CXC chemokine (ligand/receptor)
|
|
- Prosper Whitehead
- 6 years ago
- Views:
Transcription
1 List of abbreviations -MEM alpha-modified minimal essential AKT protein kinase B (also abbreviated PKB) AMC 7-amino-4-methylcoumarin AP-1 activator protein 1 ARF ADP-ribosylation factor, a small GTP-binding protein ARP2/3 actin-related proteins2/3 ASAP1 the Arf-GTPase-activating protein 1 ATF activating transcription factor BSA bovin serum albumin CC (L/R) C chemokine (ligand/receptor) Cdc42 cell division cycle 42,a GTP binding protein CDK cyclin-dependent kinases Chk checkpoint kinases c-met mesenchymal-epithelial transition factor CXC(L/R) CXC chemokine (ligand/receptor) ECL enhanced chemiluminescence ECM extracellular matrix EGF(R) epidermal growth factor (receptor) EMT epithelial-mesenchymal transition ER estrogen receptor ERK extracellular signal-regulated kinase FA focal adhesion FACS fluorescence-activated cell sorting F-actin filament-actin FAK focal adhesion kinase FAT focal adhesion targeting domain FERM band 4.1, ezrin, radixin and moesin homology domain Fra-1(fosl-1) fos related antigen-1(fos like-1) FRAP fluorescence recovery after photobleaching GAP GTPase activating proteins GFP green fluorescent protein 147
2 GIT G-protein-coupled receptor kinase interacting protein Grb2 growth factor receptor-bound protein 2 GRAF GTPase activating protein for Rho associated with FAK GRK G-protein receptor kinase GST glutathione-s-transferase GTP guanosine Triphosphate HE haematoxylin and eosin HGF hepatocyte growth factor ILK integrin linked kinase I.P. Intraperitoneal injection JNK c-jun N-terminal kinase KD knock down KO knock out LD leucine-rich sequences LIMK LIM-domain kinase MAPK mitogen-activated protein kinase MDA microtubule disrupting agents MDM2 murine double minute 2 (mdm2 oncogene) MLC myosin light chain MLCK myosin light chain kinase MMTV mouse mammary tumor virus MMP matrix metalloproteinases NF-kB nuclear factor kappa-light-chain-enhancer of activated B cells N-WASP N-Wiskott Aldrich syndrome protein p130cas Crk-associated substrate PBS phosphate buffered saline PI propidium iodide PI3K phosphoinositide-3 kinase PKB protein kinases B PKL paxillin kinase linker PLC phospholipase C PPR proline-rich regions 148
3 PTEN phosphatase and tensin homolog PTP protein tyrosine phosphatase Rac Ras-related C3 botulinum toxin substrate 1 Ras Ras super family RhoA Ras homolog gene family, member A ROCK Rho-associated kinase qrt-pcr quantitative real time- polymerase chain reaction SDS-PAGE sodium dodecyl sulfate - poly acrylamide gel electroforese SF scatter factor SH Src-homology domain sirna short interference RNA shrna short hairpin RNA SRE serum response element PVDF polyvinylideenfluoride TAM tumor-associated macrophages TBP 0.05% Triton/0.5% BSA in PBS TIRF total internal reflection fluorescence TRE TPA response element 149
4 List of publications 1. Yafeng Ma, Bob van de Water and Sylvia Le Dévédec. Focal adhesion kinase inhibition as a potential strategy for anticancer therapies. (submitted to Drug of the Future) 2. Yafeng Ma, Saertje Verkoeijen, Maroesja J. van Nimwegen, John H. Meerman and Bob van de Water. Role of Fos related antigen-1 (Fra-1) in focal adhesion kinase (FAK) mediated chemoresistance in mammary adenocarcinoma tumors and lung metastases. Research paper (submitted to Molecular Pharmacology ) 3. Yafeng Ma, Saertje Verkoeijen and Bob van de Water. c-jun N-terminal kinase coordinates vincristine-induced Rho-kinase-dependent cell contractility through the focal adhesion-associated scaffold protein paxillin. Research paper (submitted to Journal Pharmacology Experimental Therapeutics) 4. Yafeng Ma, Hans de Bont, John H. Meerman and Bob van de Water. An autocrine CXCR3 activation-loop drives breast tumor cell migration and invasion through ERK and Akt signaling. Research paper (submitted to Molecular Cancer Therapeutics) 5. Yafeng Ma, Sylvia Le Dévédec, Saertje Verkoeijen and Bob van de Water. The Serine178 residue of paxillin determines EGF-induced cell migration of metastatic breast tumor cell MTLn3. (In preparation) 150
5 CURRICULUM VITAE Yafeng Ma was born on January 28 th, 1980 in HeNan, China. In 1997, she started her college education in Biochemistry department in Nanjing University (Nanjing, Jiang Su, China). In 2001, she received her bachelor degree and started her 3-year master study under supervision of Prof. Chen Junhui in Biochemistry and Molecular Biology (Biochemistry Dept., Life Science School) in the same university. Her research was about anti-tumor effects of extracts from human urine. From September 2004 till April 2009, she pursued her PhD project in Division of Toxicology in the Leiden/Amsterdam Center of Drug Research (Leiden University, The Netherlands) financed by a 4-year fellowship from the Chinese Scholar Council. Her research was under supervision of Prof. Bob van de Water and focused on focal adhesion-dependent signaling in breast cancer treatment. From May 2009, she is a postdoctoral researcher in the group of Prof. Laura Machesky at the Beatson Institute of Cancer Research in Glasgow, Scotland. 151
Cell Motility. Junfeng Ji ( 纪俊峰 ), PhD
Cell Motility Junfeng Ji ( 纪俊峰 ), PhD Professor Laboratory of Somatic Reprogramming and Stem Cell Aging Center for Stem Cell and Tissue Engineering School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cnedu
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationThe elements of G protein-coupled receptor systems
The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationThe recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation
The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationSignaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
More informationMCB*4010 Midterm Exam / Winter 2008
MCB*4010 Midterm Exam / Winter 2008 Name: ID: Instructions: Answer all 4 questions. The number of marks for each question indicates how many points you need to provide. Write your answers in point form,
More informationCHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
More informationCell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationSignal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
More informationINTEGRIN SIGNALLING DURING TUMOUR PROGRESSION
INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION Wenjun Guo and Filippo G. Giancotti Abstract During progression from tumour growth to metastasis, specific integrin signals enable cancer cells to detach from
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationKEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationThe Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationThe investigation of the integrative function of focal adhesion kinase (FAK) in human oesophageal squamous cell carcinoma cell lines
The investigation of the integrative function of focal adhesion kinase (FAK) in human oesophageal squamous cell carcinoma cell lines Catherine Mary Worsley A dissertation submitted to the Faculty of Science,
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#10:(November-22-2010) Cancer and Signals 1 1 Micro-Environment Story How does the rest of our body influences the cancer cell?
More informationAdditional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationORIGINAL PAPER DISRUPTION OF CELL SPREADING BY THE ACTIVATION OF MEK/ERK PATHWAY IS DEPENDENT ON AP-1 ACTIVITY
Nagoya J. Med. Sci. 72. 139 ~ 144, 1 ORIGINAL PAPER DISRUPTION OF CELL SPREADING BY THE ACTIVATION OF MEK/ERK PATHWAY IS DEPENDENT ON AP-1 ACTIVITY FENG XU, SATOKO ITO, MICHINARI HAMAGUCHI and TAKESHI
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationBL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
More informationBiol403 MAP kinase signalling
Biol403 MAP kinase signalling The mitogen activated protein kinase (MAPK) pathway is a signalling cascade activated by a diverse range of effectors. The cascade regulates many cellular activities including
More informationPropagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationGeneral introduction: matrix adhesion, cell migration and breast cancer
CHAPTER 1 General introduction: matrix adhesion, cell migration and breast cancer Cell migration is a central process in development, as well as in many physiological and disease states such as cancer
More informationSphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan
96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and
More informationEffects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
More informationSupplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
More informationSignal Transduction SS Gerhild van Echten-Deckert
Signal Transduction SS 2018 Gerhild van Echten-Deckert Tel. 73 2703 E-mail: g.echten.deckert@uni-bonn.de https://www.limes-institut-bonn.de/forschung/ Focus on 2 classes of cell-surface receptors (Growth
More informationLysosomes and endocytic pathways 9/27/2012 Phyllis Hanson
Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson General principles Properties of lysosomes Delivery of enzymes to lysosomes Endocytic uptake clathrin, others Endocytic pathways recycling vs.
More informationSignal transduction by focal adhesion kinase in cancer
Cancer Metastasis Rev (2009) 28:35 49 DOI 10.1007/s10555-008-9165-4 Signal transduction by focal adhesion kinase in cancer Jihe Zhao & Jun-Lin Guan Published online: 24 January 2009 # Springer Science
More informationFOCAL ADHESION KINASE: IN COMMAND AND CONTROL OF CELL MOTILITY
FOCAL ADHESION KINASE: IN COMMAND AND CONTROL OF CELL MOTILITY Satyajit K. Mitra, Daniel A. Hanson and David D. Schlaepfer Abstract A central question in cell biology is how membrane-spanning receptors
More informationSignal Transduction Pathways. Part 2
Signal Transduction Pathways Part 2 GPCRs G-protein coupled receptors > 700 GPCRs in humans Mediate responses to senses taste, smell, sight ~ 1000 GPCRs mediate sense of smell in mouse Half of all known
More informationFOR AUTHOR APPROVAL ONLY
Critical Reviews in Eukaryotic Gene Expression, 15(3):255 275 (2005) Signal Transduction and Actin in the Regulation of G1-Phase Progression Johannes Boonstra* & Maarten J. A. Moes Department of Cell Architecture
More informationMolecular mechanisms of the PRL phosphatases
REVIEW ARTICLE Molecular mechanisms of the PRL phosphatases Pablo Rios, Xun Li and Maja Köhn European Molecular Biology Laboratory, Genome Biology Unit, Heidelberg, Germany Keywords cancer; cell signalling;
More informationThe Influence of a Single Nucleotide Polymorphism In The Matrix Metalloproteinase-1 Promoter on Glioma Biology
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2006 The Influence of a Single Nucleotide Polymorphism In The Matrix Metalloproteinase-1 Promoter on Glioma
More informationThe Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway in Prostate Cancer
Grand Valley State University ScholarWorks@GVSU Masters Theses Graduate Research and Creative Practice 4-27-2017 The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway
More informationCell Cyc Cell Cy l c e
Mechanisms of Cell Proliferation 1 Cell Cycle G 2 S G 1 2 Multi-cellular organisms depend on cell division/proliferation; Each organism has a developmental plan that determines its behavior and properties;
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationPaxillin: a crossroad in pathological cell migration
López-Colomé et al. Journal of Hematology & Oncology (2017) 10:50 DOI 10.1186/s13045-017-0418-y REVIEW Paxillin: a crossroad in pathological cell migration Ana María López-Colomé *, Irene Lee-Rivera, Regina
More informationBIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)
Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset
More informationReviews. This Review is part of a thematic series on Migration of Vascular Cells, which includes the following articles:
Reviews This Review is part of a thematic series on Migration of Vascular Cells, which includes the following articles: Mechanisms of Vascular Smooth Muscle Cell Migration Endothelial Cell Migration During
More informationMany Forms of Cell-Cell Communication Regulate Tissue Function and Phenotype Physiological Functions of Gap Junctions Homeostasis buffering/sharing of ions, nutrients, and water Metabolic support nutrient
More informationC) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.
706-2000-Exam 4 Answer Key 1) The question asks you to explain peaks A and B in the top graph. The other two graphs were there to give you hints. The question did not ask for these other two graphs to
More informationPhospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
More informationA RENAISSANCE FOR SRC
A RENAISSANCE FOR SRC Timothy J. Yeatman The c-src non-receptor tyrosine kinase is overexpressed and activated in a large number of human malignancies and has been linked to the development of cancer and
More informationMAPK Pathway
MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth
More informationTherapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative
More informationSignal Transduction: G-Protein Coupled Receptors
Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,
More informationPCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
More informationCELL CYCLE MOLECULAR BASIS OF ONCOGENESIS
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6
More informationBL 424 Chapter 15: Cell Signaling; Signal Transduction
BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationProf. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2)
Prof. R. V. Skibbens November 22, 2010 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality - clocks go in only one direction G1 doesn t have replication-inducing
More informationChapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
More informationReview Article Mesenchymal Migration as a Therapeutic Target in Glioblastoma
Journal of Oncology Volume 2010, Article ID 430142, 17 pages doi:10.1155/2010/430142 Review Article Mesenchymal Migration as a Therapeutic Target in Glioblastoma Jessie Zhong, 1, 2 Andre Paul, 1 Stewart
More informationImpact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
More informationregulation of polarized membrane transport by rab GTPases Peter van der Sluijs;
regulation of polarized membrane transport by rab GTPases Peter van der Sluijs; p.vandersluijs@umcutrecht.nl cytotoxic T cell recognizes complex of viral peptide with MHC class I and kills infected cell
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationOncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
More informationLife Science 1A Final Exam. January 19, 2006
ame: TF: Section Time Life Science 1A Final Exam January 19, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use non-erasable
More informationCHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES
CHAPTER 3: EGFR ACTIVATION IMPACTS ON FAK PROTEIN EXPRESSION AND PHOSPHORYLATION STATUS IN HOSCC CELL LINES 3.1 Introduction Developmental processes such as cell migration depend on signals from both the
More informationSignal Transduction I
Signal Transduction I Prof. Tianhua Zhou Department of Cell Biology Zhejiang University School of Medicine Office hours by appointment tzhou@zju.edu.cn Signal transduction: Key contents for signal transduction:
More informationTherapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center
Therapeutic Resistance to HER2 Targeted Therapies Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Relevant Financial Disclosures Millennium/Takeda Pharmaceuticals (consultant, sponsored
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationProtein regulation Protein motion
Lecture 13 Protein regulation Protein motion Antoine van Oijen BCMP201 Spring 2008 04/02 Section IV 04/09 Hands-on methods session / PS 4 due 1 Today s lecture 1) Mechanisms of protein regulation 2) Molecular
More informationCancer Biology Dynamical Cell Systems
The Institute of Cancer Research PHD STUDENTSHIP PROJECT PROPOSAL PROJECT DETAILS Project Title: SUPERVISORY TEAM Primary Supervisor: The forces behind pancreatic cancer; and changing them as a therapeutic
More informationRath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published
More informationPrinciples of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
More informationSignal Transduction Pathway Smorgasbord
Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationBCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney
BCHM3972 Human Molecular Cell Biology (Advanced) 2013 Course University of Sydney Page 2: Immune Mechanisms & Molecular Biology of Host Defence (Prof Campbell) Page 45: Infection and Implications for Cell
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationRegulation of Enzymatic Activity. Lesson 4
Regulation of Enzymatic Activity Lesson 4 Regulation of Enzymatic Activity no real regulation: - regulation of enzyme expression and turnover - control of enzyme trafficking - supply of cofactors real
More informationHHS Public Access Author manuscript Curr Opin Hematol. Author manuscript; available in PMC 2015 March 24.
Role of Rho kinases in abnormal and normal hematopoiesis Raghuveer Singh Mali, Simryn Kapur, and Reuben Kapur Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Department
More informationIntroduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationUNCOVERING THE BIOLOGICAL FUNCTIONS OF PHOSPHATASE OF REGENERATING LIVER -2
UNCOVERING THE BIOLOGICAL FUNCTIONS OF PHOSPHATASE OF REGENERATING LIVER -2 By YAN WANG B.S., Wuhan University, P.R. China, 2004 Submitted to the Graduate Faculty of the University of Pittsburgh School
More informationIntracellular signalling pathways activated by leptin by Gema FRUHBECK. Presentation by Amnesiacs Anonymous
Intracellular signalling pathways activated by leptin by Gema FRUHBECK Presentation by Amnesiacs Anonymous Introduction to Leptin By Ahrial Young Why is Leptin important? Pleiotropic = it controls the
More informationAngiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System
Japan-Mexico Workshop on Pharmacology and Nanobiology Feb. 25, 2009; Universidad Nacional Autönoma de Mëxico, Mexico City Angiostasis and Angiogenesis Regulated by Angiopoietin1-Tie2 Receptor System Shigetomo
More informationCHARACTERIZING THE INTERPLAY BETWEEN FAK, SRC, AND ACK2 IN THE REGULATION OF SH3PX1 ACTIVITY. A Dissertation
CHARACTERIZING THE INTERPLAY BETWEEN FAK, SRC, AND ACK2 IN THE REGULATION OF SH3PX1 ACTIVITY A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment
More informationTable S1: Data-generating Model:
Table S1: Data-generating Model: Below are the parameters used for the data-generating model (section 1.5). The model was generated using CNORode. The data generating model is included below (figure S1).
More informationIdentificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationCENTRAL LABORATORY SERVICES
CENTRAL LABORATORY SERVICES Bridging the Gaps in Biomarker Development and Testing for Global Clinical Trials Biomarkers, Digital Pathology & the Central Lab Presentation Title Presenter Name July 16,
More informationCAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM
CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes
More information