BHS Annual Meeting

Transcription

1 BHS Annual Meeting Implementing next-generation deepsequencing assays in diagnostic algorithms in hematological malignancies Dr. Alexander Kohlmann

2 Medical Need for Molecular Characterization 1. Diagnosis/Classification 2. Prognosis 3. Targeted/individualized therapy 4. Minimal residual disease (MRD)

3 Developments in NGS and 2014 Outlook Adopted from Lex Nederbragt

4 Developments in NGS and 2014 Outlook HiSeq X Ten NextSeq MiSeqDx Junior+ MinION GeneReader Adopted from Lex Nederbragt

5 Editor's Summary: A Cancer Genome 6 Nov The technologies that made it possible to characterize individual African and Chinese genomes have broad application in the biomedical field. A demonstration of what can be achieved in a medical context is the first comprehensive sequence of an individual cancer genome, for a patient with AML

6 NGS and Hematological Malignancies Chronic Lymphocytic Leukemia, Nature 2011: NOTCH1 mutations Chronic Lymphocytic Leukemia, NEJM 2011: SF3B1 mutations Hairy Cell Leukemia, NEJM 2011: BRAF mutations Multiple Myeloma, Nature 2011: BRAF mutations non-hodgkin Lymphoma, Nature 2011: MLL2 mutations Burkitt Lymphoma, Nat Gen, Nature 2012: ID3 mutations MDS, Nature + NEJM 2011: SF3B1 + splicing machinery mutations AML, Blood 2011: BCOR mutations AML, Nature, Cell, NEJM 2012: clonal evolution, cohesin genes mutations WM, NEJM 2012: MYD88 mutations T-LGL, NEJM 2012: STAT3 mutations MPN, NEJM 2013: CALR mutations

7 MLL Munich Leukemia Laboratory NGS platforms GS FLX [3] 454 GS Junior [4] Illumina MiSeq [3] Ion Torrent PGM [1] NimbleGen Fluidigm RainDance Beckman Coulter [4] IT (Cluster)

8 Interactions in Routine Diagnostics General practioner Patient Biostatistician Hematologist Molecular biologist Pathologist Cytogeneticist Technician

9 Basic Principles of NGS Approaches [DNA] Whole -exome (WES) ~60 Mb region ~100X coverage Read: 2 x 100 bp Coding regions Gene panels >1000X coverage Deep-sequencing Up to few 100 kb region Read: 500 bp bidirectional Quantitative data Whole-genome (WGS) 3.3 Gb region ~30-40X coverage Read: 2 x 100 bp Structural aberrations

10 Accreditation: DIN EN ISO 15189:2007 Example analyses: TET2 CBL KRAS RUNX1

11 Mutation Analysis Using 454 Sequencing Amplicon deep-sequencing in routine diagnostics operations Target (gene / region)

12 Sample Preparation Options for NGS 96-well plates Access Arrays Microdroplets µl reaction volume 2000 ng / plate up to 95 amplicons / case nl reaction volume 50 ng / reaction 48 amplicons x 48 cases pl reaction volume 2000 ng / sample up to 4000 amplicons

13 454 Sequencing Candidate Genes: TET2 13 amplicons 6 amplicons E3 E4 E5 E6 E7 E8 E9 E10 E11 3,409bp 91bp 94bp 209bp 151bp 90bp 138bp 355bp 1,472bp 27 amplicons Median: 343 bp Minimum: 336 bp Maximum: 350 bp bi-directional sequencing

14 454 Life Sciences Titanium PicoTiterPlate 900,000 reads

15 Sequencing Methodologies: 454 Life Science T A C G Next-generation Sequencing Read: GS6YAAE01AK65W rank= x=124.5 y= Read length=412 TGTACTACTCTACGGTAGCAGAGACTTGGTCTG ACCGGGATCTCCTCTCTGGTTTCTCCTCTTTAG TAATCTCTATGGGCGTGTGTGGTATCAACATGG GATGCACCATGCCCAACCCCAGGGCATCTTGGT AGGTCACAAACTCTGGACGGCCGGTGGGAAGCC CATAGGGCAACCCAGGCTTTGGGGCAAGGTGCC CAGGAAACAGACTGCCATTGGGTAACAAAACTG GGTGAGGGTAGACAGGTCCTTTGCCATGTAAGG AGAGGGGACTTACAGCAATGCCCTCAGGGGCTG GGTAAGGGAGGTAACTCCTGGGGTAGGGAATTG GTGGGGACCTGAATGCCTCATTTGGAGACAGAA ATATAGAGCTTGGTGGAAGGCCTGTAGAACCAT GTCGTCAGTGTGAGTA

16 Illumina MiSeq Instrument Flow Cell (FC) 16,000,000 reads

17 Sequencing Methodologies: Illumina A C G T % Bases by cycle Quality by A4RR3:1:1101:15637:1456 1:N:0:1 CAGGAACTCACTGCCTCCCAGCTCTGA AACATACCATTGTTCAAGTTGAACAGA AAGCTGCACATGTATTTATCATACACT TTCCCTCTTCTGTCAGCTTCATCTTGA GAAATAATCTAAAAAGAAAGACACAGG AGAAAATTCTTTTGGATAAAGGTGATC AAGCCTGACAGTCAGATCGGAAGAGCA CACGTCTGAACTCCAGTCACGAGTGGA TCTCGTATGCCGTCTTCTGCTTGAAAA AAAAAAAA + BBBBBFFFFFFFCGGGGGGGGGHHHFB 5FFFHHHHFHHHHHHBFGGGHFHHHHH GHFHGBFFHGHHHFGHHHHHHHHHHHH HHHHHHGHHHHHHHHHHHHHFHHHHB5 EFBGGHFHHHFHFHFGGGHHHFHHGHH 0FHFGHHHHHHHHHGHHHHGHFHHFHH EFHGGHH2GFHHHHHGHGHG/F/<CFH GHHGHHHGEDHHHHFFGFHHGDG<GFH F0DGFEFHHGHGGGHGHHHGGGFF0FF GGGG?=--

18 NGS Data Analysis: MLL In-House Pipeline Kohlmann A. et al., Br J Haematol. 2013;160(6):

19 TET2 Variant Analysis Procedure (454) c.??? p.??? Roche Amplicon Variant Analyzer (AVA) software

20 TET2 Variant Analysis Procedure (454) c.5183_5187delagatg p.glu1728glyfsx10 JSI SeqPilot software

21 Utility of Amplicon Deep-Sequencing Assays Disease Characterization & Classification Predictive Information Prognostic Information

22 Deep-sequencing of RUNX1 mutations Amplicon design for deep-sequencing analysis Transcript ID: ENST E3 270bp E4 157bp E5 105bp E6 192bp E7 162bp E8 476bp 7 amplicons 454 sequencing fusion primers Median: 342 bp Minimum: 341 bp Maximum: 348 bp [FU] bp 424 RUNX1_ _ [bp] Grossmann V. et al., Haematologica. 2011;96(12):

23 Robustness of Amplicon Deep Sequencing Grossmann V. et al., J Mol Diagn. 2013;15(4):

24 Robustness of Mutation Calling Study Grossmann V. et al., J Mol Diagn. 2013;15(4):

25 Robustness of Mutation Calling Study Grossmann V. et al., J Mol Diagn. 2013;15(4):

26 IRON-I Study: Participants and Laboratories Prof. Haferlach, Munich Leukemia Laboratory, Munich Dr. Timmermann, Max Planck Institute for Molecular Genetics, Berlin Germany Germany Italy Prof. Basso, Università degli studi di Padova, Padova Prof. Young, St. Bartholomews, London GB USA Dr. Simen, 454 Life Sciences, Branford Dr. Gabriel, Blood Bank, Linz Austria Austria Belgium Prof. Vandenberghe, UZ Leuven, Belgium Prof. Martinelli, University of Bologna Italy Netherlands Brazil Dr. Garicochea, Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre Dr. JH Jansen, Radboud University Medical Centre, Nijmegen

27 IRON-I: Inter-laboratory Reproducibility TET2 Thr1096Serfs*7 % mutated Coverage A. Kohlmann et al., Leukemia; 25: , 2011

28 Longitudinal Study on Detection Robustness TP53 mutation (p.leu194arg) studied during 11 distinct runs - routine operations from 19. June September independent PCR assays - three distinct molecular barcodes (MID-066, MID-067, MID-068) - three distinct sequencing instruments TP53 p.leu194arg

29 Performance: Reproducibility & Linearity KRAS: p.gly13asp CEBPA Distinct sample preparation assays are leading to robust results Serial dilutions of amplicons yield consistent results Grossmann V. et al., J Mol Diagn. 2013;15(4):

30 Serial Analyses of RUNX1 Mutations p.gln235* p.leu294serfs*7 p.arg444profs*128 p.arg139_ser140inspro Kohlmann A. et al., Leukemia Jan;28(1):

31 Detection of Residual Disease in AML RUNX1 double mutation (p.asp133*, p.pro157thrfs*29) c.396dupt 38.0% 2.0% 0.4% 1.4% 9.0% c.467dupc 37.0% 2.0% 0.8% 1.6% 12.0%

32 Mutation Load (%) Implication of residual RUNX1 mutations Mutation load reduction analysis of 103 cases at follow-up stage 3.61% good responders (n=76) poor responders (n=27) Kohlmann A. et al., Leukemia Jan;28(1):

33 Prognostic Model of Residual Mutation Load Significant differences in (a) EFS (median 21.0 vs 5.7 months, P<0.001) and (b) OS (median 56.9 vs 32.0 months, P=0.002) a p<0.001 b p=0.002 good responders (n=76; median 21.0 months) good responders (n=76; median 56.9 months) poor responders (n=27; median 5.7 months) poor responders (n=27; median 32.0 months) Kohlmann A. et al., Leukemia Jan;28(1):

34 Molecular Detection of Mutations in CML t(9;22)(q34;q11) in CML and targeted treatment regimens Baccarani et al., Haematologica. 2008;93(2):161-9.

35 Assay Design for Deep-Sequencing in CML 1. cdna Synthesis: 1 µg total RNA required 2. First amplification: BCR-ABL1 transcript breakpoint & kinase domain (KD) 3. Second amplification of first PCR product with 454 barcoded fusion primers G250E/R T315I L248V Q252R/H H396P/R V299L F317L M244V Y253F/H L387M/F F359V E255K/V M351T F486S P-loop TK domain A-loop Soverini S. et al., Blood. 2013;122(9):

36 IRON Study Phase II: BCR-ABL1 Data BCR-ABL1 TKD screening performed in Bologna, Brno, Istanbul, London, Madrid, Prague, Rome, Salamanca, Vienna (n=615) 100% M351T 59.55% M351T 89.99% The M351T-positive clone acquires an F317L mutation which confers greater selective advantage M351T+F317L 53.27% M351T M351T+F317L 85.32% 20% Lower limit of Sanger Sequencing 46.56% 0.05% male, 64 yrs DAS after IM failure Nov Dec IM Jan Feb Mar Apr CCyR May MMolR The M351T-positive clone re-emerges Jun M351T 0.53% Jul Aug Sep Oct DAS M351T 3.50% Nov Dec Jan Feb Mar Cytogenetic relapse 1 Data provided by Dr. Simona Soverini, Univ. of Bologna

37 What is the Future of NGS Diagnostics? Gene expression Methylation Digital PCR exome or genome sequencing deep-sequencing of gene panels

38 Gene Panels in Myeloid Malignancies Myeloid malignancies are clinical and biological heterogeneous diseases

39 Mutations in MDS and MDS/MPN Various combinations of founding driver mutations involving genes of RNA splicing (SRSF2, U2AF1) or DNA methylation (TET2, DNMT3A), and subclonal driver mutations involving genes like ASXL1, EZH2, RUNX1, or TP53 SF3B1 mutation: refractory anemia with ring sideroblasts Miscellaneous driver mutations: refractory cytopenia with unilineage dysplasia (refractory anemia) Refractory cytopenia with multilineage dysplasia Refractory anemia with excess blasts TET2/SRSF2 comutation: chronic myelomonocytic leukemia Various founding mutations plus subclonal SETBP1 mutation: atypical chronic myeloid leukemia SF3B1/JAK2 or SF3B1/MPL comutation: refractory anemia with ring sideroblasts associated with Marked thrombocytosis Activating GSF3R mutation: chronic neutrophilic leukemia Cazzola M. et al., Blood. 2013;122(25):

40 CALR (Calreticulin) Mutations in MPN CALR positive myeloproliferative neoplasms suggested to have a more benign clinical course than the corresponding disorders associated with JAK2 or MPL mutations Klampfl T. et al., N Engl J Med Dec 19;369(25):

41 Clinical Effect of Point Mutations in MDS Rafael Bejar et al., NEJM 2011: 18 genes in 439 MDS patients Evaluation of the mutation status of TP53, EZH2, ETV6, RUNX1, and ASXL1 would add the most information to clinical prognostic scores as currently assessed in patients with myelodysplastic syndromes. Bejar R. et al., N Engl J Med. 2011;364(26):

42 Splicing Machinery Mutations in MDS Kenichi Yoshida et al., Nature 2011: spliceosome in 582 MDS patients Our whole-exome sequencing study unexpectedly unmasked a complexity of novel pathway mutations found in approximately 45% to 85% of myelodysplasia patients depending on the disease subtypes. E/A splicing complex: SF3B1 SRSF2 U2AF1 ZRSR2 SF3A1 SF1 U2AF2 PRPF40B Yoshida K. et al., Nature. 2011;478(7367):64-9.

43 Clinical Effect of Point Mutations in MDS Elli Papaemmanuil et al., BLOOD 2013: 111 genes in 738 MDS patients Patients with cytogenetic aberrations: 33% Patients with molecular oncogenic aberrations: 78% Papaemmanuil E. et al., Blood. 2013;122(22):

44 Clinical Effect of Point Mutations in MDS Torsten Haferlach et al., LEUKEMIA 2013: 104 genes in 944 MDS patients Patients with cytogenetic aberrations: 31.4% Patients with molecular oncogenic aberrations: 89.5% Haferlach T. et al., Leukemia Nov 13. [Epub]

45 The Top Twelve Genes Mutated in MDS Papaemmanuil et al. Haferlach et al. 1 SF3B1 TET2 2 TET2 SF3B1 3 SRSF2 ASXL1 4 ASXL1 SRSF2 5 DNMT3A DNMT3A 6 RUNX1 RUNX1 7 U2AF1 U2AF1 8 TP53 ZRSR2 9 EZH2 STAG2 10 IDH2 TP53 11 STAG2 EZH2 12 ZRSR2 CBL Papaemmanuil E. et al., Blood Nov 21;122(22): Haferlach T. et al., Leukemia Nov 13. [Epub]

46 Prognostic Models in MDS Beyond IPSS-R Model 1 Model 2 14 genes + age + WBC, Hb, Plt, % blasts, Cytogenetics according IPSS-R 14 genes only (13/14 from Model 1) Haferlach T. et al., Leukemia Nov 13. [Epub]

47 Deep-Sequencing Myeloid Gene Panel 27-gene panel in routine Dx ASXL1 BCOR BRAF CBL CEBPA DNMT3A ETV6 EZH2 FLT3 (TKD) GATA1 GATA2 IDH1 IDH2 JAK2 KIT KRAS MPL NPM1 NRAS PHF6 RUNX1 SF3B1 SRSF2 TET2 TP53 U2AF1 WT1 Turn-around time: 6-7 days Input: 2.5 µg DNA Single-plex PCR libraries

48 Template Preparation Using Microdroplets Merging Pre-made patient customized DNA with library primer of individual library: PCR primer-pair droplets: 29 genes selected 29-gene Primer Pair Library Genomic DNA Template Mix Amplicon design pipeline 450 amplicons Median length: 164 bp Range: bp Primer synthesis Picoliter-volume droplets Single-plex PCR reaction Emulsion plate collects PCR droplets for amplification Tewhey R. et al., Nat Biotechnol. 2009;27(11):

49 Deep-Sequencing Using SBS Chemistry Assay overview for massively parallel deep-sequencing: Amplicon Generation SBS Chemistry SBS Sequencing

50 Targeted Deep-Sequencing Gene Panel 13-gene panel: ATM BIRC3 BRAF (V600) FBXW7 KLHL6 KRAS NOTCH1 (PEST) NRAS MYD88 POT1 SF3B1 (HEAT) TP53 XPO1 Quesada V. et al., Nat Genet. 2011;44(1): Puente XS. et al., Nature. 2011;475(7354): Wang L. et al., N Engl J Med. 2011;365(26): Landau DA., et al., Cell. 2013;152(4): Rossi D. et al., Blood. 2013;121(8): Turn-around time: 6-7 days Input: 2.2 µg DNA Single-plex PCR libraries 323 amplicons RainDance MiSeq

51 What is the Future of NGS Diagnostics? Gene expression Methylation Digital PCR exome or genome sequencing deep-sequencing of gene panels

52 Panels vs. Whole-exome & Whole-Genome GenomeWeb online, October 2012

53 Summary and Conclusions Next-generation sequencing can be routinely applied in hematological malignancies in diagnosis and prognosis Amplicon deep-sequencing is a technically challenging and complex workflow, including the need for bioinformatics data analysis support Laboratory-developed assays enable the characterization of hematological malignancies for targeted regions, mostly distinct genes or exons, e.g. RUNX1, BCR-ABL1, TP53, EZH2, KRAS, Whole-exome and whole-genome sequencing efforts in cancer patients lead to novel actionable gene panels for diagnostics At this stage, whole-exome/whole-genome diagnostic assessment either too costly, too difficult to analyze or not thoroughly regulated concerning ethical topics