IV Simposio International Sao Paulo Nov Hematologic malignant diseases molecular information, present and future
|
|
- Cleopatra Brooks
- 5 years ago
- Views:
Transcription
1 IV Simposio International Sao Paulo Nov Hematologic malignant diseases molecular information, present and future Dr. rer. nat. Alexander Kohlmann, MLL Munich Leukemia Laboratory
2 Spectrum of Methods in Leukemia Diagnostics Cytomorphology Cytogenetics Immunophenotyping Histology FISH Molecular Genetics
3 The Human Genome Sequencing Dimensions Sanger Sequencing ~1,500,000 US$ <5,000 US$ 5 months 1 week 1,000 US$ 1 day Human Genome Project Illumina Genome Analyzer ~2,700,000,000 US$ Ley et al., Nature Mardis et al., N Engl J Med Ley et al., N Engl J Med. 2010
4 Impact of Next-Generation Sequencing on AML IDH1 mutations DNMT3A mutations Mardis E, NEJM 2009 Ley T, NEJM 2010
5 Molecular Diagnostics in Courtesy of Lou Staudt, LLMPP group, NIH
6 Diagnosis and Classification in 2008 (AML) 1. Recurrent genetic abnormalities 2. Gene mutations 3. Multilineage dysplasia and MDS-related cytogenetic changes 4. History of patient: de novo, t-aml, or s-aml
7 MLL Munich Leukemia Laboratory NGS platforms 454 GS FLX [3] 454 GS Junior [4] Illumina MiSeq [2] NimbleGen Fluidigm RainDance [2] Beckman Coulter [3]
8 Accreditation: DIN EN ISO 15189:2007 Example parameters: TET2 CBL KRAS RUNX1
9 Utility of Amplicon (deep-/ultra-deep) Sequencing Disease Characterization / Classification Prognostic Information Predictive Information
10 454 Next-Generation Sequencing at the MLL Amplicon Sequencing Diagnostics Operations Research & Collaborations 1. Kohlmann et al., Amplicons, JCO Grossmann et al., CEBPA, J.Mol.Diagn Klein et al., Toolbox, Bioinformatics Kohlmann et al., IRON, Leukemia Kohlmann et al., NGS review, Sem. Onc Grossmann et al., Blast crisis, Leukemia Grossmann et al., NimbleGen,Leukemia Grossmann et al., EZH2, Leukemia Grossmann et al., RUNX1, Haematologica Grossmann et al., BCOR, Blood Bacher et al., TET2, Br J Haematol Haferlach et al., NF1, Leukemia Tiacci et al., DNMT3A, Leukemia Weissmann et al., TET2, Leukemia Tiacci et al., BCOR, Haematologica Grossmann et al., CALM-AF10, BJH Schnittger et al., MPNs, Haematologica, Fasan et al., GATA2 mutations, Leukemia Schnittger et al., CBL in MPN, Haematologica Grossmann et al., AML prognosis, Blood Grossmann et al., RAS in Myeloma, BCJ Meggendorfer et al. SFSR2 in CMML, Blood Schnittger et al., ASXL1 in AML, Leukemia 2012
11 Mutation Analysis Using the 454 Instrument Deep-Sequencing of Amplicons in routine diagnostics operations Target (gene / region)
12 454 Sequencing Candidate Genes: TET2 13 amplicons 6 amplicons E3 E4 E5 E6 E7 E8 E9 E10 E11 3,409bp 91bp 94bp 209bp 151bp 90bp 138bp 355bp 1,472bp 27 amplicons Median: 343 bp Minimum: 336 bp Maximum: 350 bp bi-directional sequencing
13 PCR Setup: TET2 CBL KRAS 96-well plate with lyophilized primers (Roche Applied Science) 3 Patients / 96-well plate A TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 FastStart B TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 FastStart C TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 TET2 FastStart D TET2 TET2 TET2 CBL TET2 TET2 TET2 CBL TET2 TET2 TET2 CBL FastStart E TET2 TET2 TET2 CBL TET2 TET2 TET2 CBL TET2 TET2 TET2 CBL FastStart F TET2 TET2 TET2 KRAS TET2 TET2 TET2 KRAS TET2 TET2 TET2 KRAS FastStart G TET2 TET2 TET2 KRAS TET2 TET2 TET2 KRAS TET2 TET2 TET2 KRAS FastStart H TET2 TET2 TET2 control TET2 TET2 TET2 control TET2 TET2 TET2 control MID Plate #1 MID Plate #2 MID Plate #3
14 Sample Preparation: Non-454 Workflow Sample Entry Entity Sample type Ficoll Gradient Cell count Purity DNA Isolation 12 samples/run [ Quantification ]
15 Overview: Automation Solutions PCR & Purification PCR set-up Pre-configured Plates PCR purification (Beckman) Amplicon pooling (Beckman) Titanium Chemistry empcr Breaking Enrichment (454 REM) Sequencing 8-lane PTP Multiplexing GS Junior PCR set-up: targeted sequencing Fluidigm, RainDance, NimbleGen PCR clean-up: Agencourt solution; implemented in Q Bead enrichment: implemented in Q4-2010
16 Automation of Sample Preparation Steps - I 1. Purification of PCR products 2. Preparation of quantification
17 Automation of Sample Preparation Steps - II Bead - Enrichment
18 GS FLX Run Performance (8-lane PTP) Reactions 799,961
19 NGS Assay: Flowgram of a Single Well T A C G PicoTiterPlate Flow of incorporated nucleotides
20 Comparison of Sequencing Methodologies T A C G Sanger sequencing Next-generation
21 Sequencing Methodologies: NGS T A C G Read: GS6YAAE01AK65W rank= x=124.5 y= Read length=412 TGTACTACTCTACGGTAGCAGAGACTTGGTCTG ACCGGGATCTCCTCTCTGGTTTCTCCTCTTTAG TAATCTCTATGGGCGTGTGTGGTATCAACATGG GATGCACCATGCCCAACCCCAGGGCATCTTGGT AGGTCACAAACTCTGGACGGCCGGTGGGAAGCC CATAGGGCAACCCAGGCTTTGGGGCAAGGTGCC CAGGAAACAGACTGCCATTGGGTAACAAAACTG GGTGAGGGTAGACAGGTCCTTTGCCATGTAAGG AGAGGGGACTTACAGCAATGCCCTCAGGGGCTG GGTAAGGGAGGTAACTCCTGGGGTAGGGAATTG GTGGGGACCTGAATGCCTCATTTGGAGACAGAA ATATAGAGCTTGGTGGAAGGCCTGTAGAACCAT Next-generation Sequencing GTCGTCAGTGTGAGTA
22 454 NGS Data Analysis Workflow Amplicon Pipeline Alignment & Analysis Sequencing Raw Images Image processing Signal processing Read: GS6YAAE01AK65W rank= x=124.5 y= Read length=412 TGTACTACTCTACGGTAGCAGAGACTTGGTCTG ACCGGGATCTCCTCTCTGGTTTCTCCTCTTTAG TAATCTCTATGGGCGTGTGTGGTATCAACATGG GATGCACCATGCCCAACCCCAGGGCATCTTGGT AGGTCACAAACTCTGGACGGCCGGTGGGAAGCC CATAGGGCAACCCAGGCTTTGGGGCAAGGTGCC CAGGAAACAGACTGCCATTGGGTAACAAAACTG GGTGAGGGTAGACAGGTCCTTTGCCATGTAAGG AGAGGGGACTTACAGCAATGCCCTCAGGGGCTG GGTAAGGGAGGTAACTCCTGGGGTAGGGAATTG GTGGGGACCTGAATGCCTCATTTGGAGACAGAA ATATAGAGCTTGGTGGAAGGCCTGTAGAACCAT GTCGTCAGTGTGAGTA Amplicon variants Indel detection SNP calling Coverage plots Quality report Medical validation Report - 9 hours run time - 600,000 reads images - e.g. 128 RUNX1 assays - 30 GB data - >500-fold coverage
23 nonsense mutation missense mutation deletion conserved domain What About Data Analysis? Post-454 GS Amplicon Variant Analyzer Data Processing SFF files Transfer to cluster AVA Software HTML-Report QC, Visualization JSI Software 454 Toolbox HTML-Report JSI Sequence Pilot Klein H.-U. et al., Bioinformatics. 2011;27(8):
24 Detection of Mutations in AVA: TET2 example Reference sequence 454 intensity data Mutation Roche Amplicon Variant Analyzer (AVA) software
25 TET2 Variant Analysis in AVA Software c.??? p.??? Roche Amplicon Variant Analyzer (AVA) software
26 TET2 Variant Analysis in Sequence Pilot c.5183_5187delagatg p.glu1728glyfsx10 JSI SeqPilot software
27 Utility of Amplicon (deep-/ultra-deep) Sequencing Disease Characterization / Classification Prognostic Information Predictive Information
28 Chronic Myelomonocytic Leukemia (CMML) Clonal hematopoietic malignancy characterized by features of both a myeloproliferative neoplasm and a myelodysplastic syndrome (WHO classification 2008) n=81 cases selected for mutation analysis in seven candidate genes Next-generation amplicon deep-sequencing (454) CMML-1 (n=45): Blasts (including promonocytes) <5% in the PB; <10% in the BM CMML-2 (n=36): Blasts (including promonocytes) 5-19% in the PB or 10-19% in the BM, or when Auer rods are present irrespective of the blast plus promonocyte count
29 CMML Patients (n=81) PCR amplicons Sex Male 57 (70.4%) Female 24 (29.6%) CBL: exons 8 and 9 Age (years) JAK2: exons 12 and 14 MPL: exon 10 NRAS: exons 2 and 3 KRAS: exons 2 and 3 Patient Characteristics and Target Genes RUNX1: complete coding region TET2: complete coding region CMML Patients (n=81) Median 72.8 Range CMML 1 45 (55.6%) 2 36 (44.4%) Karyotype Normal or -Y 63 (81.8%) Aberrant 14 (18.2%) Missing data 4 Bone marrow blasts (%) Median 10.0 Range Missing data 27 Peripheral blood blasts (%) Median 3.0 Range 0-35 Missing data 48 White blood cell count (10 9 /liter) Median 13.4 Range Missing data 11 Platelets (10 9 /liter) Median 82.5 Range Missing data 13
30 Variant Frequency Table: Exemplary 9 Cases CBL JAK2 KRAS MPL NRAS
31 Molecular Aberrations in 81 CMML Patients TET2 [44.4%] CBL [22.2%] NRAS [22.2%] KRAS [12.3%] JAK2 [9.9%] RUNX1 [8.7%] MPL [0%] no mut. [27.1%] Karyotype CMML normal karyotype (incl. -Y) aberrant karyotype data not available CMML-1 CMML-2 59/81 (72.8%) cases mutated In mean, 1.6 mutations per case were observed (range 1-6) In no case were CBL and KRAS aberrations, or JAK2 and RUNX1 mutations, concomitantly detected Kohlmann A. et al., J Clin Oncol ;28:
32 -(d/dt) Fluorescence (640/530) Sensitivity of Amplicon Deep-Sequencing NGS JAK2 V617F 606 reads 1.16% mutated GTC Melting Peaks codon 617 ==> TTC Standard Melting curve analysis * ~1% mutated V617F and LOH Mutation Melting Peaks wild-type Temperature ( C) Tem perature ( C) Melting Peaks * Schnittger S. et al., Leukemia Dec;20(12):
33 RAS Pathway Alterations in CMML NRAS: 10 mutations were found in 18/81 (22.2%) cases KRAS: 8 mutations were detected in 10/81 (12.3%) cases Only 3/81 (3.7%) cases harbored mutations in both NRAS and KRAS 25/81 (30.9%) patients either harbored mutations in NRAS or KRAS KRAS 107: G/T 9.1% 130: G/T 131: A/T 18.10% 17.28% G12C L19F T20S Patient #34 Clonality?
34 B Resolution of Distinct Subclones (KRAS) KRAS Case #33 exon 2; Gly12Cys exon 2; Leu19Phe exon 2; Thr20Ser
35 454 Hematology Focus Group Meeting from Monday 10th May - Tuesday 11th May 2010, Munich 50 participants from 12 countries, 3 continents Topic: Next-generation sequencing applications Results: Interlaboratory Robustness Of NGS (IRON) study
36 IRON Study: Participants and Laboratories Prof. Haferlach, Munich Leukemia Laboratory, Munich Dr. Timmermann, Max Planck Institute for Molecular Genetics, Berlin Germany Germany Italy Prof. Basso, Università degli studi di Padova, Padova Prof. Young, St. Bartholomews, London GB USA Dr. Simen, 454 Life Sciences, Branford Dr. Gabriel, Blood Bank, Linz Austria Austria Belgium Prof. Vandenberghe, UZ Leuven, Belgium Prof. Martinelli, University of Bologna Italy Netherlands Brazil Dr. Garicochea, Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre Dr. JH Jansen, Radboud University Medical Centre, Nijmegen
37 IRON Study: Samples and Study Materials 18 samples (CMML) Centrally collected by MLL Aliquots prepared (1.6 µg) Shipping package Blinded sample aliquots 454 reagents Enzymes 96-well primer plates Study protocol IRON: Interlaboratory RObustness of Next-generation sequencing
38 IRON Study: Consistency of Mutations Leu34Phe Median: 49.8% Minimum: 45.8% Maximum: 54.7% Ile1762Val Median: 49.6% Minimum: 45.4% Maximum: 53.9%
39 IRON: Mutation Load and Coverage Distribution Kohlmann A. et al., Leukemia. 2011;25(12):
40 Utility of Amplicon (deep-/ultra-deep) Sequencing Disease Characterization / Classification Prognostic Information Predictive Information
41 Survival according to Cytogenetics: AML Schoch et al., Blood, 102, , 2003
42 Karyotype vs. Molecular Markers in AML A novel hierarchical prognostic model of AML solely based on molecular mutations 1,000 AML patients with cytogenetic data available were investigated for the following molecular alterations: PML-RARA, RUNX1-RUNX1T1, CBFB-MYH11, FLT3-ITD, and MLL-PTD, as well as mutations in NPM1, CEPBA, RUNX1, ASXL1, and TP53 Clinical data was available in 841 patients. Grossmann et. al., Blood 2012
43 Karyotype vs. Molecular Markers in AML Grossmann et. al., Blood 2012
44 Can we detect MRD? RUNX1 Alterations in AML RUNX1: Runt-related transcription factor 1 Regulator of differentiation of hematopoietic stem cells into mature blood cells Various types of alterations: 1) Translocations 2) Intragenic mutations Frequently mutated in de novo AML with NK or non-complex chromosomal imbalances Dicker F. et al., Blood. 2007;110:
45 RUNX1 Mutations in AML strong adverse prognostic effect in AML with normal karyotype or noncomplex chromosomal imbalances Especially in those cases that do not carry CEBPA, NPM1, FLT3-ITD, or MLL- PTD alterations total cohort RUNX1wt (n=183; median: n.r.) RUNX1mut (n=97; median: 378 days) intermediate cytogenetic risk RUNX1wt (n=81; median: n.r.) RUNX1mut (n=67; median: 348 days) p= Days Patients with NK and noncomplex chromosomal imbalances p= Days without mutations in NPM1, CEBPA, FLT3-ITD, or MLL-PTD Schnittger S. et al., Blood. 2011; 117(8):
46 RUNX1: First Candidate Gene in Routine Dx Transcript ID: ENST E3 270bp E4 157bp E5 105bp E6 192bp E7 162bp E8 476bp 7 amplicons Median: 342 bp Minimum: 341 bp Maximum: 348 bp Grossmann V. et al., Haematologica. 2011;96(12):
47 GS Junior Performance: Ideal Output RUNX1 107,842 reads
48 Detection of Molecular RUNX1 Mutations Clone #1: 909-fold coverage 11.55% mutated c.1098_1106delaggcccgttinsg p.gly367profsx203 #1 #2 Clone #2: 909-fold coverage 32.34% mutated c.1144_1150delgcctcgginscc p.ala382profsx189
49 Serial Analyses of RUNX1 Mutations Category #1: responders 55% (17/31) of patients responded to therapy and were characterized by a total clearance of the mutated clone at the first time point of follow-up November 2010 Mutation at diagnosis Amplicon 8.1 Codons fold coverage p.gly366glyfsx204 p.ser383argfsx188 February 2011 Mutation at 1 st follow-up Amplicon 8.1 Codons ,697-fold coverage
50 Serial Analyses of RUNX1 Mutations Category #2: patients with refractory disease and Transplantation
51 What is the Near-Term Future of Diagnostics? Gene expression DNA copy number Methylation exome or genome sequencing Amplicon deep-sequencing (gene panels)
52 Summary and Conclusions Next-generation sequencing can be renamed into Now-generation sequencing Amplicon deep-sequencing is a technically challenging and complex workflow, but can be applied in an accredited and certified diagnostic environment Laboratory-developed assays allow the characterization of a variety of hematological malignancies for targeted genomic regions, mostly distinct genes or exons, e.g. RUNX1, CEBPA, TET2, TP53, EZH2, KRAS, CBL Major achievements thus far: (1) breakthrough of whole-exome sequencing efforts in cancer patients, predominantly as part of largescale international programs; and (2) the implementation of targeted resequencing of regions/genes of interest in diagnostic workflows
BHS Annual Meeting
BHS Annual Meeting 2014 01.02.2014 Implementing next-generation deepsequencing assays in diagnostic algorithms in hematological malignancies Dr. Alexander Kohlmann Medical Need for Molecular Characterization
More informationNext Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
More informationSupplemental Material. The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia
Supplemental Material The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia Torsten Haferlach, 1 Anna Stengel, 1 Sandra Eckstein, 1 Karolína
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationConcomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia
Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Feng-Ming Tien, Hsin-An Hou, Jih-Luh Tang, Yuan-Yeh Kuo, Chien-Yuan Chen, Cheng-Hong Tsai, Ming Yao, Chi-Cheng
More informationSUPPLEMENTARY INFORMATION
Supplementary Information S1 Frequency of DNMT3A mutations in hematologic disorders and their associated clinical phenotypes. Disease Patient population Frequency (%) Associated Clinical Characteristics
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationMolecular Markers in Acute Leukemia. Dr Muhd Zanapiah Zakaria Hospital Ampang
Molecular Markers in Acute Leukemia Dr Muhd Zanapiah Zakaria Hospital Ampang Molecular Markers Useful at diagnosis Classify groups and prognosis Development of more specific therapies Application of risk-adjusted
More informationADRL Advanced Diagnostics Research Laboratory
ADRL Advanced Diagnostics Research Laboratory John DeCoteau, MD FRCP Department of Pathology, Division of Hematopathology University of Saskatchewan Saskatchewan Cancer Agency ADRL Project Objectives New
More informationNew drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna
New drugs in Acute Leukemia Cristina Papayannidis, MD, PhD University of Bologna Challenges to targeted therapy in AML Multiple subtypes based upon mutations/cytogenetic aberrations No known uniform genomic
More informationMutational Impact on Diagnostic and Prognostic Evaluation of MDS
Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by
More informationWHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities
WHO Classification of Myeloid Neoplasms with Defined Molecular Abnormalities Robert W. McKenna, M.D. 1/2009 WHO Classification of Myeloid Neoplasms (4th Edition)--2008 Incorporates new information that
More informationCurrent Techniques in Molecular Biology Friedel Nollet, Ph.D.
Current Techniques in Molecular Biology Friedel Nollet, Ph.D. Molecular Biology and Cytometry course May 16-17, 2013 Mol, SCK-CEN, Belgium Sanger DNA sequencing Kary Mullis received a Nobel Prize in chemistry
More informationUpdate on the WHO Classification of Acute Myeloid Leukemia. Kaaren K. Reichard, MD Mayo Clinic Rochester
Update on the WHO Classification of Acute Myeloid Leukemia Kaaren K. Reichard, MD Mayo Clinic Rochester reichard.kaaren@mayo.edu Nothing to disclose Conflict of Interest Objectives Present a practical
More informationExamining Genetics and Genomics of Acute Myeloid Leukemia in 2017
Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Elli Papaemmanuil, PhD Memorial Sloan Kettering Cancer Center New York, New York, United States Today s Talk Cancer genome introduction
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Patel JP, Gönen M, Figueroa ME, et al. Prognostic relevance
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationOverview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology
Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology
More informationBlastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )
Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH2017-0314) Habibe Kurt, Joseph D. Khoury, Carlos E. Bueso-Ramos, Jeffrey L. Jorgensen, Guilin Tang, L. Jeffrey Medeiros, and
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More informationDisclosure: Objectives/Outline. Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations. Nothing to disclose.
RC1 Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations RC2 Disclosure: Nothing to disclose Henry Moon Lecture: UCSF Annual Conference Kathryn Foucar, MD kfoucar@salud.unm.edu May
More informationMolecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.
Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine
More informationAcute leukemia and myelodysplastic syndromes
11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid
More informationPublished Ahead of Print on June 22, 2017, as doi: /haematol Copyright 2017 Ferrata Storti Foundation.
Published Ahead of Print on June 22, 2017, as doi:10.3324/haematol.2017.166173. Copyright 2017 Ferrata Storti Foundation. Molecular analysis of myelodysplastic syndrome with isolated del(5q) reveals a
More informationDiagnostic Molecular Pathology of Myeloid Neoplasms
Diagnostic Molecular Pathology of Myeloid Neoplasms Beirut, Lebanon Tuesday November 29, 2011: Pre-congress workshop Adam Bagg University of Pennsylvania Philadelphia, USA Myeloid neoplasms Myeloproliferative
More informationClonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu
More informationCorporate Medical Policy. Policy Effective February 23, 2018
Corporate Medical Policy Genetic Testing for FLT3, NPM1 and CEBPA Mutations in Acute File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_flt3_npm1_and_cebpa_mutations_in_acute_myeloid_leukemia
More informationAcute Myeloid Leukemia with RUNX1 and Several Co-mutations
Case SH2017-0281 Acute Myeloid Leukemia with RUNX1 and Several Co-mutations James Bauer, MD, PhD David Yang, MD Erik Ranheim, MD, PhD Catherine Leith, MB, Bchir Clinical History Chief Complaint: 72 year
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationJuan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1
Juan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1 Xin Hua Hospital, Shanghai, China 2 Oregon Health & Science University, Portland, OR, United States AML is a hematopoietic neoplasms characterized
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationPartial tandem duplication of KMT2A (MLL) may predict a subset of myelodysplastic syndrome with unique characteristics and poor outcome
Published Ahead of Print on January 19, 2018, as doi:10.3324/haematol.2017.185249. Copyright 2018 Ferrata Storti Foundation. Partial tandem duplication of KMT2A (MLL) may predict a subset of myelodysplastic
More informationReporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia
More information5/21/2018. Disclosures. Objectives. Normal blood cells production. Bone marrow failure syndromes. Story of DNA
AML: Understanding your diagnosis and current and emerging treatments Nothing to disclose. Disclosures Mohammad Abu Zaid, MD Assistant Professor of Medicine Indiana University School of Medicine Indiana
More informationCost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
More informationWest Midlands Regional Genetics Laboratory
West Midlands Regional Genetics Laboratory Haemato-oncology service update letter October 2017 Dear colleagues, We are writing to outline the latest developments to our service, aiming to support the management
More informationHEMATOLOGIC MALIGNANCIES BIOLOGY
HEMATOLOGIC MALIGNANCIES BIOLOGY Failure of terminal differentiation Failure of differentiated cells to undergo apoptosis Failure to control growth Neoplastic stem cell FAILURE OF TERMINAL DIFFERENTIATION
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO
More informationLaboratory Service Report
Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic
More informationMolecular profiling in confirming the diagnosis of early myelodysplastic syndrome
Molecular profiling of early MDS Hematopathology - March 2016 Article Molecular profiling in confirming the diagnosis of early myelodysplastic syndrome Maya Thangavelu 1,*, Ryan Olson 2, Li Li 2, Wanlong
More informationAvailable online at
Annals of Clinical & Laboratory Science, vol. 45, no. 5, 2015 Available online at www.annclinlabsci.org Bioinformatics Analysis to Determine Prognostic Mutations of 72 de novo Acute Myeloid Leukemia Cases
More informationDISCLOSURE Luca Malcovati, MD. No financial relationships to disclose
ICUS, CCUS and CHIP Luca Malcovati, MD Department of Molecular Medicine, University of Pavia Medical School, & Department of Hematology Oncology, IRCCS Policlinico S. Matteo Foundation, Pavia, Italy DISCLOSURE
More informationImpact of Biomarkers in the Management of Patients with Acute Myeloid Leukemia
Impact of Biomarkers in the Management of Patients with Acute Myeloid Leukemia Hartmut Döhner Medical Director, Department of Internal Medicine III Director, Comprehensive Cancer Center Ulm Ulm University,
More informationManagement of Myelodysplastic Syndromes
Management of Myelodysplastic Syndromes Peter L. Greenberg, MD Stanford Cancer Institute Myelodysplastic Syndromes: Clinical & Molecular Advances for Disease Classification and Prognostication MDSs: A
More informationAML: WHO classification, biology and prognosis. Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen
AML: WHO classification, biology and prognosis Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Acute myeloid leukemia Clonal expansion of undifferentiated myeloid precursors Impaired
More informationLeukemia and subsequent solid tumors among patients with myeloproliferative neoplasms
Leukemia and subsequent solid tumors among patients with myeloproliferative neoplasms Tiziano Barbui (tbarbui@asst-pg23.it Hematology and Research Foundation,Ospedale Papa Giovanni XXIII, Bergamo Italy
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Schlenk RF, Döhner K, Krauter J, et al. Mutations and treatment
More informationASBMT MDS/MPN Update Sunil Abhyankar, MD
ASBMT MDS/MPN Update Sunil Abhyankar, MD Professor of Medicine Medical Director, Pheresis and Cell Processing Division of Hematologic Malignancies and Cellular Therapeutics Department of Internal Medicine
More informationLaboratory Service Report
Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-ih2xuglwpq.ashx Indication for Test DS CR Pathogenic utations Detected CR 1. JAK2: c.1849g>t;p.val617phe
More informationMyelodysplastic syndromes and the new WHO 2016 classification
Myelodysplastic syndromes and the new WHO 2016 classification 32nd General Annual Meeting of the Belgian Hematology Society 10-11 February 2017 Gregor Verhoef, Departement of Hematology, University Hospital
More informationMolecularly Targeted Therapies - Strategies of the AMLSG
Molecularly Targeted Therapies - Strategies of the AMLSG Richard Schlenk Department of Internal Medicine III Ulm University, Germany Genotype-adapted Leukemia Program NAPOLEON GIMEMA/AMLSG/SAL APL [t(15;17)]
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationPublished Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation.
Published Ahead of Print on April 14, 2016, as doi:10.3324/haematol.2016.143214. Copyright 2016 Ferrata Storti Foundation. Immunohistochemical pattern of p53 is a measure of TP53 mutation burden and adverse
More informationAugust 17, Dear Valued Client:
August 7, 08 Re: CMS Announces 6-Month Period of Enforcement Discretion for Laboratory Date of Service Exception Policy Under the Medicare Clinical Laboratory Fee Schedule (the 4 Day Rule ) Dear Valued
More informationMinimal Residual Disease as a Surrogate Endpoint in Acute Myeloid Leukemia Clinical Trials
Minimal Residual Disease as a Surrogate Endpoint in Acute Myeloid Leukemia Clinical Trials Fda.gov Adriano Venditti Hematology, University Tor Vergata, Rome, Italy Minimal Residual Disease 10 12 Relapse
More informationMolecular Genetic Testing for the Diagnosis of Haematological Malignancies
Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench Haemto-Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge UK Molecular
More informationSESSION 1 Reactive cytopenia and dysplasia
SESSION 1 Reactive cytopenia and dysplasia Falko Fend, Tübingen & Alexandar Tzankov, Basel 1 Disclosure of speaker s interests (Potential) conflict of interest none Potentially relevant company relationships
More informationGENETICS OF HEMATOLOGICAL MALIGNANCIES
de DUVE INSTITUTE GENETICS OF HEMATOLOGICAL MALIGNANCIES INTERUNIVERSITY CERTIFICATE IN HUMAN GENETICS Université catholique de Louvain Brussels,19/02/2016 Professor Hélène Antoine-Poirel, MD, PhD Center
More informationCHALLENGING CASES PRESENTATION
CHALLENGING CASES PRESENTATION Michael C. Wiemann, MD, FACP Program Co-Chair and Vice President Indy Hematology Education President, Clinical St. John Providence Physician Network Detroit, Michigan 36
More informationTreatments and Current Research in Leukemia. Richard A. Larson, MD University of Chicago
Treatments and Current Research in Leukemia Richard A. Larson, MD University of Chicago 2 Acute (rapid progression) Myeloid Acute myeloid leukemia (AML) Acute promyelocytic leukemia (APL) Lymphoid Acute
More informationCase 1. Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX
Case 1 Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX Disclosure of Relevant Financial Relationships The USCAP requires that anyone in a position to influence or control the content of all CME
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationMyelodysplastic Syndromes. Post-ASH meeting 2014 Marie-Christiane Vekemans
Myelodysplastic Syndromes Post-ASH meeting 2014 Marie-Christiane Vekemans Agenda New biological developments Risk assessment and prognostic factors New therapeutic options Agenda New biological developments
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationPersonalized Therapy for Acute Myeloid Leukemia. Patrick Stiff MD Loyola University Medical Center
Personalized Therapy for Acute Myeloid Leukemia Patrick Stiff MD Loyola University Medical Center 708-327-3216 Major groups of Mutations in AML Targets for AML: Is this Achievable? Chronic Myeloid Leukemia:
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091533 Age 28 Years Gender Male 1/9/2017 120000AM 1/9/2017 105415AM 4/9/2017 23858M Ref By Final LEUKEMIA DIAGNOSTIC COMREHENSIVE ROFILE, ANY 6 MARKERS t (1;19) (q23
More informationDNMT3A mutations and clinical features in Chinese patients with acute myeloid leukemia
Lu et al. Cancer Cell International 2013, 13:1 PRIMARY RESEARCH Open Access DNMT3A mutations and clinical features in Chinese patients with acute myeloid leukemia Quanyi Lu 1*, Yamei Chen 1, Hang Wang
More informationTEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days
TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome
More informationDepartment of Leukemia, The University of Texas M.D. Anderson Cancer Center, Houston, Texas; 2 Sunesis Pharmaceuticals, Inc, South San Francisco
Phase I/II Study of Vosaroxin and Decitabine in Newly Diagnosed Older Patients with Acute Myeloid Leukemia (AML) and High Risk Myelodysplastic Syndrome (MDS) Naval Daver 1, Hagop Kantarjian 1, Guillermo
More informationChanging AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight
Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight Co-Moderators: Rick Winneker, PhD, Senior Vice President, Research, Leukemia & Lymphoma Society Mike
More informationCorrigenda. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues (revised 4th edition): corrections made in second print run
Corrigenda WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues (revised 4th edition): corrections made in second print run In addition to corrections of minor typographical errors, corrections
More informationNew treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke
University of Groningen New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke IMPORTANT NOTE: You are advised to consult the publisher's version
More informationTable 1: biological tests in SMD
Table 1: biological tests in SMD Tests Mandatory Recommended Under validation Morphology Marrow aspirate Marrow biopsy 1 Iron staining Quantification of dysplasia WHO 2008 Classification Cytogenetics Conventional
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationSchool of Pathology and Laboratory Medicine: Current and New Research Interests
School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling
More informationMolecular Pathology Evaluation Panel and Molecular Pathology Consortium Advice Note
Molecular Pathology Evaluation Panel and Molecular Pathology Consortium Advice Note MPEP/MPC Advice Note 2016-02 June 2016 Test evaluated: Tumour Protein p53 (TP53) Molecular Pathology Evaluation Panel
More informationPrognostic Scoring Systems for Therapeutic Decision Making in MDS. Peter Greenberg, MD Stanford University Cancer Center Stanford, CA
Prognostic Scoring Systems for Therapeutic Decision Making in MDS Peter Greenberg, MD Stanford University Cancer Center Stanford, CA DISCLOSURE I have no relevant financial relationships to disclose. MDSs:
More informationDepartment of Leukemia, The University of Texas M.D. Anderson Cancer Center, Houston, Texas; 2 Sunesis Pharmaceuticals, Inc, South San Francisco
Phase I/II Study of Vosaroxin and Decitabine in Newly Diagnosed Older Patients with Acute Myeloid Leukemia (AML) and High Risk Myelodysplastic Syndrome (MDS) Naval Daver 1, Hagop Kantarjian 1, Guillermo
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationMyelodysplastic syndrome is a highly heterogeneous hematopoietic
SHORT COMMUNICATION Clinical Characteristics and Prognosis of 48 Patients with Mutations in Myelodysplastic Syndrome Yulu Tian #, Ruijuan Zhang #, Linhua Yang* Yang L. Clinical Characteristics and Prognosis
More informationEXT ADDRESS CITY LAST NAME ID NUMBER PT. ADDRESS CITY INSURANCE PROVIDER. 0 Other. 0 IGH/B-cell cionaliry (PCR)
THE UNIVERSITY OF TEXAS *Required Fields PHYSICIAN! FACILITY/ CLIENT INFORMATION MDAndersonefief &ter MaltgararEettcy 'REQUESTING PHYSICIAN Division of Pathology! Laboratory Medicine Services Test Requisition
More informationOpportunities for Optimal Testing in the Myeloproliferative Neoplasms. Curtis A. Hanson, MD
Opportunities for Optimal Testing in the Myeloproliferative Neoplasms Curtis A. Hanson, MD 2013 MFMER slide-1 DISCLOSURES: Relevant Financial Relationship(s) None Off Label Usage None 2013 MFMER slide-2
More informationACCME/Disclosures. History. Hematopathology Specialty Conference Case #4 4/13/2016
Hematopathology Specialty Conference Case #4 Sherrie L. Perkins MD, PhD University of Utah ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose
More informationMyelodysplastic syndromes Impact of Biology. Lionel Adès Hopital Saint Louis Groupe Francophone des SMD. Épidémiologie
Myelodysplastic syndromes Impact of Biology Lionel Adès Hopital Saint Louis Groupe Francophone des SMD Épidémiologie Incidence : 3 à 6 / 100 000 hab. / An Prédomine chez les sujets âgés Augmentation de
More informationMRD detection in AML. Adriano Venditti Hematology Fondazione Policlinico Tor Vergata Rome
MRD detection in AML Adriano Venditti Hematology Fondazione Policlinico Tor Vergata Rome Determinants of Treatment Response Leukemia Tumor burden Growth potential Drug resistance Karyotype Genetics Host
More informationInitial Diagnostic Workup of Acute Leukemia
Initial Diagnostic Workup of Acute Leukemia Guideline from the College of American Pathologists (CAP) and the American Society of Hematology (ASH) Publication: Archives of Pathology and Laboratory Medicine
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationThe role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia
The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)
More informationMolecular Genetic Testing to Predict Response to Therapy in MDS
Molecular Genetic Testing to Predict Response to Therapy in MDS Rafael Bejar MD, PhD Bone Marrow Failure Disease Scientific Symposium Rockville, MD March 18 th, 2016 Overview Response Criteria Lenalidomide
More informationThe Center for PERSONALIZED DIAGNOSTICS
The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)
More informationMeasurable/Minimal Residual Disease in Patients with Acute Myeloid Leukemia Undergoing Transplantation
Measurable/Minimal Residual Disease in Patients with Acute Myeloid Leukemia Undergoing Transplantation June 9, 2018 Dave Sanford The Leukemia/Bone Marrow Transplant Program of British Columbia Disclosures
More informationChronic Myelomonocytic Leukemia with molecular abnormalities SH
Chronic Myelomonocytic Leukemia with molecular abnormalities SH2017-0351 Madhu P. Menon MD,PhD, Juan Gomez MD, Kedar V. Inamdar MD,PhD and Kristin Karner MD Madhu P Menon, MD, PhD Henry Ford Hospital Patient
More informationMyelodysplastic syndromes
Myelodysplastic syndromes Robert P Hasserjian Massachusetts General Hospital, Boston, MA Disclosure of Relevant Financial Relationships Dr. Hasserjian declares he has no conflict(s) of interest to disclose.
More informationCBL and EZH2 as new molecular markers in MPN
CBL and EZH2 as new molecular markers in MPN Andy Chase University of Southampton and Wessex Regional Genetics Laboratory Salisbury, UK Munich 2011 * Myeloproliferative neoplasms MDS/MPN Myelodysplastic
More information