DDR2 controls the epithelial-mesenchymal-transition-related gene expression via c-myb acetylation upon matrix stiffening
|
|
- Job William Small
- 6 years ago
- Views:
Transcription
1 Supplementary information controls the epithelialmesenchymaltransitionrelated gene expression via cmyb acetylation upon matrix stiffening Daehwan Kim, Eunae You, Jangho Jeong, Panseon Ko, JungWoong Kim and Sangmyung Rhee* Department of Life Science, ChungAng University, Seoul 6974, Republic of Korea These two authors contributed equally to this work. *To whom correspondence should be addressed: Tel.: Fax: sangmyung.rhee@cau.ac.kr
2 Relative expression Relative expression Fold expression a (bp) 5 PAG (kpa) b DDR1 5 DDR GAPDH PAG (kpa) PAG (kpa) c d Collagen coated PAG (kpa) Gelatin coated PAG (kpa) Serum (bp) 5 NC G NC G (bp) 5 NC (kpa) 5 GAPDH 5 GAPDH G G (kpa) PAG PAG No S S Supplementary Figure 1. Expression of transcripts is dependent on matrix rigidity. (a,b) RTPCR (a) and qrtpcr (b) analyses of expression levels of DDR1,, and GAPDH in H199 cells incubated on a PAG of various stiffness or on glass (G). (c) RTPCR analysis of the expression levels of and GAPDH in H199 cells incubated on a PAG of various stiffness or glass coated with collagen or gelatine. (d) RTPCR analysis of expression levels of and GAPDH in H199 cells incubated on a PAG in the absence or presence of serum. Band densities were measured and normalised to GAPDH expression levels under the same conditions. NC, negative control. Data represent the mean of three independent experiments ± SEM. P <.1.
3 TF? TF promoter 78 candidates 1 st selection : Searching program (threshold.9) nd selection : Relevance for lung cancer 8 candidates (STAT1b, PEA3, NFkB1, FOXA1, cmyb, ELF1, LEF1, crel) Supplementary Figure. The experimental scheme employed to analyse transcription factors that regulate promoter activity in lung cancer. Seventyeight candidates are listed in Supplementary Table 1, and eight candidates (STAT1b, PEA3, NFκB1, FOXA1, cmyb, ELF1, LEF1, and crel) were eventually selected.
4 Relative Luciferase Activity GFP GFPcMyb GFPLEF1 p3 bgal Supplementary Figure 3. Coexpression of cmyb with p3 induces promoter activity. Relative expression of WT promoter driven luciferase reporters in cmyb, LEF1, or p3overexpressing H199 cells. Data represent the mean of three independent experiments ± SEM. P <.1.
5 Cell number (x1 4 ) 1 cmyb KD cmyb KD 8 * (days) Supplementary Figure 4. Inhibition of proliferation in cmyb knockdown H199 cells is reversed by overexpression. Quantification of proliferation of H199 cells incubated on a stiff matrix for the indicated periods. The cells were trypsinized and counted. Data represent the mean of three independent experiments ± SEM. * P <.5, P <.1.
6 cmyb KD KD GM Fold change of spheroid area cmyb KD KD GM a Day Day 4 b Factin Ki67 DAPI Merged.5 * * Supplementary Figure 5. A knockdown of cmyb and inhibits cancer invasion in a 3D environment. H199 cells expressing mock (with or without 5 mm GM61), anti, or anti cmyb shrna were incubated for days to form spheroids as described in the Methods section. Collagenembedded spheroids were further incubated for 4 days, fixed, and stained with phalloidin, an antiki67 antibody, and DAPI. The spheroids were examined by phase contrast microscopy (a) and fluorescence microscopy (b). GM: GM61. Scale bars: μm (a) and 5 μm (b). Data represent the mean of three independent experiments ± SEM. * P <.5, * P<.1.
7 Number of invading cells Absorbance (55 nm) Cell number (x1 4 ) Fold expression Fold expression a b.5.5 kpa 4 kpa 1. cmyb KD * * c.3 DDR1 cmyb KD MYB DDR1 4 cmyb KD. * 3 * (days) (days) d cmyb KD Supplementary Figure 6. The knockdown of cmyb inhibits proliferation and invasiveness of A549 cells. (a) qrtpcr analysis of DDR1 and on.5 and 4kPa PAGs in A549 cells. (b) qrtpcr of MYB, DDR1 and on 4 kpa PAGs in mock shrna and cmyb KD A549 cells. (c) Quantification of cell proliferation in mock or anti cmyb shrna expressing A549 cells. Graphs show absorbance of crystal violet (left) and the number of counted cells (right). (d) Quantification of invasion. Data represent the mean of three independent experiments ± SEM. * P<.5, P<.1, * P<.5.
8 Fold ratio of transcript level Fold ratio of EP3 transcript level Fold ratio of MYB transcript level a.5 kpa 4 kpa ITGB1 KD #1 ITGB1 KD # 4 kpa b (kda) Integrin b1 perk ERK pmlc MLC atubulin (kpa) c Mo * * Mo #1 # ITGB1 KD d.5 kpa 4 kpa.5 kpa 4 kpa.5 kpa 4 kpa Mo * * Mo #1 # ITGB1 KD e Mo Mo #1 # ITGB1 KD Supplementary Figure 7. Cellular contractility on a stiff matrix regulates the expression of and EP3 via integrin b1. (a) A phase contrast image of H199 cells transfected with mock sirna or anti integrin β1 sirna (#1 and #) on.5 and 4kPa PAGs. Scale bar, 5 μm. (b) Western blot analysis of mock or anti integrin β1 sirna transfected H199 cells. (c,d,e) qrtpcr analysis of expression of (c), EP3 (d), and MYB (e) in mock and integrin β1 knockdown cells. qrtpcr values were normalised to GAPDH. Mo:. Data represent the mean of three independent experiments ± SEM. * P<.5, P<.1, * P<.5.
9 LEF1 cmyb GFP.5 kpa 4 kpa GFP DAPI Merged GFP DAPI Merged Supplementary Figure 8. Cellular localisation of cmyb and LEF1 does not depend on matrix stiffness. Fluorescent images of H199 cells transfected with plasmids encoding GFP, GFPcMyb, or GFPLEF1 and incubated on a PAG. Nuclei were stained with DAPI. Scale bar, 1 mm.
10 Figure 1c pfak perk pmlc atub FAK ERK MLC Figure a DDR1 atub Figure b Figure d (long) atub atub perk ERK p1
11 Figure 3b Figure 4e and 4g atub atub GFP DDR1 pmlc MLC Figure 5d Figure 5f p3 p3 AcK cmyb DDR1 atub pro
12 Figure 5a Figure 6c Figure 6e cmyb LEF1 AcK (of cmyb) cmyb atub cmyb atub AcK (of LEF1) perk perk ERK ERK Supplementary Figure 9. Full length blots. Red dotted lines show the cropping locations.
13 Supplementary Table 1. Seventyeight transcription factors that are predicted to bind to the promoter region. No Name Description 1 FOXP3 Forkhead box P3 RXR Retinoid X receptor alpha 3 NR3C1 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) 4 RAR Retinoic acid receptor beta 5 GR Glucocorticoid receptor alpha 6 C/EBP CCAAT/enhancer binding protein alpha 7 C/EBP CCAAT/enhancer binding protein beta 8 POUF POU class homeobox 9 cmyb Transcription factor cmyb 1 FOXA1 Forkhead box A1 11 FOXA Forkhead box A 1 XBP1 Xbox binding protein 1 13 TFIID Transcription factor II D 14 cets1 Vets erythroblastosis virus E6 oncogene homolog 1 15 cets Vets erythroblastosis virus E6 oncogene homolog 16 IRF1 Interferon regulatory factor 1 17 NFATC1 Nuclear factor of activated Tcells, cytoplasmic, calcineurindependent 1 18 NFATC Nuclear factor of activated Tcells, cytoplasmic, calcineurindependent 19 AP A Transcription factor APalpha A p53 Tumor protein p53 1 AR Androgen receptor GATA1 GATA binding protein 1 (globin transcription factor 1) 3 GATA GATA binding protein (globin transcription factor ) 4 STAT1 Signal transducer and activator of transcription 1beta 5 STAT4 Signal transducer and activator of transcription 4 6 STAT5A Signal transducer and activator of transcription 5a 7 ATF3 Activating transcription factor 3 8 NFI/CTF Nuclear factor ICCAATbinding transcription factor 9 NF1 Neurofibromin 1 3 SRY Sexdetermining region Y 31 TCF4E Transcription factor 7 like, T cell specific, HMG box 3 VDR Vitamin D (1,5 dihydroxyvitamin D3) receptor
14 33 PXR1 Pregnane X receptor 34 cjun Jun protooncogene 35 cfos FBJ murine osteosarcoma viral oncogene homolog 36 HNF1A HNF1 homeobox A 37 HNF1B HNF1 homeobox B 38 YY1 YY1 transcription factor 39 POUF1 POU class homeobox 1 4 TEAD TEA domain family member 41 RBPJ Recombination signal binding protein for immunoglobulin kappa J region 4 PEA3 Phosphatidylinositol4phosphate 5kinase and related FYVE fingercontaining proteins signal transduction mechanisms 43 COUP TF1 Nuclear receptor subfamily, group F, member 1 44 LEF1 Lymphoid enhancerbinding factor 1 45 NF B1 Nuclear factor of kappa light polypeptide gene enhancer in Bcells 46 EF1 EF transcription factor 1 47 SP1 Sp1 transcription factor 48 MAZ MYCassociated zinc finger protein (purinebinding transcription factor) 49 TBP TATA box binding protein 5 MEFA Myocyte enhancer factor A 51 HOXD9 Homeobox D9 5 HOXD1 Homeobox D91 53 NFY Nfy Histonelike transcription factor NFY protein family (IC) 54 Elk1 Member of ETS oncogene family 55 EBF Transcription factor COE1like 56 Ik1 IKAROS family zinc finger 1 (Ikaros) 57 ELF1 E74like factor 1 (ets domain transcription factor) 58 PU.1 SPI1 (PU 1) spleen focus forming virus (SFFV) proviral integration oncogene 59 WT1 Wilms tumor 1 6 Egr3 Early growth response 3 61 AhR:Arnt Aryl hydrocarbon receptor nuclear translocator 6 PPAR Peroxisome proliferatoractivated receptor alpha 63 TCF4 Transcription factor 4 64 IRF Interferon regulatory factor 65 USF Upstream transcription factor, cfos interacting 66 Pax Paired box
15 67 Nkx.1 Homeobox protein Nkx.1 68 Sox5 sex determining region Ybox 5 69 HSF1 Heat shock transcription factor 1 7 HSF Heat shock transcription factor 71 CP Transcription factor CP 7 NFE Nuclear factor, erythroid 73 MZF1 Myeloid zinc finger 1 74 Evi1 Ecotropic viral integration site 1 75 crel Vrel avian reticuloendotheliosis viral oncogene homolog 76 NRF NfE related factor 77 Lyf1 Lymphoid transcription factor LyF1 78 Pbx1 PreBcell leukemia homeobox 1
15. Supplementary Figure 9. Predicted gene module expression changes at 24hpi during HIV
Supplementary Information Table of content 1. Supplementary Table 1. Summary of RNAseq data and mapping statistics 2. Supplementary Table 2. Biological functions enriched in 12 hpi DE genes, derived from
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationSUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationDysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File
Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,
More informationNuclear Receptor Monoclonal Antibodies
High affinity and specificity 研究用 Research www.funakoshi.co.jp Use Only Nuclear Receptor Monoclonal Antibodies All antibodies are validated by reactivity with proteins from full length cdna expressed in
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationPathway Map Reference Guide
Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationLPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
More informationTranscription Factors 818 個 (2013/1/24 現在 )
Transcription Factors 818 個 (2013/1/24 現在 ) 遺伝子シンボル説明 FXC_PID 価格 FHC_PID 価格 AEBP2 AE binding protein 2, transcript variant 2 FXC30523M 50,000 FHC30523 50,000 AHR aryl hydrocarbon receptor FXC01249 40,000
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationInterleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
More informationStructure and Function of Fusion Gene Products in. Childhood Acute Leukemia
Structure and Function of Fusion Gene Products in Childhood Acute Leukemia Chromosomal Translocations Chr. 12 Chr. 21 der(12) der(21) A.T. Look, Science 278 (1997) Distribution Childhood ALL TEL-AML1 t(12;21)
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationLoss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationRabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))
Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :
More informationTRANSCRIPTION FACTORS in ONCOGENESIS
TRANSCRIPTION FACTORS in ONCOGENESIS 19 10 2018 TRANSCRIPTION Basal transcription TAF TBP TATAA IIA RNA Polimerasi IIB IIF IIE IIH Transcription factors Gene-specific Tissue-specific Time-specific Enhancer
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationMaturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationA Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationNeocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationSupplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informations u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationProlonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationInterleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases
54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of
More informationLoss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationSupplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
More informationIP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSupplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
More informationPrediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More information