Nature Methods: doi: /nmeth Supplementary Figure 1
|
|
- Ariel Hill
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one of the openings is closed d) A filter formed by two triangular pillars. In all cases except the Cluster-Chip, cluster larger than the opening size passes due to its elastic behavior. The cluster being missed points to the importance of split flow fields simultaneously effecting the cluster in the Cluster-Chip and proves that the capture in the Cluster-Chip is not simply due to filtering. In all simulations, the opening widths and diameters of individual cells are 14 μm.
2 Supplementary Figure 2 Probability of chip-mediated artifact cluster formation from single cells on the Cluster-Chip. The calculated probabilities are based on simplifying assumptions on chip geometry and cell adhesion. We assume a blood sample with 1000 CTCs. In addition, each of the 4096 parallel cluster traps on the Cluster-Chip is assumed to have equal probability of receiving CTCs and whenever multiple CTCs go into the same trap, a CTC-cluster is formed. We used Poisson approximation to calculate probability of forming a CTC-cluster composed of a specific number of cells. Our model confirms that it is extremely unlikely to form artifact CTC clusters on the Cluster-Chip.
3 Supplementary Figure 3 Experimental setup used to quantify the capture efficiency of the Cluster-Chip. A smaller version of the Cluster-Chip is connected to a large microfluidic waste chamber, which permits to accurately identify and analyze non-captured cell clusters in whole blood. Both the chip and waste chamber are imaged using fluorescence microscopy to calculate the cell cluster capture efficiency.
4 Supplementary Figure 4 Distribution of captured small and large clusters on the Cluster-Chip. Normalized distribution of (a) 2-cell clusters (b) 3-cell clusters (c) clusters containing 4 or more cells across the Cluster-Chip. We used simulated whole blood samples spiked with artificial clusters of MDA-MB-231 breast cancer cell line. The Cluster-Chip was operated at 2.5 ml/hr and was on a thermoelectric cooler set at 4 C.
5 Supplementary Figure 5 Characterization of MDA-MB-231 cell cluster size distribution before spiking. We prepare clusters of fluorescently labeled MDA-MB-231 cancer cells and deposit the suspension on an ultra-low attachment culture dish. Using fluorescence microscopy, we count the number of cells within each cluster and then spike into whole blood in order to prepare a simulated sample containing characterized cluster population for quantitative device testing.
6 Supplementary Figure 6 Intact and damaged cell clusters captured using a membrane filter. Fluorescent and brightftield images of intact and damaged MDA-MB-231 cell clusters when captured using a polycarbonate tracketched membrane filter operated under 1.5 psi.
7 Supplementary Figure 7 Viability of cell clusters released from the Cluster-Chip. The Cluster-Chip is operated at 4 C and the clusters were released at 250 ml/hr reverse flow rate (A) Fluorescent images of MDA-MB- 231 clusters treated with two-color viability (green)/cytotoxicity (red) assay. The cells are divided in two batches: Control and cell clusters captured and released from Cluster-Chip (B) Percentage of viable clusters captured and released using Cluster-Chip against the control. Scale bar 100 μm.
8 Supplementary Figure 8 Images of CTC -clusters isolated from a breast cancer patient and released in solution. CTC-clusters isolated from a patient with metastatic breast cancer using the Cluster-Chip operated at 4 C and released with reverse flow. CTC clusters are not fixed and live stained for common breast cancer surface markers. Scale bar 20 μm.
9 Supplementary Figure 9 Correlation between the number of CTCs and CTC clusters in patients. Comparison of number of CTC clusters isolated using the Cluster-Chip and number of single CTCs isolated using CTC-iChip from the same patient at the same timepoint. Among the 19 cases studied, we found no correlation between the numbers of CTC-clusters and that of single CTCs.
10 Supplementary Figure 10 Proliferative index of single CTCs isolated from a breast cancer patient. Representative images of a Ki67-negative (-) and a Ki67-positive (+) CTC stained with antibodies against wide spectrum cytokeratin (CK, red), Ki67 (yellow) and CD45 (green). Nuclei are stained with DAPI (blue). The bar graph shows the mean percentage of Ki67- positive cells isolated from a breast cancer patient across multiple time points. All together, 439 single CTCs were stained and 162 resulted positive for Ki67.
11 Supplementary Figure 11 Heat map showing expression levels of CTC clusters isolated from a patient. Heatmap showing expression levels of representative epithelial-to-mesenchymal transition (EMT) genes in released CTC-clusters and healthy donor white blood cells (WBCs). Epithelial markers E-cadherin (CDH1), EpCAM and Mucin1 (MUC1), as well as mesenchymal markers Vimentin (VIM), Fibronectin1 (FN1), N-cadherin (CDH2) and TWIST1 are shown.
12 Supplementary Table 1 Clinical and molecular tumor characteristics of the patients used for CTC-clusters quantification Patient ID Tumor type Gender Age Molecular type Mutation profile or Prostate- specific antigen levels (ng/ml) BR11 Breast cancer Female 68 Triple- negative breast cancer BRCA carrier BR21 Breast cancer Female 71 Hormone receptor positive breast cancer PIK3CA BR- 29 Breast cancer Female 56 Hormone receptor positive breast cancer PIK3CA BRx- 102 Breast cancer Female 60 Triple- negative breast cancer No mutations found BRx- 104 Breast cancer Female 62 Hormone receptor positive breast cancer Not analyzed BRx- 107 Breast cancer Female 58 Hormone receptor positive breast cancer No mutations found BRx- 108 Breast cancer Female 49 Hormone receptor positive breast cancer No mutations found BRx- 109 Breast cancer Female 42 Hormone receptor positive breast cancer No mutations found BRx- 11 Breast cancer Female 51 Hormone receptor positive breast cancer PIK3CA BRx- 13 Breast cancer Female 60 Hormone receptor positive breast cancer PIK3CA and HRAS BRx- 16 Breast cancer Female 74 Triple- negative breast cancer BRCA carrier BRx- 18 Breast cancer Female 53 HER2 positive breast cancer PIK3CA BRx- 35 Breast cancer Female 54 Hormone receptor positive breast cancer Not analyzed BRx- 38 Breast cancer Female 54 Hormone receptor positive breast cancer PIK3CA BRx- 39 Breast cancer Female 52 Hormone receptor positive breast cancer PIK3CA BRx- 42 Breast cancer Female 54 Hormone receptor positive breast cancer PIK3CA BRx- 53 Breast cancer Female 54 Hormone receptor positive breast cancer PIK3CA BRx- 55 Breast cancer Female 80 Hormone receptor positive breast cancer PIK3CA BRx- 61 Breast cancer Female 55 Hormone receptor positive breast cancer No mutations found Brx- 66 Breast cancer Female 66 Hormone receptor positive breast cancer PIK3CA BRx- 74 Breast cancer Female 72 Hormone receptor positive breast cancer No mutations found Brx- 78 Breast cancer Female 66 Hormone receptor positive breast cancer PIK3CA Brx- 85 Breast cancer Female 56 Triple- negative breast cancer No mutations found BRx- 93 Breast cancer Female 54 Hormone receptor positive breast cancer No mutations found BRx- 94 Breast cancer Female 44 Triple- negative breast cancer No mutations found BRx- 98 Breast cancer Female 75 Hormone receptor positive breast cancer PIK3CA BRx- 99 Breast cancer Female 60 Hormone receptor positive breast cancer PIK3CA Mel- 28 Melanoma Female 40 Metastatic melanoma BRAF Mel- 31 Melanoma Male 63 Metastatic melanoma NRAS
13 Mel- 41 Melanoma Male 72 Metastatic melanoma BRAF Mel- 45 Melanoma Female 56 Metastatic melanoma BRAF Mel- 47 Melanoma Female 75 Metastatic melanoma No mutations found Mel- 48 Melanoma Male 55 Metastatic melanoma BRAF Mel- 50 Melanoma Male 64 Metastatic melanoma No mutations found Mel- 57 Melanoma Male 76 Metastatic melanoma NRAS Mel- 61 Melanoma Male 49 Metastatic melanoma BRAF Mel- 63 Melanoma Female 35 Metastatic melanoma BRAF Mel- 64 Melanoma Female 66 Metastatic uveal melanoma No mutations found Mel- 67 Melanoma Male 62 Metastatic melanoma No mutations found Mel- 69 Melanoma Female 66 Metastatic melanoma BRAF Mel- 72 Melanoma Male 20 Metastatic melanoma No mutations found Mel- 73 Melanoma Male 71 Metastatic melanoma No mutations found Mel- 79 Melanoma Male 61 Metastatic melanoma No mutations found Mel- 82 Melanoma Female 37 Metastatic melanoma BRAF Mel- 83 Melanoma Male 63 Metastatic melanoma No mutations found Mel- 85 Melanoma Male 56 Metastatic uveal melanoma BRAF Mel- 87 Melanoma Male 64 Metastatic melanoma BRAF GU- 04 Prostate cancer Male 82 Castration- resistant prostate cancer PSA GU- 51 Prostate cancer Male 61 Castration- resistant prostate cancer PSA GU- 52 Prostate cancer Male 72 Castration- resistant prostate cancer PSA GU- 112 Prostate cancer Male 84 Castration- resistant prostate cancer PSA 0.53 GU- 121 Prostate cancer Male 72 Castration- resistant prostate cancer PSA GU- 126 Prostate cancer Male 69 Castration- resistant prostate cancer PSA 9.64 GU- 133 Prostate cancer Male 75 Castration- resistant prostate cancer PSA GU- 143 Prostate cancer Male 78 Castration- resistant prostate cancer PSA 2.74 GU- 151 Prostate cancer Male 69 Castration- resistant prostate cancer PSA GU- 156 Prostate cancer Male 73 Castration- resistant prostate cancer PSA 0.2 GU- 157 Prostate cancer Male 78 Castration- resistant prostate cancer PSA GU- 160 Prostate cancer Male 61 Castration- resistant prostate cancer PSA GU- 162 Prostate cancer Male 63 Castration- resistant prostate cancer PSA 0.13
Challenges for use of CTCs as a Diagnostic. Farideh Z. Bischoff, Ph.D. Interim CSO Sr. Director, Translational Clinical Development Biocept, Inc.
Challenges for use of CTCs as a Diagnostic Farideh Z. ischoff, Ph.D. Interim CSO Sr. Director, Translational Clinical Development iocept, Inc. Current Technology for CTC Testing Existing CTC testing platform
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationA Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
More informationA microfluidic device for label-free, physical capture of circulating tumor cell-clusters
A microfluidic device for label-free, physical capture of circulating tumor cell-clusters The Harvard community has made this article openly available. Please share how this access benefits you. Your story
More informationSupplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells
Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun
More informationElectronic Supplementary Information (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2012
Electronic Supplementary Information (ESI) for Lab on a Chip Electronic Supplementary Information Construction of oxygen and chemical concentration gradients in a single microfluidic device for studying
More informationHigh Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods
High Sensitivity Immunomagnetic CTC Isolation as Compared to Alternative Isolation Methods 1. Introduction: An overview of CTC isolation methods 2. Challenges for direct comparisons of CTC recovery 3.
More informationSupplementary Figure 1. Effects of EDTA and ACD anticoagulants on blood storage. (a) EDTA
Supplementary Figure 1. Effects of EDTA and ACD anticoagulants on blood storage. (a) EDTA vacutainers (4.9 mm EDTA in 10 ml of blood) induce hemolysis after overnight storage in room temperature. (b) Viability
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationCover Letter. Reviewer 1:
Cover Letter Michael Yang, M.D., Ph.D. Managing Editor of Cancer Research Frontiers 1188 Willis Ave, #109, Albertson, NY 11507, USA Phone: +1-917-426-1571 http://cancer-research-frontiers.org/ Dear Dr.
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationProtocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationLiquid Biopsy: Implications for Cancer Staging & Therapy
Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationLongitudinal tracking of single live cancer cells to understand cell cycle effects of the
Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor Joshua M. Marcus 1, Russell T. Burke 1, John A. DeSisto 1, Yosef Landesman
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationLayered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue
Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to
More informationThe CellCollector TM technology
The CellCollector TM technology In vivo isolation of circulating tumor cells by the CellCollector TM system Dr. Klaus Lücke (CEO) Unmet medical need in oncology: Access to tumor cells not only at the time
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/8/e1700521/dc1 Supplementary Materials for Functional vascularized lung grafts for lung bioengineering N. Valerio Dorrello, Brandon A. Guenthart, John D. O Neill,
More informationDetecting Oncogenic Mutations in Whole Blood
WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013
More informationThe Avatar System TM Yields Biologically Relevant Results
Application Note The Avatar System TM Yields Biologically Relevant Results Liquid biopsies stand to revolutionize the cancer field, enabling early detection and noninvasive monitoring of tumors. In the
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationSpatially resolved multiparametric single cell analysis. Technical Journal Club 19th September 2017 Christina Müller (Group Speck)
Spatially resolved multiparametric single cell analysis Technical Journal Club 19th September 2017 Christina Müller (Group Speck) Why spatially resolved multiparametric single cell analysis? Multiparametric
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips.
Supplementary Figure 1 Diagram of BBB and brain chips. (a) Schematic of the BBB Chip demonstrates the 3 parts of the chip, Top PDMS channel, membrane and Bottom PDMS channel; (b) Image of 2 BBB Chips,
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationYoungnam Cho. National Cancer Center Biomarker Branch
Youngnam Cho National Cancer Center Biomarker Branch Contents 1. Liquid Biopsy 2. Circulating Tumor Cells from Blood 3. Cell-free DNA from Blood 1. Liquid biopsy Cancer Diagnosis IMAGING TISSUE BIOPSY
More informationTitle: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor- Stromal Interactions
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2016 Title: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor-
More informationMETACELL. PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (CTCs) METACELL LIQUID BIOPSY
METACELL PERSONALIZED CANCER THERAPY USING CIRCULATING TUMOR CELLS (s) AN EASY WAY TO LIQUID BIOPSY MORE THAN A METASTATIC CELL IN BLOOD A STEP TOWARDS PERSONALIZED CANCER TREATMENT LIQUID BIOPSY REAL-TIME
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationComparative study of multicellular tumor spheroid formation methods and implications for drug screening
Supporting Information Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Maria F. Gencoglu, Lauren E. Barney, Christopher L. Hall, Elizabeth A. Brooks,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/318/ra29/dc1 Supplementary Materials for Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer
More informationDeciphering the biology that drives response to immunotherapy
Deciphering the biology that drives response to immunotherapy Phenoptics TM Quantitative Pathology Platform Trent Norris, Field Application Scientist September 15, 2016 HUMAN HEALTH ENVIRONMENTAL HEALTH
More informationMitosis. Single Nano Micro Milli Macro. Primary. PCNA expression
a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationSupplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted
Supplemental Figure 1. Quantification of proliferation in thyroid of WT, Ctns -/- and grafted Ctns -/- mice. Cells immunolabeled for the proliferation marker (Ki-67) were counted in sections (n=3 WT, n=4
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationSupplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
More informationVariable Response to Chemotherapeutics by a Subpopulation of MCF-7 Breast Cancer Cells
Variable Response to Chemotherapeutics by a Subpopulation of MCF-7 Breast Cancer Cells JULIE MARIE DORLAND BIOMEDICAL ENGINEERING AND PLAN II HONORS MAY 17, 2016 ENGINEERING HONORS UNDERGRADUATE THESIS
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationAPPLICATION SPECIFIC PROTOCOL ANGIOGENESIS... 1 TABLE OF CONTENTS... 1 MONOLAYER FORMATION... 2 OPTION 1: APPLICATION OF ANGIOGENIC STIMULI...
APPLICATION SPECIFIC PROTOCOL ANGIOGENESIS AIM 3D Cell Culture Chips offer a new perspective in studying angiogenesis by allowing the growth of new vascular sprouts in a 3D matrix from a pre-existing endothelial
More informationMolecular classification of breast cancer implications for pathologists. Sarah E Pinder
Molecular classification of breast cancer implications for pathologists Sarah E Pinder Courtesy of CW Elston Histological types Breast Cancer Special Types 17 morphological special types 25-30% of all
More informationProspective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening
Prospective Clinical Study of Circulating Tumor Cells For Colorectal Cancer Screening Results From a Multi-Year 620-Sample Study CRC: SLOW GROWING, PREVENTABLE POLYP TO CANCER CAN TAKE 5 TO 15 YEARS CANCER
More informationRecent advances in breast cancers
Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response
More informationDelacroix et al Renal effects of renal denervation Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate
Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate Supplementary Table 1: Ranking each patient based on the number of measurements showing a numerical improvement. Rank at each
More informationWHEN STARTING A NEW LINE OF THERAPY FOR YOUR METASTATIC BREAST, COLORECTAL, AND PROSTATE 1 CANCER PATIENTS
WHEN STARTING A NEW LINE OF THERAPY FOR YOUR METASTATIC BREAST, COLORECTAL, AND PROSTATE 1 CANCER PATIENTS There is uncertainty whether their prognosis will improve It can take as long as 3 months to learn
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationAdnaNews. News from the meeting on Advances in Circulating Tumor Cells (ACTC), Reythymnon, Crete, Greece October 8-11, 2014.
News from the meeting on Advances in Circulating Tumor Cells (ACTC), Reythymnon, Crete, Greece October 8-11, 2014. The ACTC meeting (www.actc2014.org) is together with the ISMRC meeting one of the most
More informationSupplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm
More informationMutant p53 regulates ovarian cancer transformed phenotypes through autocrine matrix deposition
Mutant p53 regulates ovarian cancer transformed phenotypes through autocrine matrix deposition Marcin P. Iwanicki,, Ronny Drapkin, Joan S. Brugge JCI Insight. 2016;1(10):e86829. https://doi.org/10.1172/jci.insight.86829.
More informationDetection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.
Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationPlasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
More informationTumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.
Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
More informationCirculating Stromal Cells in Immunotherapy Utilizing a Total Blood Based Biopsy
Circulating Stromal Cells in Immunotherapy Utilizing a Total Blood Based Biopsy Cancer associated macrophage CTCs Daniel Adams Senior Research Scientist/Head of Clinical Core Laboratory Creatv MicroTech,
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationBreast Cancer Interpretation Guide
Breast Cancer Interpretation Guide UCT D O R P NEW ERBB2/ C E P S ht e ZytoLig lor Prob o C l a u 2D D17S12 ng to the i d r o c c a ting for re-tes idelines 2013 ASCO Gu Breast Cancer Interpretation Guide
More informationImmune Cell Phenotyping in Solid Tumors using Quantitative Pathology
Immune Cell Phenotyping in Solid Tumors using Quantitative Pathology James R. Mansfield Director of Quantitative Pathology Applications 2009 PerkinElmer What is Quantitative Pathology? Quantitative Pathology
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationChallenges of new discoveries of clinical applications into the management of cancer patients
Challenges of new discoveries of clinical applications into the management of cancer patients Tomáš Zima, Veronika Mikulová Institute of Clinical Biochemistry and Laboratory Diagnostics, General University
More informationSimplifying Microfluidic Separation Devices towards Field-Detection of Blood Parasites
Electronic Supplementary Material (ESI) for Analytical Methods. Supplementary Material (ESI) for Analytical Methods Simplifying Microfluidic Separation Devices towards Field-Detection of Blood Parasites
More informationQué hemos aprendido hasta hoy? What have we learned so far?
Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationBasement membrane in lobule.
Bahram Memar, MD Basement membrane in lobule. Normal lobule-luteal phase Normal lobule-follicular phase Lactating breast Greater than 95% are adenocarcinomas in situ carcinomas and invasive carcinomas.
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Fong PC, Boss DS, Yap TA, et al. Inhibition of poly(adp-ribose)
More informationControllable organization and high throughput production of recoverable 3D tumors using pneumatic microfluidics
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) for Lab on a Chip This journal is The Royal Society
More informationCirculating Tumor Cells (CTC) Technologies
Table of Contents MIR036 I. SCOPE AND METHODOLOGY Scope of the Study Analytics and data presented in this report pertain to several parameters such as - Research Methodology This report is uniquely researched
More informationNature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationDetection of the Circulating Tumor Cells in Cancer Patients
Detection of the Circulating Tumor Cells in Cancer Patients Athanasios Armakolas; Zacharoula Panteleakou; Adrianos Nezos; Aikaterini Tsouma; Maria Skondra; Peter Lembessis; Nikolaos Pissimissis; Michael
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationCytoPainter Lysosomal Staining Kit - Blue Fluorescence
ab112135 CytoPainter Lysosomal Staining Kit - Blue Fluorescence Instructions for Use For staining Lysosomes in suspension and adherent cells by using our proprietary blue fluorescence probe This product
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More information1/23/2017. Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical School
Application of Cytologic Techniques to Circulating Tumor Cell Specimens Alarice Lowe, MD Assistant Professor of Pathology Director, Circulating Tumor Cell Lab Brigham and Women s Hospital Harvard Medical
More informationThe mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge
The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly
More information