Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases
|
|
- Sherilyn Hubbard
- 5 years ago
- Views:
Transcription
1 Supplementary Information Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Ulrike Mock 1, Kristoffer Riecken 1, Belinda Berdien 1, Waseem Qasim 2, Emma Chan 2, Toni Cathomen 3,4, Boris Fehse 1 1 Research Dept. Cell and Gene Therapy, Clinic for Stem Cell Transplantation, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany. 2 Molecular Immunology Unit, UCL Institute of Child Health, London, WC1N 1EH, United Kingdom 3 Institute of Cell and Gene Therapy and 4 Center for Chronic Immunodeficiency, University Medical Center Freiburg, Engesserstr. 4, Freiburg, Germany Supplementary information Mock et al. Page 1
2 Supplementary Figure 1 a A 2658 bp A SFFV N-term repeat modules (1-18) linker FokI b B 3765 bp B Supplementary Figure 1. Recombination events in TALEN-encoding LVV (a) Schematic representation of PCR-design. Primer-set A was used for proviral DNA (u40/41; u42/43) and B for reverse transcribed viral mrna (p07/u37). (b) Recombination in TALEN-encoding LVV determined by sequencing of integrated proviruses in transduced cells (bulk-culture). DNA of a transduced 293T-bulk culture was isolated, proviral DNA was PCR-amplified, subcloned and sequenced. Recombination pattern (dark grey) for either left arm (TALEN L) or right arm (TALEN R) is depicted. Light grey blocks represent monomers that could not be identified unambiguously. In total 15 clones were analyzed, 15/15 showed recombination, 15/15 were in frame. In 10/15 clones one, in 4/15 at least two recombination events were detectable. Clone #2 (TALEN L) could not be assigned definitely. Supplementary information Mock et al. Page 2
3 Supplementary Figure % egfp-positive hours post transduction Supplementary Figure 2. Kinetics of egfp-expression post transduction with NRTLV. Transduction of 293T cells was performed with NRTLV-iG2, and percentages of egfp-positive cells were measured at indicated time points by flow cytometry. Summarised data for 3 independently produced vector preparations is shown. Error bars indicate SEM. Supplementary information Mock et al. Page 3
4 Supplementary Figure Mean Fluorescence Intensity, relative to DMSO control [%] DMSO control 5µg/mL 5ug/mL 50ug/mL 50µg/mL 100µg/mL 100ug/mL Concentration of Cycloheximide Supplementary Figure 3. mrna transfer is the main mechanism of non-reverse transcribable lentiviral vectors (NRTLV). 293T cells were transduced with NRTLV LeGO-iG2 two hours after addition of the translation-inhibiting compound cycloheximide. Mean fluorescence intensity of egfp was measured by flow cytometry after incubation at 32 C for 24 hours and corrected for autofluorescence. The DMSO control reflects both egfp-protein transfer and de-novo translated egfp, whereas in the presence of cycloheximide egfp fluorescence is obviously due to protein transfer. MFI values obtained for DMSO controls were set to 100%, and relative values were defined for the three experimental groups. Error bars indicate SD for n=3. Supplementary information Mock et al. Page 4
5 Supplementary Figure 4 a CMV I : LeGO-iTALEN-L-iG2-BGH-p(A) / LeGO-iTALEN-R-iG2-BGH-p(A) Ψ RRE TALEN egfp BGH-p(A) II : LeGO-iTALEN-L-iG2--BGH-p(A) / LeGO-iTALEN-R-iG2--BGH-p(A) CMV Ψ RRE TALEN egfp BGH-p(A) III : LeGO-iTALEN-L-iG2-SV40-p(A) / LeGO-iTALEN-R-iG2-SV40-p(A) CMV Ψ RRE TALEN egfp SV40-p(A) IV : LeGO-iTALEN-L-iG2--SV40-p(A) / LeGO-iTALEN-R-iG2--SV40-p(A) CMV Ψ RRE TALEN egfp SV40-p(A) b Fold increase (MFI egfp) * * ** ** 0.0 italen-ig2- italen- ig2- SV40p(A) italen- ig2- BGHp(A) italen- ig2- - SV40p(A) italen- ig2- - BGHp(A) Supplementary Figure 4. Improved expression of TALEN constructs with different p(a)-signals. (a) Schematic vector design of I: LeGO-iTALEN-iG2-BGH-p(A) II: LeGO-iTALEN-iG2--BGH-p(A) III: LeGO-iTALEN-iG2-SV40-p(A) IV: LeGO-iTALEN-L-iG2--SV40-p(A). 3 rd generation LVV derived from LeGO-system (Weber et al.). CMV = CMV-ie promoter; ( U3), R, U5 = elements of SIN-LTR, self-inactivating long terminal repeat; Ψ = Psi, packaging signal; RRE = Rev response element; SFFV = promoter of spleen focus-forming virus; = Woodchuck hepatitis virus posttranscriptional regulatory element; = internal ribosome entry site; egfp = enhanced green fluorescent protein; p(a) = polyadenylation signal; BGH = bovine growth hormone; SV40 = simian virus 40. (b) Transduction of 293T cells was performed with non-concentrated preparations of NRTLV encoding TALEN and egfp. Expression was assessed based on mean fluorescence intensities (MFIs) for egfp measured 48h post transduction by flow cytometry and normalized to italen-ig2-. The highest increase in MFI was observed for the two lentiviral vector constructs with internal, exogenous p(a)-signals from the bovine growth hormone (BGH) or the simian virus 40 (SV40) directly following the signal [italen-ig2--bghp(a) and italen-ig2--sv40p(a)]. Introduction of the respective p(a)-signals upstream of the led to a slightly lower, but still significant increase of expression [italen-ig2-bghp(a); italenig2-sv40p(a)]. All constructs are schematically depicted in Supplementary Figure 2d. Means for 3 independently produced vector preparations, each measured in duplicates, are shown. Error bars indicate SD (* p < 0.01; ** p < 0.005). = Woodchuck hepatitis virus posttranscriptional regulatory element; i = internal ribosome entry site (). Supplementary information Mock et al. Page 5
6 Supplementary Figure % egfp-positive (d2) % CCR5 knockout MOI per vector 0 Supplementary Figure 5. Correlation between egfp-expression and CCR5 knockout after transduction with NRTLV. Clonal CCR5+ 293T cells were co-transduced with increasing MOIs of concentrated NRTLVs delivering the CCR5-specific italen-constructs with improved /BGH-p(A)-containing vectors. egfpexpression was measured on d2 post transduction (left axis, light grey bars) and CCR5 knockout on d5 post transduction (right axis, dark grey bars) by flow cytometry. Data shown for n = 3. NRTLV = non-reverse transcribable lentiviral vector; i = internal ribosome entry site (); = Woodchuck hepatitis virus posttranscriptional regulatory element; BGH = bovine growth hormone. Supplementary information Mock et al. Page 6
7 Supplementary Figure 6 untransduced MOI 1250 MOI 2500 egfp untransduced MOI 1250 MOI 2500 CCR5-PerCP-Cy5.5 Supplementary Figure 6. Marking but no knock-out with CCR5-specific TALEN delivered by NRTLV. Primary T cells from different donors were activated and transduced with either MOI 1250 or MOI 2500 per TALEN-arm as NRTLV on day 3 post activation. egfp-expression was measured on d2 post transduction (upper panel) and CCR5 knockout on d5 post-transduction (lower panel) by flow cytometry. Data shown for 1 representative donor out of 3. Supplementary information Mock et al. Page 7
8 Supplementary Table 1 Oligonucleotide sequences Number Sequence (5-3 ) Target u8 u9 u28 u29 u30 u31 u40 u41 u42 u43 p74 u37 u44 u45 u46 u47 AAGATGGATTATCAAGTGTCAAGTCC GATGATTCCTGGGAGAGACGC AGTCCTCCGACAGACTGAGT TGCAGGTCGACTCTAGAGTC TGCATGCATGGCGCAAT AACTGGGCAACAATGCTCTC ATCTACGCACGCTCGGCTA CTGCTTGGCCAATTGGCAGAT AAGGTTCGTTCGACAGTGG CACACCGTAATCAATAGGAGATC ATCAGCCTGCTTCTCGCTT CATACGGGAAGCAATAGCATGATAC ACAATGAGACACCA GATATGTCCATTGGCCTTGCCC TACATACAACACCACCATGTAT CATGGGCTACCCTTACGACGTGCCTGACTACGCCTCTAG ACCCAAGAAAAAGCGGAAAGTGGGCATCCACG hccr5-f hccr5-r TALEN-seq F1 TALEN-seq R1 TALEN-seq F2 TALEN-seq R2 TALEN-F 1st PCR TALEN-R 1st PCR TALEN-F 2nd PCR TALEN-R 2nd PCR SFFV-F -R pmdl_gp_rre_r pmdl_gp_rre_f pmdl_gp_rre_mut italen oligo sense u48 u58 u59 u60 u61 u62 u63 CTAGCGTGGATGCCCACTTTCCGCTTTTTCTTGGGTCTA GAGGCGTAGTCAGGCACGTCGTAAGGGTAGCC GCTGTACAAGTAACTGTGCCTTCTAG GCTGTACAGCCATAGAGCCCAC GCTGTACAAGTAAAACTTGTTTATTGCAGC GCTGTACACAGACATGATAAGATACATTGATGAGT GGTCTAGACCAAAGAAGAAGCGGAAGG TAGCGGCCGCTTATGAGCGGAAATTG italen oligo antisense BGH-p(A)-F BGH-p(A)-R SV40-p(A)-F SV40-p(A)-R italen-tcrα2-f italen-tcrα2-r Supplementary information Mock et al. Page 8
G enome engineering with designer nucleases is a very potent technology for both, basic research as well as
OPEN SUBJECT AREAS: GENETIC VECTORS TARGETED GENE REPAIR Received 5 June 2014 Accepted 22 August 2014 Published 18 September 2014 Correspondence and requests for materials should be addressed to B.F. (fehse@uke.de)
More informationSupplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
More informationDNA context and promoter activity affect gene expression in lentiviral vectors
ACTA BIOMED 2008; 79: 192-196 Mattioli 1885 O R I G I N A L A R T I C L E DNA context and promoter activity affect gene expression in lentiviral vectors Gensheng Mao 1, Francesco Marotta 2, Jia Yu 3, Liang
More informationCertificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631987 10 μg Specified on product label. Product Information plvx-ef1α-ires-mcherry is a bicistronic lentiviral expression vector that can be used
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More information~Lentivirus production~
~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationCertificate of Analysis
Certificate of Analysis plvx-ef1α-ires-puro Vector Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No.
More informationConditional and reversible disruption of essential herpesvirus protein functions
nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text:
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationYour Gene ATG GGT. pd1118 EF1a-ORF, Lenti-ElecD 7803 bp
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett
More informationA phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding
A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding multiple anti-hiv RNAs John A. Zaia, M.D. John J. Rossi,
More informationTherapeutic Genome Editing with CRISPR-Cas and other programmable gene scissors
Brussels, April 12 th 2018 Therapeutic Genome Editing with CRISPR-Cas and other programmable gene scissors Toni Cathomen Gene Therapy returns to Center Stage Engineering the Genome Jameson Golliday (source:
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationReview and Public RAC Discussion of Protocol #
Review and Public RAC Discussion of Protocol #0508 725 A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding
More informationCURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES
[Frontiers in Bioscience 5, d527-555, May 1, 2000] CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES Betty Lamothe, Sadhna Joshi Department of Medical
More informationSupplementary Information. Potent inhibition of HIV-1 by TRIM5-cyclophilin fusion proteins engineered from human components
Supplementary Information Article Title Authors Supplementary Methods Supplementary Table S1 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Potent inhibition of HIV-1 by TRIM5-cyclophilin
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationVIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer
VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of
More informationPre-made Lentiviral Particles for Fluorescent Proteins
Pre-made Lentiviral Particles for Fluorescent Proteins Catalog# Product Name Amounts Fluorescent proteins expressed under sucmv promoter: LVP001 LVP001-PBS LVP002 LVP002-PBS LVP011 LVP011-PBS LVP012 LVP012-PBS
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSupplemental Information. Prostaglandin E 2 Increases Lentiviral Vector. Transduction Efficiency of Adult Human
YMTHE, Volume 26 Supplemental Information Prostaglandin E 2 Increases Lentiviral Vector Transduction Efficiency of Adult Human Hematopoietic Stem and Progenitor Cells Garrett C. Heffner, Melissa Bonner,
More informationViral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP
Viral Vectors In The Research Laboratory: Just How Safe Are They? Dawn P. Wooley, Ph.D., SM(NRM), RBP, CBSP 1 Learning Objectives Recognize hazards associated with viral vectors in research and animal
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationRetroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase.
Retroviruses ---The name retrovirus comes from the enzyme, reverse transcriptase. ---Reverse transcriptase (RT) converts the RNA genome present in the virus particle into DNA. ---RT discovered in 1970.
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More information7.012 Problem Set 6 Solutions
Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed
More informationDevelopment of a replication-competent lentivirus assay for dendritic cell-targeting lentiviral vectors
Citation: Molecular Therapy Methods & Clinical Development (2015) 2, 15017; doi:10.1038/mtm.2015.17 All rights reserved 2329-0501/15 www.nature.com/mtm Article Development of a replication-competent lentivirus
More informationSUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
More informationClinical Translation of Immunotherapy using WT1 and CMV specific TCR Gene Transfer
Clinical Translation of Immunotherapy using WT1 and CMV specific Gene Transfer Dr Emma C Morris Reader, Dept of Immunology, UCL Consultant Haematologist (BMT), UCLH and RFH ISCT, 2/5/211 Gene Transfer
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationSupplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
More informationSequences in the 5 and 3 R Elements of Human Immunodeficiency Virus Type 1 Critical for Efficient Reverse Transcription
JOURNAL OF VIROLOGY, Sept. 2000, p. 8324 8334 Vol. 74, No. 18 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Sequences in the 5 and 3 R Elements of Human
More informationHighly Significant Antiviral Activity of HIV-1 LTR-Specific Tre-
Supporting Information Hauber et al. page 1 Text S1 - Supporting Information Highly Significant Antiviral Activity of HIV-1 LTR-Specific Tre- Recombinase in Humanized Mice Ilona Hauber 1, Helga Hofmann-Sieber
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
More informationDevelopment of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals
Trejbalová et al. Clinical Epigenetics (2016) 8:19 DOI 10.1186/s13148-016-0185-6 RESEARCH Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationPolyomaviridae. Spring
Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm
More informationPre-made Reporter Lentivirus for MAPK/ERK Signal Pathway
Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P
More informationPre-made Reporter Lentivirus for JAK-STAT Signaling Pathway
Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)
More informationNature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
More informationIKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
More informationHD1 (FLU) HD2 (EBV) HD2 (FLU)
ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationName Section Problem Set 6
Name Section 7.012 Problem Set 6 Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed of lipids
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationPre-made Reporter Lentivirus for NF-κB Signal Pathway
Pre-made Reporter for NF-κB Signal Pathway Cat# Product Name Amounts LVP965-P or: LVP965-P-PBS NFKB-GFP (Puro) LVP966-P or: LVP966-P-PBS NFKB-RFP (Puro) LVP967-P or: LVP967-P-PBS NFKB-Luc (Puro) LVP968-P
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationEfficient Transient Genetic Manipulation In Vitro and In Vivo by Prototype Foamy Virus-mediated Nonviral RNA Transfer
original article The American Society of Gene & Cell Therapy Efficient Transient Genetic Manipulation In Vitro and In Vivo by Prototype Foamy Virus-mediated Nonviral RNA Transfer Martin V. Hamann 1,2,
More informationJumpstart your research with ViraPower Lentiviral Expression Systems
ViraPower Lentiviral Expression Systems Jumpstart your research with ViraPower Lentiviral Expression Systems With ViraPower Lentiviral Systems you can: Efficiently transduce both dividing and non-dividing
More informationSupplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationViral Genetics. BIT 220 Chapter 16
Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More informationMicroRNA-182 is induced by IL-2 and promotes clonal expansion of
1 Supplemental Material 2 3 4 MicroRNA-182 is induced by IL-2 and promotes clonal expansion of activated helper T lymphocytes 5 6 7 8 9 10 11 12 Anna-Barbara Stittrich 1, Claudia Haftmann 1, Evridiki Sgouroudis
More informationAuxin-Inducible Degron (AID) System Total Set
Catalog No. BRS-APC011A Auxin-Inducible Degron (AID) System Total Set This AID System Charactoristics Principle of Auxin-Inducible Degron (AID ) System AID plasmid protein 1. Transfection of AID plasmid
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationDirect non-productive HIV-1 infection in a T-cell line is driven by cellular activation state and NFκB
Dahabieh et al. Retrovirology 2014, 11:17 RESEARCH Open Access Direct non-productive HIV-1 infection in a T-cell line is driven by cellular activation state and NFκB Matthew S Dahabieh 1, Marcel Ooms 2*,
More informationSupplementary Figure 1 The plasmids used for the GPCR-CRISPR ChaCha and the GPCR-CRISPR Tango systems. (a) The plasmids for the GPCR-CRISPR ChaCha
Supplementary Figure 1 The plasmids used for the GPCR-CRISPR ChaCha and the GPCR-CRISPR Tango systems. (a) The plasmids for the GPCR-CRISPR ChaCha system. The dcas9-vpr effector is fused to the C-terminus
More informationVIROLOGY. Engineering Viral Genomes: Retrovirus Vectors
VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationSUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationReceived 19 May 2004/Accepted 13 September 2004
JOURNAL OF VIROLOGY, Feb. 2005, p. 1666 1677 Vol. 79, No. 3 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.3.1666 1677.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Genetic Recombination
More informationPaolo Moi, Italy. Università di Cagliari Ospedale Pediatrico Microcitemico - A. Cao - CAGLIARI
T H E O R E T I C A L A N D P R A C T I C A L T R A I N I N G I N HAEMATOLOGICAL RARE DISEASES: from genetic counselling - through bench - to bed Gene Therapy for Hemoglobinopathies Paolo Moi, Italy Università
More informationA Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire.
Company LOGO A Multicistronic DNA Vaccine Induces Significant Protection against Tuberculosis in Mice and Offers Flexibility in the Expressed Antigen Repertoire. Fayaz Ahmad Mir, Stefan H. E. Kaufmann,
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationCRISPRaTest Functional dcas9-activator Assay Kit v1 Last update: 2018/07/04 Cellecta, Inc.
CRISPRaTest Functional dcas9-activator Assay Kit v1 Last update: 2018/07/04 Cellecta, Inc. Copyright (c) 2018 Cellecta, Inc. All Rights Reserved. Table of Contents 1. CRISPRaTest Functional dcas9-activator
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationLentiviral gene therapy for HIV-1 using TRIM-Cyclophilin restriction factors
Lentiviral gene therapy for HIV-1 using TRIM-Cyclophilin restriction factors Emma Chan Institute of Child Health University College London A thesis submitted for the degree of Doctor of Philosophy 2012
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells
Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal
More informationEffective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
More informationChapter 14 Part One Biotechnology and Industry: Microbes at Work
Chapter 14 Part One Biotechnology and Industry: Microbes at Work Objectives: After reading Chapter 14, you should understand How biotechnology has resulted in numerous pharmaceutical products to help lessen
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationMuscular Dystrophy. Biol 405 Molecular Medicine
Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12005 a S Ψ ΨΨ ΨΨ ΨΨ Ψ Ψ Ψ Ψ Ψ ΨΨ Ψ Ψ ΨΨΨΨΨΨ S1 (a.a. 1 751) S2 (a.a. 752 1353) S1 Fc S1 (a.a. 1-747) Fc b HCoV-EMC-S1-Fc SARS-CoV-S1-Fc HCoV-EMC-S1-Fc SARS-CoV-S1-Fc kda - 170 - - 130
More informationAppendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
More informationgenome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More informationChoosing Between Lentivirus and Adeno-associated Virus For DNA Delivery
Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Presenter: April 12, 2017 Ed Davis, Ph.D. Senior Application Scientist GeneCopoeia, Inc. Outline Introduction to GeneCopoeia Lentiviral
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
More information