Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
|
|
|
- Garry Jacobs
- 5 years ago
- Views:
Transcription
1 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Gapdh N T N T PTEN l PTEN D Melanoma-Free Survival ink/arf -/- (n=9) ink/arf +/- (n=11) ink/arf +/+ (n=5) any ink/arf, no rtta (n=8) Days Post-4OHT/Dox E Melanoma-Free Survival 5 -Dox, -4OHT (n=131) +Dox, +4OHT (n=14) 3 Days Post-4OHT/Dox 4 Day Day 11 Day 18 Day 28 Supplemental Figure S1. haracterization of the iip Mouse. A, Schematic of the iip mouse model. The base phenotype is Ink/Arf-null. After topical tamoxifen administration, Pten is floxed out and rtta is activated via removal of the stop cassette. Doxycycline can now activate the RAF transgene, and is restricted to tamoxifen-treated melanocytes., RTPR for human RAFV6E transgene expression in iip tumors, no reverse transcriptase on one tumor, and an inras tumor., PR genotyping of two pairs of matched normal and tumor tissue showing floxing out of the PTEN locus. D, Kaplan-Meier survival curve of iip mice treated with 1ul of 1uM 4OHT and dietary doxycycline, showing dependence on Ink/Arf status for tumor latency. E, Kaplan-Meier survival curve of iip mice with or without treatment with 1ul of 1uM 4OHT and dietary doxycycline. F, representative mouse with longitudinal pictures showing tumor regression off doxycycline.
2 A RTK luster MAPK Rebound luster Drug-naive prb-s81/811 cn1 FoxM1 im leaved aspase 7 log2 Fold-change vs Median TGA: PTEN vs RTKs 1.5 PTEN focal deletion PTEN mutation 1. PTEN wt p per2 per3 pmet Supplemental Figure S2. A, human samples showing effects of RAF inhibition on selected proteins, normalized to the matched pre-treatment samples. Only 1 paired A samples are available for RPPA analysis., heirarchical clustering of iip mouse samples showing similarity between MAPK-Rebound resistant samples and drug-naive samples., PTEN status versus RTK activation status in the TGA melanoma RPPA dataset. A ps79 A1 AMPK pt172 AMPK alpha eclin-g- L3a-R-NA ax ad ps112 ak cl-xl id im aspase-7 cleavedd198 Rb ps87 S811 yclin 1 eif4g FoxM1 Paxillin eef2k yclin D1 p27 N-adherin E-adherin Annexin I PK-alpha ps657 Fibronectin V2 aveolin-1 MAPK pt2 Y4 MEK1 MEK1 ps217 S221 -Raf p9rsk p9rsk pt359 S363 -Raf ps338 eif4e ps9-r-na 4E-P1 pt37 T46 4E-P1 S6 ps24 S244 eif4e 4E-P1 ps65 S6 ps235 S236 4E-P1 pt7 mtor ps2448 mtor Rictor pt1135 Raptor TS1 p7s6k pt389 Rictor Akt ps473 Akt GSK3 ps9 GSK3-alpha-beta ps21 S9 PRAS4 pt246 Akt pt38 p7s6k PI3K-p11-alpha PDK1 ps241 PDK1 PI3K-p85 IRS1 PTEN HER3 c-kit c-met py1235 HER3 py1298 py1173 py168 HER2 py1248 NDRG1 pt346 YAP ps127 FASN I2 beta-atenin Gab2 eef2 PK-pan etaii ps66 TIGAR p62-r-na hk1 ps345 DJ-1 ciap YAP hk2 pt68 JNK2 DK1 PDD4 Src py416 Notch1 PEA zeta Dvl3 p38 MAPK NF2 Smad1 Src py527 TAZ NF-k-p65 ps536 p27 pt157 ER-alpha ps118 FOX3a Tuberin Y-1 ps12 TTF1 INPP4-G-E XR1 RM15 JNK pt183 pt185 Smad3 laudin-7 PR ollagen VI STAT5-alpha AVRL1 TRF PK-delta ps664 p27 pt beta Rab25 p38 pt18 Y182 hk1 Y-1 Rab11 PEA15 ps116 p53 Stathmin ER-alpha Lck AR STAT3 py75 53P1 c-myc MYH11
3 Hyper-MAPK RTK Supplemental Figure S3. Immunohistochemistry for perk (red) and DAPI (blue) on human patient samples. H&E slides of the same area are also shown.
4 Supplemental Figure S4 A 25 RAF mrna A 2 25A 9A1A 1 15A 34A A 2 25A 9 9A 1A A 7 34A A RAF gdna Normal Human gdna Melanoma No Amplification Melanoma Amplification Supplemental Figure S4. Analysis of the RAF locus. A, relative expression of RAF across all human samples., relative expression of genes surrounding the RAF locus., quantitative PR analysis of the RAF locus, including one negative and one positive control melanoma described in (47).
5 Supplemental Figure A A 27 25A 28 1A 15A 4 9A A Y Y YE5.1 YE48.2 YE48.3 YE51.1 YE51.3 YE48.1 YE YE E F A 6 9A A A A A D Hyper-MAPK MAPK Rebound RTK Supplemental Figure S5. Supervised and unsupervised clustering of RPPA and RNA-seq data. A, lustering of resistant human and mouse samples solely by perk and pmek RPPA data., lustering by the RNA-seq ERK signature of, all samples and, all resistant samples. D, lustering of all samples by the RNA-seq ERK and cell cycle signatures. E, F. Unsupervised clustering using the top 2.5% most variable genes for E, all samples and F, only the resistant
![1 -log2[dabrafenib] nm D p-y1173 perk ERK ps6 Vinculin nm dabrafenib](/docs-images/95/125396391/images/6-2.jpg "Supplemental Figure S6. In vitro RTK analyses.")
6 Supplemental Figure 6 A RPPA prtks A375 phage per3log2 Fold-change RTK Resistant Patient Samples A375 Overexpression per3 pmet pmet p p pher2 pher2 Normalized OD 1..5 ER2 MET ER log2[dabrafenib] nm Normalized OD WM88 phage log2[dabrafenib] nm D p-y1173 perk ERK ps6 Vinculin nm dabrafenib Supplemental Figure S6. In vitro RTK analyses. A, Quantification of RTK overexpression by RPPA, showing similar levels in A375 (vs ) and in patient RTK tumor samples (vs pretreatment samples)., Unnormalized dose-response curve from Fig. 5A., effect of overexpression on WM88 growth in monolayer. D, Western blot of MAPK and mtor pathway markers in the absence or presence of nm dabrafenib in WM88 cells.
7 Supplemental Figure S7 Pre-treatment vs PFS orrelation FWER = Pre-treatment vs PFS Anti-orrelation FWER =.9 Pre-treatment vs REIST orrelation FWER =.128 Pre-treatment vs REIST Anti-orrelation FWER =.139 On-treatment vs PFS orrelation FWER = On-treatment vs PFS Anti-orrelation FWER = On-treatment vs REIST orrelation FWER = On-treatment vs REIST Anti-orrelation FWER =.32 Supplemental Figure S7. GSEA plots of selected significant pathways identified for each sample-clinical outcome comparison.
Phosphorylation Site Company Cat #
Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific
Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Response and resistance to BRAF inhibitors in melanoma
Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Co-clinical assessment identifies patterns of BRAF inhibitor resistance in melanoma
The Journal of Clinical Investigation Research article Co-clinical assessment identifies patterns of BRAF inhibitor resistance in melanoma Lawrence N. Kwong, 1 Genevieve M. Boland, 2 Dennie T. Frederick,
Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
ras Multikinase Inhibitor Multikinase Inhibitor 0.1
a ras ** * ** * ** ** ** ** un in et m lu Se ib SL G 32 W 7 So 50 ra 74 fe ni b LY W 294 or 0 tm 02 R an ap n a in Ev my er cin ol im BE us Z2 3 En P 5 za I13 st 0 au rin D as SP ati 60 nib C 012 is 5
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Supplementary Information. Table of contents
Supplementary Information Table of contents Fig. S1. Inhibition of specific upstream kinases affects the activity of the analyzed readouts Fig. S2. Down-regulation of INCENP gene induces the formation
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways
Mechanisms Associated with Dietary Energy Balance Effects on Tumor Development: Alterations in Growth Factor and Energy Sensing Pathways John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
Mechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention
Mechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed Chair Division
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Development of Rational Drug Combinations for Oncology Indications - An Industry Perspective
Development of Rational Drug Combinations for Oncology Indications An Industry Perspective Stuart Lutzker, MDPhD Vice President Oncology Early Development Genentech Inc 1 Conventional Oncology Drug Development
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
BRAF inhibitors Anti-angiogenic therapy Other molecular targets Discussion
If you experience any technical difficulties call 8-274-939 or e-mail informed@commpartners.com Slides will advance automatically. You can also advance/ review the presentation using the control buttons
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
presentation session & clinical Keith T. Flaherty, M.D. Abramson Cancer Center of the University of Pennsylvania
Melanoma: highlights from the oral presentation session & clinical science symposium at ASCO 2009 Keith T. Flaherty, M.D. Abramson Cancer Center of the University of Pennsylvania Abstracts to be discussed
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed
New Developments in Thyroid Cancer
New Developments in Thyroid Cancer Eric J. Sherman, MD Professor Vice-Chair for Clinical Operations Chief, Division of Head and Neck Surgery Departments of Otolaryngology, Radiation Oncology, and Immunology
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048
Selecting the right patients for the right trials.
Selecting the right patients for the right trials. Paul Waring Professor of Pathology University of Melbourne June 21, 2011 RCPA Genetics short course Drug development challenges. Current model of drug
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG
Interrogating mtor Inhibition in Patients with HRPC
Interrogating mtor Inhibition in Patients with HRPC Daniel George, John Madden, Andrew Armstrong, Mark Dewhirst, Nancy Major, and Phillip Febbo Divisions of Medical Oncology, Urology, Pathology, Radiology,
Targeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor
Targeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor Josep Tabernero, Andrés Cervantes, Cristina Saura, Desamparados Roda, Yibing Yan, Kui Lin, Sumati Murli,
K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF
shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)
New horizons for small cell lung cancers. Charles Rudin MD PhD
New horizons for small cell lung cancers Charles Rudin MD PhD Annual deaths (US) US cancer deaths 140000 120000 100000 80000 60000 40000 20000 0 Cancer type Small cell lung cancer: a disease in need of
PI3K / AKT / mtor. Signalling Pathway in Cancer. PI3K / AKT / mtor Related Antibodies from CovalAb
NEWSLETTER Version 1 From Research to Discovery PI3K / AKT / mtor Signalling Pathway in Cancer PI3K / AKT / mtor Related Antibodies from CovalAb www.covalab.com CovalAb - 11 avenue Albert Einstein 69100
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Enlarge Slides. One Moment Please. Skin Cancer. Thomas Olencki, DO David Carr, MD. Today s Webcast Friday, 09/09/11, Noon
New Features Enlarge Slides Links One Moment Please Chapters Polling Use the email function to let us know what you think One Moment Please Skin Cancer Thomas Olencki, DO David Carr, MD Today s Webcast
Identification of BRAF mutations in melanoma lesions with the Roche z480 instrument
Identification of BRAF mutations in melanoma lesions with the Roche z480 instrument Márta Széll IAP, Siófok May 14, 2012 Multifactorial skin diseses: much more frequent then genodermatoses exhibit familial
Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
Supplementary Figure 1: Experimental design. DISCOVERY PHASE VALIDATION PHASE (N = 88) (N = 20) Healthy = 20. Healthy = 6. Endometriosis = 33
DISCOVERY PHASE (N = 20) Healthy = 6 Endometriosis = 7 EAOC = 7 Quantitative PCR (mirnas = 1113) a Quantitative PCR Verification of Candidate mirnas (N = 24) VALIDATION PHASE (N = 88) Healthy = 20 Endometriosis
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
Plasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant
Chapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
Supporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
Insulin/IGF1-IRS-PI-3 kinase-mtor signaling pathway
Insulin/IGF1-IRS-PI-3 kinase-mtor signaling pathway Nutrients RAPAMYCIN (FKBP12) mtor/rictor complex phosphorylates Akt at the S473 activating site in a Rheb-independent fashion TSC1 or TSC2-null MEFs
ABSTRACT INTRODUCTION. Ulises D. Orlando 1,*, Ana F. Castillo 1,*, Melina A. Dattilo 1, Angela R. Solano 1, Paula M. Maloberti 1, Ernesto J.
/, Vol. 6, No. 40 Acyl-CoA synthetase-4, a new regulator of mtor and a potential therapeutic target for enhanced estrogen receptor function in receptor-positive and -negative breast cancer Ulises D. Orlando
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Therapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center
Therapeutic Resistance to HER2 Targeted Therapies Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Relevant Financial Disclosures Millennium/Takeda Pharmaceuticals (consultant, sponsored
Abstract. Introduction
LMW-E/CDK2 Deregulates Acinar Morphogenesis, Induces Tumorigenesis, and Associates with the Activated b-raf- ERK1/2-mTOR Pathway in Breast Cancer Patients MyLinh T. Duong 1,2, Said Akli 1, Caimiao Wei
Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
Growth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
Phospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
One Moment Please. Skin Cancer. Today s Webcast Friday, 09/09/11, Noon. David Carr, MD
One Moment Please One Moment Please Skin Cancer Thomas Olencki, DO David Carr, MD Today s Webcast Friday, 09/09/11, Noon 1 New Features Enlarge Slides Links Chapters Polling Use the email function to let
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Information
Supplementary Information Supplementary Methods Assessment of clinical characteristics of the single-agent anti-pd-1 cohort Clinical data were retrospectively collected from patient record, including age,
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation, and tumor progression in the colon
SUPPLEMENTARY INFORMATION Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation, and tumor progression in the colon Kevin M. Haigis, Krystle Kendall, Yufang Wang, Ann Cheung,
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Bio-Plex Pro Cell Signaling Assays
Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling