**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!
|
|
|
- Julian Gray
- 6 years ago
- Views:
Transcription
1 Yuan et al., Supplemental Figure 1, related to Figure 1! EY2 modulates the transcriptional activity of ERb, but not ERa!! B! -DPN! +DPN! * ERb GPDH MCF7 MD-MB-231 Primary BC - KD - KD #1 #2 #3 Relative mrn Levels! MD-MB-231 Primary BC - Ectopic #1 #2 #3 EY2 GPDH EY2: ! MD7! MSMB! C! Relative mrn Levels! -E +E EY2: ! Vector! ER! ER Vector! ER! ER!! MD7! MSMB! D! Relative mrn Levels! -E +E shey2: ! Vector! MD7! ERb Vector! MSMB! ERb E Relative mrn Levels! E +E EY2: ! Vector! ps ER! Vector! GREB1! ER!
2 Yuan et al., Supplemental Figure 2, related to Figure 1! EY2 represses ERb-mediated transcription of multiple ERb-specific target genes! Vec! Flag-ERa Flag-ERb dox: ! a-flag! B! a-gpdh! Relative mrn Levels! 75! -dox, -E 5 -dox, +E2! 25! +dox, -E2! +dox, +E2! ERa ERb ERa ERb ERa ERb ERa ERb ERa ERb MD7! MSMB! NKG2E! HVCR PL2G4D! C! vector EY2 E2: Dox: a-flag a-ey2 a-gpdh D! E! ChIP over input DN (%)! dox, -E -dox, +E2! +dox, -E2! +dox, +E2! Relative mrn Levels! 7! -EY 5! 3! +EY * * * 0. 1! MD7 MSMB NKG2E HVCR2 PL2G4D! E2: ! MD7! MSMB! NKG2E! HVCR PL2G4D!
3 Yuan et al., Supplemental Figure 3, related to Figure 2 EY2 specifically dephosphorylates ERb, not ERa. B GST-EY EY2: GST WT D274 D502! N-terminal! catalytic domain! C-terminal! Mg 2+ binding domain! Human Mouse Zebrafish Xenopus W!! D! L! D! E! T! I! W!! D! L! D! E! T! I! W!! D! L! D! E! T! I!! W! D! L! D! E! T! I! I! G! D! G! V! E! E! E! I! G! D! G! V! E! E! E! V! G! D! G! V! E! E! E! V! G! D! G!! E! E! E! Drosophila W!! D! L! D! E! T! L! I! G! D! G! N! E! E! E! Flatworm! W! D! L! D! E! T! I! V! G! D! G! K! E! E! E! PO 4 released (nm)! GST! EY2: GST WT D274 D502! C Relative MD7 mrn! 5! 3! 1! Flag-EY2 Myc-ERb GPDH! -E +E EY2: - WT D274 D502! -! D IP: Flag-ERa! IP: Flag-ERb EY pan-py! Flag-ERa EY pan-py! Flag-ERb -! 1 2 3
4 Yuan et al., Supplementary Figure 4, related to Figure 2 EY2 directly dephosphorylates py36-erb Relative Luc ctivity!! 3 -E 25! +E 2 15! 1 5! EY2: ! B IP: a-flag! Flag-ERb: - Y36 Y31 Y16 WT! E2: ! IB: -py! IB:a-Flag! ! ER : WT -F2 -F1! C Flag-ERb: Y36F Y36F WT WT! E2: ! IB: a-py! IB:a-Flag! IP: a-flag! D PO 4 released (nm )! ! -!! Peptide: ph2x py36-erb! E IP: IgG a-erb Time (hr): ! F! IB: py3 IB: total ERb -! ! ERβ! GPDH!
5 Yuan et al., Supplemental Figure 5, related to Figure 3! c-bl binding to ERb, purification of WT and mutant c-bl proteins!! B! E2: - +! Input! IP:a-IgG! IP:a-c-bl! IB:a-ERb E2: - +! Input! IP:a-IgG! IP:a-ERb IB:a-c-bl! C! WT Kinase-Dead! D! WT Kinase-Dead! Dox: ! Flag-HRP! MW(kDa)! 25 Dox: ! p-tyr! ! a-tubulin! Immunoblot! 35! 25! Silver Staining!
6 Yuan et al., Supplemental Figure 6, related to Figure 5 Effects of py36, EY2 and c-bl on tumor cell growth Relative cell number! 1 EV! WT! Y36F! B Relative cell number! EV! WT! Y36E! 3! 9! 3! 9! C Myc-EY GPDH! EV! EY2! D EV! Myc-EY2! Relative cell number! EV! EY Tumor Volume (mm 3 )! EV! EY 7! 1 21! 2 35! E! c-bl!! GPDH! F sh-con! sh-bl! Relative cell number! 5! 3! 1! sh-con! sh-bl! Tumor Volume (mm 3 )! sh-con! sh-bl! !
7 Yuan et al., Supplemental Figure 7, related to Figure 5 Kaplan-Meier survival curves Related to Fig 5 B Related to Fig 5B C Related to Fig 5C D Related to Fig 5D
8 Yuan et al., Supplemental Figure 8, related to Figure 5 EY2 and c-bl regulate the antitumor activity of ERb through py36 C Relative Cell Number! Con/Con! Con/EY WT/Con! WT/EY Y36E/Con! Y36E/EY Relative Cell Number! Con/sh-con! Con/sh-bl! WT/sh-con! WT/sh-bl! Y36E/sh-con! Y36E/sh-bl! 3! 9! B D Con/Con! Con/sh-con! WT/Con! WT/sh-con! Y36E/Con! Y36E/sh-con! Con/EY Con/sh-bl! WT/EY WT/sh-bl! Y36E/EY Y36E/sh-bl! Tumor Volume (mm 3 )! Con/Con! Con/EY WT/Con! WT/EY Y36E/Con! Y36E/EY Tumor Volume (mm 3 )! Con/sh-con! Con/sh-bl! WT/sh-con! WT/sh-bl! Y36E/sh-con! Y36E/sh-bl! 7! 1 21! 2 35! 7! 1 21! 2 35! 4
9 Yuan et al., Supplemental Figure 9, related to Figure 6 Validation of the specificity of the antibodies used in IHC IgG! a-c-bl! a-c-bl! + GST! a-c-bl! + GST-c-bl! B IgG! a-ey a-ey + GST! a-ey2! + GST-EY C IgG! a-py3 a-py3 + Y36 peptide! a-py3 + py36 peptide! D E py36 immunocytochemistry in MD-MB-231! IP:! a-igg a-erb sicon! sierb sierb: E2:! IB: a-py3 IB: a-erb Input: a-erb Input: a-gpdh
10 Yuan et al., Supplemental Figure 10, related to Figure 6 py36 correlates with patient survival!! 1. py36+ (n=22)! py36- (n=34)! P = 0.001! 1. py36+ (n=22)! py36- (n=34)! P = 0.005! Disease-free survival! Overall survival! Time (months)! Time (months)! B! py36 positive! py36 negative! C! py36 IHC; Stage I! 1. P = P = 0.17! Disease-free survival! py36- (n=122)! py36+ (n=169)! Overall survival! py36- (n=122)! py36+ (n=170)! Time (months)! Time (months)!
11 Yuan et al., Supplemental Figure 11, related to Figure 6 Total ERb IHC in breast tumors!! Total ERb positive! Total ERb negative! B! Total ERb IHC; Stage I! 1. P = P = 0.65 Overall survival! ERβ- (n=69)! ERβ+ (n=151)! Time (months)! Disease-free survival! ERβ- (n=69)! ERβ+ (n=151)! Time (months)!
12 Supplemental Table S1, related to Figure 6 summary of the IHC results, with tissues categorized by low and high expression of py36, c-bl, and EY2. The P value is generated using the χ2 test. py36 Low py36 High c-bl Low c-bl High P = 7.46 x 10-6 py36 Low py36 High EY2 Low EY2 High P = 2.89 x 10-5
13 Supplemental Table S2. Cox univariate and multivariate analysis of disease-free survival and overall survival in stage II and III breast cancer patients Univariate Multivariate Factor P value HR 95% CI P value HR 95% CI Disease-free survival Tumor size: 20 vs > 20 mm Lymph node: negative vs positive Grade: I vs II/III ERα: negative vs positive PR: negative vs positive HER2: negative vs positive ERβ: negative vs positive py36: negative vs positive Overall survival Tumor size: 20 vs > 20 mm Lymph node: negative vs positive Grade: I vs II/III ERα: negative vs positive PR: negative vs positive HER2: negative vs positive ERβ: negative vs positive py36: negative vs positive
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Supplements. Figure S1. B Phalloidin Alexa488
Supplements A, DMSO, PP2, PP3 Crk-myc Figure S1. (A) Src kinase activity is necessary for recruitment of Crk to Nephrin cytoplasmic domain. Human podocytes expressing /7-NephrinCD () were treated with
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3073 LATS2 Binding ability to SIAH2 Degradation by SIAH2 1-160 161-402 403-480 -/ 481-666 1-666 - - 667-1088 -/ 1-0 Supplementary Figure 1 Schematic drawing of LATS2 deletion mutants and
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients
1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Only Estrogen receptor positive is not enough to predict the prognosis of breast cancer
Young Investigator Award, Global Breast Cancer Conference 2018 Only Estrogen receptor positive is not enough to predict the prognosis of breast cancer ㅑ Running head: Revisiting estrogen positive tumors
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
Tumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level
moderately differentiated well differentiated Log (T/H) mrna level a Tumor stage : I II III IV.4.4.8 1.2 1.6 2. 2.4 2.8 3.2 N 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 # patient b normal colon (adjacent
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
Locoregional treatment Session Oral Abstract Presentation Saulo Brito Silva
Locoregional treatment Session Oral Abstract Presentation Saulo Brito Silva Background Post-operative radiotherapy (PORT) improves disease free and overall suvivallin selected patients with breast cancer
Expanded View Figures
Sarah Kit Leng Lui et al USP26 stabilizes SM7 MO reports xpanded View igures igure V1. USP26 enhances SM2 phosphorylation and T-b-mediated transcription. raph representing relative luciferase values obtained
SUPPLEMENTARY FIG. S3. Kaplan Meier survival analysis followed with log-rank test of de novo acute myeloid leukemia patients selected by age <60, IA
Supplementary Data Supplementary Appendix A: Treatment Protocols Treatment protocols of 123 cases patients were treated with the protocols as follows: 110 patients received standard DA (daunorubicin 45
Supplemental Figure 1
mrn/ mirn expression 3.5 3.5.5.5 +Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of 4-44 + cells (%) mrn/mirn 8 6 4.5.5.5 mir-5 sh-jg +Jagged
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.
Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei
William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
La farmacologia dei CDK4/6 inibitori
La farmacologia dei CDK4/6 inibitori Romano Danesi UO Farmacologia clinica e Farmacogenetica Università di Pisa The role of cyclin D CDK4/6 p16 Rb pathway in the cell cycle Debu Tripathy et al. Clin Cancer
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half:
a d h ΔSH2 Δ(SH3SH2) Myr SH3 SH2 Kinase domain 85 5 249 55 5 csrc ΔSH3 FlagHK HAcSrc HAcSrcΔSH2 HAcSrcΔSH3 HAcSrcΔ(SH3SH2) WB: FlagHK HAcSrc HAcSrcKD HAcSrcY529F WB: HisHK2HK2 Input GSTcSrc GST : : GST
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors
CORRECTION NOTICE Nat. Med. 22, 194 21 (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Identification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2
SUPPLEMENTARY INFORMATION Identification of non-ser/thr-pro consensus motifs for Cdk1 and their roles in mitotic regulation of C2H2 zinc finger proteins and Ect2 Kazuhiro Suzuki, Kosuke Sako, Kazuhiro
HIV-1 Tat complexes reveal subunit composition of active P-TEFb and stable association with 7SKsnRNP
HIV-1 Tat complexes reveal subunit composition of active P-TEFb and stable association with 7SKsnRNP Bijan Sobhian and Monsef Benkirane (Institute of human genetics, Montpellier, France) Many ways to activate
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
APPENDIX. CDK6 protects Epithelial Ovarian Cancer from platinum-induced death via FOXO3 regulation
APPENDIX CDK6 protects Epithelial Ovarian Cancer from platinum-induced death via FOXO3 regulation Alessandra Dall Acqua, Maura Sonego, Ilenia Pellizzari, Ilenia Pellarin, Vincenzo Canzonieri, Sara D Andrea,
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Proteomic Biomarker Discovery in Breast Cancer
Proteomic Biomarker Discovery in Breast Cancer Rob Baxter Laboratory for Cellular and Diagnostic Proteomics Kolling Institute, University of Sydney, Royal North Shore Hospital robert.baxter@sydney.edu.au
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
Supplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Supplemental Figures. Amylase. Glucose. Pancreas FAP-WT FAP-KO weight (g) mg/dl U/L 0.
Supplemental Figures A.2 3.1 2 2 1 1.5. 3 U/L 4 mg/dl weight (g).25.15 Amylase Glucose Pancreas B Trichrome HABP PAS H&E Supplemental Figure 1. FAP is dispensable for pancreatic development. (A) The pancreas
Nature Immunology doi: /ni.2771
Supplementary Figure 1. Lymphadenopathy, mitogen response, effector cells, and serum Ig assessment. (a) Computerized Tomography (CT) images demonstrating lymphadenopathy (arrows) in patient F.II.1 and
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer. Cheol Min Kang 2018/04/05
Abstract No.: ABS-0075 Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer 2018/04/05 Cheol Min Kang Department of surgery, University of Ulsan
Supplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs.
Supplementary Figure 1. Expression of the inducible tper2 is proportional to Dox/Tet concentration in Rosa-DTG/Per2 Per2-luc/wt MEFs. (a) Dose-responsive expression of tper2 by Dox. Note that there are
This PDF file includes: Supplementary Figures 1 to 6 Supplementary Tables 1 to 2 Supplementary Methods Supplementary References
Structure of the catalytic core of p300 and implications for chromatin targeting and HAT regulation Manuela Delvecchio, Jonathan Gaucher, Carmen Aguilar-Gurrieri, Esther Ortega, Daniel Panne This PDF file
Supplemental Information. Lck/Hck/Fgr-Mediated Tyrosine. Phosphorylation Negatively Regulates. TBK1 to Restrain Innate Antiviral Responses
Cell Host & Microbe, Volume 21 Supplemental Information Lck/Hck/FgrMediated Tyrosine Phosphorylation Negatively Regulates to Restrain Innate Antiviral Responses Shengduo Liu, Shasha Chen, Xinran Li, Shiying
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Recruitment of HBO1 Histone Acetylase and Blocks
Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin
The effect of delayed adjuvant chemotherapy on relapse of triplenegative
Original Article The effect of delayed adjuvant chemotherapy on relapse of triplenegative breast cancer Shuang Li 1#, Ding Ma 2#, Hao-Hong Shi 3#, Ke-Da Yu 2, Qiang Zhang 1 1 Department of Breast Surgery,
Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
Figure 6: TERT regulates MYC half-life and ubiquitination.
TERT or IgG as indicated. For the western blots, representative images of n= independent experiments are shown. Student s t-test was used, and * indicates p
Phospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
Immunotherapy for Breast Cancer Clinical Development
Immunotherapy for Breast Cancer Clinical Development Laurence Buisseret, MD, PhD Breast Cancer Translational Research Laboratory Institut Jules Bordet Université Libre de Bruxelles (ULB) ESMO preceptorship
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Expanded View Figures
MO reports PR3 dephosphorylates TZ Xian-o Lv et al xpanded View igures igure V1. PR3 dephosphorylates and inactivates YP/TZ., Overexpression of tight junction proteins Pals1 () or LIN7 () has no effect
Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
MammaPrint, the story of the 70-gene profile
MammaPrint, the story of the 70-gene profile René Bernards Professor of Molecular Carcinogenesis The Netherlands Cancer Institute Amsterdam Chief Scientific Officer Agendia Amsterdam The breast cancer
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048
PIK3CA Mutations in HER2-Positive Breast Cancer
2016.4.29. GBCC PIK3CA Mutations in HER2-Positive Breast Cancer Seock-Ah Im, MD, PhD. Department of Internal Medicine Seoul National University Hospital Contents Introduction TCGA data HER2 signaling pathway
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.
Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue
Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to
Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its
Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
supplementary information
DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.