Block A: Membrane Biology & Biochemistry. Lipid signalling and sphingolipid function
|
|
|
- Austen Dixon
- 6 years ago
- Views:
Transcription
1 Block A: Membrane Biology & Biochemistry Lipid signalling and sphingolipid function Gerhild van Echten-Deckert Tel
2 Sphingolipids: History H H NH 2 Johann Ludwig Wilhelm Thudichum 1884
3 Sphingolipids - Structure H NH 2 H Sphingosine H H H H H H AcHN HC H H H AcHN H H H H H H HN CH 3 CH 3 H Ceramide Ganglioside GM1 H HN HN CH H 3 H 3 C CH 3 N P H 3 C CH 3 H Ceramide Ceramide Sphingomyelin
4 Glycosphingolipids form cell type specific profiles ligodendrocyte Neuron GalCer GlcCer Myelin Sheath Sulfatide LacCer Axon Astrocyte Endothelial Cells Gbose 3 Cer Gbose 4 Cer Neuron Muscle Fiber van Echten-Deckert & Herget, BBA 2006 Microglia G M3 G M2 G M1 G D3 G D1a G D1b G T1b
5 HN 2 CH C H 2 C H serine NH 2 H CH 3(CH 2) 14CSCoA palmitoyl-coa serine palmitoyltransferase (+PLP) Sphingolipids - Metabolism De novo synthesis H NH 2 3- ketosphinganine 3- ketosphinganine reductase (+NADPH) CH 3 H CH 3 H D-erythro- sphinganine CH 3 (CH 2 ) 16 CSC oa + stearoyl-coa sphinganine N- acyltransferase HN CH 3 H CH 3 H D-erythro- dihydroceramide HN CH 3 ceramide GalCer galactosyltransferase galactosylceramidase HN dihydroceramide desaturase ceramide kinase CH 3 P H C1P phosphatase ceramide-1-phosphate CH 3 Glycosphingolipids H H ceramide CH 3 Phosphosphingolipids cermide glucosyltransferase glucosylceramidase ceramidase ceramide synthase sphingomyelin synthase sphingomyelinase GlcCer GSL H NH 2 H sphingosine CH 3 H 3 C CH 3 N HN P CH 3 H sphingomyelin CH 3 CH 3 Recycling pathway Degradation P sphingosine kinase NH 2 phosphatase H sphingosine-1-phosphate -lyase (+PLP) hexadecenal phosphoethanolamine CH 3 nly one enzyme is known that cleaves the sphingoid backbone van Echten-Deckert & Herget, BBA 2006
6 Biosynthesis of major brain gangliosides Glc-T Gal-T I SAT I SAT II β 1,1 β 1,4 α 2,3 α 2,8 Cer GlcCer LacCer GM3 GD3 GalNAc-T β 1,4 GlcCer GalCer Sulfatide LacCer GM2 Gal-T II β 1,3 GD2 GM1a SAT IV α 2,3 GD1b GM3 GM2 GM1 GD1a SAT V α 2,8 GT1b GD3 GD1a GD1b GT1b GT1a GQ1b ligo Astro Neuro a-series b-series Glucose (Glc) Galactose (Gal) N-Acetylgalactosamine (GalNAc) Sialic Acid van Echten-Deckert & Walter, Prog Lipid Res 2012
7 Degradation pathways of selected glycosphingolipids affected in lysosomal storage disorders GM1- Gangliosidosis GM1 GM1- -galactosidase GM2-activator, SAP-B GM2 Tay-Sachs Sandhoff -hexosaminidasea,b GM2-activator Sialidosis GM3 sialidase SAP-B Glucose (Glc) Galactose (Gal) LacCer N-Acetylgalactosamine (GalNAc) Sialic Acid Phosphocholine van Echten-Deckert & Walter, Prog Lipid Res 2012 GlcCer Gaucher GlcCerase SAP-C acid SMase Cer Niemann-Pick A,B Farber acid Cerase SAP-C, SAP-D Sph SM
8 Wymann & Schneiter, Nature, 2008
9 Physiological/clinical relevance of bioactive sphingolipids Ser + FA-CoA apoptosis p Sphingomyelin DHCer differentiation inflammation insulin resistance Ceramide C1P inflammation senescence stress response MDR glucose tolerance brain function morphogenesis tumour genesis GlcCer GSL Sa So anti-apoptosis proliferation migration inflammation i angiogenesis wound healing
10 Dual Action of : Extracellular Ligand and Intracellular Second Messenger growth factor 1-5 trimeric G-proteins sphingosine Sphingosine kinase adenylate- monomeric cyclase PLC G-proteins intracellular targets? proliferation Ca 2+ homeostasis anti-apoptosis histone deacetylses survival differentiation motility cytoskeleton rearrangements inflammation angiogenesis
11 The ceramide/-rheostat in cell growth regulation Serine + Palmitoyl-CoA Always applicable? Sphinganine Sphingosine Kinase Phosphatase Lyase Ethanolaminephosphate + Hexadekenal Proliferation Dihydroceramide Desaturase Ceramide Sphingomyelin Glycosphingolipids Apoptosis
12 cis-4-methylsphingosine (cimes) is a synthetic prodrug for a metabolically stable -analogue P H NH 2 CH 3 C 1 h 24 h cimes C cimes H S1 32 P cimes 32 P cis-4-methylsphingosine // N-acyl-derivative Sphingosine i P H NH 2 H Ceramide van Echten Deckert et al. JBC 1997 Nätzker et al., Biol Chem, 2002 Nätzker et al., Genes Cells, 2006
13 cis-4-methylsphingosine (cimes) is a synthetic prodrug for a metabolically stable -analogue Serine + Palmitoyl-CoA Swiss-3T3 fibroblastsbl Proliferation neurons neuroblastoma Apoptosis cis-4-methylso P Sphinganine Sphingosine Kinase Phosphatase Lyase Ethanolaminephosphate + Hexadekenal Proliferation Dihydroceramide Desaturase Ceramide Sphingomyelin Glycosphingolipids van Echten Deckert et al. JBC 1997 van Echten-Deckert et al. JBC 1998 Nätzker et al. Biol Chem 2002 Apoptosis
14 In post-mitotic neurons cimes affects similar pathways as does, albeit in a sustained and more pronounced manner cimes extracellular intracellular treshold concentration is P necesseray for the apoptotic p effect cimesp CDK4-Inhibitor cyclind1/cdk4 p38 SB caspases Z-VAD Nätzker et al., Genes to Cells 2006 apoptosis no apoptosis
15 Lyase-deficient mice Generated by Paul van Veldhoven, Leuven, Belgium Kinase Lyase Sphingosine i Phosphatase Ethanolaminephosphate p + Hexadekenal +/+ Age: 6 weeks -/- Ceramide Sphingomyelin Glycosphingolipids Characteristics: s: Smaller size of pups Life span: nursing period (usually 4-6 weeks) Breeding with +/- mice +/+ +/- -/- Age: 6 days
16 induces apoptosis in lyase-deficient primary cultured cerebellar neurons 120 viability (% of +/+ ) /+ +/- -/- 0 +/+ +/- -/- 3 caspas se activity (relativ ve to +/+) 2,5 2 1,5 1 0,5 0 +/+ +/- -/- cyclin D1 -tubulin 12h +/+ +/- -/- Hagen et al, JBC 2009
17 Profile of intracellular, sphingosine, and ceramide ESI MS/MS fold change fold change p ,0 2,5 2,0 1,5 1,0 0,5 0,0 Sph +/+ +/- -/- +/+ +/- -/- +/+ +/- -/- vehicle Sph ceramide * * +/+ +/- -/- +/+ +/- -/- +/+ +/- -/- vehicle Sph * * * +/+ = wildtype +/- = heterozygous -/- = -lyase deficient Hagen et al, JBC 2009
18 -lyase deficiency increases formation of neuronal sphingolipids via recycling at the expense of de novo biosynthesis Serine + PalmitoylCoA SPT de novo synthesis rm1/3 SMS Sphingomyelin SMase recycling pathway Ceramide CS CDase Sphingosine Glycosphingolipids Gangliosides degradation pathway SPP SK -lyase Hexadecenal + Phosphoethanolamine Hagen-Euteneuer et al, J.Biol.Chem. 2012
19 Effects of sphingoid bases on neuronal morphology Correlation with the apoptotic effect control A Sph cimes D G J E H K F I L +/+ B +/- C -/- -/-: -lyase deficient neurons
20 Is sphingoid base-induced neuronal apoptosis mediated by receptors? 1 > > 3 > 2 80 knock down of -receptor 1,2,3 with sirna 60 in -lyase -/- neurons 40 apoptosis still occurred after knock down RNA content (% of C) m C sirna C sirna C sirna via ability (% of c) ty ) pase activit elative to c) cas (re ,5 2 1,5 1 0,5 c -/- sirna -/- -/- sirna + -/- 0 -/- -/- -/- -/- c sirna sirna+ 0 -/- -/- -/- -/- c sirna sirna+ -/- = -lyase deficient Hagen et al, JBC 2009
21 Generation of sphingoid base phosphates by SK2 is essential for their apoptotic effect Neurons (wt, SK1- or SK2-deficient) were labelled with 32 P i prior to addition of Sph, or cimes S1 32 P (%) * * * * * cim mes 32 P (% %) * * 0 +/+ SK1 SK2 +/+ SK1 SK2 +/+ SK1 SK2 -/- -/- -/- -/- -/- -/- vehicle Sph 0 +/+ SK1 SK2 -/- -/- cimes Hagen et al, JBC 2009
22 The subcellular origin of is essential for its neurotoxic effect cimes Sph PM Sph SK1 (LPP?) SK2 cimesp apoptotic ti SPP ER SK2 apoptotic Hagen et al, JBC 2009
23 1906: 37. Meeting of doctors for the insane of southwest Germany in Tübingen Alois Alzheimer reports about a peculiar affection of the cerebral cortex Auguste D. 2013: World Alzheimer Report 2013 AD most common neurodegenerative disease worldwide 36 mill. cases (2030: 77 mill. 2050: 135 mill.) Costs worldwide: 604 Bill. USD in 2010 (1% of the global GDP) 1,117 Bill USD in 2030
24 Histopathological findings reported by A. Alzheimer (1906) Miliary foci distributed all over the cortex, caused by the infiltration of a peculiar substance into the cortex Weird neurofibrillary changes, that appeared like very thick tangles filling not only the cell body but also neuronal processes Images C & D are from Holtzman et al. Sci Transl. Med. 2011, 3, 1-17
25 Key neuropathological elements of AD BAP-tists: senile (neuritic) plaques:extracellular aggregates of -amyloid TAU-ists: Neurofibrillary tangles: intracellular bundles of hyperphosphorylated tau ohcm.oxfordmedicine.com/.../graphic10017.jpeg
26 Scheme of major proteolytic processing pathways of APP A B APP S- APP S- A p3 Therapeutic approaches aimed to reduce A production/aggregation have failed! APP APP CTF APP APP CTF van Echten-Deckert & Walter, Prog Lipid Res 2012
27 The subcellular origin of is essential for its neurotoxic effect cimes Sph PM Sph SK1 (LPP?) SK2 cimesp apoptotic ti SPP ER SK2 apoptotic Hagen et al, JBC 2009
28 Cimes fails to induce apoptosis in SK2-deficient neurons apoptosis occurred only in +/+ and SK1 -/- neurons ability (% of c) vi spase activ vity relative to c) ca ( 0,0 c cimes c cimes c cimes c cimes c cimes c cimes +/+ SK1 -/- SK2 -/- +/+ SK1 -/- SK2 -/- 4,0 30 3,0 2,0 10 1,0 +/+ SK1 -/- SK2 -/- c cimes c cimes c cimes Hagen et al, Cell Death Differ, 2011
![Cimes induces a persistent increase of intracellular calcium in neurons Ca i [nm M] 1400 1200 1000 800 600 400 200 10 µm](/docs-images/80/81841499/images/29-2.jpg "KCl 30 mm * Ca i [nm] 0 0 200 400 600 800 1000 1200 time [s] * ctrl 2h 4h 8h 16h cimes 24h Hagen et al, Cell Death Differ,")
29 Cimes induces a persistent increase of intracellular calcium in neurons Ca i [nm M] µm KCl 30 mm * Ca i [nm] time [s] * ctrl 2h 4h 8h 16h cimes 24h Hagen et al, Cell Death Differ, 2011
30 without affecting mitochondrial functions c +/+ cytosolic fraction ctrl cimes mitochondrial fraction ctrl cimes cytochrome c -tubulin Ra atio aggrega ates / mono omeres cytosolic fraction mitochondrial fraction 0 +/+ c -/- -/- c +/+ +/+ c -/- -/ ctrl cimes cccp Cytochrome c -tubulin Hagen et al, Cell Death Differ, 2011
31 Summary cimes extracellular intracellular Z-LEHD-FMK cimes SK2 Caspase-12 Caspase-9 Caspase-3 cimesp MDL ER ER-stress Ca 2+ Calpain MDL SPP SK2 Sph p35 p25 CDK5 Rb P neuronal apoptosis cell cycle reactivation tau P Hagen et al, Cell Death Differ, 2011
32 Summary cimes extracellular intracellular ER cimes Z-LEHD-FMK SK2 Caspase-12 Caspase-9 Caspase-3 cimesp MDL Pathophysiological Relevance of ER-stress Ca 2+ Calpain -Lyase??? MDL SPP SK2 P Sph p35 p25 CDK5 Rb cell cycle reactivation neuronal apoptosis tau P Hagen et al, Cell Death Differ, 2011
33 Correlation between -lyase expression and neuronal apoptosis Bars correspond to 50 µm Hagen et al, Cell Death Differ, 2011
34 -lyase deficiency is accompanied by an increase of cholesteryl-ester in the brain 800 +/+ -/ /+ -/- e ng / mg tissu Camp Sit Lano Lath 24S- Cholol H-Chol 0 Desmo Chol cholest terol ester % Puglielli, Tanzi & Kovacs; Nature Cell Biology, 2001: Using genetic, biochemical and metabolic approaches, we found that cholesteryl-ester levels are directly correlated with A production. 0 +/+ -/- Hagen-Euteneuer et al, J.Biol.Chem. 2012
35 -Lyase deficiency is accompanied by increased expression of Amyloid Precursor Protein (APP) C L +/- L -/- Total brain lysates of 6-weeks old mice AB140 directed against C-terminus APP FL APP CTF APP CTF Mouse embryonic fibroblasts APP expression Impact of sphingosine kinase on APP expression Karaca et al., JBC, 2014
36 Conclusions Sphingosine-1-phosphate () is a neuronal death signal, when generated by SK2 and impaired degradation Calpain is an essential mediator of -induced neurotoxicity n cellular and molecular level neurotoxicity parallels that of A -lyase expression is correlated with neuronal death -lyase deficiency is correlated with Alzheimer characteristics: Hyperphosphorylation h of tau Impaired APP-processing Elevated levels of cholesteryl-ester stimulates BACE1, the rate-limiting enzyme for A production (Takasugi et al., 2011, J. Neurosci.) Conditional knockout mouse: neuron specific Conditional knockout mouse: neuron-specific inactivation of-lyase
37 Scheme of Sphingolipid Metabolism Brain-specific deletion SPL fl/fl Nestin-Cre
38 Schematic of the Floxed L Allele * co-factor (PLP) binding site floxed, Sgpl1 flx/flx floxed, Sgpl1 flx/flx mice: Julie Saba, akland, CA, USA Bonn: crossbreeding with the nestin-cre transgenic mouse line Nes-Cre1
39 Conditional Knockdown of L in Brains of 4-Weeks-ld Mice RT-PCR f/+ f/f f/+ cre f/f /cre Immunoblot customized AB (Julie Saba)
40 Conditional Knockdown of L in Murine Brain Does not Affect Life Span Wt ( 5) Wt (n=5), f/f Nestin/Cre (n=4) total K (n=3)
41 SPL Depletion Affects the Expression of Presynaptic Proteins Pre synaptic protein Protein mrna level level Bassoon Decreased Unchanged Synapsin 1 Decreased Unchanged Synaptophysin Decreased Unchanged Synaptobrevin Decreased Unchanged Syntaxin 1 Decreased Unchanged Synaptotagmin Unchanged Unchanged Piccolo Unchanged Unchanged SNAP25 Unchanged Unchanged Post synaptic protein Protein mrna level level PSD 95 Unchanged Unchanged
42 Potential Molecular Link of SPL Activity and Synaptic Plasticity SPL So Hagen et al. Cell Death Differ. (2011) [Ca 2+ ] i Uvarov et al. Biochim Biophys Acta (2008) Ubiquitin proteasome activity Pre synaptic markers PE LC3II p62 Beclin 1 Autophagy APP Synaptic plasticity Behavioral changes???
43 CNCLUSINS Targeted deletion of -lyase in the brain affects: - proteasomal and autophagic activity - expression of presynaptic proteins - APP processing - astrogliosis -short term synaptic plasticity i - learning and memory
Block A: Membrane Biology & Biochemistry. Lipid signalling and sphingolipid function
Block A: Membrane Biology & Biochemistry Lipid signalling and sphingolipid function 10. - 14.11.2014 Gerhild van Echten-Deckert Tel. 73 2703 E-mail: g.echten.deckert@uni-bonn.de www.limes-institut-bonn.de
number Done by Corrected by Doctor
number 26 Done by حسام أبو عوض Corrected by Zaid Emad Doctor فيصل الخطيب 1 P a g e A small note about phosphatidyl inositol-4,5-bisphosphate (PIP2) before moving on: This molecule is found in the membrane
Sphingosine-1-phosphate signaling and cardiac fibrosis. Department of Physiology, Kanazawa University School of Medicine, Kanazawa, Japan
96 Special Issue: Cellular and Molecular Bases for Fibrotic Diseases Review Article Sphingosine-1-phosphate signaling and cardiac fibrosis Noriko Takuwa 1, 2, ), Yasuo Okamoto 1), Kazuaki Yoshioka 1) and
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
Abdallah Q& Razi. Faisal
27 & Ahmad Attari م ح م د ي وس ف Abdallah Q& Razi Faisal Sphingophospolipids - The backbone of sphingophospholipids is sphingosine, unlike glycerophospholipids with a glycerol as the backbone. Which contains
3-keto-Dihydrosphingosine is an Important Early Metabolite of Sphingolipid Biosynthesis
H C 2 H H H H H H H C 2 H H H H H H H H H H NHAc C 2 H H H H C 2 H H H H H H C 17 H 35 NH H N E W S L E T T E R F R G LY C / S P H I N G L I P I D R E S E A R C H N V E M B E R 2 0 1 8 3-keto-Dihydrosphingosine
Metabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
Phospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
Development of Sphingosine Kinase Selective Inhibitors for Cancer Therapy
Development of Sphingosine Kinase Selective Inhibitors for Cancer Therapy Zuping Xia College of Pharmacy Washington State University Sphingolipids, similar to phospholipids, are composed of a polar head
Nutrition and Age-Associated Inflammation :Role of Nutritional Intervention Simin Nikbin Meydani, DVM, PhD.
Nutrition and Age-Associated Inflammation :Role of Nutritional Intervention Simin Nikbin Meydani, DVM, PhD simin.meydani@tufts.edu Outline 1) Role of immune and inflammatory responses in age-related diseases
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS. Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry
METABOLISM OF ACYLGLYCEROLS AND SPHINGOLIPDS Ben S. Ashok MSc.,FAGE.,PhD., Dept. of Biochemistry STORAGE AND MEMBRANE LIPIDS STORAGE LIPIDS Mainly as triacylglycerols (triglycerides) in adipose cells Constitute
Sphingolipids: Regulators of the Crosstalk between Apoptosis and Autophagy
Sphingolipids: Regulators of the Crosstalk between Apoptosis and Autophagy Megan M. Young 1, Mark Kester 1 and Hong-Gang Wang 1, * 1 Department of Pharmacology and Penn State Hershey Cancer Institute,
The Role of Sphingolipids in Alzheimer s Disease, Parkinson s Disease and Lewy Body Dementia: A Common Pathway?
The Role of Sphingolipids in Alzheimer s Disease, Parkinson s Disease and Lewy Body Dementia: A Common Pathway? Michelle M. Mielke, PhD Professor of Epidemiology and Neurology Center for Healthy Brain
The role of the laboratory in diagnosing lysosomal disorders
The role of the laboratory in diagnosing lysosomal disorders Dr Guy Besley, formerly Willink Biochemical Genetics Unit, Manchester Children s Hospital, Manchester M27 4HA, UK. Lysosomal disorders What
neurons Gemma Triola, Gemma Fabrias, Mihaela Dragusin, Lars Niederhausen, Roland Broere,
Molecular Pharmacology Fast Forward. Published on September 15, 2004 as doi:10.1124/mol.104.003681 MOL 003681 1 Specificity of the dihydroceramide desaturase inhibitor GT11 in primary cultured cerebellar
Sphingolipids: regulators of crosstalk between apoptosis and autophagy. Megan M. Young, Mark Kester, and Hong-Gang Wang 1
review Sphingolipids: regulators of crosstalk between apoptosis and autophagy Megan M. Young, Mark Kester, and Hong-Gang Wang 1 Department of Pharmacology and Penn State Hershey Cancer Institute, Pennsylvania
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
UNIVERSITA DEGLI STUDI DI MILANO
UNIVERSITA DEGLI STUDI DI MILANO SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE BIOCHIMICHE, NUTRIZIONALI E METABOLICHE DOTTORATO DI RICERCA IN BIOCHIMICA CICLO XXIII BIO/10 TESI DI DOTTORATO DI RICERCA PLASMA
Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS
Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Alexei Belenky CASSS, Meritage Resort, Napa 2008 Outline Role of lipid analysis in drug discovery and disease diagnostics Analytical tools and
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
Role of Toll-like Receptors in the Activation
Role of Toll-like Receptors in the Activation of Natural Killer T (NKT) lymphocytes HOST PATHOGEN CROSS TALK Annecy, Les Pensières September 24-26, 2007 Institut Pasteur de Lille Inserm 547 (Prof M. Capron)
Sphingolipids (and precursor fatty acyl-coa s) M. Cameron Sullards
LIPID MAPS Lipidomics Workshop April 28, 2007 www.lipidmaps.org Sphingolipids (and precursor fatty acyl-coa s) M. Cameron Sullards Schools of Chemistry, Biochemistry and Biology & Petit Institute for Bioengineering
Phospholipids, Triglycerids. Léránt István
Phospholipids, Triglycerids Léránt István Membran lipids Phosphatidic acids COMMON INTERMEDIER IN Biosynthesis of Glycerol Fatty acid Fatty acid Fatty acid Glycerol Fatty acid Fatty acid P Alcohol phospholipids
Sphingolipids (and precursor fatty acyl-coa s) M. Cameron Sullards
LIPID MAPS Lipidomics Workshop April 28, 2007 www.lipidmaps.org Sphingolipids (and precursor fatty acyl-coa s) M. Cameron Sullards Schools of Chemistry, Biochemistry and Biology & Petit Institute for Bioengineering
Department of Biochemistry and Molecular Biology. Medical University of South Carolina. Charleston, South Carolina, 29425
Bioactive Sphingolipids: Metabolism and Function Authors: Nana Bartke and Yusuf A. Hannun 1 Institution: Department of Biochemistry and Molecular Biology Medical University of South Carolina 173 Ashley
GANGLIOSIDES for Neuroscience Research
GANGLIOSIDES for Neuroscience Research STANDARDS & MONOCLONAL ANTIBODIES Gangliosides GANGLIOSIDE AND GLYCOLIPID STANDARDS purified PURIFIED NATURAL GANGLIOSIDES Cat. # Description Size GANGLIOSIDE A PATH
Thematic Review Series: Lipids and Lipid Metabolism in the Eye. Regulating survival and development in the retina: key roles for simple sphingolipids
thematic review Thematic Review Series: Lipids and Lipid Metabolism in the Eye Regulating survival and development in the retina: key roles for simple sphingolipids Nora P. Rotstein, 1 Gisela E. Miranda,
BCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
Optimising. membranes
Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins
SPHINGOLIPIDS AS TARGETS FOR RECOVERY FROM SPINAL CORD INJURIES: DECIPHERING THE ROLE OF SPHINGOSINE-1-PHOSPHATE
SPHINGOLIPIDS AS TARGETS FOR RECOVERY FROM SPINAL CORD INJURIES: DECIPHERING THE ROLE OF SPHINGOSINE-1-PHOSPHATE Josefina Casas Brugulat Institut Química Avançada de Catalunya CSIC Rodrigo Martínez Maza
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
REGULATION OF GALACTOSYLCERAMIDE BIOSYNTHESIS. A Thesis Presented to The Academic Faculty. Jessica Elaine Kollmeyer
REGULATION OF GALACTOSYLCERAMIDE BIOSYNTHESIS A Thesis Presented to The Academic Faculty By Jessica Elaine Kollmeyer In Partial Fulfillment Of the Requirements for the Degree Masters of Science in Biology
Review Article Ganglioside Biochemistry
International Scholarly Research Network ISRN Biochemistry Volume 2012, Article ID 506160, 36 pages doi:10.5402/2012/506160 Review Article Ganglioside Biochemistry Thomas Kolter Program Unit Membrane Biology
Lipids and Membranes
Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis
TechNotes. Gangliosides. 1. Applications
TechNotes Gangliosides Gangliosides are a large group of sialylated glycosphingolipids that are widely expressed in mammalian tissues. Gangliosides are found in most tissues of the body, but they are particularly
Diabetes Mellitus and Dementia. Andrea Shelton & Adena Zadourian
Diabetes Mellitus and Dementia Andrea Shelton & Adena Zadourian Abstract Diabetes mellitus increases the risk for developing dementia...but there is inconsistency with the subtypes of dementia Diabetes
sphingolipids Nora P. Rotstein*, Gisela E. Miranda, Carolina E. Abrahan and O. Lorena German
Regulating survival and development in the retina: key roles for simple sphingolipids Nora P. Rotstein*, Gisela E. Miranda, Carolina E. Abrahan and O. Lorena German Instituto de Investigaciones Bioquímicas
I. Structure and Properties of Lipids
I. Structure and Properties of Lipids Lipids: A diverse group of compounds characterized by their low solubility in water and a high solubility in organic solvents such as chloroform and methanol. Nonpolar
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
Lecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
Rare metabolic diseases: the miglustat experience. Fran Platt Department of Pharmacology University of Oxford
Rare metabolic diseases: the miglustat experience Fran Platt Department of Pharmacology University of Oxford The lysosome is an organelle involved in degrading and recycling macromolecules Christian de
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Sphingolipids in Disease
Handbook of Experimental Pharmacology 216 Erich Gulbins Irina Petrache Editors Sphingolipids in Disease Handbook of Experimental Pharmacology Volume 216 Editor-in-Chief F.B. Hofmann, München Editorial
Figure S2
Figure S1 Figure S2 Figure S3 Figure S4 Figure S5 Figure S6 SUPPLEMENTARY FIGURE LEGENDS Figure S1 Biosynthetic pathway for gangliosides showing activity of GalNAcT and GD3s and the structures of the major
Sphingoid Bases, Sphingolipids and Glycosphingolipids
Sphingoid Bases, Sphingolipids and Glycosphingolipids Sphingoid bases such as sphingosine are the characteristic structural unit of the sphingolipids. The bases are long chain aliphatic amines, containing
Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.
Research article Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension, and its inhibition attenuates pathologic features of disease Wanli Ma, 1 Weihong Han, 1 Peter
Technical Report. Structural Analysis of Glycosphingolipids by LC-IT-TOF-MS. Abstract:
C146-E268 Technical Report Structural Analysis of Glycosphingolipids by LC-T-TF-MS Akemi Suzuki 1, Jin-ichi nokuchi 2, Masakazu Nagafuku 2, Hideshi Fujiwake 3, Yoshikatsu Umemura 3 Abstract: A method for
TABLE OF CONTENTS TABLE OF
TABLE F CNTENTS TABLE F CNTENTS...ii Technical Service...iv Natural Products...iv Storage...iv Package Weight...iv Matreya s Mission...iv Lysosomal Storage Disorders Pathways Chart...v Sphingoid Bases,
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
RCPA Research Award Final Progress Review
RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease.
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. José C. Fernández-Checa Liver Unit, Hospital Clinic CIBEK and IDIBAPS Instituto Investigaciones Biomédicas Barcelona Consejo Superior
Sphingolipids and gangliosides of the nervous system in membrane function and dysfunction
FEBS Letters 584 (2010) 1748 1759 journal homepage: www.febsletters.org Review Sphingolipids and gangliosides of the nervous system in membrane function and dysfunction Elena Posse de Chaves *, Simonetta
HEPATOCARCINOGENESIS AND CERAMIDE/CHOLESTEROL METABOLISM. Fernández-Checa 1,2
HEPATOCARCINOGENESIS AND CERAMIDE/CHOLESTEROL METABOLISM Albert Morales 1, Montserrat Marí 1, Carmen García-Ruiz 1, Anna Colell 1 and Jose C. Fernández-Checa 1,2 1 Department of Cell Death and Proliferation,
LIPIDS TAG, PL and SL metabolism. Marek Vecka
LIPIDS TAG, PL and SL metabolism Marek Vecka BIOSYNTHESIS OF TAG TWO BIOSYNTHETIC PATHWAYS IN MAMMALS liver, adipose tissue - use mainly phosphatidate pathway ( Kennedy pathway ) intestine - monoacylglycerol
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models. Yu Wu
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models Yu Wu Alzheimer s Disease (AD) Mouse models: APP/PS1, PS1δE9, APPswe, hps1 Wirths, O. et al, Acta neuropathologica
Lecture 14 - The cell cycle and cell death
02.17.10 Lecture 14 - The cell cycle and cell death The cell cycle: cells duplicate their contents and divide The cell cycle may be divided into 4 phases The cell cycle triggers essential processes (DNA
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
Review My journey into the world of sphingolipids and sphingolipidoses
554 Proc. Jpn. Acad., Ser. B 88 (2012) [Vol. 88, Review My journey into the world of sphingolipids and sphingolipidoses By Konrad SANDHFF *1, (Communicated by Kunihiko SUZUKI, M.J.A.) Abstract: Analysis
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!
a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!
Defective cholesterol trafficking in Niemann-Pick C-deficient cells
FEBS Letters 584 (2010) 2731 2739 journal homepage: www.febsletters.org Review Defective cholesterol trafficking in Niemann-Pick C-deficient cells Kyle B. Peake, Jean E. Vance * Group on the Molecular
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer
Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
LIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
Roles, regulation and inhibitors of sphingosine kinase 2
REVIEW ARTICLE Roles, regulation and inhibitors of sphingosine kinase 2 Heidi A. Neubauer 1,2 and Stuart M. Pitson 1,2,3 1 Centre for Cancer Biology, SA Pathology, Adelaide, Australia 2 School of Molecular
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Cell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
Wnt Signaling Pathway and AD
Center for Cell Regulation and Pathology Joaquín V. Luco (CRCP), Millennium Institute (MIFAB) Center for Aging and Regeneration (CARE). Wnt Signaling Pathway and AD Nibaldo C. Inestrosa European Union
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Glycans linked to lipids and lipid precursors
Glycobiology BCMB 8130 Clinical Correlations! -sign up for 1st and 2nd choice (1/2)! *********************************! Glycosylation in Diabetes! O-Mannosylation in Human Pathophysiology! Glycoconjugate
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Samali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
Chapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
Lipids and Biological Membranes
Lipids and Biological Membranes Lipids: Found in all living organisms Especially important as components of biological membranes Defined functionally, not structurally, as compounds that are totally or
M. Camero. ineering i and Biosciencei Georgia Institute
LIPID MAPS Lipid domics Workshop April 28, 2007 www.lipidmaps.org Sphingolipids (and precursor fatty acyl-coa s) M. Camero on Sullards Schools of Chemistry, Biochemistry and Biology & Petit Institute t
INTRACELLULAR TARGETS OF SPHINGOSINE-1-PHOSPHATE
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 INTRACELLULAR TARGETS OF SPHINGOSINE-1-PHOSPHATE Graham Michael Strub Virginia Commonwealth University
Metabolism of sphingolipids in the gut and its relation to inflammation and cancer development.
Metabolism of sphingolipids in the gut and its relation to inflammation and cancer development. Duan, Rui-Dong; Nilsson, Åke Published in: Progress in lipid research DOI: 10.1016/j.plipres.2008.04.003
Gene Expression-Targeted Isoflavone Therapy: Facts, Questions and Further Possibilities
Gene Expression-Targeted Isoflavone Therapy: Facts, Questions and Further Possibilities Grzegorz Wegrzyn Department of Molecular Biology University of Gdansk Gdansk, Poland Lysosomal storage diseases (LSD)
Lipidomics Workshop 8:00AM-1:00 PM, Saturday, April 28, 2007 Grand Ballroom South of the Renaissance Hotel 999 Ninth Street NW, Washington, DC Al
Lipidomics Workshop 8:00AM-1:00 PM, Saturday, April 28, 2007 Grand Ballroom South of the Renaissance Hotel 999 Ninth Street NW, Washington, DC Al Merrill cell phone: 678-895-7029 LIPID MAPS Lipidomics
DFG-SPP. Sphingolipids - Signals and Disease. Meeting 2009
DFG-SPP Sphingolipids - Signals and Disease Meeting 2009 University Hospital Essen Hörsaal - Operatives Zentrum II Friday, September 4, 2009 9.00 am Welcome Reception I) MEMBRANES, ENZYMES AND INHIBITORS
Ceramide sphingolipid signaling mediates Tumor Necrosis Factor (TNF)-dependent toxicity via caspase signaling in dopaminergic neurons
Ceramide sphingolipid signaling mediates Tumor Necrosis Factor (TNF)-dependent toxicity via caspase signaling in dopaminergic neurons Terina N. Martinez, The University of Texas Southwestern Medical Center
Biochemistry. Metabolic pathways
Biochemistry Metabolic pathways 07.11.2017 01.12.2017 Gerhild van Echten-Deckert Tel. 73 2703 E-mail: g.echten.deckert@uni-bonn.de www.limes-institut-bonn.de Objectives of the course: Energy metabolism
Ceramide and sphingosine-1-phosphate in cancer, two faces of the sphinx
Review Article Ceramide and sphingosine-1-phosphate in cancer, two faces of the sphinx Mel Pilar Espaillat 1,2, Achraf A. Shamseddine 2, Mohamad M. Adada 2, Yusuf A. Hannun 2,3, Lina M. Obeid 2,3,4 1 Department
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
The elements of G protein-coupled receptor systems
The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch
cholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
Apolipoprotein E, cholesterol metabolism, diabetes, and the convergence of risk factors for Alzheimer s disease and cardiovascular disease
FEATURE REVIEW (2006) 11, 721 736 & 2006 Nature Publishing Group All rights reserved 1359-4184/06 $30.00 www.nature.com/mp Apolipoprotein E, cholesterol metabolism, diabetes, and the convergence of risk
Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
Biochemistry. Metabolism
Biochemistry Metabolism 07.11.2017 27.11.2017 Gluconeogenesis Gerhild van Echten-Deckert Tel. 73 2703 E-mail: g.echten.deckert@uni-bonn.de www.limes-institut-bonn.de Gluconeogenesis Glycolysis 7 glycolytic
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
9.01 Introduction to Neuroscience Fall 2007
MIT OpenCourseWare http://ocw.mit.edu 9.01 Introduction to Neuroscience Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. 9.01 Recitation (R02)
ALZHEIMER S DISEASE FACTOIDS & STATISTICS
ALZHEIMER S DISEASE FACTOIDS & STATISTICS ~ 4 million affected in US alone 6-8% if 65+ years old, 30-50% if 80+ By 2030, in US >65 million people >65+ (---> ~14 million with AD) AD is one of the top 10
Fatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Microglia, Inflammation, and FTD
FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?