TMA-VARESE COHORT-1 TMA-BERN COHORT-2
|
|
|
- Octavia Dina McCormick
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage % = % > % TUMOR STAGE T2C 28 56% T3A % T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA (ng/ml) PRE-SURGEY % 11 to % > 2 5 1% TMA-ERN COHORT-2 TOTAL SAMPLES #174 GLEASON SCORE Number Percentage % = % > % TUMOR STAGE T2C 83 48% T3A % T3C-T4 16 9% NODE STATUS N % N1 1 1% N2 % PSA (ng/ml) PRE-SURGEY % 11 to % > % Supplementary Figure 1 Histopathological and clinical parameters of primary prostate cancer patients in the two patient cohorts evaluated by TMAs.
2 Wound width (% of T) Supplementary Figure 2 A sh - sh-1 sh-2 sh-4 2X sh- sh-1 C 12 h 1 8 h 48h h sh- sh1 Supplementary Figure 2 ESE3/EHF knockdown induces epithelial to mesenchymal transition. (A) Morphological changes induced by stable ESE3 knockdown by shrna in RWPE-1 cells evaluated by phase-contrast microscopy. () Increased cell migration in ESE3 kd - RWPE-1 (sh1) cells compared to RWPE-1 control (sh-) cells in scratch-wound healing assay. (C) Wound width as percentage at time from triplicate experiments. P<.1.
3 Fold change Fold change Fold change Supplementary Figure 3 A PrECs RWPE-1 siese3 ex siese3 ex siese3 3 UTR siese3 3 UTR siese3 ex. ESE3 VIM CDH ESE3 VIM CDH1 siese3 3'UTR ESE3 VIM CDH1 RWPE-1 RWPE-1 siese3 3'UTR Supplementary Figure 3 Transient downregulation of ESE3/EHF induces a mesenchymal phenotype. (A) Morphological changes induced by transient ESE3 knockdown with ESE3 targeting sirnas (siese3ex and siese3 3 UTR) in PrECs and RWPE-1 cells evaluated by phase-contrast microscopy. () ESE3, Vimentin (VIM) and CDH1 RNA level following transient ESE3 knockdown in PrECs and RWPE-1 cells evaluated by QRT-PCR. P values were determined using t-test. P<.5;, P<.1.
4 Supplementary Figure 4 H&E No Ab SV4LT TWIST1 PrECs ESE3 kd -PrECs 8 weeks H&E no Ab 1X SV4LT TWIST1 PrECs ESE3 kd -PrECs 4X Supplementary Figure 4 In vivo formation of lung metastasis. Control and ESE3 kd -PrECs cells were inoculated by tail vein injection into immunodeficient mice (n=4/group). Mice were sacrificed at 8 weeks to perform histological analysis of multiple lung sections following H&E staining and immunostaining for SV4 large T antigen. Representative sections of the lungs of mice injected with control and ESE3 kd -PrECs cells and examined after 8 weeks are shown.
5 Supplementary Figure 5 A ESE3 KD -PrECs Supplementary Figure 5 Prostato-sphere formation by prostate epithelial cells. (A) Sphere-forming assay under limiting dilution conditions. Cells were plated in 96-well plates and prostatospheres were counted after 7-1 days. () Phase-contrast (upper panels) and fluorescence microscopy (lower panels) images of prostato-spheres of ESE3 kd -PrECs. Cells were stained separately with either a green or red fluorescent dye and then mixed prior to the sphere-forming assay., P<.1.
6 SFE % SFE % SFE (%) SFE (%) SFE (%) SFE (%) Supplementary Figure 6 A PrECs PrECs siese3 ex RWPE-1 RWPE-1 siese3 ex. C PrECs PrECs siese3 3'UTR D RWPE-1 RWPE-1 siese3 3'UTR E.15 PrECs F.2 RWPE pcdna siese3 3 UTR + pcdna + pese3 siese3 3 UTR + pese3 + pcdna siese3 3'UTR + pcdna + pese3 siese3 3'UTR + pese3 Supplementary Figure 6 Transient downregulation of ESE3/EHF in PrECs and RWPE-1 cells induces stem-like properties. (A-) Prostato-sphere formation following transient ESE3/EHF knockdown with sirna targeting exon 2, siese3ex, in PrECs and RWPE-1 cells. (C-D) Prostato-sphere formation following transient ESE3/EHF knockdown with the sirnas targeting the 3 UTR. (E-F) Prostato-sphere assay after ESE3/EHF knockdown with 3 UTR sirnas and concomitant transfection of an ESE3/EHF expression vector or control pcdna in PrECs and RWPE-1., P<.1.
7 Supplementary Figure 7 A Supplementary Figure 7 Prostato-sphere formation and stem-like properties in DU145 cells. (A) In vitro sphereforming and self-renewal of DU145 cells. () Expression of cancer stem cell genes in adherent cells and prostato-spheres of DU145 cells determined by QRT-PCR. P values were determined using t-test. P<.5;, P<.1.
8 Supplementary Figure 8 Survival analysis ESE3 STAIN N total N. events Troncated % Score = -1(weak/Neg) % Score = 2 (Normal-like) % Global % iochemical relapse analysis ESE3 STAIN N total N. events Troncated % Score = -1(weak/Neg) % Score = 2 (Normal-like) % Global % Gleason score distribution GLEASON SCORE TOTAL % ESE3 score weak/neg ESE3 score Normal-like 6 69% 16 (68%) 13 (72%) 7 17% 27 (18%) 2 (11%) 8 14% 22 (14%) 3 (17%) Supplementary Figure 8 Overall survival and PSA biochemical relapse in prostate cancer patients. Tables show the data relative to the patients included in the analysis described in Figure 8. Gleason score distribution was not statistically different between the two groups.
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
Does EMT Contribute to Radiation Resistance in Human Breast Cancer?
AD Award Number: W81XWH-10-1-0592 TITLE: Does EMT Contribute to Radiation Resistance in Human Breast Cancer? PRINCIPAL INVESTIGATOR: Anupama Munshi, Ph.D CONTRACTING ORGANIZATION: University of Oklahoma
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Supplementary Figures for
Supplementary Figures for SOX2 suppresses CDKN1A to sustain growth of lung squamous cell carcinoma Takuya Fukazawa 1, Minzhe Guo 4, 5, Naomasa Ishida 1, Tomoki Yamatsuji 1, Munenori Takaoka 1, Etsuko Yokota
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.
AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,
Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Supplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer
AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Please refer to the specific section of the ecqm to identify the QDM data elements and associated value sets for use in reporting this ecqm.
Page 1 of 5 Page 2 of 5 2014 ecqm Flows Measure Identifier: CMS129v4 NQF 0389: Prostate Cancer: Avoidance of Overuse of Bone Scan for Staging Low Risk Prostate Cancer Patients Please refer to the specific
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties
SUPPLEMENTAL INFORMATION Inhibition of FOXC2 restores epithelial phenotype and drug-sensitivity in prostate cancer cells with stem-like properties Anurag N Paranjape 1, *, Rama Soundararajan 1, *, Steven
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity
The EMBO Journal Peer Review Process File - EMBO-2014-89574 Manuscript EMBO-2014-89574 Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity Shiv K. Singh,
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal
CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal transition and breast cancer progression Rhonda L. Brown,, Jing Yang, Chonghui Cheng J Clin Invest. 2011;121(3):1064-1074.
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Krishnamoorthy et al.,
Krishnamoorthy et al., c d e ND ND Supplementary Figure 1 RSV-induces inflammation even in the asence of allergen. Tolerized pups were either infected with RSV or not. The mice were sacrificed a week following
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer
Article Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Jiyeon Yun,, Sang-Hyun Song, Hwang-Phill Kim, Sae-Won Han,, Eugene C Yi & Tae-You Kim,,, Abstract
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
Interactions between cancer stem cells and their niche govern metastatic colonization
Correction Interactions between cancer stem cells and their niche govern metastatic colonization Ilaria Malanchi, Albert Santamaria-Martínez, Evelyn Susanto, Hong Peng, Hans-Anton Lehr, Jean-Francois Delaloye
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
Journal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
SUPPLEMENTAL TEXT AND FIGURES
SUPPLEMENTAL TEXT AND FIGURES Prrx1 isoform switching regulates pancreatic cancer invasion and metastatic colonization Shigetsugu Takano, Maximilian Reichert, Basil Bakir, Koushik K. Das, Takahiro Nishida,
Integrative Genomics Analysis Reveals Silencing of b-adrenergic Signaling by Polycomb in Prostate Cancer
Article Integrative Genomics Analysis Reveals Silencing of b-adrenergic Signaling by Polycomb in Prostate Cancer Jindan Yu, 1 Qi Cao, 1,8 Rohit Mehra, 1,8 Bharathi Laxman, 1 Jianjun Yu, 1,5 Scott A. Tomlins,
Supplementary Information
Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
The CXCL5/CXCR2 axis contributes to the epithelial-mesenchymal transition of nasopharyngeal carcinoma cells by activating ERK/GSK-3β/snail signalling
Qiu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:85 https://doi.org/10.1186/s13046-018-0722-6 RESEARCH Open Access The CXCL5/CXCR2 axis contributes to the epithelial-mesenchymal
Metastasis regulation by PPARD expression in cancer cells
Metastasis regulation by PPARD expression in cancer cells Xiangsheng Zuo, 1 Weiguo Xu, 1,2 Min Xu, 1 Rui Tian, 1 Micheline J. Moussalli, 3 Fei Mao, 1 Xiaofeng Zheng, 4 Jing Wang, 4 Jeffrey S. Morris, 5
Supplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.
Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
The rationale to study EVs from the ES-2 cell line and use as control EVs from a 5th cell line, which has not been previously tested, is unclear.
Reviewers' comments: Reviewer #1 (Remarks to the Author): This study attempts to demonstrate that extracellular vesicles (EVs) shed by aggressive ovarian cancer cells promote metastatic abilities of less
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
TITLE: A PSCA Promoter Based Avian Retroviral Transgene Model of Normal and Malignant Prostate
AD Award Number: DAMD17-03-1-0163 TITLE: A PSCA Promoter Based Avian Retroviral Transgene Model of Normal and Malignant Prostate PRINCIPAL INVESTIGATOR: Robert Reiter, M.D. CONTRACTING ORGANIZATION: The
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Supplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Chugai Succeeds in Establishing Stable Cell Lines of Cancer Stem Cell for the First Time
Chugai Succeeds in Establishing Stable Cell Lines of Cancer Stem Cell for the First Time - A Step Forward in Elucidating the Mechanisms of Recurrence / Metastasis and Drug Resistance of Cancer and in the
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Gene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.
SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents
Differential Connexin Function Enhances Self-Renewal in Glioblastoma
CSU ID: 2558414 Name: Sonal Patel Differential Connexin Function Enhances Self-Renewal in Glioblastoma Cancer is one of the most common disease in the US with more than a million people affected every
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Supplementary material
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Epithelial-to-mesenchymal transition involves triacylglycerol accumulation in DU145
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC: