VCAM vwf WMS Wnt Transcription factor binding site Transforming growth factor Tissue inhibitor of metalloproteinase Tumor necrosis factor Tissue-type plasminogen activator Thrombospondin type-1 like Thrombotic thrombocytopenic purpura urokinase-type plasminogen activator Untranslated region Vascular adhesion molecule von Willebrand factor Weill-Marchesani syndrome Wingless xii

13 ACKNOWLEDGEMENTS I am grateful for all the support I have received for my study. Thanks especially go to my supervisor, Colin Donald MacCalman, whose supervision and marvelous ideas enable me to win through. I also would like to make a special reference to professors Geoffrey Hammond, Dan Rurak and Elizabeth Conibear, who have read through my thesis draft. Thanks also to Ellen Zhu, who is our lab manager. Without her co-operation I could not have obtained these data. Thanks to Keith Choi, my previous supervisor. Without him I would not been able to move from China to Canada. Lastly, my deepest gratitude goes to my beloved mum, dad and my husband, who have supported me through this challenging period. xiii

14 CHAPTER 1: INTRODUCTION Embryonic trophoblast invasion and interaction with extracellular matrix (ECM) exert key roles in the early development of human placenta to establish and maintain a successful pregnancy. These processes allow trophoblast cells to enter the endometrium and blood vessels for the formation of the maternal-fetal circulation. Alterations in the composition of the ECM are essential to regulate trophoblast invasion. Given that matrix-degrading enzymes are of vital importance for ECM remodeling and cell invasion during both normal and pathological conditions, we sought to determine the roles of a distintegrin-like and metalloproteinase with thrombospondin repeats (ADAMTS), which are members of a metalloproteinase family, in these crucial processes. A better understanding of the mechanisms of ADAMTS modulation during pregnancy may be helpful to prevent and treat the poor pregnancy outcomes. Previously, our laboratory had determined that multiple ADAMTS subtypes were present in first trimester human placenta. Of these, only ADAMTS-12 was present in cultures of invasive extravillous cytotrophoblast (EVT) at significantly higher levels than in poorly invasive JEG-3 chorocarcinoma cells. Loss- or gain-of function studies using sirna and stable transfection strategies demonstrated that this ADAMTS-12 plays a non-redundant role in human trophoblastic cell invasion (Beristain and MacCalman, unpublished). More surprisingly, this pro-invasion function of ADAMTS-12 is independent of its proteolytic activity (Beristain and MacCalman, unpublished). Instead, our novel findings strongly suggest that ADAMTS-12-mediated invasion is dependent upon alterations in the cell-ecm interaction in 1

15 these cells (Beristain and MacCalman, unpublished). The studies described in this dissertation are a logical progression from these findings. The overall objective of these studies was to explore the molecular mechanisms underlying ADAMTS-12-mediated cell invasion, and it can be divided into 3 aims. Aim 1: identifying the factors that regulate ADAMTS-12 expression in first trimester human placenta. Aim 2: determining the functional domain of ADAMTS-12 that promotes trophoblast invasion. Aim 3: clarifying the molecules that are mediated by ADAMTS-12 in trophoblasts. 1.1 Early human placental development and trophoblast invasion Implantation and early placental development Implantation of the human blastocyst and the accompanying trophoblast invasion is considered the determining element for a successful pregnancy [1]. The implantation window refers to the period of maximal uterine receptivity, which occurs 7 days after ovulation (between days 20 and 24 of the menstrual cycle) and continues for less than 48 hours [4, 5]. This process initiates through maturation of the endometrium in response to different modulatory molecules. This transformation is termed decidualization, a process that creates an optimal environment for receiving the blastocyst and successful embryo-fetal development. Importantly, implantation of 2

16 the human blastocyst into a receptive endometrium leads to the development of a functional placenta and the establishment of pregnancy [6]. Human blastocyst implantation and subsequent placental development involves 3 stages including: (1) the apposition of the blastocyst to the endometrial luminal epithelium. At this stage, the blastocyst possesses an inner cell mass and is embraced by the trophectoderm, which is the placental precursor. (2) The attachment of the trophectoderm to the uterine wall, at which point the embryo-uterine contact initiates through adherence of the apical surface of the trophectoderm to the uterine luminal epithelium [7]. Since trophectoderm is the only cell type that is allowed to adhere to the apical surface of epithelium cells, the embryo attachment to the uterine epithelialum is unique in mammalian cell biology [8]. Subsequently, trophoblasts derived from trophectoderm penetrate the uterine epithelium and its basement membrane, contacting the underlying stroma. (3) The invasion of trophoblast, which traverses the uterine decidua and engrafts the maternal blood vessels to form a functional placenta [9-12] Trophoblast development Trophoblast differentiation is likely induced by the process of adhesion [2]. Before the initiation of invasion, the trophectoderm differentiates into two separate trophoblast subsets, the outer syncytiotrophoblast and the inner invasive cytotrophoblast (Figure 1.1). The syncytiotrophoblasts are large, polymorphic, multi-nucleated cells and are responsible for placental nutrient, gaseous exchange and the production and secretion of most placental 3

17 hormones and growth factors [13]. It is formed by the fusion of post-mitotic cytotrophoblasts. Initially, the outer syncytiotrophoblasts extend into the maternal decidua, and thus the blastocyst becomes embedded in the endometrium [14]. Therefore, syncytiotrophoblasts acquire the capacity to extend into the endometrium during implantation. After this period, the syncytiotrophoblasts exert a more defined endocrine function. At the same time, cytotrophoblasts positioned at the tips of the chorionic villi are considered trophoblast stem cells, and undergo extensive proliferation and differentiation to replenish the invasive phenotype. They breach the syncytiotrophoblast and subsequently form cell columns of the anchoring villous that invade into the endometrium and facilitate the attachment of the placenta to the uterine wall during gestation [3]. Trophoblasts located outside this inter-villous space are termed extravillous trophoblasts (EVTs) and acquire a highly invasive phenotype. A subpopulation of the EVT subsequently detaches from the leading edge of the cellular columns of anchoring villous and invades into the decidual matrix, and is defined as interstitial or endovascular EVT. The interstitial EVTs migrate through and invade the decidual stromal compartments and anchor the villi to the decidue, whereas the endovascular EVTs migrate to the maternal uterine spiral arteries where they penetrate the basal lamina. There the trophoblasts remodel and replace the endothelial cell lining of the spiral arteries, degrading the muscle, thereby delivering a sufficient blood flow to the placenta. Thus, by the end of the first trimester of human pregnancy, which is 12 weeks from conception or 14 weeks from first day of the last normal menstrual period, the maternal-placental circulation is well established and all the differentiated subtypes of trophoblasts appear at the maternal-fetal interface. Beyond this time 4

18 Figure 1. 1: Schematic representation of cytotrophoblast differentiation. In the chorionic villi, villous cytotrophoblasts fuse to form syncytiotrophoblasts which cover the outside of chorionic villi, float in maternal blood and perform endocrine, nutrient exchange, and endothelial functions. In a separate pathway, cytotrophoblasts aggregate and form cell columns of anchoring villi, from where EVT migrate and invade into the uterine endometrial compartment. Interstitial EVT scatter among decidual cells and the endovascular EVT continue invading the spiral arteries, and replace the endothelial cells. (Adapted from Guibourdenche et al., 2009, Folia Histochem Cytobiol. 2009:47(5): S35 [15]) 5

19 period, the placenta undergoes spontaneous differentiation and cytotrophoblasts become less prominent since they successively fuse to form syncytiotrophoblast[16]. This fusion process continues until term when cytotrophoblasts cease to proliferate [17] Control of trophoblast function Accurate trophoblast differentiation and invasion are a consequence of cooperative regulation by both the placenta and the uterus. Trophoblast functions are controlled by numerous heterogeneous factors acting through both autocrine and paracrine mechanisms. Differentiation of cytotrophoblast to syncytiotrophoblast or EVT cells is accurately regulated by various signal transduction pathways, and specific gene products which are expressed in response to environmental cues such as changes in O 2 levels, hormones, growth factors, cytokines and adhesion molecules. As trophoblasts invade the uterus, they encounter a higher O 2 level, and this triggers the exit of trophoblasts from the cell cycle and their subsequent differentiation [18, 19]. This involves the altered expression of specific genes, such as Hash-2 and Id-2 that contribute to cytotrophoblast proliferation, and which are down-regulated in differentiated cells [20, 21]. In addition, the glial cell missing factor 1 (GCM1), along with the AP-2 and Sp transcription factor families, induce the fusion of cytotrophoblasts. On the other hand, Hash-2 restrains this process by inhibit the transcription of CYP19/aromatase gene [22]. camp enhances AP-2 activity and subsequently promotes syncytial fusion [23]. Endoglin, a co-factor in transforming growth factor- (TGF-β) receptor binding, helps TGF-β to reduce 6

20 differentiation along the invasive pathway [24], whereas tumor necrosis factor (TNF)-α inhibits the the differentiation towards syncytiotrophoblasts [25]. Canonical Wingless (Wnt) signaling and marinobufagenin, an endogenous inhibitor of Na/K-ATPase, are also known to be key mediators of the invasive phenotype [26, 27]. Cadherins that mediate cell adhesion are also involved. E-cadherin expression is decreased as syncytialization occurs, whereas N-cadherin expression is increased [28], and during this process, transcription factor Twist regulates expression levels of both E-cadherin and N-cadherin (Ng and MacCalman, unpublished). The migration and invasion of EVT is tightly regulated by numerous factors produced by the various cell types within both the trophoblast and endometrial compartments, such as the decidual cells, uterine natural killer cells, macrophages, and cells of the vasculature [29]. Many of these factors act locally in an autocrine/paracrine manner, and they include cell adhesion molecules, cytokines, hormones, growth factors, which are produced in a tightly spatially and temporally regulated manner [30]. In addition, the actual process of invasion of trophoblasts appears to be directed by the expression of matrix metalloproteinases (MMPs) and integrins that interact with the ECM that embraces the trophoblast cell [31, 32]. N-cadherin also participates in trophoblast invasion during early pregnancy (Ng and MacCalman, unpublished). Moreover, the development of the human placenta requires a substantial remodeling of the ECM of the decidual matrix by specific matrix-degrading proteinases and their associated inhibitors [32-35], which will be discussed in greater detail below. 7

21 1.1.4 Pathological pregnancy The fact that only 50-60% of all conceptions survive for more than 20 weeks of gestation illustrates that human reproduction is remarkably inefficient. Frequently, pregnancy losses are caused by problems that occurr during implantation and early placentation. The frequency of spontaneous abortion is high during the critical early stages of pregnancy [36]. Implantation failure is also the major obstacle to assisted reproduction technologies (ART). Failure of the human embryo to implant also accounts for the limited success of ART. For example, 25% of couples experiencing infertility have unexplained infertility whereas during in vitro fertilization (IVF) ~75% of transferred embryos fail to implant. Thus, despite the transfer of healthy appearing embryos to the endometrial cavity following IVF, the majority fail to result in successful pregnancy [37]. A successful gestation relies upon the appropriate proliferation and differentiation of trophoblasts, and dysfunctional trophoblast likely contribute to an implantation failure. In addition, a disorder of trophoblast development can induce complications of varying degrees of severity, such as malformation, fetal growth restriction, spontaneous abortion and miscarriage [38-40]. For example, inadequate EVT invasion and spiral arterial remodeling has been observed in preeclampsia (PE) and fetal growth restriction. Although PE usually sets up in the first trimester [41, 42], it generally affects women in the second or third trimesters [43], when it is characterized by maternal edema, pregnancy induced hypertension, and in more severe forms, such as eclampsia and seizures [44]. Conversely, excessive EVTs invasion can be associated with 8

22 an invasive mole, placenta accreta and choriocarcinoma [43]. The consequences of both excessive and inadequate EVTs invasion pose risks to both mother and conceptus. Thus, the balance between factors that regulate blastocyst implantation and subsequent EVTs invasion are key determinants of a successful pregnancy Models for study of trophoblast invasion Human trophoblast cell lines Implantation of the human trophoblast into the maternal endometrium cannot be studied in vivo. Researchers must seek help from cell lines for the study of human embryo implantation. There are a large number of available trophoblast cell lines [45] that have been derived from various of sources, including malignant tissue, normal placenta, and embryonic carcinomas [46]. The cell lines frequently used are summarized in table 1.1. Most trophoblast cell lines are generated from placental choriocarcinomas [29]. Each cell line has a distinct phenotype, and may be useful for some parameters or responses but inappropriate for others. Making the appropriate choice from numerous potential cell lines for a particular study is therefore an important consideration. Trophoblast cells are epithelial in nature, and cytokeratin (KRT) 7 is highly expressed by the trophoblast in vivo but not in any other cells in the placental villous or maternal deciduas, except for the uterine glandular epithelium [47]. KRT7 is therefore accepted as the most useful biomarker of trophoblast cells, and is widely used to confirm the identity of trophoblasts during 9

23 Table 1. 1: Model trophoblast cell lines used for the study of implantation Syncytialization Trophoblast migration/adhesion Trophoblast invasion BeWo HTR-8/SVneo JEG-3 AC1M-88 HTR-8/SVneo JAR BeWo the purification of primary trophoblast cells from first-trimester placenta [48-50] Transformed choriocarcinoma cell lines Trophoblastic cell lines established from choriocarcinoma cells have been widely used to investigate the cell biology of human trophoblast differentiation in vitro [46]. Choriocarcinoma is a malignant neoplasm derived from trophoblastic cells, which is characterized by aggressive proliferation and lack of production of chorionic villi. Several choriocarcinoma cell lines have been established that exhibit a varying degree of differentiation in culture. JEG-3, established from choriocarcinoma explant cultures of choriocarcinoma cells, are mononucleate trophoblastic cells [51]. Although an increase in camp levels is required to promote the production of hcg in these cultures, these cells do not undergo fusion to form a 10

24 multinucleated syncytium under these culture conditions [52, 53]. Thus, JEG-3 cells have been accepted as an in vitro model system to study mononucleate trophoblasts. The BeWo cell line is a trophoblast-derived choriocarcinoma cell line and these cells undergo fusion at high density. Thus BeWo cells are typically used as a model to mimic the syncytialisation of cytotrophoblasts. JAR cells are another choriocarcinoma cell line derived from neoplastic trophoblast cells and are used as early human trophoblast cells Immortalized trophoblast cells The HTR-8/SVneo trophoblast cells were derived from human first trimester placenta at gestational age of 8 10 weeks and were immortalized using simian virus 40 large T antigen [54]. Although HTR-8/SVneo cells are nontumorigenic and nonmetastatic, they are highly invasive in vitro and retain various characterics of normal EVTs. They produce cytokeratins 7, 8, and 18; cytoplasmic human placental lactogen (hpl); IGF-II mrna and protein, and they share the similar repertoire of integrin profile with invasive cytotrophoblasts. When cultured in the presence of laminin or Matrigel, these cells express HLA-G, a nonclassical MHC class I molecule primarily expressed on EVT in situ [55-57] EVT propagated from human first trimester chorionic villous explants Human EVT subpopulations isolated mechanically from minced chorionic villous explants provide a valid model for studying EVT cell biology. The mechanical isolation of EVTs from first trimester chorionic villous explants (8-12 weeks gestation) yields pure EVT cultures, when 11

25 analyzed through morphological and phenotypical assays [58]. Immunofluorescence can be used to confirm that pure trophoblast outgrowths stain 100% positive for cytokeratin, the epithelial cell marker, but not vimentin, the mesenchymal cell marker. Furthermore, 90% of mechanically isolated EVTs from chorionic villous explants immunostaining 100% positive for cytokeratin, stain positively for insulin-like growth factor-ii [59]. Two subtypes of trophoblastic EVT populations are isolated from minced chorionic villi: multinucleate EVTs and mononucleate EVTs. The multinucleate EVTs are thought to be phenotypically similar to trophoblast giant cells, and are characterized by abundant vesiculated rough endoplasmic reticulum (RER) and produce human hpl [60]. The mononucleate EVTs are fibroblastic in appearance, and are characterized by polymorphic nuclei and numerous cytoplasmic vessels, and express the matrix metalloproteinases (MMPs) or gelatinases, MMP-2 and MMP-9 [60]. Additionally, EVT subpopulations derived from chorionic villous tissues express hcg, a reliable trophoblast specific marker [61, 62]. The trophoblastic cell markers, described above, are all expressed by invasive EVTs in situ. Differentiation and invasion in primary cultures of EVTs are regulated by specific growth factors [34]. For example, TGF- 1, which is produced by the placenta and decidua in vivo [63, 64], is capable of reducing proliferation, invasion, and promoting the differentiation and fusion in EVTs in vitro [63, 65, 66]. These primary cultures can mimic the terminal differentiation processes associated with placental bed giant cell differentiation in vivo that leads to the formation of multinucleated cellular structures [65]. This cellular event has also been associated with a reduction in the invasive capacity of these cells [63]. 12

26 1.2 Molecular mechanisms underlying trophoblasts invasion Trophoblastic cell invasion is vital for a successful pregnancy, and a number of factors modulate the process, either in positive or in negative way, to ensure sufficient but not excessive invasion. These regulators include cell adhesion molecules, ECM, matrix proteases, growth factors, cytokines and hormones, which are contributed by fetal as well as maternal compartments. The following reviews the current knowledge of those locally produced factors (Figure 1.2) Hormones Gonadotropin-releasing hormone The hypothalamic decapeptide gonadotropin-releasing hormone (GnRH)-I is well known for its role in regulation of pituitary gonadotropin secretion. It binds to specific receptors (GnRHR) on gonadotropes and stimulates gonadotropin production and secretion, thus regulating gonadal function [67]. It stimulates the biosynthesis of FSH and LH in the anterior pituitary, which subsequently regulates gonadal steroidogenesis and gametogenesis in both sexes [68, 69]. The hormone is also expressed in extrapituitary tissues and tumor cells, suggesting that it may function in a autocrine and/or paracrine regulatory manner in nonpituitary contexts [70, 71]. GnRH-I and the second form of this hormone, GnRH-II, have been detected in the human placenta [72, 73]. GnRH-I and GnRH-II mrna are expressed in first trimester human placenta, while only GnRH-I but not GnRH-II is present in term placenta. Both hormones are synthesized 13

27 Figure 1.2: Factors involved in the regulation of trophoblast invasion Growth factors, cytokines, Hormones GnRH, hcg, progesterone, etc. Inflammatory factors EGF, TGFβ, IGFs, IGFBPs, LIF, ILs, TNFα, etc. Trophoblast invasion Matrix proteases and inhibitors MMPs, TIMPs, upa, tpa, PAIs, etc. Cell adhesion proteins Integrins, E-cad, N-cad, etc. 14

28 by cytotrophoblasts, EVTs and decidual cells. However, only GnRH-I was detected in the multinucleated syncytiotrophoblast layer of first trimester chorionic villi and in cultures of villous cytotrophoblasts allowed to undergo syncytialization in vitro [74]. The expression of GnRH receptor is also present in the human placenta [75, 76]. The timing of maximal GnRH receptor expression coincides with the maximal GnRH-I expression [76-78]. Interestingly, the promoting action of GnRH-I but not GnRH-II is reduced by both the GnRH receptor antagonist (Antide) and a sirna specifically against the GnRH receptor, suggesting that GnRH-II does not influence trophoblast invasion via the GnRH receptor [79]. Furthermore, both GnRH-I and II promote cell invasion by activating protein kinase C, ERK1/2, and c-jun N-terminal kinase, whereas only GnRH-II regulates invasion by the transactivation of the tyrosine kinase activity of epidermal growth factor receptor [79], indicating that GnRH-II exerts function through different mechanism with GnRH-I. GnRH-I and GnRH-II regulate the balance between MMP-2, MMP-9 and the tissue inhibitor of metalloproteinase-1 (TIMP-1), and the expression levels of urokinase-type plasminagen activator (upa)/plasminogen activator inhibitor-1 in EVTs [80-82]. Also, GnRH-I and II increase MMP-26 expression through the JNK pathway in human cytotrophoblasts [83]. This is important because MMP-26 is not only able to cleave ECM and basement membrane proteins [84, 85], but acts to process the nascent MMP-9 zymogen to generate its active form [84-86]. Since trophoblasts share common features, including migratory and invasive properties, with malignant cells, it is noteworthy that GnRH has also been associated with cancer cell invasion. Low concentrations of GnRH agonists stimulate the migration and invasion of ovarian 15

29 cancer cells through activation of MMP-2 and MMP-9 promoters and a subsequent increase in their gene expression, but high does of GnRH-I and GnRH-II agonists suppresses ovarian cancer cells invasion by disturbing the balance between various MMPs and their TIMPs [87, 88]. Also, GnRH-I and GnRH-II both inhibit breast cancer cell invasion in vitro [89]. Furthermore, GnRH-I agonists and antagonists reduce the migration and invasion of prostate cancer and epidermoid carcinoma cells [89-91] Human chorionic gonadotropin Syncytiotrophoblast cells secrete human chorionic gonadotropin (hcg), which is involved in several pregnancy-promoting process, including corpus luteum survival, progesterone production and trophoblast differentiation [92]. hcg is produced by syncytiotrophoblast in vivo [93] and primary cultures of EVTs [61], suggesting that it may modulate trophoblast invasion. Functional hcg/lh receptors are also present on both cytotrophoblasts, syncytiotrophoblasts and EVTs, stimulating the differentiation of cytotrophoblasts into syncytiotrophoblasts in response to hcg via a camp/protein kinase A-dependent pathway [94-96]. hcg promotes invasion in JEG-3 cells and in primary trophoblastic cells [97, 98]. This is likely related to the observation that hcg significantly upregulates MMP-9 in endometrium [99]. Furthermore, hcg stimulates trophoblast migration via an IGF-II effect in vitro [100]. However other studies of primary trophoblast showed the opposite influence in invasion [101, 102]. Therefore, the role of hcg in trophoblast invasion is still unclear. However, hcg secreted by EVTs but not by the syncytiotrophoblasts promotes trophoblast invasion in vitro, indicating that the source of hcg is 16

30 essential to understanding its roles in placenta [61] Progesterone Progesterone is primarily produced by the gravidic ovary corpus luteum until the 6 th week of gestation. With the appearance of syncytiotrophoblasts, the placenta gradually takes over the production of progesterone from the corpus luteum and this is essential for the maintenance of pregnancy. Progesterone may influence trophoblast invasion by suppressing MMP-9 [103], and progesterone also restrains endometrial breakdown by inhibiting MMPs during early pregnancy [5], implying that invasion of trophoblast cells is inhibited by progesterone. In another study, although progesterone decreased MMP-2 expression in the early first trimester (6-8 weeks) trophoblasts, it increased cell invasion into the endometrium and MMP-2 expression in late first trimester (9-12 weeks) trophoblasts [104], suggesting that the influence of progesterone on the invasion of trophoblasts alters with time. In this process, a differential progesterone receptor (PR) repertoire, with the significant increase of the PRB subtype in the early gestational trophoblast and over-expression of the PRA subtype in the late gestational trophoblast, correlates with the altered progesterone functions [104] Matrix proteases and their inhibitors Matrix metalloproteinases To date, 26 mammalian and 22 human MMPs have been identified [105, 106]. Human 17

31 MMPs can be divided into 5 groups which differ in terms of their sizes and substrate specificity: collagenases, gelatinases, stromelysins, membrane-type MMPs and nonclassified MMPs [107]. The MMPs control a variety of cellular properties by mediating cell-matrix and cell-cell communications and by regulating the activity of circulating, cell surface and pericellular molecules, through the main function of MMPs, which is the proteolytic degradation of the ECM. Degradation of the ECM allows cells to invade by influencing cell morphology, motility and differentiation [106]. Several MMPs, and particularly MMP-2 and MMP-9 are involved in placental invasion. Their spatial and temporal distribution in trophoblast cells alter with gestational age, suggesting that MMP expression is tightly controled [108]. The gelatinases, MMP-2 and MMP-9, cleave collagen IV, which is the dominant protein in the basement membrane, and a variety of other ECM proteins. The cleavage of these ECM proteins collectively enable the trophoblast cells to invade through the underlying decidual matrix and into the uterine arteriole [109, 110]. During the first trimester, MMP-2 is produced by EVTs, while MMP-9 is expressed mainly in villous cytotrophoblasts [109]. In vitro, human cytotrophoblast cells produce MMP-2 and MMP-9 [111]. These secretions are necessary for trophoblast invasion because phenanthroline, a non-specific MMP inhibitor, suppresses cytotrophoblast invasion [112]. The secretion profile of these gelatinases switches with gestation age. No MMP-9 is secreted by cytotrophoblasts until week 6, but from the 7 th to 11 th week of gestation MMP-9 secretion increases over time. In contrast, MMP-2 production is suppressed from the 6th to 11th week of gestation. The mrna levels of the gelatinases correlate with proteinase production [113]. Therefore, MMP-2 can be regarded as the main gelatinase in early 18

32 trophoblast (the 6 th 8 th week of gestation), while MMP-9 appears to dominate over MMP-2 in trophoblastic cells at the 9 th 12 th week of gestation [111, 113]. Both MMP-14 and MMP-15 are also expressed in the human placenta during the first trimester [ ]. They are activators for some MMPs, and are particularly capable of activating MMP-2 in vitro [119, 120]. They also act as proteolytic enzymes degrading ECM elements: for instance fibronectin, laminin, gelatin and collagen I and III are substrates for MMP-14 [121, 122]. The EVTs that invade the endometrium and tubal wall exhibit coexpression of MMP-14, MMP-15 and MMP-2 mrna. Furthermore, cytotrophoblasts of cell islands also express mrnas for these three genes. In contrast, MMP-15 is not detectable from cell columns and decidua, whereas MMP-14 and MMP-2 mrnas are expressed in these cells. The coexpression pattern of MMP-14, MMP-15 and MMP-2 suggests that these membrane type-mmps probably effect invasion of EVT by activating MMP-2 [116]. Human MMP-26, which is also known as matrilysin-2, also plays a role in tissue remodeling processes during placentation [123]. This metalloproteinase degrades fibrinogen and ECM proteins, and is widely distributed in both villous trophoblasts and cytotrophoblast columns from 25 to 26 week gestational trophoblasts [124]. MMP-26 shares a similar pattern of expression with MMP-9, and their expression is temporally altered in villous trophoblast [117, 124]. These MMPs thus appear to cooperate in the remodeling of the ECM during placentation rather than acting alone. Other MMPs such as MMP-1, MMP-3 and MMP-7 are expressed within the placenta during different stages of human pregnancy [125]. MMP-3 distributes in first trimester villous 19

33 and invasive trophoblast, as well as trophoblast cell lines, and contributes to the degradation of insulin-like growth factor binding protein-1 (IGFBP-1) [126]. MMP-18 and MMP-19 mrnas have also been identified in the placenta [127, 128] but their roles in placental biology are still unknown. Besides their function on ECM degradation, MMPs also regulate the activities of growth factors, cytokines and angiogenic factors as well as other molecules, and thus regulate trophoblast invasion [129, 130] Tissue inhibitors of matrix metalloproteinases There are two types of MMP inhibitors: tissue inhibitors of metalloproteinases (TIMPs) and other inhibitors of MMPs (IMPs). Although IMPs have never been described in trophoblast, TIMPs, including TIMP-1, TIMP-2, TIMP-3 and TIMP-4) [131], are the major endogenous inhibitors of MMP activities in many tissues including the placenta [132]. TIMPs interact with their substrates, mainly via their C-terminal domain that contains the MMP catalytic site, in a 1:1 stoichiometric fashion, and this results in effective reduction of the catalytic activity of MMPs. The appropriate balance between the production of MMPs and their TIMPs is vital for the orderly progress of implantation and placentation. Individual TIMPs possess a certain degree of specificity in their inhibitory capacity against a variety of MMPs, and exhibit tissue-specific expression patterns and regulatory modes [133]. TIMP-2 and TIMP-3, but not TIMP-1, are effective inhibitors of MMP-14 and MMP-15, whereas TIMP-1 preferentially binds MMP-9 [119]. TIMP-1 mrna distributes in embryos in all 20

34 developmental stages of preimplantation, whereas TIMP-2 mrna is not detectable in early stage embryos (1-4 cells) but present only in later stage embryos (8 cells to blastocyst) [134]. Coexpression of MMPs and TIMPs has been shown in trophoblasts, futher suggesting that the invasive property of cytotrophoblasts depends on the balance between MMPs and TIMPs [135, 136]. Since the gelatinases MMP-2 and MMP-9 are involved in trophoblast invasion, their inhibitors also contribute to this precisely controlled process. Although TIMP-1 and TIMP-2 both are effective inhibitors of these two gelatinases, MMP-9 preferentially binds to and is inhibited by TIMP-1 [137], and MMP-2 preferentially binds to and is inhibited by TIMP-2 [138]. On the other hand, TIMP-2, together with MMP-14 and MMP-15, can activate MMP-2 [ ]. Interestingly, in mouse models TIMP-4 is produced by the blastocyst, and blockage of TIMP-4 activity by a specific antibody elevates the expression and activity of MMP-2 and MMP-9 [142], suggesting the potential regulatory role of TIMP-4 in human trophoblast invasion. And it is known that TIMP-4 is expressed in the JEG-3 malignant choriocarcinoma human cell line [123]. Hormones, growth factors and cytokines that can induce trophoblast invasive phenotype are capable of exerting their regulatory function through the expression and activity of TIMPs [81, 143]. Additionally, TIMPs are also known to increase cell proliferation [144, 145] and embryo development [146] Serine proteases Urokinase-type plasminogen activator (upa), the tissue-type plasminogen activator (tpa), 21

35 the PA inhibitors PAI-1 and PAI-2, and the cell surface upa receptor (upar) constitute the plasminogen activator (PA) system to regulate the formation of plasmin. upa and tpa can activate zymogen plasminogen to the plasmin [147, 148], which is capable of cleaving the ECM. Inhibitors PAI-1 and -2 control the activity of the PA system [148]. Apart from cleaving ECM, the PA system exerts proteolytic activation of MMPs, and thus indirectly acts on ECM degradation. Both endometrium and trophoblasts can produce upa and plasmin [149, 150], indicating that an autocrine/paracrine action of the PA system affects the implantation process. With the exception of MMP-11 and most membrane type-mmps, which are activated intracellularly by the Golgi-associated proteinase furin [151], most MMPs are secreted as latent enzymes and processed to an active form extracellularly by other MMPs or by a serine protease such as plasmin due to the action of proteolytic cascades [152]. The PA system is involved in the plasmin/mmp proteolytic cascade by modulating the conversion of plasminogen to plasmin. Plasmin generation results from the interaction of upa with upar [147, 148, 153, 154]. The secretion of PAI-1 and TIMPs by both the EVT and the surrounding decidua compensates for the proteolytic activities of the PA system and MMPs within the uterine-fetal microenvironment Integrins Integrins are heterodimeric adhesion molecules containg α and β subunits. Integrins can bind to a variety of ECM proteins and other cell adhesion molecules, thereby influencing cellular 22

36 signaling, cytoskeleton reorganization, adhesion, migration and invasion, [155]. Trophoblasts exhibit a differential integrin repertoire in invasive and non-invasive cells [31, 156]. The adhesion molecules that characterize the stem cell population of villous cytotrophoblasts inhibit invasion, and are reduced in quantity as trophoblasts undergo differentiation through the invasive pathway. During this process, the integrin repertoire in the receptive uterus is also alerted to assist implantation Integrins in villous trophoblasts Gradually, as gestation progresses, syncytiotrophoblasts adhere directly to the basement membrane. Collagen IV, heparan sulphate proteoglycan and several laminin isoforms: 511, 521 and 411, with lesser amounts of 211 and 221, are produced during this progress [157]. Integrin α6β4, the laminin receptor, distributes at the basal surface of villous cytotrophoblasts throughout gestation [158, 159] and also at the basal syncytiotrophoblast surface. Integrin α6β4, which binds laminins 511 and 521 [160] facilitate cells attaching to basement membrane and adhering to their neighbours. The β1 integrin is not detectable in first trimester villous cytotrophoblasts. It appears in the second trimester along with potential partner integrin chains, especially α3, and increases gradually [158]. After its appearance, β1 integrin may contribute to the adhesion of the villous trophoblast to ligands including laminins and collagen IV in the basal lamina. Integrin α5β1 levels are increased in primary cultures of villous cytotrophoblasts, indicating gene suppression in the villous environment in vivo. 23

37 Integrin αv subunit is a substrate for tissue transglutaminase action [161] and is present on the surface of all cytotrophoblasts and the basal syncytiotrophoblasts. It heterodimerizes with integrins β 1, β 3, β 5, β 6 or β 8 to form functional signaling complexes [162]. Integrin αvβ3 is present in the microvillus and retains binding affinity for the ECM protein vitronectin and peptides containing a RGD sequence, which is an arginine/glycine/aspartic acid motif. Osteopontin, another αvβ3 ligand, appears in the ECM and is produced by both villous cytotrophoblasts and syncytiotrophoblasts [161, 163]. Integrin β5 is mainly expressed during the first trimester at trophoblast cell surfaces, but not at the basal membrane, and it is confined to cytotrophoblasts in term placenta [164] Integrins in extravillous trophoblast (EVT) Trophoblast switches its integrin repertoire as it detaches from the columns of EVT and invades into maternal decidua, spiral arteries and myometrium. The alteration of integrin subunits in villous trophoblasts and EVTs characterizes the acquisition of an invasive phenotype. Villous trophoblast cells show increases in integrin α5β1 (the fibronectin receptor) [59, 165], α4β1 (the fibronectin, VCAM-1 and EMILIN-1 receptor) [164], αvβ3 (the vitronectin receptor), which bind fibronectin and other RGD-containing ligands in the ECM [164], and α1β1 (the laminin/collagen receptor) as well as α6β1 (the laminin receptor), suggesting that these integrins facilitate invasion. In contrast, integrin α6β4 (the laminin receptor), which is expressed highly in villous trophoblast to stabilize adhesion, is lost in these cells [19, 159, ]. Integrins αvβ3 and α1β1 are important in promoting migration and invasion, whereas α5β1 24

38 contributes to cell anchorage [59, 164, 169]. Blocking integrin β1 function leads to a reduction of anchorage and column outgrowth in villous explants, and a shift from cell-matrix interaction towards cell-cell adhesion [59]. The disturbance of invasion resulting from the functional inhibition of laminin, collagen IV or integrin α1 in vitro implicates the importance of α1β1 laminin or α1β1 collagen IV interactions. At the beginning of invasion, cytotrophoblasts in columns interact with fibrinoid, an ECM component that contains fibronectin [170], the ligand for integrin α5β1; vitronectin, which binds αvβ3; as well as laminin and collagen IV, which bind α1β1. Fibrinoid accumulates near the trophoblast columns and probably anchors them to the uterus [171]. It should also be noted that the decidual ECM exhibits a similar profile of ECM components that is enriched by laminins, collagen IV [157, 172] and fibronectin [172, 173]. As EVTs further invade into maternal spiral arteries, integrins αvβ3 and αvβ5 increase in abundance in the EVTs [164, 174, 175]. These two integrins, together with β1, may facilitate endovascular trophoblast adhesion and migration within uterine arteries since they can mediate adhesion of human cytotrophoblasts to endothelial cells in vitro [176]. Integrin α4β1 may also mediate cytotrophoblasts-endothelium or cytotrophoblasts cytotrophoblasts interactions during endovascular invasion according to the fact that cytotrophoblasts expressing α4 integrin bind the vascular cell adhesion molecule VCAM-1 [164] Integrins in the endometrium The endometrial integrin repertoire is controlled by steroid hormones like estradiol and 25

39 progesterone as well as cytokines[177], and alters with the timing of the implantation window. Integrins αvβ3 and α4β1 are regarded as markers of a receptive endometrium [ ]. αvβ3 is increased during embryo attachment and reduced in women suffering infertility [181, 182]. During the implantation window, women with recurrent miscarriages retain a reduced level of α4β1 and α5β1 integrins in the endometrium compared to those with unexplained infertility [183]. And also a deficiency of integrins αvβ3 or α4β1 in the uterus is associated with unexplained infertility [182] Growth factors, cytokines and inflammatory factors Epidermal growth factor Epidermal growth factor (EGF) is present in the human endometrium throughout the menstrual cycle, in gestational decidua, and in the placenta throughout gestation[94]. EGF induces trophoblast invasion [98, 184], differentiation [185, 186] and proliferation [187], and is therefore a significant player in the processes of implantation. Blocking the EGF signaling system in human first trimester cytotrophoblast cells inhibits trophoblast invasion in vitro, whereas supplementation with EGF rescues invasion [188]. EGF elevates the activities of MMP-2, MMP-9, and upa as well as PAI-1 in trophoblasts [189, 190], therefore promoting cell invasion. The EGF-induced MMP-2 regulation is realized through several transcription factors, including p53 [191]. EGF enhances trophoblast invasion by inducing α2 integrin expression in BeWo choriocarcinoma cells [192]. Moreover, EGF also stimulates the proliferation of early first 26

40 trimester cytotrophoblasts, and stimulates the secretion of human placental lactogen (hpl) and hcg in late first trimester syncytiotrophoblasts, thereby regulating early placental development [185] Transforming growth factor β The transforming growth factor β (TGFβ) family, composed of TGFβ1, β2 and β3, are major repressors of cytotrophoblast outgrowth. TGFβs are present both in endometrial and cytotrophoblast cells, and are co-expressed with their receptors, the TGFβRs [193]. TGFβ1 is present in cytotrophoblast columns and islands, as well as extracellularly around the EVTs, but is absent in EVTs. TGFβ2 and β3 are also present in placenta, but only TGFβ2 is present in EVTs. Furthermore, extracellular TGFβ1 and cytoplasmic TGFβ2 are present in decidua [194]. TGFβ generally exhibits extracellular immunoreactivity, indicating that it binds to ECM. All of these TGFβ isoforms inhibit EVT invasion through a reduction of MMP-9 and upa, but exert no alteration on cell proliferation and apoptosis in vitro [195]. TGFβ1 reduces cytotrophoblast cell migration and invasion partially through an increase of the endogenous TIMP-1 and -2, which act to block MMP activity, and through the upregulation of PAI-1 to inhibit upa activity [63, 66, ]. Moreover, hepatocyte growth factor-induced cell invasion is eliminated by TGFβ1 [199]. In addition, a decrease in the outgrowth of EVT from villous explants in the presence of TGFβ3 suggests a role in suppressing trophoblast outgrowth [199]. Furthermore, the inhibition of TGFβ3 expression or the blockage of its activity leads to the formation of EVT columns, thereby enhancing outgrowth of trophoblast, and increased MMP-2 27

41 and -9 expression [199], as well as fibronectin release [24] Insulin-like growth factor and insulin-like growth factor binding protein-1 Insulin-like growth factor (IGF)-II and insulin-like growth factor binding protein-1 (IGFBP-1) are two of the most important molecules that act at the fetal maternal interface to stimulate EVT migration or invasion without influence on cell proliferation [58, 200]. IGFBP-1 is secrected by the decidualized endometrium [31], but is not expressed by trophoblasts, and it interacts with IGF-II synthesized by trophoblasts. Therefore, IGF-II acts on EVT cells in an autocrine manner whereas IGFBP-1 acts in a paracrine manner. MMP-3, which is present in villous trophoblasts and EVTs, contributes to this autocrine/paracrine action by degrading IGFBP-1 [126]. IGFBP-1 regulates the metabolism of IGF-I and IGF-II and stimulates the gelatinolytic activity of trophoblasts [201]. In addition, IGF-II and IGFBPs are thought to mediate cell-to-cell communication between trophoblasts and decidua, and to thereby regulate invasion [202]. Since neither IGF-II nor IGFBP-1 influences the expression of invasion-associated enzymes (MMP and PA) or TIMPs, IGFBP-1 promotes trophoblast invasion mainly through enhancing cell migration [58, 200] Leukaemia inhibitory factor Leukaemia inhibitory factor (LIF) is a glycoprotein with a variety of functions, which include the stimulation of cell proliferation, differentiation, and survival [203]. LIF binds to heterodimeric LIF receptor and then activates a series of intracellular signaling pathways in 28

42 diverse cells types. These pathways include the JAK/STAT, MAPK, and PI3-kinase (PIPK) [204]. Although the blastocyst is able to secret LIF, endometrial tissue is the dominant source of this cytokine during the pre-implantation period. which expresses the highest concentrations of LIF around the time of implantation [205]. It is also known that LIF is expressed by cytotrophoblasts and decidua at the fetal maternal interface [206], suggesting that LIF facilitates trophoblast invasion into the maternal side. Human cytotrophoblasts, during first trimester, express LIF receptor mrna, which is indicative of a paracrine function of LIF during implantation and placentation [206]. LIF influences cell invasion and promotes trophoblast differentiation [207, 208]. Increased binding to ECM elements in response to LIF is shown in primary culture of EVTs through the regulation of integrin molecules, and an altered balance between MMPs and TIMPs [143]. LIF also stimulates the invasion of HTR-8/SVneo, a poorly invasive trophoblast cell line [209], and further enhances primary EVT and JEG-3 invasion via the STAT3 signaling pathway [210]. Controversially, although LIF was shown to suppress gelatinase activity in cytotrophoblasts [211], another study observed that LIF had no effect on gelatinases MMP-2 and MMP-9 but stimulated TIMP-1 and -2 expression in first trimester EVT [143] Interleukins Interleukin-1 (IL-1) is expressed at the embryo-uterine interface. IL-1 is produced by trophoblastic cells and decidualized stromal cells [212], and the IL-1 receptor is expressed in both trophoblastic cells and endometrial epithelial cells [31]. IL-1 can stimulate MMP-9 29

43 activity in trophoblasts [213], thereby inducing trophoblast invasion, and can elevate MMP-3 expression through AKT and MAPK signaling in trophoblasts in vitro [126]. In contrast, IL-10 is an autocrine inhibitor of MMP-9 expression and human trophoblast invasion [214]. IL-6 is present on endometrial epithelial cells [215], decidual stromal cells [216] and fetal trophoblasts during implantation and placentation [11, 217, 218]. The IL-6 receptor and its associated transducer gp30 co-localize in trophoblasts [207, 219], as well as in endometrial epithelium and in stroma with weak intensity [220]. IL-6 stimulates cytotrophoblast migration and invasion and increases integrin α5β1 and α1β1 expression [221]. IL-6 activates MMP-2 and MMP-9 [222] and alters integrin expression in trophoblasts [223, 224]. IL-8 and its receptors are also present in decidua and trophoblasts. IL-8 stimulates trophoblast invasion by increasing MMP-2, MMP-9 and integrins α5, β1 in vitro [221]. In response to IL-11, there is an increase in adhesion of primary endometrial epithelial and trophoblast cells [225]. Correspondingly, the IL-11 receptor is detected in interstitial EVTs. Moreover, IL-11 promotes the migration of human trophoblast cells with no effect on their proliferation. This may be accomplished by the stimulation of STAT3 phosphorylation [226] Tumor necrosis factor-α Tumour necrosis factor-α (TNF-α) is a protein that induces proinflammatory actions. Alterations of the placental expression of TNF-α suggests that it has a specific function during fetal development [227]. TNF-α mainly distributes in cell columns [228], and its immunoreactivity at the placental uterine interface is maintained during invasion, but increases 30

44 as the EVTs replace the endothelial cells of the spiral arteries [228]. At later stages of pregnancy, TNF-α levels are reduced in invasive cells [228]. Importantly, the TNF-α receptor is also expressed in villous cytotrophoblasts, cell columns and invasive trophoblasts during early pregnancy [229]. TNF-α specifically suppresses trophoblast migration and invasion [230]. In villous explant cultures as well as in HTR-8/SVneo cell, TNF-α decreases migration mainly through the upregulation of PAI-1 [167, 231, 232]. The TNF-α-mediated increase in PAI-1 production probably involves NFκB-dependent signaling [231]. TNF-α also attenuates IGF-1 mediated trophoblast cell migration by reducing the response sensitivity to IGF-1 stimulation [233]. Besides suppressing trophoblast migration and invasion, TNF-α also stimulates MMP-9 expression in first trimester trophoblasts, explant cultures and decidual cells [167, 220, 234]. TNF-α mediated induction of MMP9 could counterbalance the adverse effects of excessive cytokine levels, and this may also apply to other MMPs regulated by TNF-α in trophoblasts [235, 236]. 1.3 The ADAMTS The ADAMTS are a gene family of secreted, multidomain and multifunctional proteinases which are present in both vertebrates and in invertebrates. Beginning with the discovery of ADAMTS-1 a dozen years ago [237, 238], the ADAMTS field has been considerably expanded to 19 subtypes in mammals [239]. As metalloproteinases they share features with the ADAM and 31

45 MMP families of enzymes and are able to proteolytically degrade a diverse array of cellular, extracellular and ECM substrates. The ADAMTS are not membrane-anchored but bind to ECM components such as heparin and heparan sulfate after secretion [240, 241]. This family of proteinases is known to influence embryonic growth and development [242, 243], the initiation and progression of cancer [239], arthritis [244], several thrombotic and inflammatory conditions [245] and the periodic remodeling events that occur in adult reproductive system[242, 243, 246, 247]. A variety of ADAMTS family members have been identified at the RNA level in the human term placenta or uterus [238, 248], indicating that the ADAMTS likely contribute to reproduction and development. The expression and activity of ADAMTSs can be modulated at various levels through the regulation of transcriptional processing, post-transcriptional processing, post-translational processing, inhibitors, growth factors [249, 250], hormones [251, 252] and cytokines [253] The ADAMTS domain structure The ADAMTS contain four structural and functional domains: the N-terminal prodomain, the metalloproteinase domain, the disintegrin-like domain and the ancillary domains (Figure 1.3). Generally, the ADAMTS catalytic domain dictates cleavage site specificity, whereas the disintegrin-like and the ancillary domains, which have no catalytic activity, provide substrate-binding specificity. Therefore, less homology appears between the family members in 32

46 the C-terminal region than in the N-terminal region. Initially, the ADAMTS are produced as inactive zymogens with a signal peptide at the N-terminus. Structurally, the ADAMTS proteinases comprise: (1) A prodomain of varying length, which may preserve enzymatic latency. Furin cleavage consensus motif(s) contained in this domain can be cleaved by furin or related pro-protein convertases intracellularly and/or extracellularly, therefore the proteins are secreted in the mature form. Furin and the inactive zymogen ADAMTS-4 corporately localize in the trans-golgi network [254], and recombinant furin is capable of degrading purified zymogen ADAMTS-4 in cell-free condition [255]. Blocking furin activity inhibits the removal of the pro-domain with no influence on secretion, suggesting that furin is essential in this N-terminal processing [254]. However, furin-independent prodomain processing is present in some ADAMTS members and in some cells. (2) A highly conserved metalloproteinase domain possessing a zinc binding site: HExxHxxGxxH/N/SXXHD ( x refers to a random amino acid and D refers to Asp which is unique in ADAM and ADAMTS), in which the catalytic zinc is coordinated by three His. The binding process has been attributed to the conserved glycine, which favors the formation of a tight metal-binding loop and allows the third His to reside in the correct location [257, 258]. A methionine residue is located downstream of the third zinc-binding histidine, and forms the Met-turn, a tight right-handed turn probably accounting for the structure of the zinc-binding site [257]. (3) A disintegrin-like domain, which shares 25%-45% identity with snake venom 33

47 Figure 1. 3: Schematic domain structure of ADAMTS. The common domain backbone is shown at the top. The unique C-terminal domain organization of each ADAMTS is indicated on the right. TSP, thrombospondin type 1 motif; PLAC, protease and lacunin module; CUB, cubilin motif. (Adapted from Apte, JBC, 2009:284 (46) [256]) 34

48 disintegrins that are a family of soluble peptides. Some of the snake venom disintegrins contain a sequence Arg/Gly/Asp (RGD) which can be recognized by integrins [259]. Nevertheless, the ADAMTS sequence does not exhibit homology with the RGD sequence and there is no evidence that ADAMTS has disintegrin activity. (4) Ancillary domains containing numerous domains and motifs, which contribute to the substrate specificity of the ADAMTS. This domain possesses a central thrombospondin type 1-like (TSP) domain, a cysteine-rich domain (CRD), a spacer motif that varies in length without characteristic structure, and variation in the number of TSP repeats [239, 241]. The TSP region is highly conserved with the type-1 repeats of thrombospondins-1 and -2 [260]. Therefore, the central TSP in the ADAMTS structure may function as a sulphated glycosaminoglycan-binding domain [261]. NaCl is required for elution of the independently expressed central TSP of murine ADAMTS-1 from a heparin column, suggesting that central TSP accounts for the heparin-adamamts-1 interaction [240]. The highly conserved CRD sequence contains 10 Cys residues. It is followed by a spacer region, which is Cys-free and possesses a variety of conserved hydrophobic residues within the N-terminus, and a less homologous C-terminus. In murine ADAMTS-1, the CRD-spacer sequence functions as an ECM-binding domain [240]. Through these domains, human ADAMTS-4 binds to both heparin and the glycosaminoglycans of aggrecan. Moreover, three putative heparin-binding sequences are predicted: one is in the CRD domain and two are in the spacer domain [255]. All ADAMTS proteinases possess TSP repeats that range from zero to fourteen in number 35

49 in tandem oragnization between the C-terminus to the spacer region. These TSP repeats are less homologous between the different ADAMTS subtypes than is the central TSP. However, according to the study on murine ADAMTS-1, these motifs share a similar function with the central TSP in that they all can form functional heparin-binding units [240]. The ADAMTS proteinases have been further subclassified according to the presence of additional C-terminal modules (Figure 1.3). ADAMTS-9 and ADAMTS-20 contain a unique GON domain, which possesses 10 conserved cystein residues [262]. ADAMTS-7 and -12 contain a mucin domain, which is also known as the spacer-2 domain, between the 3 rd and 4 th additional TSP repeats. This portion contains a variety of Pro, Ser and Thr residues, and is thus believed to be highly O-glycosylated [263]. ADAMTS-13 is unique in having two cubilin motif (CUB) [264], which are identified in a great number of extracellular and plasma membrane-associated proteins, most of which are believed to have functions in development including the formation and development of the embryo [265]. Moreover, the CUB domain likely mediates interactions between CUB-containing proteins [266, 267]. ADAMTS-2, -3, -6, -7, -10, -12, -14, -16, -17, -18 and -19 all contain a protease and lacunin module (PLAC) domain with a 6-Cys conserved repeat [249, 268], which influences epithelial remodeling during embryogenesis and wings development in moth Manduca sexta [268]. 36

50 1.3.2 Functions of the ADAMTS proteins The aggrecanases: ADAMTS -1, -4, -5, -8, -9, -15 This subgroup of ADAMTS is characteric for the specific substrate aggrecan, which is the major structural component of cartilage. Aggrecan exhibits a compression-resistance effect by degrading and swelling against the type II collagenases [269, 270]. The aggrecanases cleave aggrecan in cartilage, thereby leading to the onset of arthritis [270]. ADAMTS-1, -4, -5, -8, -9 and -15 are capable of cleaving aggrecan at various conserved cleavage sites [271]. ADAMTS-4 and ADAMTS-5 are the most studied aggrecanases. They especially contribute to aggrecan degradation in osteoarthritis (OA) [272]. Both Adamts-4 -/- and Adamts-5 -/- mice are born normally and are not distinguishable from wild type mice, suggesting that normal development occurs independently of these enzymes [ ]. In a surgically induced OA model, the severity rating of OA was significantly decreased in Adamts-5 -/- mice, whereas no distinction was observed in Adamts-4 -/- mice [ ]. Likewise, Adamts-5 -/- mice but not ADAMTS-4 -/- mice were prevented from the loss of aggrecan in a model for inflammatory arthritis [ ]. Moreover, increased aggrecanase activity was observed in explants of articular cartilage from Adamts-4 -/- and wild-type mice but not in those from Adamts-5 -/- mice [ ]. Taken together, the studies using mouse models elucidate that ADAMTS-5 has predominant aggrecanase activity. ADAMTS-1, -4 and -9 also degrade versican, an aggrecan-related proteoglycan, at homologous cleavage sites [276]. Furthermore, ADAMTS-4 can cleave brevican, another 37

51 proteoglycan [277], implicating its action in central nervous system physiology and pathology [278]. Since ADAMTS-4 can cleave fibromodulin, decorin and cartilage oligomeric matrix protein, it likely has a wider proteolytic spectrum other than proteglycans [279]. In addition, ADAMTS-1 has degrading activity for gelatin, a type I collagen, in vito [280]. Moreover, in a mouse model of chronic viral myocarditis, ADAMTS-1, together with Captopril, an angiotensin-converting enzyme inhibitor, diminishes fibrosis by accelerating type I collagen degradation [281] Anti-angiogenesis: ADAMTS-1 and -8 Specific ADAMTS regulate vascularization, a characteristic of both chronic achilled tendinopathy [282] and arthritis [283]. ADAMTS-1 and -8 exhibit anti-angiogenic effects, which can inhibit vascular endothelial growth factor (VEGF) and fibroblast growth factor-2-induced blood vessel formation in endothelium, therefore inhibiting cell proliferation [258]. Both ADAMTS-1 and -8 decrease VEGF-induced angiogenesis and inhibit fibroblast growth factor-2 induced vascularization, with ADAMTS-1 being more efficient than ADAMTS-8 [248]. ADAMTS-1 also interacts with the growth factor VEGF 165 and limits its bioavailability, but does not degrade it, indicating that the inhibitory function is realized by suppressing the interaction of VEGF and its cell receptor [284]. ADAMTS-1 and -8 exhibit the anti-angiogenic effect through the interaction of their TSP motifs with CD36, an essential anti-angiogenic receptor in endothelium [285], or directly through VEGF binding [284]. These TSP motifs share sequence homology with TSP1 and TSP2, 38

52 which have anti-angiogenic activity [286]. Through the region, which contains the two C-terminal TSP repeats, ADAMTS-1 can bind VEGF-165 [284]. A GWQRRL/TVECRD region, which is contained in the first C-terminal TSP repeat, disginguishes ADAMTS-1 and -8 from any other ADAMTS subtype, likely contributes to their anti-angiogenic actions. However, an ADAMTS-1 N-terminal deletion mutant containing the central TSP domain, CRD, the spacer motif and the C-terminal TSP repeats failed to inhibit angiogenesis [287]. On the other hand, an ADAMTS-1 active site mutant lost its anti-angiogenic activity [287], thereby indicating that both the catalytic and ancillary domains account for the anti-angiogenesis activity The procollagen N-terminal proteinases: ADAMTS-2, -3, and -14 The removal of the N-terminal propeptides from procollagen is attributed to ADAMTS-2, -3 and -14, which activate the collagen [250, ]. The active site sequences in these proteinases differ from those of other ADAMTS family members. ADAMTS-2 cleaves type I, II and III procollagen [250, 288]. ADAMTS-3 processes type I and II procollagen [291], whereas ADAMTS-14 only acts on type I procollagen [292]. Gene mutations in ADAMTS-2 cause human Ehlers Danlos syndrome (EDS) type VII [293], a recessive inheritable disorder with a phenotype of extreme fragility of the skin. An accumulation of procollagen intermediates in the conversion into mature type I collagen are observed in patients with EDS type VII [294]. ADAMTS-2-null mice, although born normally, developed severe skin fragility after birth. ADAMTS-2-null females have normal fertility, whereas males are sterile [247]. These observations collectively indicate that ADAMTS-2 plays a pivotal role in fibrillogenesis of type I 39

53 procollagen in skin as well as in maturation of spermatogonia. While ADAMTS-3 and ADAMTS-14 are highly homologous with ADAMTS-2, they cannot compensate adequately for the absence of ADAMTS-2 in skin. However, ADAMTS-2 and -3 share a relative expression pattern which might account for the relative sparing of some type I procollagen-containing tissues such as cartilage in dermatosparaxis, an inherit defect in collagen synthesis [290]. In addition, ADAMTS-14 functions as a physiological aminoprocollagen peptidase of type I procollagen [292] The GON-ADAMTS: ADAMTS-9 and -20 Since the C. elegans ADAMTS, GON-1, which mediates gonadal cell motility and morphogenesis, is highly homologous with ADAMTS-9 and -20, this ADAMTS subgroup is believed to have roles in development [262, 295, 296]. In a mouse model, ADAMTS-20 is necessary for melanocyte migration during embryogenesis, and a naturally occurring defect in this proteinase leads to the belted white-spotting phenotype, which influences the mortality and maturation of melanoblasts [297]. Early lethality of the Adamts9 -/- mice during early gestation supports the critical role of ADAMTS-9 during development [298] von Willebrand factor-cleaving protease: ADAMTS-13 ADAMTS-13 is distinguishable from any other ADAMTS subtype. It possesses a relatively small pro-domain and a CUB motif which is unique in human ADAMTS [264]. ADAMTS-13 suppresses von Willebrand factor (vwf) -platelet aggregation. The vwf is a large multimeric 40

54 glycoprotein that serves as a carrier protein for clotting factor VIII. The vwf is produced by megakaryocytes and vascular endothelial cells, and is detectable in platelets and plasma [299]. It facilitates platelet aggregation and regulates platelet adhesion to injured blood vessels by the interaction with specific receptors on the platelet surface and with exposed ECM proteins [300, 301]. The shear stress activates this specific receptor on platelet surface and therefore enhances vwf-mediated blood coagulation, whereas ADAMTS-13 cleaves vwf multimers under high fluid shear stress [302]. ADAMTS-13 binds to native vwf via domains distal to the spacer, and probably including the TSP repeats [303]. But bound vwf is not cleaved by ADAMTS-13 unless changes in the secondary structure of vwf expose itself to the enzyme. Inactivation of ADAMTS-13 accounts for TTP (thrombotic thrombocytopenic purpura), which is a severe disease of blood coagulation accompanied by fever, renal dysfunction and neurological disorders. The inactivation of ADAMTS-13 is caused by: (a) the presence of anti-adamts-13 autoantibody that is present transiently; and (b) compound heterozygous or homozygous mutations of ADAMTS-13 that cause congenital deficiency of the protease [304]. The presence of the spacer region of ADAMTS-13 is required for its ability to cleave vwf in vitro, and the C-terminal TSP and CUB domains are dispensable [305] ADAMTS in tumors Modulated expression of the ADAMTS is observed in a variety of cancer tissues, indicating that members of this metalloprotease family act as tumor suppressors or oncogenes. Moreover, at distinct stages during tumour development, the ADAMTS likely exert various, even opposing 41

55 activities. For instance, ADAMTS-1 mrna is down regulated in hepatocellular carcinoma and pancreatic cancer compared with matched noncancerous tissues [306]. In these cases, ADAMTS-1 expression displays no correlation with tumor vascularity. In lung cancer, and colon cancer, ADAMTS-1 is also suppressed [307, 308]. However, patients with enhanced ADAMTS-1 expression are subject to metastatic pancreatic cancer, and have a poorer outcome after curative surgery, suggesting that ADAMTS-1 probably promotes the development of pancreatic cancer through retroperitoneal invasion and lymph node metastasis [306]. Over-expression of ADAMTS-1 enhances tumour growth in vitro [309] and promotes pulmonary metastasis of mammary carcinoma or lung carcinoma [310]. These apparently controversial effects may due to the C-terminal processing of ADAMTS-1. This proteinase undergoes auto-proteolytic cleavage at varying cleavage sites, which accounts for pro- or anti-tumor action [310]. In breast cancer, mrnas for ADAMTS-1, -3, -5, -8, -9, -10 and -18 are reduced by up to 90%, and ADAMTS-4, -6, -14 and -20 mrnas are increased by at least 80% compared with matched normal mammary gland tissue [311]. There was a significant 83% reduction of ADAMTS-9 in breast cancer compared with non-neoplastic mammary tissue [311]. In renal, esophageal and nasopharyngeal cancer, ADAMTS-9 is also identified as tumor suppressor [312]. In prostate cancer, down-regulated ADAMTS-13 and -20 are observed compared to matched samples of normal prostate and benign prostatic hyperplasia tissue. Likewise, vwf cleaving activity of ADAMTS-13 was mildly reduced in brain and protease tumors [313]. ADAMTS-13 inactivity is not related to metastasis directly, but diminishes the cleavage of vwf, which 42

56 facilitates adhesion between tumour cells and platelets [314]. In colon cancer cases and cell lines, ADAMTS-15 which is known as a tumor repressor, is identified with heterozygous mutations which leads to the inactivation of this enzyme [315] Other ADAMTS This subgroup of ADAMTS proteins has no clearly identified function, although the modulated expression of these proteinases has been identified in various disorders. For instance, in breast carcinoma, ADAMTS-6 is down-regulated whereas ADAMTS-18 is up-regulated [311]. In patients with osteoarthritis, ADAMTS-12 and ADAMTS-16 showed increased expression in cartilage [244]. ADAMTS-7, -10 and -12 have proteolytic activity, although ADAMTS-7 degrade aggrecan and versican at the sites distinctive from the conserved cleaving sites of the aggrecanases ADAMTS subgroup [249, 263, 316]. The mucin domain of ADAMTS-7 bears one or more N-linked chondroitin sulfate (CS) chains, which modify the mucin domain and thereby reduce the binding affinity of the protein for heparin [263]. ADAMTS-10 is present in heart, skin and fetal chondrocytes [317]. ADAMTS-10 mutation is associated with Weill-Marchesani syndrome (WMS), which is a connective tissues disorder featured by short fingers and toes, short stature, heart defects, joint stiffness and abnormalities of eye lens, suggesting ADAMTS-10 is involved both in normal growth before and after birth as well as the development of skeleton, heart, lens and skin in humans. ADAMTS-10 null mutations are present in families with autosomal recessive form of WMS. The mutations are located in the catalytic domain, predicting premature termination of translation of the proteinase [317]. ADAMTS-10 specifically binds to 43

57 the matrix glycoprotein fibrillin-1, which is associated with dominant WMS [318, 319]. Finally, ADAMTS-16 is highly expressed in adult ovary and brain as well as in fetal kidney and lung. Over-expression of ADAMTS-16 results in a reduction in cell motility and proliferation, but causes no alternation in the adhesive phenotype of chondrosarcoma cells. This effect of ADAMTS-16 might be accomplished through the inhibition of MMP-13 [320] Regulation of the ADAMTS expression and activities Regulation of gene expression ADAMTS mrnas are distributed widely in normal adult tissues but are generally more restricted in fetal tissue. Various hormones, growth factors as well as inflammatory cytokines have been identified to modulate particular ADAMTS genes. TGFβ increases the levels of ADAMTS-2 mrna in MG-63 osteosarcoma cells [250], as well as ADAMTS-4 mrna (but not ADAMTS-5 mrna) in articular cartilage [321], and ADAMTS-12 mrna in KMST human fetal fibroblasts [249]. Expression of ADAMTS-16 is also stimulated by TGFβ in chondrocyte cell lines, leading to a reduction in cell motility and proliferation, as well as a decline in MMP-13 expression [320]. IL-1 leads to an increase in detectable aggrecanase activity, but no influence on ADAMTS-4, in chondrocytes or bovine nasal or articular cartilage, consistent with the role of the cytokine as a mediator of cartilage matrix breakdown [322]. However, the increased activity in this system is probably brought by other aggrecanase ADAMTSs. Murine ADAMTS-1 can be upregulated by 44

58 IL-1, indicating that ADAMTS-1 is involved in inflammatory responses [237]. ADAMTS-4 mrna is induced by cotreatment with IL-1α and oncostatin M, but not by either cytokine alone in a human chondrocyte cell line, while ADAMTS-5 mrna is increased by IL-1α but not by oncostatin M [323]. These observations suggest that gene expression of the two homologous aggrecanases may be regulated through different mechanisms. However, in other studies, retinoic acid or IL-1α display relatively little effects on the mrna levels of ADAMTS-4 and -5 in synovium, articular cartilage and bovine nasal cartilage, despite the marked upregulation of aggrecanase activity [322, 324, 325]. The enhancement in ADAMTS-4 cleaving activity acquired after the addition of IL-1α can be partially attributed to the induction of other enzymes, which subsequently activate the existing ADAMTS enzyme within the tissue [326]. IL-1β increases ADAMTS-4 and ADAMTS-5 mrna in equine chondrocytes [327]. IL-1β induces ADAMTS-4 gene expression which was mediated through MyD88, IRAK-1 and TRAF6 as well as Ras-driven reactive oxygen species culminating in NF-κB transcription factor actions in human chondrocytes [328]. In human chondrocytes and chondrosarcoma cells, IL-1β enhances ADAMTS-9 activity via nuclear factor of activated T cells, a transcription factor which activates both ADAMTS-4 and -5 promoters [329]. IL-17, a cytokine regulating inflammatory responses that is expressed by immune system, nervous system as well as peripheral tissues, also increases the ADAMTS-4 mrna level in bovine articular chondrocytes through the activation of JNK, p38 and ERK mitogen-activated protein kinases [330]. In human THP-1 monocytic cells, ADAMTS-4 expression is strongly induced by a 45

59 biologically activated compound PMA, and peroxisome proliferator-activated receptor γ agonist GW7845, while retinoid X receptor agonist 9-cis-retinoic acid, both of which exhibit anti-inflammatory effects, inhibit this induction [331], suggesting that ADAMTS-4 is likely involved in the activation of macrophages in inflammatory response and a variety of diseases. mrna levels of ADAMTS-1, -6 and -9 are induced after the treatment of TNF-α in ARPE-19, the retinal pigment epithelium derived cell line [332], and mrna levels of ADAMTS-4 and -8 are upregulated in human atherosclerotic plaques by IFN-γ, IL-1β and TNF-α [333]. The thyroid hormone, tri-iodothyronine, increases ADAMTS-5 but not ADAMTS-4 mrna levels in cartilage, which in turn degrades aggrecan during endochondral ossification [251]. The amounts of ADAMTS-1 mrna in osteoblasts and bone are also stimulated in response to parathyroid hormone [252]. Luteinizing hormone and hcg induce ADAMTS-1 production in pre-ovulatory granulosa cells, and this is under the control of progesterone and its receptor, resulting in ADAMTS-1 playing a critical role in follicular rupture [334, 335]. GnRH-I is also involved in this process, and ADAMTS-1, -2, -3, -5, -7, -8 and -9 mrna levels are either up or down regulated at 24h post-gnrh-i in bovine preovulatory and periovulatory follicles [336]. In cattle, the abundance of mrna for ADAMTS-1,- 2, -7 and -9 in theca and granulose cells is regulated by GnRH-I in time- and cell- specific manners [337]. DNA methylation and demethylation are also thought to regulate ADAMTS expression. Although deficient in control cartilage, expression of ADAMTS-4 is increased due to DNA demethylation at specific CpG sites in the ADAMTS-4 promoter, which leads to a inheritable 46

60 and irreversable change in the ADAMTS-4 expression pattern in osteoarthritis chondrocytes [338]. ADAMTS-8 is downregulated in several brain tumors by promoter hypermethylation [339], and a similar observation has been made in lung carcinomas [340]. The frequency of ADAMTS-9 promoter methylation is also significantly higher in gastric cancer, colorectal cancer and pancreatic cancer compared with normal tissues, and the expression levels of ADAMTS-9 are inversely correlated with methylation levels [341] Post-transcriptional regulation Some ADAMTS proteins are regulated through alternative splicing at the 3 end of the open reading frame [332, 335, 342]. The full coding sequences of ADAMTS-6, -7 and -9 contain a PLAC domain next the four TSP repeats, seven TSP repeats seperated by a mucin module and terminated by a PLAC domain, and fourteen TSP repeats followed by a GON-1 module [256]. However, the apparent molecular sizes of ADAMTS-6, -7 and -9 in biological samples are different from the predicted sizes and co-expression of short and long forms is observed, suggesting that this family of enzymes might be regulated by RNA splicing, by which the ancillary domains of the proteases are modified. In ADAMTS-6, two spliced variants, one terminating immediately after the prodomain and another one after the metalloprotease domain, have been identified [342]. The 5 untranslated region (5 UTR) in the ADAMTS-6 mrna sequence has a potential role in translational control. The 5' UTR in the ADAMTS-6 mrna possesses numerous upstream initiation codons ATG. Next to the initiation codons are very short open reading frames 47

61 which are potentially involved in the recruitment of ribosomes to non-productive regions, therefore inhibiting the downstream translation. Either through the use of an alternative promoter or by mrna processing, production of a transcript lacking these upstream ATGs can restore protein production [342]. This mechanism of regulation has been implicated in several diseases [343] Post-translational regulation of ADAMTS proteases Apart from ADAMTS-7, -9 and -13, which are active with their prodomains intact [263, 344, 345], most ADAMTS enzymes are synthesized as inactive zymogens, and then undergo N-terminal processing to be activated. The process is initiated by a signal peptidase, which is located in the endoplasmic retriculum (ER) and directs the transit of the zymogen to the ER membrane, where the maturation continues. Afterwards, prodomain removal is processed by furin, a widely expressed proprotein convertase, or other proprotein convertases. The prodomain contains a cleavage site that can be recognized by zymogen convertases. In general, the prodomain maintains enzyme latency, but it is also predicted to direct the proper folding and secretion of proteins [346]. In furin-deficient cells, the removal of the pro-domains of ADAMTS-1 [347], ADAMTS-7 [263], ADAMTS-9 [295] and ADAMTS-12 [249], is either severely inhibited or completely blocked, but can be rescued in response to furin. The ADAMTS-4 zymogen is localized together with furin in the trans-golgi network [254], suggesting that this is where processing occurs. However, apart from furin, other proprotein convertase may also remove the prodomain. For instance, ADAMTS-4 zymogen can be 48

62 appropriately processed in RPE40, the furin-deficient cell line [254]. One or more additional cleaving sites are identified at the upstream of the primary site among several ADAMTS [250], and it is predicted that sequential removal of the N-terminal region of the ADAMTS accounts for their extracellular presence or release. In general, processing takes place in the trans-golgi network, but ADAMTS-9 is an exception to this rule because it specifically undergoes processing by furin at the cell surface [345] Regulation by the ancillary domains Both the substrate specificity and localization of ADAMTS enzymes are determined by their ancillary domains. Processing to remove C-terminal fragments has been described for the maturation of several ADAMTS, such as ADAMTS-1 [248, 347], ADAMTS-4 [348], ADAMTS-8 [248], ADAMTS-9 [295], ADAMTS-12 [249] and ADAMTS-18[349]. C-terminal processing occurs by autocatalysis or cleavage by other enzymes. For ADAMTS-4, C-terminal processing is observed to occur as an autocatalytic event [255], but MMP-17 also mediates this to form truncated isoforms with varying length [348, 350]. Cleavage sites locate within the spacer region with the exception of ADAMTS-12, which contains a cleaveage site within the mucin module. The C-terminal processing varies according to distinct ADAMTS subtypes. One C-terminal processing event occurs in ADAMTS-1, -8 and -12, while there are two processing events in ADAMTS-4. These C-terminal processing events positively or negatively alter the activities of these proteins, depending on the cleavage site. The activities of the metalloprotease domains of the ADAMTS are influenced by the 49

63 CRD-spacer region. MMP-17 cleaves the C-terminus of ADAMTS-4 to form a ~53 kda truncated isoform which has a high binding affinity for syndecan-1, whereas further cleavage to yield a 40 kda isoform causes the release from syndecan-1 [350]. The binding affinity of ADAMTS-1 and -4 proteins for heparin is reduced by proteolytic cleavage within the CRD-spacer portion, suggesting that the spacer module influences these interactions [347, 348]. In addition, this processing reduces the anti-angiogenesis effect of ADAMTS-1 and alters the aggrecanase activity of ADAMTS-4 [347, 348]. Also, removal of the CRD-spacer region in ADAMTS-13 leads to a marked reduction in vwf cleaving activity [351]. Furthermore, the released C-terminal fragments may have independent biological activities Regulation by other endogenous factors TIMPs are the principal endogenous ECM inhibitors of ADAMTS, although some TIMPs possess a limited inhibitory capacity [352]. Among the TIMP family, TIMP-3 is unique since it tightly binds to the ECM, and is found exclusively within the ECM, whereas the other TIMPs are diffusible when secreted [353]. TIMP-3 potently inhibits aggrecan-cleaving activity of ADAMTS-4 and ADAMTS-5 through the interaction with their C-terminal domains containing the central TSP and spacer domains [354, 355], whereas TIMP-1, -2 and -4 display little or no inhibitory effect on the two aggrecanases [356, 357]. In cartilage, the inhibition of ADAMTS-4 by TIMP-3 is surprisingly enhanced by aggrecan, which improve binding affinity for TIMP-3 by interacting with the TSP and spacer domains of ADAMTS-4, suggesting that the tissue environment can modulate the biological function of the proteinase and its inhibitor [355]. 50

64 TIMP-2 and TIMP-3 partially inhibit ADAMTS-1, but the latter metalloprotease is insensitive to TIMP-1 and TIMP-4 at similar concentrations, suggesting the balance between this protease and its inhibitors determine their biological functions [358]. Moreover, ADAMTS-2 is inhibited by TIMP-3 [359]. In addition to the TIMP family, there are some more endogeneous inhibitors of ADAMTS. The serine proteinase inhibitor, α2 macroglobulin (α2m), is one of them. ADAMTS-4, -5 and -12 cleave α2m in the bait region in vitro, and consequently the proteinases are trapped and inactivated by α2m [249] [360], but it is not clear whether this inhibitory action occurs in vivo. In addition, Papilin, a protein homologous with the ancillary domains of the ADAMTS, displays a non-competitive inhibitory effect on ADAMTS-2 [361]. Furthermore, the C-terminal region of fibronectin contains potently inhibitory property on ADAMTS-4 [362]. Some molecules also facilitate ADAMTS activation. Syndecan-4, another transmembrane heparin sulfate proteoglycan, can bind ADAMTS-5 via its heparin sulfate chains, therefore increasing ADAMTS-5 activity [363]. However, it is worth noting that in drug research, several chemicals and natural products specifically inhibiting aggrecanases ADAMTS-4 and -5 have been identified as potential therapeutic agents for arthritis, tumor metastasis and vascular diseases [364, 365]. 51

65 1.4 Characterizations of ADAMTS ADAMTS-12 structure ADAMTS-12 exhibits a similar domain organization to the other ADAMTS family members, with a unique number and organization of the TSP repeats. It displays a high degree of homology with ADAMTS-7, which contains seven TSP repeats interrupted by a mucin domain, also called the spacer-2 domain, and followed by a PLAC domain. Thus these two proteinases form a subgroup within the ADAMTS family (Figure 1.4). ADAMTS-12 is synthesized as inactive precursor molecule with a predicted molecular mass of 178 kda. The pre-proteinase is activated by cleavage of the prodomain during intracellular processing that is mediated by furin. Subsequently the process generates two fragments of different sizes. The 120-kDa N-terminal fragment contains the metalloproteinase and disintegrin-like domains. This fragment exhibits proteolytic activity by interacting with α 2 M. The 83-kDa C-terminal fragment contains the spacer-2 and the four TSP repeat domain of ADAMTS-12. Both fragments are anchored to ECM. BB-94, the broad spectrum hydroxamate inhibitor partially blocks the maturation process, indicating that MMP is likely related to the generation of these two ADAMTS-12 fragments [249]. The known substrates and inhibitors of ADAMTS-12 are summarized in Table Regulation of ADAMTS-12 expression Cytokine-mediated induction of ADAMTS-12 expression is cell-type specific. TNFα and IL-1β strongly increases the ADAMTS-12 mrna levels in human cartilage explants compared 52

66 with untreated tissues [366], whereas the granulin-epithelin precursor (GEP), a secreted growth factor, inhibits TNFα induced ADAMTS-12 expression [367]. However, in another study, only TGFβ significantly induced the expression of ADAMTS-12 in human fetal fibroblasts, whereas TGFα, IL-1α, IL-1β, EGF, and acidic fibroblast growth factor do not display any apparent influence on ADAMTS-12 mrna levels [249]. In EVTs, a significant reduction in ADAMTS-12 mrna was identified after the addition of TGF-β1, while IL-1β leads to a continuous and significant increase in ADAMTS-12 mrna level [368] Function of ADAMTS-12 ADAMTS-12 has been identified in fetal lung tissue [249], as well as in adult mammary stromal fibroblasts and myoepithelial cells [311], suggesting that it may play roles during fetal developmental and reproductive process. ADAMTS-12 is also present in cartilage, synovium, tendon, skeletal muscle and fat, contributing to the support of the body [370]. In cancer research, ADAMTS-12 expression has been noted in gastrointestinal, colorectal, renal and pancreatic carcinomas, as well as in Burkitt's lymphoma [249], suggesting that ADAMTS-12 is involved in tumor processes potentially through its proteolytic activity or as a modulatory molecule mediating cell proliferation, migration or invasion. In addition, it has been suggested that ADAMTS-12 acts as a tumor-suppressor, which is capable of inhibiting the proliferative capacities of cancer cells and displaying anti-angiogenesis effects [372]. This proteinase blocks the Ras-dependent extracellular signal-regulated kinase (ERK) signaling pathway in 53

67 Figure 1. 4: Domain structure and organization of ADAMTS-7 and ADAMTS-12 (Adapted from Liu, Nat Clin Pract Rheumatol, 2009:5(1) [369]) Table 1. 2: The known substrates and inhibitors of ADAMTS-12 COMP, cartilage oligomeric matrix protein; GEP, granulin-epithelin precursor; α2m, α2 macroglobulin Substrates Inhibitors In vivo COMP [366], GEP [367] GEP [367] In vitro α2m [366],COMP [370],aggrecan [371] α2m [366] 54

68 Madin-Darby canine kidney cells, subsequently preventing hepatocyte growth factor induced tumorigenesis, and the domains following the disintegrin-like domain are required for this activity [371]. In addition, subcutaneous tumors induced by A549 endocarcinomic human alveolar basal epithelial cells overexpressing ADAMTS-12 display a considerable growth deficiency as compared with those induced by parental cells [371]. The ADAMTS-12 is epigenetically silenced by the hypermethylation of promoter in a variety of cancers [372]. The ADAMTS-12 knockout mouse, Adamts12 -/-, displays a higher angiogenic response and tumor invasion [373]. Furthermore, enhanced ADAMTS-12 expression is observed in the stromal cells embracing epithelial malignant cells compared with the paired normal cells [372]. Likewise, colon fibroblasts in co-culture with colon cancer cell lines express a higher level of ADAMTS-12 than those cultured alone. These enhanced expression patterns of ADAMTS-12 have been associated with an anti-proliferative and anti-angiogenic properties in cancer cells [372]. In the pathogenesis of arthritis, significant increases of ADAMTS-12 expression occur in the cartilage from osteoarthritis patients, when compared to normal cartilage, suggesting that it may account for ECM degradation and correlate with the activities of the MMPs and TIMPs [244]. Proteolytic activity is required for the ADAMTS-12 inhibition of chondrogenesis, since a ADAMTS-12 point mutant without catalytic property entirely fails to exhibit this function, and the four TSP repeats are necessary for ADAMTS-12 catalytic property and inhibitory effect on chondrocyte differentiation [374]. Together with ADAMTS-7, ADAMTS-12 directly binds with and cleaves the cartilage oligomeric matrix protein (COMP), a prominent noncollagenous component of cartilage. The presence of four C-terminal TSP repeats of ADAMTS-7 and -12 are 55

69 essential for this cleavage activity. In addition, α2m and GEP act as their substrates and efficiently protect COMP degradation by these proteinases [366, 369]. Moreover, GEP co-locates with ADAMTS-12 on the cell surface of chondrocytes, and the latter binds with GEP through the C-terminal four TSP repeats, which bind and degrade the COMP substrate [370]. Therefore GEP competitively inhibits COMP degradation by ADAMTS-12 [261] Roles for ADAMTS-12 in human trophoblastic cell invasion Previously, our laboratory has identified that a variety of ADAMTS family members are expressed in first trimester human placenta (Figure 1.5) (Beristain and MacCalman, unpublished). Of these, only ADAMTS-12 was found to be present at higher levels in primary cultures of invasive EVTs than in poorly invasive JEG-3 cells. Studies using sirna and stable transfection strategies demonstrated that ADAMTS-12 has an active and dominant role in promoting trophoblast invasion. The exogenous expression of a protease-dead form of ADAMTS-12 also increased the invasive capacity of trophoblastic cells, demonstrating that ADAMTS-12 promoted cellular invasion independently of its intrinsic proteolytic activity. Beristain next examined the effects of a broad synthetic MMP inhibitor (GM6001) [375] on JEG-3/ADAMTS-12 or JEG-3/ADAMTS-12-MUT cells. Using Transwell invasion assays, he determined that GM6001 reduced the invasive capacity of both JEG-3/ADAMTS-12 and JEG-3/ADAMTS-12-MUT to levels that were not significantly different from those observed for control JEG-3 cell cultures. These data strongly suggested that the MMP-domain of 56

70 Figure 1. 5: ADAMTS subtypes present in human placenta and trophoblastic cells. Southern blots were performed using RT-PCR products derived from RNA extracted from first trimester placenta (P), JEG-3 cells (J) or EVTs (E). (Beristain and MacCalman, unpublished) 57

71 ADAMTS-12 does not contribute to JEG-3 cell invasion. To determine the regulation of ADAMTS-12 expression, Beristain cultured EVTs in the presence of TGF-β1 and IL-1β respectively (Beristain and MacCalman, unpublished). ThemRNA level of ADAMTS-12 was significantly decreased by TGF-β1 but increased by IL-1β in a timeand concentration-dependent manner. To better understand the cellular mechanisms underlying ADAMTS-12-mediated invasion, Beristain then determined that JEG-3 cells constitutively expressing either wild type ADAMTS-12 (JEG-3/ADAMTS-12) or the protease dead form of ADAMTS-12 (JEG-3/ADAMTS-12-MUT) had similar binding affinities to their own ECM, but were both significantly reduced when plated on ECM produced by our control JEG-3/LacZ cells. Conversely, there was a significant decrease in the number of JEG-3/LacZ cells binding to the native ECM of both JEG-3/ADAMTS-12 and JEG-3/ADAMTS-12-MUT cells, indicating that ADAMTS-12 regulates cell-ecm interaction and that this event is independent of its proteolytic activity. The studies described in this dissertation are a logical progression from these observations. The hypothesis is that: ADAMTS-12 can be regulated by multiple factors including hormone, growth factor and cytokines in first trimester human placenta, which leads to a specific distribution of ADAMTS-12; ADAMTS-12 promotes cell invasion through particular functional domain(s); ADAMTS-12 modifies cell-ecm interaction through the alteration of cell adhesion molecules and ECM components, therefore promoting cell invasion. The overall objective of these studies was to explore the molecular mechanisms of ADAMTS-12 in the regulation of 58

72 trophoblast invasion. Dr. H Zhu contributed to the immunohistochemical staining and GnRH regulation experiments in these studies (Figure 3.1, 3.2, 3.3 and 3.4). 59

73 CHAPTER 2: EXPERIMENTAL PROCEDURES 2.1 Materials Tissues Placental explants were obtained from women undergoing elective termination of pregnancy at 8 to 12 weeks of gestation. The use of placental tissues was approved by the Committee for Ethical Review of Research involving Human Subjects, University of British Columbia. All patients provided informed written consent. Samples of the placental explants were snap frozen for later extraction of total RNA and protein, fixed for immunohistochemical staining, or processed for cell isolation and/or tissue culture Cell lines JEG-3 human placental choriocarcinoma cells were purchased from ATCC (Manassas, VA, US). On-going cultures were maintained in Dulbecco s Modified Eagle s Medium (DMEM) (GIBCO, US) containing 25mM glucose, L-glutamine and supplemented with 5% fetal bovine serum (FBS) (HyClone, US). The HTR-8/SVneo human first-trimester extravillous trophoblastic cells were kindly provided by Dr. CH Graham, Queen's University, Kingston, Ontario, Canada, 60

74 and were cultured in DMEM containing 25mM glucose, L-glutamine and supplemented with 5% FBS Extravillous trophoblast (EVT) Primary cultures of EVTs were propagated from first trimester placental explants as previously described [376]. Briefly, chorionic villi were washed three times in PBS. The villi were minced finely and plated in 25cm 2 tissue culture flasks containing DMEM supplemented with antibiotics (100U/ml penicillin, 100u g/ml streptomycin) and 10% FBS. The fragments of the chorionic villi were allowed to adhere for 2-3 days, after which any non-adherent tissue was removed. The villous explants were cultured for a further days with the culture medium being replaced every 48 h. The EVTs were separated from the villous explants by a brief (2-3 min) 0.25% trypsin digestion at 37 o C and plated in 60 mm 2 culture dishes in DMEM supplemented with antibiotics and 10% FBS. The purity of the EVT cultures was determined by immunostaining with a monoclonal antibody directed against human cytokeratin filaments 8 and 18 (Sigma Aldrich, St Louis, MO, USA) [377]. Only cell cultures that exhibited 100% immunostaining for the epithelial cellular marker were used for further studies. 61

75 2.2 Methods Immunohistochemistry staining Immunohistochemistry was performed using frozen sections prepared from permanent paraffin blocks containing first-trimester chorionic villi (n = 3). The tissue sections were immunostained using polyclonal antibodies directed against human ADAMTS-12 on three independent occasions. Non-specific antibodies (IgG) were used as the negative control. All antibodies were used at a dilution of 1:1000. Sequential incubations were performed in turn [74]: in 10% normal goat serum for 30 min, in primary antibody at 37 C for 1 h, in secondary biotinylated antibody at 37 C for 45 min, in streptavidin-biotinylated horseradish peroxidase complex reagent at 37 C for 30 min, after which the sections were washed by PBS. Then the sections were exposed to chromagen reaction solution (0.035% diaminobenzidine and 0.03% H 2 O 2 ) for 10 min, washed in tap water for 5 min, counterstained in hematoxylin, dehydrated, cleared, and mounted Hormone treatments EVTs (5 x 10 6 cells) were plated in 60mm 2 tissue culture dishes and grown to 80% confluency. The cells were then washed with PBS and cultured in DMEM under serum-free conditions. 24 h after the removal of serum from the culture medium, the cells were washed 62

76 again with PBS before being cultured in the presence of increasing concentrations of GnRH-I or GnRH-II (0, 0.1, 1, 10, or 100 nm) for 24 h or a fixed concentration of GnRH-I or GnRH-II (100 nm) for 0, 3, 6, 12, or 24 h. To inhibit the regulatory effects of GnRH-I, cultures of EVTs were treated with Cetrorelix, a GnRH-I antagonist, at increasing concentrations of 0, 1, 10 or 100nM for 24 h. In addition, EVTs were cultured in the presence of either GnRH-I (100nM), GnRH-II (100 nm) alone or in combination with Cetrorelix (0, 1, 10 or 100nM) for 24 h. The concentrations of hormones used in these studies are based upon a previous report [79] RNA preparation and generation of first-strand cdna Total RNA was prepared from the primary cultures of EVTs or cell lines using Trizol (Invitrogen, US) following the protocol recommended by the manufacturer. To verify the integrity of the RNA, aliquots of the total RNA extracts were electrophoresed in a 1% (w/v) denaturing agarose gel containing 3.7% (v/v) formaldehyde and the 28 S and 18 S ribosomal RNA subunits visualized by ethidium bromide staining. The purity and concentration of total RNA present in each of the extracts were determined by optical densitometry (260/280nm) using a Ultrospec 3000 UV-spectrophotometer (Pharmacia Biotech, Uppsala, Sweden). Aliquots (1ug) of total RNA extracts were reverse-transcribed into cdna using SuperScript VILO cdna Synthesis Kit (Invitrogen, US) according to the manufacturer s instructions. 63

77 2.2.4 Real-time PCR The cdna generated from the total RNA served as a template for real-time PCR using the ABI PRISM 7300 sequence detection system (PerkinElmer Applied Biosystems, Foster City, CA) equipped with a 96-well optical reaction plate. The primers used for SYBR Green Real-time quantitative PCR were designed using the Primer Express Software version 3.0 (PerkinElmer Applied Biosystems) (Table 2.1). The reactions were set up with 12.5 µl 2 x PCR Taq MasterMix (ABM, Richmond, CA), 7.5 µl of primer mixture (300 nm), and 5 µl of cdna template with 1:11 (v/v) dilution. The conditions were as follows: 52 C for 2 min followed by 95 C for 10 min and 40 cycles of 95 C for 15 sec and 60 C for 1 min. All real-time PCR were performed in duplicate, with the mean values to determine the corresponding mrna levels. The Table 2. 1: Primer sequences for real-time PCR Gene Primer Sequence Integrin α9 Integrin β6 ADAMTS-12 GAPDH F5 -CCCGTCCACCATTGATGTG-3 R5 -CCTTGCCGATGCCTTTGT-3 F5 -TGGCCAAGCCCGAGAAG-3 R5 -ACTGATGGTCGCACCAGCTAGT-3 F5 -CCACCGTGAGGGCTGAGT-3 R5 -TTTGGGTGTGTGTGATGTGTGT-3 F5'-ATGGAA ATCCCATCACCATCTT-3' R5'-CGCCCC ACTTGATTTTGG-3' 64

78 amplification efficiency was determined by plotting log cdna dilution against CT ( CT = C T.Target C T.GAPDH ), the slope of which was close to zero, indicating maximal and similar efficiency of the target and reference genes (data not shown). Relative mrna levels were determined using the formula 2 CT where CT = (C T.Target C T.GAPDH ) X (C T.Target C T.GAPDH ) 0. In this formula, X represents any time point or experimental treatment, and control cultures are assigned a value of zero [79]. This experimental approach was further validated by the observation that differences between the C T for the target gene and GAPDH remained relatively constant for each amount of cdna examined Expression of recombinant human ADAMTS-12 and its C-terminal truncated mutants Mammalian expression vectors (pcdna3.1) containing either a full-length human ADAMTS-12 cdna (pcdna3-adam-ts12-ha) or a full-length human ADAMTS-12 cdna in which the catalytic domain had been inactivated by site directed mutagenesis (pcdna3-adam-ts12-mut) were generously provided by Dr. S. Cal (Universidad de Oviedo, Spain). These cdna constructs have been described in detail elsewhere [249]. Using pcdna3-adam-ts12-ha plasmid DNA as template, coding sequences for ADAMTS-12 (12-FL) and four C-terminal truncated mutants:12-mmp, 12-Dis, 12-Cys and 12-TSP1 were amplified by Phusion High-Fidelity PCR Kit (Finnzymes, Finland). All these fragments were initiated from the same AUG start codon but ended at distinct domains. The 65

79 12-MUT coding sequence was also amplified using the pcdna3-adam-ts12-mut as the template. The diagram of all constructs is shown in Figure3.6.The specific nucleotide sequences of primer sets are listed in Table 2.2. The PCR was carried out for 28 cycles of denaturation (5 s at 98 C), annealing (30 s at 53 C) and extension (30 s to 2 min at 72 C). The PCR products were ligated into the mammalian expression vector pcdna3.1d/v5- His-TOPO (Invitrogen, US) in the forward orientation using standard molecular biology techniques and this was subsequently verified by nucleotide sequencing analysis following by the analysis using BLAST software (available at blast.ncbi.nlm.nih.gov/blast.cgi) Expression vector Mammalian expression vector pcdna 3.1D/V5-His-TOPO (Invitrogen, US) was used for stable expression of recombinant proteins. It contains CMV, T7 and SV40 early promoters, TOPO recognition sites, an ampicillin resistance gene, and a 3 -terminal tag encoding the V5 epitope and a 6 x His peptide (Figure 3.6). The control plasmid, pcdna 3.1D/V5-His/LacZ, contains a 3.2 kb fragment containing the β-galactosidase gene cloned in frame with the C-terminal peptide. It was used to determine transfection efficiency and served as a control for these studies. 66

80 Table 2. 2: Primer sequences and PCR conditions Estimated PCR Gene Primer Sequence Product Size (bp) PCR conditions Denaturing: 98 C 5s Annealing: 53 C 15s ADAMTS12-MMP ADAMTS12-Dis ADAMTS12-Cys ADAMTS12-TSP1 ADAMTS12-FL GAPDH Laminin α 3 Laminin β 3 F5 -CACCATGATGCCATGTGCCCAGAGGAG-3 R5 -CTTGGACTTCAAGCCTTTC F5 -CACCATGATGCCATGTGCCCAGAGGAG-3 R5 -GCCTCCAGGAATGCTCTCTGG F5 -CACCATGATGCCATGTGCCCAGAGGAG-3 R5 - GGAAGAGCCATCTCCCAGGCA F5 -CACCATGATGCCATGTGCCCAGAGGAG-3 R5 -GCATTGCTGGAGGCCACAC F5 -CACCATGATGCCATGTGCCCAGAGGAG-3 R5 -CTTTTGACTTTTGGAGCAAC F 5 -ATGTTCGTCATGGGTGTGAACCA-3 R 5 -TGGCAGGTTTTTCTAGACGGCAG F5 -GGCCTCATTTGGATTTCAGA-3 R5 -GCAAACTGTGACCTGGGTTT Forward:5 -CATCTACCTGTGGACTGACCAA-3 Reverse:5 -GGAATCCCAGACACTAAATCCA Extension: 72 C 30s 28 cycles Denaturing: 98 C 5s Annealing: 53 C 15s Extension: 72 C 60s 28 cycles Denaturing: 98 C 5s Annealing: 53 C 15s Extension: 72 C 90s 28 cycles Denaturing: 98 C 5s Annealing: 53 C 15s Extension: 72 C 120s 28 cycles Denaturing: 98 C 5s Annealing: 53 C 20s Extension: 72 C 180s 28 cycles Denaturing: 94 C 45s Annealing: 55 C 30s Extension: 72 C 60s 19 cycles Denaturing: 98 C 10s Annealing: 52 C 15s Extension: 72 C 15s 29 cycles Denaturing: 98 C 10s Annealing: 56 C 15s Extension: 72 C 15s 24 cycles Denaturing: 98 C 10s Forward:5 -CCAAATGGCTTTAAAAGTCTGG-3 Annealing: 56 C 15s Reverse:5 - TCTCCCACTTTTTCCATTCTGT-3 Extension: 72 C 15s Laminin γ cycles 67

81 2.2.7 Generation of stably transfected JEG-3 cell lines JEG-3 cells were seeded at 0.5 x 10 5 /ml in 35 mm 2 plates containing DMEM supplemented with 5% FBS. The cells were cultured overnight and transfected with pcdna-12-mut, pcdna-12-fl, pcdna-12-mmp, pcdna-12-dis, pcdna-12-cys, pcdna-12-tsp1 and pcdna-lacz the following day with 1.5ug plasmid DNAs using Lipofectamine 2000 (Invitrogen, US) according to the manufacturer s instructions. The stable cell lines were selected after 48 h of transfection using G418 antibiotic (700ug/ml DMAM, Invitrogen). Positives were then subcloned by limiting dilution and expanded into cell lines that were maintained in the selection medium. At least three independent clones were selected per construct based solely on expression levels of the exogenous mrna, as determined by PCR analysis (data not shown). After 2 weeks of selection, the stable transfected cells were used for further experiments sirna transfection sirna (6 nmol/35mm 2 culture dish; Qiagen, US) targeting the human ADAMTS-12 mrna transcript 5 -CAGGAAAGACGGCAAACCGTA-3 was transfected into HTR-8/SVneo using 8 μl of Oligofectamine reagent (Invitrogen, US) according to the manufacturer s protocol. Cells tranfected with a non-silencing, scrambled AllStars Negative Control sirna (Qiagen, US) or cultured in the presence of Oligofectamine reagent alone, served as negative controls for these studies. The concentration of sirnas and the concentration ratio of Oligofectamine:siRNA were optimized before these studies (data not shown). RNA and proteins were extracted 24 h or 48 h 68

82 respectively after sirna transfection Immunofluorescence staining Cells were seeded at 0.75 x 10 5 /ml on coverslips. After a 24 h incubation, the cover slips were rinsed with PBS and cells were fixed in 100% methanol at -20 o C for 5 min. Then the cells were washed again with cold PBS and incubated in PBS with 0.2 % Triton X-100 for 15 min. To stain the cells, coverslips were incubated in TBST containing 5% BSA for 20 min to block unspecific binding and then incubated with mouse monoclonal anti-his antibody (Santa Cruz) at 1:4 dilution for 1 h. After a quick wash, cells were incubated with secondary antibody goat anti-mouse IgG1 conjugated with Alexa Fluor 488 (Santa Cruz) at 1:50 dilution for 1 h. The specimens were observed under a fluorescence microscope with appropriated optical filters Western blot analysis Cultures of JEG-3, HTR-8/SVneo cells or EVTs were washed three times in ice cold PBS and incubated in 100 μl of cell extraction buffer (Biosource International, Camarillo, CA) supplemented with 1.0 mm PMSF and proteinase-inhibitor cocktail for 30 min on a rocking platform. The cell lysates were centrifuged at 10, 000 x g for 10 min at 4 o C and the supernatants were used for Western blot analysis. The concentrations of protein in the cell lysates were determined by Bradford protein assay using a BSA standard curve. Western blots containing aliquots (30 μg) of the cell lysates were loaded on 10% sodium dodecyl sulfate-polyacrylamide 69

83 gels and after electrophoresis they were transferred electrophoretically to a nitrocellulose membrane (Amersham Pharmacia Biotech, Sweden). The membrane was incubated with a rabbit polyclonal antibody directed against the carboxyl terminal of human ADAMTS-12 (Santa Cruz, US), rabbit polyclonal laminin β3 antibodies, goat polyclonal laminin γ2 antibodies, mouse anti-human FAK (BD Biosciences, US), rabbit polyclonal P-SAPK/JNK antibodies, rabbit polyclonal SAPK/JNK antibodies, mouse monoclonal P-ERK1/2 antibodies, rabbit polyclonal ERK1/2 antibodies (Cell Signaling, US), mouse monoclonal His antibodies (Invitrogen, US) at 4 o C overnight and further incubated with anti-mouse, anti-goat or anti-rabbit IgG-conjugated horseradish peroxidase (HRP) secondary antibody (Santa Cruz, US) at 1:1000 dilution for 1 h. To standardize the amounts of protein loaded in each lane, the blots were stripped and reprobed with a goat polyclonal β-actin antibody (Santa Cruz). The Amersham ECL system was used to detect the amount of each antibody bound to antigen. The resultant blots were analyzed by UV densitometry. The absorbance value obtained for the ADAMTS-12 protein species in each of the cell lysates was normalized relative to the corresponding β-actin absorbance value Transwell invasion assay Transwell invasion assays were performed to assess the capability of cells to invade a synthetic basement membrane in vitro. Briefly, growth factor reduced Matrigel (BD Biosciences, US) was thawed at 4 C overnight and then diluted with cold serum-free DMEM in a 1:40 ratio. 100 ul of the diluted Matrigel was plated into a pre-cooled 12-well insert fitted with a Millipore 70

84 Corp membrane (6.5-mm filters, 8-µm pore size; Costar, Toronto, ON, Canada). After incubation at 37 C for 4 h, the suspension was aspirated. 250ul of cells suspended in DMEM supplemented with 0.1% FBS at a density of 1x10 5 cells/ml were seeded into Matrigel-coated insert, which was then immediately immersed into a culture well containing 800ul of DMEM supplemented with 10% FBS. After 48 h incubation in a humidified environment (5% CO 2 ) at 37 C, the medium inside the inserts was discarded, and the inserts were placed into methanol at -20 C. 20min after fixing, the insert was immersed in PBS and then stained in Hemacolor (EMD chemicals, Germany). After washing with PBS, the non-invaded cells from the upper surface of the Matrigel layer were completely removed by gentle swabbing after which, the filter membrane was cut out and mounted with Cytoseal XYL (Richrd-Allan Scientific, US) onto a glass histology slide. The remaining cells that had invaded into the Magrigel and appeared on the underside of the filters were counted in at least 15 randomly selected nonover-lapping fields of the membranes under a light microscope. Each cell culture was tested in triplicate wells, on three independent occasions. The invasion index was expressed as the percentage of invasion compared with the corresponding control DNA array analysis First strand cdna was prepared as described above and diluted at 1:5.5 (v/v) ratio for use in a DNA array experiment. The experimental cocktail was composed of 12.5 µl 2 x PCR Taq mastermix (ABM, Richmond, CA), 1 µl of diluted first strand cdna, and 11.5 µl of distilled 71

85 water. 25 ul of this experimental cocktail was loaded to each well of the 96-well DNA array plates in an attempt to identify the transcripts of ECM and adhesion molecules (SABiosciences, US). Then the plates were subjected to real-time PCR by using the ABI PRISM 7300 sequence detection system and the conditions were the same as described in section 2.4. The array data were analyzed by web-based software ( Every cdna sample was analysed in two independent experiments Statistical analyses The absorbance values obtained from the ethidium bromide stained gels containing PCR products and the signals generated by Western blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, CA, USA). Statistical differences between the absorbance values were assessed by the analysis of ANOVA. Significant differences between the means were determined using Dunnett s test [80, 376]. Differences were accepted as significant at P < Data are shown as the mean ± SEM according to at least three independent experiments, each with at least two dishes of cells per treatment. DNA array and real-time PCR data for integrins were analyzed by t-test. Differences were accepted as significant at P < Data are shown as the mean ± SEM according to two independent experiments. Cellular invasion was analyzed by one-way ANOVA followed by the Tukey multiple comparison test [378]. Differences were considered significant for P <0.05. Data are shown as the mean ± SEM according to at least three independent experiments, each with at least two 72

86 dishes of cells per treatment. 73

87 CHAPTER 3: RESULTS 3.1 Distribution and hormone regulation of ADAMTS-12 in first trimester human placenta ADAMTS-12 proteins immunolocalize to the villous cytotrophoblasts and cytotrophoblast columns As previous studies had shown that ADAMTS-12 expression levels in primary cultures of EVT were significantly higher than those in poorly invasive JEG-3 cell lines (Beristain and MacCalman, unpublished), the next question was whether ADAMTS-12 expression sites in vivo correlate with the invasive capability of different trophoblast lineage in developing placenta. To determine this, I performed immunohistochemistry staining of chorionic villi derived from human first trimester placenta at 8-12 weeks of gestation (Figure 3.1). This demonstrated that ADAMTS-12 was intensively immunolocalized in the inner mononucleate villus cytotrophoblast layer, which can differentiate into invasive trophoblasts. In contrast, ADAMTS-12 immunostaining was weak in the outer multinucleated syncytial trophoblast layer, a poorly-invasive trophoblast lineage. Intense immunostaining for ADAMTS-12 was also observed in the columns of mononucleate EVT. These observations demonstrate that ADAMTS-12 expression in vivo is tightly associated with the invasive capability of host cells. 74

88 3.1.2 GnRH I and II regulate ADAMTS-12 mrna and protein levels in EVT As discussed in the Introduction, there is increasing evidence that GnRH-I and GnRH-II regulate human implantation and placentation. Both hormones are distributed in mononucleate villous trophoblasts and EVTs in vivo and in vitro. In contrast, GnRH-I but not GnRH-II is present in the outer multinucleated syncytial trophoblast layer of first trimester chorionic villi and in primary cultures of villous cytotrophoblasts in vitro [74]. In view of these observations, we investigated the potential influence of these two hormones on ADAMTS-12 mrna and protein levels in primary cultures of EVT (Figure 3.3 and 3.4). To do this, EVTs derived from first-trimester placenta explants were first identified by immunostaining with the fibroblast marker, vimentin, and the epithelial markers, cytokeratin 8 and 18, to guarantee cellular purity (Figure 3.2). Significant up-regulation in ADAMTS-12 mrna and protein levels were observed in EVTs cultured in the presence of GnRH-I (100nM) for 6 h, with the levels continuing to increase until the termination at 24 h (Figure 3.3-A, B). The addition of increasing concentrations of GnRH-I to the culture medium of these cells demonstrated that ADAMTS-12 expression levels in EVTs were regulated in a concentration-dependent manner (Figure 3.3-C, D). 10mM of GnRH-I significantly promoted ADAMTS-12 expression, and a higher concentration (100nM) further increased the expression. EVTs were co-treated with GnRH-I and Cetrorelix, a GnRH-I antagonist which competitively binds to GnRH-I receptor and blocks the activation of downstream signaling pathways. Cetrorelix alone displayed no effect on ADAMTS-12 75

89 expression (Figure 3.3-E, F), but it abolished the GnRH-I-mediated increase in ADAMTS-12 expression levels in these primary cell cultures (Figure 3.3- G, H). Likewise, the presence of GnRH-II (100nM) for 6 h significantly increased ADAMTS-12 mrna and protein levels in EVTs (Figure 3.4-A, B), and GnRH-II boosted ADAMTS-12 expression in a concentration-dependent manner (Figure 3.4-C, D). Moreover, Cetrorelix did not abolish the GnRH-II-mediated increases in ADAMTS-12 mrna or protein levels in EVTs, suggesting that GnRH-II has effects on ADAMTS-12 that are not mediated via the GnRH-I receptor. (Figure 3.4-E, F) Applied bioinformatics to predict transcription factor binding sites in ADAMTS-12 Our laboratory previously identified that TGFβ1 suppressed ADAMTS-12 mrna levels in EVT primary cultures in a concentration-dependent manner. Moreover, a function-perturbing monoclonal antibody directed against TGFβ1 abolished this TGFβ1 mediated decrease in ADAMTS-12 mrna levels (Beristain and MacCalman, unpublished). In contrast, IL-1β showed an opposite effect in EVT and increased ADAMTS-12 mrna level over time in culture (Beristain and MacCalman, unpublished). A function-perturbing monoclonal antibody directed against IL-1β also attenuated the increase in ADAMTS-12 mrna levels (Beristain and MacCalman, unpublished). Combinded with the discovery that GnRH-I and GnRH-II increased the ADAMTS-12 mrna and protein levels, these data suggest ADAMTS-12 is regulated by numerous hormones and cytokines at the gene expression level in EVTs. 76

90 Transcription factors control gene expression by sequence specific binding to the enhancers or promoters of target genes. Prediction of putative transcription factor binding sites (TFBS) aids identification of regulatory mechanisms controlling expression of specific genes. Online bioinformatic applications ( and ConSITE ( were therefore applied to identify potential transcription factor binding sites (TFBS) in the ADAMTS-12 promoter. A 4000-bp promoter region from to relative to the ADAMTS-12 transcription start site was analyzed for the presence of TFBS. To eliminate false-positive predictions of binding sites, we compared promoter conservation of human ADAMTS-12 (RefSeq# NM_030955) with mouse Adamts-12 (RefSeq# NM_175501), according to which the potential TFBS were predicted at low (60% conservation score) and high (70% conservation score) levels of conservation, respectively (Figure 3.5 A). The results was illustrated as the gapped alignment and a conservation plot (Figure 3.5 B, C). Among all these potential transcription factors, NF-κB and c-fos are two factors that are regulated by GnRH, TGFβ1, and/or IL-1β [379] [380] [381]. Thus, these factors may function to regulate ADAMTS-12 expression in trophoblast cells. 77

91 3.2 Functional domains of ADAMTS-12 that promote trophoblast invasion ADAMTS-12 promotes human trophoblast invasion through its disintegrin-like domain We have found that the preferential expression of endogenous or exogenous ADAMTS-12 confers an invasive phenotype in human trophoblastic cells in vitro, but the molecular mechanisms and the contributions of the individual protein domains of this ADAMTS subtype responsible for promoting trophoblastic cell invasion remain to be elucidated. As decribed in Chapter 1, ADAMTS-12 is a multi-domain protein composed of an N-terminal prodomain, a catalytic domain and a disintegrin-like domain, as well as ancillary domains that includes a central thrombospondin (TSP) domain, a cysteine-rich domain, a spacer-1 domain, three-tsp repeat motifs, a spacer-2 domain and a C-terminal four-tsp repeat motif. To assess the functional contributions of these domains, we performed a series of gain-of-function studies using the poorly invasive JEG-3 choriocarcioma cell line with low endogenous ADAMTS-12 expression levels, and stably transfected them with a mammalian expression vector pcdna3.1d/v5-his-topo (Figure 3.6 A) containing a protease dead form of ADAMTS-12 (12-MUT, generated by site-directed mutagenesis) or 3 -sequential deletion mutants corresponding to the putative functional domains of this ADAMTS subtype (12-TSP1, 12-Cys, 12-Dis, 12-MMP). JEG-3 cell lines stably expressing wild type ADAMTS-12 (12-FL) and LacZ served as positive and negative controls, respectively, with the invasive capacities of these cell lines determined by using a standard Transwell invasion assay (Figure 3.6 B). 78

92 The results showed that there was no significant difference between the invasive capacity of JEG-3 cells expressing the protease dead form of ADAMTS-12 and the wild type ADAMTS-12 control. Likewise, the sequential deletion of spacer-2 domain (12-TSP1); the TSP repeat motifs and spacer-1 domain (12-Cys); the cysteine-rich domain and the central TSP domain (12-Dis) of ADAMTS-12 had no influence on the invasive phenotype of these cells. There was no significant difference between the above truncated ADAMTS-12 and wild type ADAMTS-12. When compared with JEG-3/LacZ, these cells displayed significantly increased invasive capacity. In contrast, loss of the disintegrin-like domain (12-MMP) abolished the ADAMTS-12 mediated increase in the invasive capacity of these cells. Collectively, these findings indicate that ADAMTS-12 promotes an invasive phenotype independently of its intrinsic proteolytic activity, but that the invasive phenotype depends on its disintegrin-like domain (Figure 3.7) Disintegrin-like domain plays key role in ADAMTS-12 localization The ADAMTS family is a group of secreted proteins that anchor to the ECM. The disintegrin-like domain and ancillary domains have been shown to play important roles in regulating the subcellular localization and substrate-binding specificity. In order to evaluate whether the disintegrin-like domain is crucial for ADAMTS-12 localization in trophoblasts, the conditioned medium obtained from JEG-3 cells stably transfected with the expression vector pcdna3.1d/v5-his-topo containing a series of ADAMTS-12 C-terminal deletion mutants (12-TSP1, 12-Cys, 12-Dis and 12-MMP) were examined for the presence of these molecules. 79

93 These recombinant forms of ADAMTS-12 could be detected by Western blotting with an anti-his antibody, and in these studies JEG-3 cells stably expressing wild type ADAMTS-12 served as a control. As for wild type ADAMTS-12, truncated ADAMTS-12 mutants with the removel of the ancillary domains (i.e., 12-TSP1, 12-Cys, 12-Dis) were not present in the culture medium after expression in JEG-3 cells, suggesting that these truncated forms of ADAMTS-12 were not released from their cellular locations. However, further deletion of the disintegrin-like domain released the enzyme into the medium, indicating that disintegrin-like domain is required for ADAMTS-12 cellular localization (Figure 3.8). Since the truncated form of ADAMTS-12 lacking the Spacer-2 domain (12-TSP1) and wild type ADAMTS-12 (12-FL) are both more efficient at promoting cell invasion than the ADAMTS-12 mutant lacking the ancillary domains, i.e., 12-Dis (Figure 3.7B), we further investigated the potential contributation of ancillary domains to the cellular localization of ADAMTS-12. In this experiment, immunofluoresence staining was performed on JEG-3 cells stably transfected with wild type ADAMTS-12 (12-FL) or functional truncated forms of ADAMTS-12 (12-TSP1 and 12-Dis), and untransfected JEG-3 cells as a control. The results demonstrate that the truncated proteins, 12-TSP1 and 12-Dis, displayed a cellular localization that is similar to wild type ADAMTS-12. In essence, all of these proteins were present in both the cytoplasm and cell exterior, indicating that the ancillary domains do not influence the intracellular transit and cell surface localization of ADAMTS-12 (Figure 3.9). 80

94 3.3 ADAMTS-12 increases laminin-5 expression through the ERK/MAPK signaling pathway DNA array indicates ADAMTS-12 increases laminin β3 subunit expression Previous studies have shown that neither wild-type ADAMTS-12 nor a proteinase-dead form of ADAMTS-12 alters the ability of JEG-3 cells to aggregate, suggesting that cell-cell interactions are not modulated by ADAMTS-12 in these cells (Beristain and MacCalman, unpublished). However, cell-ecm binding was altered by exogenous expression of either wild-type ADAMTS-12 or a proteinase-dead form of ADAMTS-12, indicating that ADAMTS-12 is involved in cell-ecm interaction (Beristain and MacCalman, unpublished). This interaction can be regulated by cell adhesion molecules, ECM-degrading enzymes and remodeling of ECM components. Thus, we used DNA microarray to identify ECM and adhesion molecules that are involved in this process. A human ECM and adhesion molecule DNA array was performed in gain- or loss-of function studies using stable transfection and sirna strategies. The DNA array detects the expression of 84 genes involved in cell-cell and cell-matrix interactions, including ECM proteins and genes related to ECM structure, as well as ECM proteases and their inhibitors. The DNA array also included probes for cell adhesion molecules, including cell-cell adhesion molecules cadherins, cell-matrix adhesion molecules integrins, and others. In gain-of function studies, mrna was extracted from JEG-3 cells stably expressing full-length ADAMTS-12(12-FL), protease-dead ADAMTS-12 (12-MUT), functional truncated 81

95 ADAMTS-12 (12-Dis) or lacz (CTR). The expression levels of numerous ECM proteins and adhesion molecules were quantitated by real-time PCR using a DNA array kit (SABioscience, US), followed by web-based PCR array data analysis (Table 3.1). Among all those altered molecules, laminin β3, a gene encoding a subunit of the ECM protein laminin-5, was identified as being significantly up-regulated with the addition of 12-FL, 12-MUT and 12-Dis. 12-FL and 12-MUT were more efficient at increasing laminin β3 mrna than 12-Dis, suggesting that despite of the presence of the disintegrin-like domain, the ancillary domains are also involved in this modulation. The increase in laminin β3 mrna levels was similar after the addition of 12-FL and 12-MUT, indicating that the catalytic activity of ADAMTS-12 was not required for this process (Figure3.10 A). Meantime, HTR-8/SVneo, an immortalized highly invasive human trophoblast cell line with high endogenous ADAMTS-12 expression was transfected with sirna targeting ADAMTS-12 or a non-silencing sirna (Control). DNA array was performed to explore how gene expression is altered after the silencing of ADAMTS-12 (Table 3.2). Interestingly, no gene was up-regulated by more than 2 fold. However, consistent with the over-expression studies, laminin β3 was remarkably reduced after the addition of ADAMTS-12 sirna (Figure3.10 B) ADAMTS-12 increases laminin α3 and γ2 subunits mrna levels in JEG-3 cells Since laminin β3 together with the laminin α3 and γ2 subunits constitutes laminin-5, which is a protein in the basement membrane that may both separate and connect epithelial cells to the 82

96 surrounding ECM, we next measured the mrna levels of the laminin α3 and γ2 subunits by RT-PCR. The data indicate that laminin α3 and γ2 mrnas are up-regulated by exogenous expression of ADAMTS-12 in JEG-3 cells (Figure 3.11 A), and are lower in HTR-8/SVneo cells which have a reduced expression of ADAMTS-12 (Figure 3.11 B) ADAMTS-12 increases the levels of laminin β3 and γ2 subunits in JEG-3 cells We next measured the levels of laminin-5 subunits by Western blot. Both laminin β3 and γ2 were increased after exogenous expression of ADAMTS-12 (Figure 3.12 A). Conversely, these two laminin-5 subunits were suppressed in JEG-3 in which ADAMTS-12 levels were reduced by treatment with an ADAMTS-12 sirna (Figure 3.12 B). In these experiments, the antibody against the α3 subunit did not work (data not shown) These observations indicate that laminin-5 levels are increased in the presence of ADAMTS-12 and suppressed in the absence of this proteinase. Moreover, this modulation must also be partially dependent on the disintegrin-like domain and ancillary domains of ADAMTS-12, and independent of its catalytic activity. The addition of 12-FL and 12-MUT more efficiently increased mrna and/or protein levels of lamininα3, β3 and γ2 subunits than that of 12-Dis, suggesting that the ancillary domains of ADAMTS-12, which are removed from the truncated form 12-Dis, also contributes to the regulatory effect of ADAMTS-12. Other studies demonstrate a correlation between laminin-5 upregulation and the invasive activity of carcinoma cells [382]. For instance the γ2 chain of laminin-5, known as an invasive 83

97 marker [383], is strongly expressed at the invasive front of colorectal carcinomas [384, 385]. Our findings are the first to implicate ADAMTS-12 in the elevation of laminin-5 expression that has been reported to mediate the invasive phenotype ADAMTS-12 over-expression activates the ERK/MAPK signaling pathway in JEG-3 cells. According to Llamazares s studies, ADAMTS-12 exhibits anti-tumorigenic properties by blocking the activation of the Ras-dependent MAPK (Mitogen-activated protein kinases) signaling pathway, and that this regulation involves its ancillary domains [371]. Hence we asked how ADAMTS-12 regulates intracellular signaling pathways involved in modulating laminin-5 expression. To address this question, we prepared whole-cell extracts from JEG-3 cells stably transfected with pcdna3.1/12-fl or pcdna3.1/lacz, and the levels of ERK1/2 (extracellular signal-regulated kinase), JNK (c-jun N-terminal kinase) and FAK (Focal adhesion kinase) were evaluated by Western blotting (Figure 3.13). The results revealed that exogenous expression of ADAMTS-12 increased the levels of ERK1/2 and phosphorylated-erk1/2 (P-ERK1/2), while JNK and phosphorylated JNK (P-JNK) were not altered by the exogenous expression of ADAMTS

98 3.3.5 Laminin-5 expression is regulated by ADAMTS-12 activation of the ERK/MAPK signaling pathway To further explore the correlation between the ERK/MAPK signaling pathway and ADAMTS-12 induction of laminin-5 expression, the MAPK pathway inhibitor PD98059, which blocks the upstream kinase MAPK-ERK kinase 1 (MEK1), was used to block the ERK signaling pathway. The Western blot results showed that laminin β3 and γ2 levels were no longer increased by exogenous expression of ADAMTS-12 in cells treated with PD98059 (Figure 3.14). These results suggest that the increase of laminin-5 levels is induced by ADAMTS-12 and that this can be attributed to activation of the ERK/MAPK cascade. 3.4 ADAMTS-12 modulates integrin expression repertoire. In previous work, our group has demonstrated that the ability of JEG-3 cells to bind to specific ECM proteins is altered by exogenous ADAMTS-12 expression (Beristain and MacCalman, data not pubublished). Integrins play important roles in mediating cell-ecm interaction, and some integrin subtypes (i.e. α3β1, α6β4)have been identified as laminin-5 receptors [386]. Meanwhile, although we have found that ADAMTS-12 modulated the ECM component laminin-5 through the ERK/MAPK signaling pathway, the cell surface molecules involved in this process were still unclear. Therefore, we looked at the potential relationship between integrins and ADAMTS-12 levels in trophoblast cells. DNA array analyses combined with additional real-time PCR were performed to determine 85

99 how the expression of integrins differs in the presence or absence of ADAMTS-12. In this experiment, JEG-3 cells stably expressing ADAMTS-12 display up-regulation of integrin α1, α2, α4, α5, αl, αm and β 4, as well as down-regulation of α3, α7, α8, α9, β5 and β6 mrna. No significant alterations of α6, αv, β1, β2 and β3 expression were observed (Figure 3.15 A). However, HTR-8/SVneo cells transiently transfected with sirna directed against ADAMTS-12 revealed distinct modification. Integrin α5, α7 and β2 were promoted, whereas α6 and β1 were suppressed, and the expression of other integrins remained unchanged (Figure 3.15 B). 86

100 Figure 3. 1: Immunolocalization of ADAMTS-12 in chorionic villi derived from human first trimester placenta. (A) Paraffin sections of first-trimester chorionic villi immunostained with a non-specific polyclonal antibody were used as a negative control. (B) Sections immunostained with polyclonal antibodies directed against ADAMTS-12 proteins (brown). ADAMTS-12 specifically distributed in villous cytotrophoblasts (leftwards arrow) and the columns of mononucleate extravillous cytotrophoblasts (oval). In contrast, ADAMTS-12 expression was weak in outer layer syncytial trophoblast (rightwards open-headed arrow). Immunohistochemical analysis of these placental tissues was performed on three independent occasions. Scale bar = 10 µm. (gestational age 8 12 wk; n = 3). 87

101 88

102 Figure 3. 2: Identification of EVT cells derived from first trimester placenta explants. (A) Live primary culture of EVT, showing epithelial cell mophology. (B) EVT cells immunostained with monoclonal antibody directed against fibroblast marker vimentin were used as a negative control. (C) EVT cells immunostained with monoclonal antibodies directed against cytokeratin filaments 8 and 18 (brown). Scare bar = 100 um. (gestational age 8-12 wk; n=3). 89

103 90

104 Figure 3. 3: Regulatory effects of GnRH-I on ADAMTS-12 mrna and protein expression levels in primary cultures of EVT. Realtime-PCR and Western blot demonstrate mrna and protein levels of ADAMTS-12 in EVTs cultured in the presence of a fixed concentration of GnRH-I (100 nm) for 0, 3, 6, 12 or 24 h (A, Realtime-PCR; B, Western blot); increasing concentrations of GnRH-I (0, 0.1, 1, 10, 100 nm) for 24h (C, Realtime-PCR; D, Western blot); increasing concentrations of GnRH antagonist Cetrorelix alone (0, 1, 10, 100 nm) for 24h (E, Realtime-PCR; F, Western blot); or GnRH-I plus Cetrorelix at various concentrations for 24h. (G, Realtime-PCR; H, Western blot). The data are presented as the mean absorbance + S.E.M. (n=3; a= P<0.05 vs. untreated control; b=p<0.5 vs. GnRH-I alone) in the bar graphs below. 91

105 Relative protein levels Relative mrna levels A 2 a a a GnRH I (100nM) 0h 3h 6h 12h 24h B ADAMTS12 120KD Actin 42KD 2 a a a GnRH I (100nM) 0h 3h 6h 12h 24h 92

106 Relative protein levels Relative mrna levels C 2 a 1.5 a GnRH I (nm) D ADAMTS12 120KD Actin 42KD 2 a 1.5 a GnRH I (nm)

107 Relative protein levels Relative mrna levels E Cetrorelix (nm) F ADAMTS12 120KD Actin 42KD Cetrorelix (nm)

108 Relative protein levels Relative mrna levels G 2.5 a b GnRH I (nm) Cetrorelix (nm) H ADAMTS12 120KD Actin 42KD 2 a 1.5 b GnRH I (nm) Cetrorelix (nm)

109 Figure 3.4: Regulatory effects of GnRH-II on ADAMTS-12 mrna and protein levels in primary cultures of EVT. Realtime-PCR and Western blot demonstrate mrna and protein levels of ADAMTS-12 in EVTs cultured in the presence of a fixed concentration of GnRH-II (100 nm) for 0, 3, 6, 12 or 24 h (A, Realtime-PCR; B, Western blot); increasing concentrations of GnRH-II (0, 0.1, 1, 10, 100 nm) for 24h (C, Realtime-PCR; D, Western blot); or GnRH-II plus Cetrorelix at various concentrations for 24h (E, Realtime-PCR; F, Western blot). The data are presented as the mean absorbance + S.E.M. (n=3; a= P<0.05 vs. untreated control) in the bar graphs below. 96

110 Relative protein levels Relative mrna levels A a a a GnRH II (100nM) 0h 3h 6h 12h 24h B ADAMTS12 120KD Actin 42KD 2 a 1.5 a a GnRH II (100nM) 0h 3h 6h 12h 24h 97

111 Relative protein levels Relative mrna levels C 2 a a a GnRH II (nm) D ADAMTS12 120KD Actin 42KD a a a GnRH II (nm)

112 Relative protein levels Relative mrna levels E 2.5 a GnRH II (nm) Cetrorelix (nm) F ADAMTS12 120KD Actin 42KD a GnRH II (nm) Cetrorelix (nm)

113 Figure 3.5 Prediction of transcription factor binding sites in the ADAMTS-12 promoter. (A) Conservation profile of ADAMTS-12 transcription factor binding sites between human and mouse. Transcription factor score is set at 80%. Conservation score is 60% (blue and red) and 70% (red), respectively. (B) Graphic view of potent transcription factor binding sites in human ADAMTS-12 with conservation score at 60%. (C) Graphic view of potent transcription factor binding sites in human ADAMTS-12 with conservation score at 70%. The nucleotide numbering (-1000 to bp) is relative to the ADAMTS-12 transcription start site predicted by the ConSITE program. 100

114 A Transcription Human_A12 Mouse_A12 factor Sequence From To Score Strand Sequence From To Score Strand AGL3 CTGGTTATGG CTTAGTATGG Thing1-E47 AAGCCAGAGT AAGCCAGAAT Broad-complex CTGAGAGACAAATC TTCAGAAACAAATC _1 Spz1 AAGGTTGCAGA AAGGTTGCAGG Snail CAGATG CAGGTA c-fos AAGACTCA AAGAGTCA Sox-5 ATTGCTA ATTGCTG Sox-5 GTTGTTT GTTGTTT NF-Y CATGTGGTTGGCTGGC TGTGTGATTGGCTGTC Thing1-E47 TGCCTGGCAA TGCCTGGTAA RORalfa-1 TCTGAGGTCA TCCAGGGTCA bzip910 GTGACTT GTGACTT HMG-IY TGGCAAAGAGAAAAAT TGGCAAAGAGAAAAA A HFH-3 GCCTATTAGTTT GCTTATTAGTTG NF-kappaB GGGTCTCCCC GGGTCTCCCC NF-kappaB GGGTCTCCCC GGGTCTCCCC SQUA TCTCCCCTATTTGG TCTCCCCTATTTGG SRF TCCCCTATTTGG TCCCCTATTTGG AGL3 CCCTATTTGG CCCTATTTGG AGL3 CCCTATTTGG CCCTATTTGG SRF CCCTATTTGGCC CCCTATTTGGCC E74A GAGGAAG AAGGAAA Sox-5 AAACAAA CACCAAT Snail AAGGTG AAGGTG

115 102

116 103

117 Figure 3.6: Schematic structure of the mammalian expression vector for ADAMTS-12 and its C-terminal deletion mutants. (A) Map of pcdna 3.1D/V5-His-TOPO, showing the elements of the mammalian expression vector, as published in the Invitrogen instruction mannual. (B) Schematic representation of the structures of wild type ADAMTS-12 (12-FL), its protease-dead mutant form (12-MUT) and its C-terminal sequential deletion mutants (12-TSP1, 12-Cys, 12-Dis and 12-MMP). 104

118 A B 105

119 Figure 3.7: ADAMTS-12 enhancement of JEG-3 cell invasion is dependent on its disintegrin-like domain. (A) JEG-3 cells stably transfected with wild type (12-FL), protease-dead mutant (12-MUT) or trunctated forms (12-TSP1, 12-Cys, 12-Dis, 12-MMP) of ADAMTS-12 were determined by Western blot with anti-his antibody. (B) Invasion assay depicting the invasive capacity of JEG-3 cells stably transfected with various truncated forms of ADAMTS-12 containing the disintegrin-like domain (12-Dis, 12-Cys, 12-TSP1), 12-MUT and 12-FL was significantly enhanced. The sequential loss of the disintegrin-like domain (12-MMP) abolished the ADAMTS-12 mediated increase in the invasive capacity. The data derived from at least three independent sets of experiments were standardized to the control, and the statistical results are presented in the column graphs. a, P<0.05 vs. LacZ; b, P<0.01 vs. LacZ; c, P<0.01 vs. 12FL; d, P<0.05 vs. 12FL. 106

120 Invasive index A B c c d d b b 4 3 a a b LacZ 12-MMP 12-Dis 12-Cys 12-TSp1 12-FL 12-MUT 107

121 Figure 3.8: Removal of the disintegrin-like domain results in the release of restrained ADAMTS-12 from ECM. Media was obtained from JEG-3 cells stably transfected with wild type (12-FL), protease-dead mutant (12-MUT) and trunctated forms (12-TSP1, 12-Cys, 12-Dis, 12-MMP) of ADAMTS-12 and was assayed by Western blot with anti-his antibody. Truncated ADAMTS-12 with the removal of disintegrin-like domain (12-MMP) was detectable. The data are derived from at least three independent sets of experiments. 108

122 109

123 Figure 3.9: Immunofluorescence staining demonstrating the cellular localization of ADAMTS-12. JEG-3 cells stably transfected with wild type (12-FL) and functional trunctated forms (12-TSP1, 12-Dis) of ADAMTS-12 were grown on glass coverlips to confluence. JEG-3 served as a negative control. After being fixed, the cells were incubated with primary antibodies mouse monoclonal anti-his antibody, then incubated with secondary antibody anti-mouse IgG1 conjugated with Alexa Fluor 488. Glass coverslips were mounted onto microscope slides using DAPI mounting media. The specimens were observed under a fluorescence microscope with appropriated optical filters. The data are derived from at least three independent sets of experiments. 110

124 111

125 Figure 3.10: DNA array reveals ADAMTS-12 increases mrna levels of laminin β3. (A) The regulatory effect of exogenous expression of wild type (12-FL), protease-dead mutant (12-MUT) and truncated (12-Dis) form of ADAMTS-12 on laminin β3 mrna expression levels in JEG-3 cells. Cells stably expressing LacZ served as a negative control. (B) The reduction of ADAMTS-12 results in a decrease of laminin β3 in HTR-8/SVneo cells. ADAMTS-12 was transiently knocked-down by sirna (A12i). Cells transfected with non-silencing sirna served as a negative control (NS). (n=2) 112

126 Laminin β 3 under-expressed fold laminin β 3 overexpression fold A Group 12-Dis vs LacZ 12-FL vs LacZ 12-MUT vs LacZ Fold Regulation LacZ 12-Dis 12-FL 12-MUT B Group A12i vs NS Fold Regulation NS A12i 113

127 Figure 3.11: Laminin α3 and γ2 mrna levels are correlated to ADAMTS-12 expression. (A) Laminin α3 and γ2 mrna expression levels were up-regulated by exogenous expression of wild type (12-FL), protease-dead mutant (12-MUT) and truncated (12-Dis) form of ADAMTS-12 in JEG-3 cells. Cells transfected with LacZ served as a negative control. (B) Laminin α3 and γ2 mrna expression levels were suppressed with the reduced expression of ADAMTS-12 (A12i) in HTR-8/SVneo cells. Cells transfected with non-silencing sirna served as a negative control (NS). The data are derived from at least three independent sets of experiments. The data are presented as the mean absorbance + S.E.M. in the bar graphs below. a= P<0.05 vs. LacZ (A) or P<0.05 vs. CTR (B) 114

128 A 115

129 B 116

130 Figure 3.12: Protein expression of laminin β3 and γ2 are correlated with ADAMTS-12 expression. (A) Laminin β3 and γ2 were increased with the exogenous expression of ADAMTS-12(12-FL) and its mutant forms (12-MUT, 12-Dis). (B) Laminin β3 and γ2 expression levels were decreased with the knockdown of ADAMTS-12 in HTR-8/SVneo cells. The data are derived from at least three independent sets of experiments. The data are presented as the mean absorbance + S.E.M. in the bar graphs below. a= P<0.05 vs. LacZ (A) or P<0.05 vs. NS (B), b=p<0.5 vs. LacZ (A). 117

131 A 118

132 B 119

133 Figure 3.13: ADAMTS-12 positively regulates the ERK/MAPK signaling pathway. Levels of components of different signaling pathways (P-ERK, ERK, P-JNK, JNK and FAK) were evaluated by Western blot in the JEG-3 cells stably expressing ADAMTS-12. JEG-3 transfected with LacZ served as negative control. The data are derived from at least three independent sets of experiments. The data are presented as the mean absorbance + S.E.M. in the bar graph below. a= P<0.05 vs. LacZ. 120

134 Figure 3.14: Inhibition of ERK/MAPK signaling pathway attenuates ADAMTS-12-induced increase of laminin-5. JEG-3 cells stably expressing ADAMTS-12 were cultured in the presence of ERK inhibitor PD98059 at 50 um or vehicle (0.5% DMSO) for 48h before being subjected to Western blot. The data are derived from at least three independent sets of experiments. The data are presented as the mean absorbance + S.E.M. (n=3; a= P<0.05 vs. ADAMTS-12 transfection alone) in the bar graph below. 121

135 Figure 3.15: Integrin expression repertoire is altered by ADAMTS-12 in trophoblast cells. Integrin α9 and β6 mrna, which were not represented in a human ECM and adhesion molecule DNA array kit for the detection of, were detected by additional primers via real-time PCR. The other integrin transcripts were detected by DNA array. (A) The relative mrna levels of integrins in JEG-3 cells stably over-expressing wild type ADAMTS-12 (12-FL) are compared with JEG-3 cells stably transfected with LacZ (control). (B) The relative expression levels of integrin mrnas in HTR8/SVneo transiently transfected with ADAMTS-12 sirna are compared with cells transfected with non-silencing sirna (control). The C T values are analyzed by 2 - CT method and the data are presented as the mean value + S.E.M. (n=2; a=p <0.05 vs. control) in the bar graphs below. 122

136 A B 123