SUPPLEMENTAL MATERIAL. Number of patients 14
|
|
|
- Hollie Price
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%) 10 (71.4) Family history of CAD, n (%) 6 (42.9) BMI > 25kg/m², n (%) 11 (78.6) Troponin T max, ng/ml 3.9± 3.2 Culprit vessel, n (%) LAD 4 (28.6) CX 3 (21.4) RCA 7 (50) CAD, n (%) 1VD 8 (57.1) 2VD 6 (42.9) 3VD 0 (0) CPKmax, U/l ± CRP, mg/dl 0.7 ± 0.8 Creatinine, mg/dl 1.1 ± 0.3 Total Cholesterol, mg/dl ± 60.2 LDL, mg/dl ± 59.7 HDL, mg/dl 39.7 ± 5.8 Triglycerides, mg/dl ±
2 Supplemental Table 1. STE-MI patient characteristics. Data are presented as mean ± SD. CPKmax, CRP, Creatinine, Cholesterol, LDL, HDL and Triglycerides were measured one day after ppci. CAD, coronary artery disease; BMI, body mass index; LAD, left anterior descending artery; CX, left circumflex artery; RCA, right coronary artery; VD, vessel disease; CPKmax, peak value of serum creatine phosphokinase; CRP, C-reactive protein; LDL, low-density lipoprotein cholesterol; HDL, high-density lipoprotein cholesterol. 2
3 Supplemental Figure Legends: Supplemental Figure 1. Flow-cytometric gating strategy for MP definition. The MP size gate was defined using monodisperse polystyrene reference beads with diameter of 1 µm and data acquired from buffer only to exclude noise. MP were stained with Annexin V and analyzed by flow cytometry. Representative flow cytometry plots are shown. Supplemental Figure 2. Binding properties of monoclonal IgM antibodies. The IgM NAb T15/E06 is specific for PC, whereas LR04, NA17, and E014 are directed against MDA-type epitopes. Binding of (A) T15/E06, (B) LR04, (C) NA17 and (D) E014 to either MDA-BSA or PC-BSA or native BSA was assessed by chemiluminescent ELISA. MDA-BSA contains different MDA-type epitopes including, advanced MAA-epitopes. Data are expressed as RLU/100ms. Supplemental Figure 3. A subset of circulating MP carries OSE. Circulating plasma MP of 18 healthy volunteers were stained with biotinylated T15/E06 (specific for PC) and LR04 (specific for MDA/MAA) as well as an isotype control antibody and analyzed by flow cytometry. Shown are the percentages of MP with positive staining for each antibody. Bonferroni s multiple comparison test; (# P<0.001compared to isotype control; ( P<0.001; and # P< compared to T15/E06). Circles depict MP from individual donors. Supplemental Figure 4. PC epitopes are nearly exclusively present on MP that carry MDA epitopes. Circulating plasma MP of healthy volunteers (n=3) were sequentially stained with T15/E06 (specific for PC), anti-mouse IgM FITC (II/41), LR04 (specific for MDA/MAA), anti-mouse IgM APC (II/41) and Annexin V and analyzed by flow cytometry. Data show dot plots of one representative experiment out of three (A) and the percentages of Annexin V + MP with positive staining for either LR04 or T15/E06 only or for both antibodies (B). 3
4 Supplemental Figure 5. The presence of OSE on MP is not due to ex vivo oxidation. Circulating MP were isolated by sequential ultracentrifugation from plasma treated with BHT or left untreated. Subsequently, binding of LR04 and T15/E06 to MP was quantified by flow cytometry. Data show contour plots of a representative experiment. Supplemental Figure 6. A subset of in vitro generated platelet-derived MP carry MDA epitopes. Platelet-derived MP were isolated from ionomycin-treated platelets, and binding of LR04 to MP and parental platelets was evaluated by flow cytometry. Shown are representative flow cytometry plots of (A) MP and (B) platelets stained with either a control antibody or LR04 as indicated. In contrast to parental cells, platelet-derived MP carry MDA epitopes. Supplemental Figure 7. Similar IgM antibody titers specific for MDA-LDL in coronary and peripheral plasma of STE-MI patients. (A) Determination of IgM titers to MDA-LDL in diluted plasma isolated from peripheral and coronary blood of STE-MI patients by ELISA. Data are mean ± SEM of 14 AMI patients and expressed as RLU/100ms. (B) Correlation of IgM titers to MDA-LDL between peripheral and coronary circulation. Circles represent results of individual patients and correlation analysis was performed with Pearson s test; P<
5 Supplemental Figure 1. Flow-cytometric gating strategy for MP definition 5
6 Supplemental Figure 2. Binding properties of monoclonal IgM antibodies 6
7 Supplemental Figure 3. A subset of circulating MP carries OSE 7
8 Supplemental Figure 4. PC epitopes are nearly exclusively present on MP that carry MDA epitopes 8
9 Supplemental Figure 5. The presence of OSE on MP is not due to ex vivo oxidation 9
10 Supplemental Figure 6. A subset of in vitro generated platelet-derived MP carry MDA epitopes 10
11 Supplemental Figure 7. Similar IgM antibody titers specific for MDA-LDL in coronary and peripheral plasma of STE-MI patients 11
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±
Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic
Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li
Concentration Estimation from Flow Cytometry Exosome Data Protocol
Concentration Estimation from Flow Cytometry Exosome Data Protocol 1. STANDARD CURVE Create a standard curve for the target exosome by plotting the mean fluorescence (y axis) against the protein concentration
Tracking a Killer Molecule
Tracking a Killer Molecule Mercodia Oxidized LDL ELISA www.mercodia.com Mercodia Oxidized LDL ELISA products Product Catalog No Kit size Oxidized LDL ELISA 10-1143-01 96 wells Oxidized LDL competitive
Patient is healthy with no chronic disease or significant risk factors [16%].
![Patient is healthy with no chronic disease or significant risk factors [16%].](/thumbs/96/129036215.jpg "Patient is healthy with no chronic disease or significant risk factors [16%].")
AAFP Risk Level 1 Patient is healthy with no chronic disease or significant risk factors [16%]. Exclude the following chronic problems from active patient list o Depression o Diabetes Type I or Type II
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
Supplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
2010 Korean Society of Cardiology Spring Scientific Session Korea Japan Joint Symposium. Seoul National University Hospital Cardiovascular Center
2010 Korean Society of Cardiology Spring Scientific Session Korea Japan Joint Symposium Does Lt Late Cth Catch up Exist Eiti in DES? : Quantitative Coronary Angiography Analysis Kyung Woo Park, MD Cardiovascular
Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
Assessment of plaque morphology by OCT in patients with ACS
Assessment of plaque morphology by OCT in patients with ACS Takashi Akasaka, M.D. Department of Cardiovascular Medicine Wakayama, Japan Unstable plaque Intima Lipid core Plaque rupture and coronary events
Division of Cardiovascular Medicine, Jichi Medical University Saitama Medical Center, Japan
Association between continuously elevated C-reactive protein and restenosis after percutaneous coronary intervention using drug-eluting stent in angina patients Division of Cardiovascular Medicine, Jichi
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
TCTAP Upendra Kaul MD,DM,FACC,FSCAI,FAMS,FCSI
Indian TUXEDO Trial In Medically Treated Diabetics Upendra Kaul MD,DM,FACC,FSCAI,FAMS,FCSI Executive Director and Dean Escorts Heart Institute & Medical Research Center and Fortis Hospitals, New Delhi
Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
Safety of Single- Versus Multi-vessel Angioplasty for Patients with AMI and Multi-vessel CAD
Safety of Single- Versus Multi-vessel Angioplasty for Patients with AMI and Multi-vessel CAD Mun K. Hong, MD Associate Professor of Medicine Director, Cardiovascular Intervention and Research Weill Cornell
Know Your Number Aggregate Report Single Analysis Compared to National Averages
Know Your Number Aggregate Report Single Analysis Compared to National s Client: Study Population: 2242 Population: 3,000 Date Range: 04/20/07-08/08/07 Version of Report: V6.2 Page 2 Study Population Demographics
By: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Clinical perspective It was recently discovered that small RNAs, called micrornas, circulate freely and stably in human plasma. This finding has sparked interest in the potential
Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury
Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,
Small dense low-density lipoprotein is a risk for coronary artery disease in an urban Japanese cohort: The Suita study
Small dense low-density lipoprotein is a risk for coronary artery disease in an urban Japanese cohort: The Suita study Hidenori Arai 1, Yoshihiro Kokubo 2, Makoto Watanabe 2, Tatsuya Sawamura 3, Tomonori
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
ab Exosome Isolation and Analysis Kit - Flow Cytometry, Cell Culture (CD63 / CD81)
Version 1 Last updated 26 September 2018 ab239682 Exosome Isolation and Analysis Kit - Flow Cytometry, Cell Culture (CD63 / For the isolation and analysis of exosome from cell culture. This product is
(n=6279). Continuous variables are reported as mean with 95% confidence interval and T1 T2 T3. Number of subjects
Table 1. Distribution of baseline characteristics across tertiles of OPG adjusted for age and sex (n=6279). Continuous variables are reported as mean with 95% confidence interval and categorical values
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
High-sensitivity Troponin T Predicts Recurrent Cardiovascular Events in Patients with Stable Coronary Heart Disease: KAROLA Study 8 Year FU
ESC Congress 2011 Paris, France, August 27-31 KAROLA Session: Prevention: Are biomarkers worth their money? Abstract # 84698 High-sensitivity Troponin T Predicts Recurrent Cardiovascular Events in Patients
Lipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional
ARMYDA-RECAPTURE (Atorvastatin for Reduction of MYocardial Damage during Angioplasty) trial
ARMYDA-RECAPTURE ( for Reduction of MYocardial Damage during Angioplasty) trial Prospective, multicenter, randomized, double blind trial investigating efficacy of atorvastatin reload in patients on chronic
The JUPITER trial: What does it tell us? Alice Y.Y. Cheng, MD, FRCPC January 24, 2009
The JUPITER trial: What does it tell us? Alice Y.Y. Cheng, MD, FRCPC January 24, 2009 Learning Objectives 1. Understand the role of statin therapy in the primary and secondary prevention of stroke 2. Explain
DECLARATION OF CONFLICT OF INTEREST. None
DECLARATION OF CONFLICT OF INTEREST None BURDEN OF CORONARY ARTERY DISEASE IN DIABETES IN INDIA Amal Kumar Banerjee MD, DM,FACC,FESC,FACP,FAPSC,FICC President Association of Physicians of India SAARC Cardiac
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Table S1: Number and percentage of patients by age category Distribution of age Age
Supplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
C-Reactive Protein and Your Heart
C-Reactive Protein and Your Heart By: James L. Holly, MD Inflammation is the process by which the body responds to injury. Laboratory evidence and findings at autopsy studies suggest that the inflammatory
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
and Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine
PPAR- Agonist and In-Stent Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine Peroxisome Proliferator- activated Receptors (PPAR) Lipid-activated transcription factors : => regulating
Supplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Chandran SS, Somerville RPT, Yang JC, et al.
Cardiology Department Coimbra Hospital and Medical School Portugal
Quantitative troponin elevation provide incremental prognostic value beyond comprehensive risk stratification in patients with acute coronary syndromes. Rui Baptista, Elisabete Jorge, Hélia Martins, Fátima
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
Lipoprotein (a) Disclosures 2/20/2013. Lipoprotein (a): Should We Measure? Should We Treat? Health Diagnostic Laboratory, Inc. No other disclosures
Lipoprotein (a): Should We Measure? Should We Treat? Joseph P. McConnell, Ph.D. DABCC Health Diagnostic Laboratory Inc. Baptist Health South Florida Eleventh Annual Cardiovascular Disease Prevention International
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution
Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein
ab Exosome Isolation and Analysis Kit - Flow Cytometry, Plasma
Version 1 Last updated 25 May 2018 ab228565 Exosome Isolation and Analysis Kit - Flow Cytometry, Plasma For the isolation/detection of exosomes from human plasma, urine or cell culture media. This product
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
Dual Targeting Nanoparticle Stimulates the Immune
Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS
GALECTIN-3 PREDICTS LONG TERM CARDIOVASCULAR DEATH IN HIGH-RISK CORONARY ARTERY DISEASE PATIENTS Table of Contents List of authors pag 2 Supplemental figure I pag 3 Supplemental figure II pag 4 Supplemental
Lipid Management 2013 Statin Benefit Groups
Clinical Integration Steering Committee Clinical Integration Chronic Disease Management Work Group Lipid Management 2013 Statin Benefit Groups Approved by Board Chair Signature Name (Please Print) Date
SMARTool clinical and biohumoral results. Chiara Caselli IFC-CNR
SMARTool clinical and biohumoral results Chiara Caselli IFC-CNR SMARTool Flow chart EVINCI and ARTreat Populations SMARTool: WP1 and WP2 WP1 Objective: To collect retrospective EVINCI clinical and imaging
eucalimus - First Experience
A New Sirolimus Eluting Stent with a Biodegradable Polymer Early and Mid Term Experience with the eucalimus Stent in Egypt Dr. Hossam El Din Mohamed Mansour on behalf of the investigators Ahmed Emara,
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina
LDL cholesterol (p = 0.40). However, higher levels of HDL cholesterol (> or =1.5 mmol/l [60 mg/dl]) were associated with less progression of CAC
![LDL cholesterol (p = 0.40). However, higher levels of HDL cholesterol (> or =1.5 mmol/l [60 mg/dl]) were associated with less progression of CAC](/thumbs/88/116891773.jpg "LDL cholesterol (p = 0.40). However, higher levels of HDL cholesterol (> or =1.5 mmol/l [60 mg/dl]) were associated with less progression of CAC")
Am J Cardiol (2004);94:729-32 Relation of degree of physical activity to coronary artery calcium score in asymptomatic individuals with multiple metabolic risk factors M. Y. Desai, et al. Ciccarone Preventive
Characteristics of Transient ST-Elevation versus ST-Elevation and Non-ST-Elevation Myocardial Infarction
Characteristics of Transient ST-Elevation versus ST-Elevation and Non-ST-Elevation Myocardial Infarction Blondheim DS, Shochat M, Asif A, Kazatsker M, Frimerman A, Vassilenko L, Abu Fane R, Neiman E, Barel
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Optimizing risk assessment of total cardiovascular risk What are the tools? Lars Rydén Professor Karolinska Institutet Stockholm, Sweden
Optimizing risk assessment of total cardiovascular risk What are the tools? Lars Rydén Professor Karolinska Institutet Stockholm, Sweden Cardiovascular Disease Prevention (CVD) Three Strategies for CVD
Decreased Inflammatory Markers in Diabetic Patients with Angiographically Proved Coronary Artery Disease after 18 Months of Statins Therapy
Decreased Inflammatory Markers in Diabetic Patients with Angiographically Proved Coronary Artery Disease after 18 Months of Statins Therapy DANIEL LIGHEZAN, ROXANA BUZAS, CORINA SERBAN, IOANA SUCEAVA University
PS + MPs PS - MPs 37% 36% 64% 64%
Supplementary Figure 1. Amount and distribution of phosphatidylserine negative (PS - ) and phosphatidylserine positive (PS + ) MPs in 280 SLE patients and 280 controls. Circles are proportional to the
Asian AMI Registry Session The 17 th Joint Meeting of Coronary Revascularization (JCR 2017) Busan, Korea Dec 8 th 2017
Asian AMI Registry Session The 17 th Joint Meeting of Coronary Revascularization (JCR 2017) Busan, Korea Dec 8 th 2017 Trends of acute myocardial infarction in Korea from the experience of Korea Acute
Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
12/18/2009 Resting and Maxi Resting and Max mal Coronary Blood Flow 2
Coronary Artery Pathophysiology ACS / AMI LeRoy E. Rabbani, MD Director, Cardiac Inpatient Services Director, Cardiac Intensive Care Unit Professor of Clinical Medicine Major Determinants of Myocardial
Form 8: Post Transplant Annual Followup
Page 1 of 7 Show trials/registries Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Print this Form t Started 1
Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups
Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate
Best Lipid Treatments
Best Lipid Treatments Pam R. Taub MD, FACC Director of Step Family Cardiac Rehabilitation and Wellness Center Associate Professor of Medicine UC San Diego Health System Overview of Talk Review of pathogenesis
Metabolic Syndrome Is A Key Determinant Of Coronary Microvascular Function In Patients With Stable Coronary Disease Undergoing PCI
Metabolic Syndrome Is A Key Determinant Of Coronary Microvascular Function In Patients With Stable Coronary Disease Undergoing PCI Narbeh Melikian*, Ajay M Shah*, Martyn R Thomas, Roy Sherwood, Mark T
In the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
APPENDIX F: CASE REPORT FORM
APPENDIX F: CASE REPORT FORM Instruction: Complete this form to notify all ACS admissions at your centre to National Cardiovascular Disease Registry. Where check boxes are provided, check ( ) one or more
Emmanouil S. Brilakis 1{, Joseph P. McConnell 2, Ryan J. Lennon 3, Ahmad A. Elesber 1, Jeffrey G. Meyer 2, and Peter B. Berger 4 * Introduction
European Heart Journal (2005) 26, 137 144 doi:10.1093/eurheartj/ehi010 Clinical research Association of lipoprotein-associated phospholipase A2 levels with coronary artery disease risk factors, angiographic
Heart Health. Team Member Workbook Session 1 LEARN IDENTIFY ACT. Learn about HTHU Level 3 and the point system
LEARN Learn about HTHU Level 3 and the point system 01 IDENTIFY Identify the major risk factors for cardiovascular disease and how to improve our cardiovascular health 03 02 ACT Begin our Session 1 Goal
Clinical Investigations
Clinical Investigations Risk Factors of Cardiac Troponin T Elevation in Patients with Stable Coronary Artery Disease After Elective Coronary Drug-Eluting Stent Implantation Zhang-Wei Chen, MD; Ju-Ying
International Journal of Cardiology and Cardiovascular Research Vol. 1(1), pp , June,
International Journal of Cardiology and Cardiovascular Research Vol. 1(1), pp. 002-006, June, 2014. www.premierpublishers.org. ISSN: XXXX-XXXX IJCCR Research Article Prognostic value of ST segment depression
x Lymphocyte count /µl CD8+ count/µl 800 Calculated
% Lymphocyte in CBC A. 50 40 30 20 10 Lymphocyte count /µl B. x10 3 2.5 1.5 C. 50 D. 1000 % CD3+CD8+ Cells 40 30 20 Calculated CD8+ count/µl 800 600 400 200 10 0 #61 #63 #64 #65 #68 #71 #72 #75 Figure
Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
Form 8: Post Transplant Annual Followup
Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started
Heart Disease in Women. Charlotte A. Lee, M.D., DBIM, FLMI
Heart Disease in Women Charlotte A. Lee, M.D., DBIM, FLMI Heart Disease in Women Congenital Heart Disease Valvular Heart Disease Arrhythmias Cardiomyopathy Hypertension Coronary Artery Disease Coronary
Intima-Media Thickness
European Society of Cardiology Stockholm, 30th August 2010 Intima-Media Thickness Integration of arterial assessment into clinical practice Prof Arno Schmidt-Trucksäss, MD Institute of Exercise and Health
Assessment of vitamin D levels in patients with acute coronary syndrome
ORIGINAL ARTICLE East J Med 21(4): 178-182, 2016 Assessment of vitamin D levels in patients with acute coronary syndrome Hakki Simsek and Naci Babat * Yuzuncu Yil University, Faculty of Medicine, Cardiology
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary Material to Mayer et al. A comparative cohort study on personalised
Suppl. Table : Baseline characteristics of the patients. Characteristic Modified cohort Non-modified cohort P value (n=00) Age years 68. ±. 69.5 ±. 0. Female sex no. (%) 60 (0.0) 88 (.7) 0.0 Body Mass
Cardiovascular Health Practice Guideline Outpatient Management of Coronary Artery Disease 2003
Authorized By: Medical Management Guideline Committee Approval Date: 12/13/01 Revision Date: 12/11/03 Beta-Blockers Nitrates Calcium Channel Blockers MEDICATIONS Indicated in post-mi, unstable angina,
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Usefulness of OCT during coronary intervention
Usefulness of OCT during coronary intervention Takashi Akasaka, M.D. Department of Cardiovascular Medicine Wakayama, Japan Predictors at 12 Months of Stent Thrombosis and Target Lesion Revascularization
A pilot Study of 25-Hydroxy Vitamin D in Egyptian Diabetic Patients with Diabetic Retinopathy
A pilot Study of 25-Hydroxy Vitamin D in Egyptian Diabetic Patients with Diabetic Retinopathy El-Orabi HA 1, Halawa MR 1, Abd El-Salam MM 1, Eliewa TF 2 and Sherif NSE 1 Internal Medicine and Endocrinology
Impact of Body Mass Index and Metabolic Syndrome on the Characteristics of Coronary Plaques Using Computed Tomography Angiography
Impact of Body Mass Index and Metabolic Syndrome on the Characteristics of Coronary Plaques Using Computed Tomography Angiography Cardiovascular Division, Faculty of Medicine, University of Tsukuba Akira
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
CRP and fibrinogen imply clinical outcome of patients with type-2 diabetes. and coronary artery disease
CRP and fibrinogen imply clinical outcome of patients with type-2 diabetes and coronary artery disease Marijan Bosevski 1, *, Golubinka Bosevska 1, Lily Stojanovska 2, Vasso Apostolopoulos 2, * 1 University
Abnormal, Autoquant Adenosine Myocardial Perfusion Heart Imaging. ID: GOLD Date: Age: 46 Sex: M John Doe Phone (310)
Background: Reason: preoperative assessment of CAD, Shortness of Breath Symptom: atypical chest pain Risk factors: hypertension Under influence: a beta blocker Medications: digoxin Height: 66 in. Weight:
ab Exosome Isolation and Analysis Kit - Flow Cytometry, Cell culture
Version 1 Last updated 14 March 2018 ab228564 Exosome Isolation and Analysis Kit - Flow Cytometry, Cell culture For the measurement of human exosomes in cell culture. This product is for research use only
PATTERN OF ANGIOGRAPHIC FINDINGS IN YOUNG PATIENTS PRESENTING WITH ACUTE ST SEGMENT ELEVATION MYOCARDIAL INFARCTION
Pak Heart J ORIGINAL ARTICLE PATTERN OF ANGIOGRAPHIC FINDINGS IN YOUNG PATIENTS PRESENTING WITH ACUTE ST SEGMENT ELEVATION MYOCARDIAL INFARCTION Burhan Akhtar, Nauman Ali, Rana Kashif - Department Of Cardiology,
Women and Coronary Artery Disease. Aren t Women Just Like Men?
Women and Coronary Artery Disease Aren t Women Just Like Men? Anita Wokhlu, MD Assistant Professor of Medicine UF Shands Gainesville, FL Wed Feb 1, 2017 CP1310268-1 Disclosure Of Relationships Anita Wokhlu,
LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)
A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin
Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures
FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been