LabDriver Audit Trail Example
|
|
- Jasmin Page
- 5 years ago
- Views:
Transcription
1 LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009 storage location: Urine 13/05/ :05:00 13/05/2009 Groups: visit: no Study: 123-XY (StudySId=1236) Description: Visit: Visit 1 (Screen) (VisitId=3577) Status: Original Optional Investigator: Dr A Doctor (InvestigatorId=1010) QSig: JCA Retest: No Subject details:= (SampleSId=8232) Subject ID: V01523 Sample order: 7 Active?: Yes Subject No: 003 Screening ID: S003 Weight (kg): 0.00 Initials: Sex: Female DoB: Description: Sample Changes Log:= Changed by Changed on At Change type Using Reason Joanna Longstock 13/05/ :23:59 SStatus To: Active integra 13/05/ :26:59 Import Stat:1 To: A/G, , ,DBilC, , ,TP, , ,Urea, , ,GLU, , ,GLU fast, , ,creat, , ,AST, , ,ALT, , ,ALP, , ,TBilO, , ,Alb, , ,PO4, , ,R-UA, , ,TCO2, , ,Ca, , ,Cl, , ,K, , ,Na, , integra 13/05/ :55:20 Import Stat:1 To: Ethanol,Negative, Joanna Longstock 13/05/ :23:36 SStatus Active To: Complete Judy Chambers 14/05/ :47:24 QC-Esig To: JCA Judy Chambers 14/05/ :47:24 SStatus findsm42.w Complete To: Checked Judy Chambers 02/06/ :32:15 Subject No To: 003 access2 10/06/ :45:46 Import Stat:1 To: HBsAg,Negative, ,HCVPLUS,Negative, ,hFSH,7.73, ,HIVAbNew, Negative, ,OV125Ag,6.1, ,TBhCG2,0.00, Study Report Printing:= Change Report file Name date Log time Via _HAEMATOLOGY_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _CHEMISTRY_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _VIROLOGY_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _ENDOCRINOLOGY_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _COAGULATION_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _HIV_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _DRUGS OF ABUSE_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _HORMONES_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, _URINALYSIS_ Judy Chambers 14/05/ :47:26 \\fs1\epson LQ-800,,,,,,Server,, Profiles:= Opt First test Profile pro Profile Sample type date time Status ESig comment Investigator comment no CHEMISTRY Blood 13/05/ :37:12 Commented SYP no COAGULATION Blood 13/05/2009 Commented SYP no DRUGS OF ABUSE Urine 13/05/2009 Commented SYP no ENDOCRINOLOGY Blood 13/05/2009 Commented SYP
2 no HAEMATOLOGY Blood 13/05/ :38:20 Commented SYP no HIV Blood 13/05/2009 Commented SYP no HORMONES Blood 13/05/2009 Commented SYP no MICROSCOPY Urine 13/05/ :35:25 Commented SYP no URINALYSIS Urine 13/05/ :06:00 Commented SYP no VIROLOGY Blood 13/05/2009 Commented SYP Profile Changes Log:= Change Change Change Change Profile Name date Log time type from to CHEMISTRY Joanna Longstock 13/05/ :27:09 ESig JoannaLS CHEMISTRY Joanna Longstock 13/05/ :33:55 Status SentOut Commented CHEMISTRY Judy Chambers 14/05/ :47:26 Report _CHEMISTRY_ \\fs1\epson LQ-800,,,,,,Server,, COAGULATION Joanna Longstock 13/05/ :34:12 Status SentOut Commented COAGULATION Joanna Longstock 13/05/ :34:12 ESig JoannaLS COAGULATION Judy Chambers 14/05/ :47:26 Report _COAGULATION_ \\fs1\epson LQ-800,,,,,,Server,, DRUGS OF ABUSE Joanna Longstock 13/05/ :34:43 ESig JoannaLS DRUGS OF ABUSE Joanna Longstock 13/05/ :23:00 Status Active Commented DRUGS OF ABUSE Judy Chambers 14/05/ :47:26 Report _DRUGS OF ABUSE_ \\fs1\epson LQ-800,,,,,,Server,, ENDOCRINOLOGY Joanna Longstock 13/05/ :34:57 ESig JoannaLS ENDOCRINOLOGY Joanna Longstock 13/05/ :34:57 Status Allocated Commented ENDOCRINOLOGY Judy Chambers 14/05/ :47:26 Report _ENDOCRINOLOGY_ \\fs1\epson LQ-800,,,,,,Server,, HAEMATOLOGY Joanna Longstock 13/05/ :24:41 Status Active Commented HAEMATOLOGY Joanna Longstock 13/05/ :24:41 ESig JoannaLS HAEMATOLOGY Judy Chambers 14/05/ :47:26 Report _HAEMATOLOGY_ \\fs1\epson LQ-800,,,,,,Server,, HIV Joanna Longstock 13/05/ :35:09 ESig JoannaLS HIV Joanna Longstock 13/05/ :35:09 Status Allocated Commented HIV Judy Chambers 14/05/ :47:26 Report _HIV_ \\fs1\epson LQ-800,,,,,,Server,, HORMONES Joanna Longstock 13/05/ :35:21 ESig JoannaLS HORMONES Joanna Longstock 13/05/ :23:36 Status Allocated Commented HORMONES Judy Chambers 14/05/ :47:26 Report _HORMONES_ \\fs1\epson LQ-800,,,,,,Server,, MICROSCOPY Joanna Longstock 13/05/ :35:26 Status Active Commented MICROSCOPY Joanna Longstock 13/05/ :35:26 ESig JoannaLS URINALYSIS Joanna Longstock 13/05/ :24:43 ESig JoannaLS URINALYSIS Joanna Longstock 13/05/ :35:35 Status Active Commented URINALYSIS Judy Chambers 14/05/ :47:26 Report _URINALYSIS_ \\fs1\epson LQ-800,,,,,,Server,, VIROLOGY Joanna Longstock 13/05/ :35:47 Status Allocated Commented VIROLOGY Joanna Longstock 13/05/ :35:47 ESig JoannaLS VIROLOGY Judy Chambers 14/05/ :47:26 Report _VIROLOGY_ \\fs1\epson LQ-800,,,,,,Server,, Tests:= Test name Result (character) Result (numeric) Flag Test status LabDriver Sample Audit Trail Single Lab No 2
3 Albumin Validated Alkaline Phosphatase Validated Amphetamines Negative Validated APTT Validated Barbiturates Negative Validated Basophils Validated Benzodiazepines Negative Validated bhcg Negative Validated Ca Validated Calcium Validated Cannabinoids Negative Validated Chloride H Validated Cocaine Negative Validated Creatinine Validated Direct Bilirubin Validated Eosinophils Validated Ethanol Negative Validated Fasting Glucose Validated FSH L Validated Haematocrit Validated Haemoglobin Validated HCV Negative Validated Hepatitis B surface Antigen Negative Validated HIV I/II Negative Validated Inorganic Phosphate Validated Lymphocytes Validated MCH Validated MCHC Validated MCV Validated MDMA Negative Validated Methadone Negative Validated Methamphetamines Negative Validated Monocytes Validated Neutrophils Validated Nitrite Urinalysis Negative Validated Opiates Negative Validated PCP ND Validated Platelets Validated Potassium Validated Prothrombin Time Validated Red Cell Count Validated Renal Epithelial Cells ND Validated SGOT(ASAT) L Validated SGPT(ALAT) Validated Sodium Validated TCO L Validated Total Bilirubin Validated Total Protein Validated Tricyclic Antidepressants TCA Negative Validated Urea Validated Uric Acid Validated Urinalysis Bilirubin Validated Urinalysis Blood Validated Urinalysis Glucose Validated Urinalysis Ketones Validated Urinalysis ph Validated Urinalysis Protein Validated Urinalysis Specific Gravity Validated Urinalysis Urobilinogen Validated Urine Casts ND Validated Urine HCG ND Validated Urine Red Blood Cells ND Validated Urine White Blood Cells ND Validated White Cell Count Validated Test Changes Log:= Change Change Change Change Test name Name date Log time type from to Using Albumin Joanna Longstock 13/05/ :27:09 Result ND, 46,,g/L Albumin Joanna Longstock 13/05/ :27:09 AStatus Active Validated Alkaline Phosphatase Joanna Longstock 13/05/ :27:09 Result ND, 49,,IU/L Alkaline Phosphatase Joanna Longstock 13/05/ :27:09 AStatus Active Validated Amphetamines Joanna Longstock 13/05/ :34:43 AStatus Active Validated LabDriver Sample Audit Trail Single Lab No 3
4 Amphetamines Joanna Longstock 13/05/ :34:43 Result ND, Negative,, APTT Joanna Longstock 13/05/ :34:12 AStatus Active Validated APTT Joanna Longstock 13/05/ :34:12 Result ND, 32.7,,Secs Barbiturates Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Barbiturates Joanna Longstock 13/05/ :34:43 AStatus Active Validated Basophils Joanna Longstock 13/05/ :24:41 AStatus Active Validated Basophils Joanna Longstock 13/05/ :24:41 Result ND, 0.03,,10*9/L Benzodiazepines Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Benzodiazepines Joanna Longstock 13/05/ :34:43 AStatus Active Validated bhcg Joanna Longstock 13/05/ :34:57 Result ND, Negative,, bhcg Joanna Longstock 13/05/ :34:57 AStatus Active Validated Ca 125 Joanna Longstock 13/05/ :33:55 Result ND, 6,,u/mL Incorrect result entry Ca 125 Joanna Longstock 13/05/ :33:55 AStatus Active Validated Incorrect result entry Calcium Joanna Longstock 13/05/ :27:09 AStatus Active Validated Calcium Joanna Longstock 13/05/ :27:09 Result ND, 2.40,,mmol/L Cannabinoids Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Cannabinoids Joanna Longstock 13/05/ :34:43 AStatus Active Validated Chloride Joanna Longstock 13/05/ :27:09 AStatus Active Analysed Chloride Joanna Longstock 13/05/ :27:09 Result ND, 103,H,mmol/L Chloride Joanna Longstock 13/05/ :33:55 AStatus Analysed Validated Cocaine Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Cocaine Joanna Longstock 13/05/ :34:43 AStatus Active Validated Creatinine Joanna Longstock 13/05/ :27:09 Result ND, 68,,umol/L Creatinine Joanna Longstock 13/05/ :27:09 AStatus Active Validated Direct Bilirubin Joanna Longstock 13/05/ :27:09 AStatus Active Validated Direct Bilirubin Joanna Longstock 13/05/ :27:09 Result ND, 1.5,,umol/L Eosinophils Joanna Longstock 13/05/ :24:41 AStatus Active Validated Eosinophils Joanna Longstock 13/05/ :24:41 Result ND, 0.15,,10*9/L Ethanol Joanna Longstock 13/05/ :23:00 AStatus Active Validated Ethanol Joanna Longstock 13/05/ :23:00 Result ND, Negative,, Fasting Glucose Joanna Longstock 13/05/ :27:09 Result ND, 5.0,,mmol/L Fasting Glucose Joanna Longstock 13/05/ :27:09 AStatus Active Validated FSH Joanna Longstock 13/05/ :35:21 AStatus Active Analysed FSH Joanna Longstock 13/05/ :35:21 Result ND, 7.7,L,mIU/mL FSH Joanna Longstock 13/05/ :23:36 AStatus Analysed Validated Haematocrit Joanna Longstock 13/05/ :24:40 Result ND, 0.37,,L/L Haematocrit Joanna Longstock 13/05/ :24:40 AStatus Active Validated Haemoglobin Joanna Longstock 13/05/ :24:40 AStatus Active Validated Haemoglobin Joanna Longstock 13/05/ :24:40 Result ND, 12.7,,g/dL HCV Joanna Longstock 13/05/ :35:47 Result ND, Negative,, HCV Joanna Longstock 13/05/ :35:47 AStatus Active Validated LabDriver Sample Audit Trail Single Lab No 4
5 Hepatitis B surface Antig Joanna Longstock 13/05/ :35:47 AStatus Active Validated Hepatitis B surface Antig Joanna Longstock 13/05/ :35:47 Result ND, Negative,, HIV I/II Joanna Longstock 13/05/ :35:09 AStatus Active Validated HIV I/II Joanna Longstock 13/05/ :35:09 Result ND, Negative,, Inorganic Phosphate Joanna Longstock 13/05/ :27:09 Result ND, 1.17,,mmol/L Inorganic Phosphate Joanna Longstock 13/05/ :27:09 AStatus Active Validated Lymphocytes Joanna Longstock 13/05/ :24:40 Result ND, 2.0,,10*9/L Lymphocytes Joanna Longstock 13/05/ :24:40 AStatus Active Validated MCH Joanna Longstock 13/05/ :24:40 AStatus Active Validated MCH Joanna Longstock 13/05/ :24:40 Result ND, 32,,pg MCHC Joanna Longstock 13/05/ :24:40 Result ND, 35,,g/dL MCHC Joanna Longstock 13/05/ :24:40 AStatus Active Validated MCV Joanna Longstock 13/05/ :24:40 AStatus Active Validated MCV Joanna Longstock 13/05/ :24:40 Result ND, 91,,fL MDMA Joanna Longstock 13/05/ :34:43 AStatus Active Validated MDMA Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Methadone Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Methadone Joanna Longstock 13/05/ :34:43 AStatus Active Validated Methamphetamines Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Methamphetamines Joanna Longstock 13/05/ :34:43 AStatus Active Validated Monocytes Joanna Longstock 13/05/ :24:40 Result ND, 0.6,,10*9/L Monocytes Joanna Longstock 13/05/ :24:40 AStatus Active Validated Neutrophils Joanna Longstock 13/05/ :24:41 Result ND, 3.6,,10*9/L Neutrophils Joanna Longstock 13/05/ :24:41 AStatus Active Validated Nitrite Urinalysis Joanna Longstock 13/05/ :35:35 Result ND, Negative,, Nitrite Urinalysis Joanna Longstock 13/05/ :35:35 AStatus Active Validated Opiates Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Opiates Joanna Longstock 13/05/ :34:43 AStatus Active Validated PCP Joanna Longstock 13/05/ :34:43 AStatus Active Validated Platelets Joanna Longstock 13/05/ :24:40 AStatus Active Validated Platelets Joanna Longstock 13/05/ :24:40 Result ND, 230,,10*9/L Potassium Joanna Longstock 13/05/ :27:09 Result ND, 4.34,,mmol/L Potassium Joanna Longstock 13/05/ :27:09 AStatus Active Validated Prothrombin Time Joanna Longstock 13/05/ :34:12 Result ND, 14.4,,Secs Prothrombin Time Joanna Longstock 13/05/ :34:12 AStatus Active Validated Red Cell Count Joanna Longstock 13/05/ :24:40 AStatus Active Validated Red Cell Count Joanna Longstock 13/05/ :24:40 Result ND, 4.0,,10*12/L Renal Epithelial Cells Joanna Longstock 13/05/ :35:25 AStatus Active Validated SGOT(ASAT) Joanna Longstock 13/05/ :27:09 Result ND, 12,L,IU/L SGOT(ASAT) Joanna Longstock 13/05/ :27:09 AStatus Active Analysed SGOT(ASAT) Joanna Longstock 13/05/ :33:55 AStatus Analysed Validated LabDriver Sample Audit Trail Single Lab No 5
6 SGPT(ALAT) Joanna Longstock 13/05/ :27:09 AStatus Active Validated SGPT(ALAT) Joanna Longstock 13/05/ :27:09 Result ND, 12,,IU/L Sodium Joanna Longstock 13/05/ :27:09 AStatus Active Validated Sodium Joanna Longstock 13/05/ :27:09 Result ND, 137,,mmol/L TCO2 Joanna Longstock 13/05/ :27:09 Result ND, 24,L,mmol/L TCO2 Joanna Longstock 13/05/ :27:09 AStatus Active Analysed TCO2 Joanna Longstock 13/05/ :33:55 AStatus Analysed Validated Total Bilirubin Joanna Longstock 13/05/ :27:09 Result ND, 6.9,,umol/L Total Bilirubin Joanna Longstock 13/05/ :27:09 AStatus Active Validated Total Protein Joanna Longstock 13/05/ :27:09 AStatus Active Validated Total Protein Joanna Longstock 13/05/ :27:09 Result ND, 70,,g/L Tricyclic Antidepressants Joanna Longstock 13/05/ :34:43 Result ND, Negative,, Tricyclic Antidepressants Joanna Longstock 13/05/ :34:43 AStatus Active Validated Urea Joanna Longstock 13/05/ :27:09 AStatus Active Validated Urea Joanna Longstock 13/05/ :27:09 Result ND, 4.3,,mmol/L Uric Acid Joanna Longstock 13/05/ :27:09 Result ND, 0.233,,mmol/L Uric Acid Joanna Longstock 13/05/ :27:09 AStatus Active Validated Urinalysis Bilirubin Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Bilirubin Joanna Longstock 13/05/ :24:43 Result ND, 0.0,,umol/L Urinalysis Blood Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Blood Joanna Longstock 13/05/ :24:43 Result ND, 0.0,,mg/L Urinalysis Glucose Joanna Longstock 13/05/ :24:43 Result ND, 0.0,,mmol/L Urinalysis Glucose Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Ketones Joanna Longstock 13/05/ :24:43 Result ND, 0.0,,mmol/L Urinalysis Ketones Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis ph Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis ph Joanna Longstock 13/05/ :24:43 Result ND, 7.0,,pH Urinalysis Protein Joanna Longstock 13/05/ :24:43 Result ND, 0.00,,g/L Urinalysis Protein Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Specific Gravi Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Specific Gravi Joanna Longstock 13/05/ :24:43 Result ND, 1.005,, Urinalysis Urobilinogen Joanna Longstock 13/05/ :24:43 AStatus Active Validated Urinalysis Urobilinogen Joanna Longstock 13/05/ :24:43 Result ND, 3.4,,umol/L Urine Casts Joanna Longstock 13/05/ :35:25 AStatus Active Validated Urine HCG Joanna Longstock 13/05/ :34:57 AStatus Active Validated Urine Red Blood Cells Joanna Longstock 13/05/ :35:26 AStatus Active Validated Urine White Blood Cells Joanna Longstock 13/05/ :35:26 AStatus Active Validated White Cell Count Joanna Longstock 13/05/ :24:41 Result ND, 6.4,,10*9/L White Cell Count Joanna Longstock 13/05/ :24:41 AStatus Active Validated Tests Not Requested:= Changed by Changed on At Change type Using Reason LabDriver Sample Audit Trail Single Lab No 6
7 Hct PD To: RDW To: 12.3 PCT To: MPV To: 9.8 PDW To: 15.5 LY% To: 31.3 MO% To: 9.3 NE% To: 56.6 EO% To: 2.3 BA% To: 0.5 phu To: 7.0 SG Urin urin To: UNIT To: Negative ULeuco To: 0 GU To: - UPRO + To: - Bili Urin ur To: - Uro Urin uri To: +/- BU To: - KU To: - Joanna Longstock 13/05/ :27:09 Test Not Req A/G integra To: Joanna Longstock 13/05/ :27:09 Test Not Req GLU integra To: LabDriver Sample Audit Trail Single Lab No 7
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationAnnex to the Accreditation Certificate D-EP according to DIN EN ISO/IEC 17043:2010
Deutsche Akkreditierungsstelle GmbH Annex to the Accreditation Certificate D-EP-19851-01-00 according to DIN EN ISO/IEC 17043:2010 Period of validity: 10.04.2017 to 21.01.2021 Holder of certificate: ESfEQA
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationDate Time By Code Description Qty (Variance) Photo
Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationHEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationB. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle
Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More information7:59:57AM Page 1 of 1
Daily Log AP Diagnostics 935 Sundrop t MRN Patient Name DOB Sex Accession ollected Ordered Physician Procedure Status Location 500334 Pastuer,Louis 05/25/1947 M 100509 AP-Visions linic BASI METABOLI PROFILE
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationGlossary of terms used in College examinations. The Royal College of Emergency Medicine
Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide
More informationASSIGNED TREATMENT ARM
SF Radiation Therapy Oncology Group Phase III Lung High-dose vs Standard-dose Conformal XRT with Chemotherapy Consolidation Treatment Summary Form RTOG Study No. 0617 Case # AMENDED DATA YES INSTRUCTIONS:
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationAnnex to the Accreditation Certificate D-EP according to DIN EN ISO/IEC 17043:2010
Deutsche Akkreditierungsstelle GmbH Annex to the Accreditation Certificate D-EP-19851-01-00 according to DIN EN ISO/IEC 17043:2010 Period of validity: 24.08.2018 to 21.01.2021 Holder of certificate: ESfEQA
More informationCROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
More informationAge: 14 Houston TX 77007
Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black
More informationTraceability in External Quality Assessment: How Weqas ensures traceability in EQA and stresses its importance to users. David Ducroq.
Traceability in External Quality Assessment: How Weqas ensures traceability in EQA and stresses its importance to users David Ducroq Weqas Unit 6, Parc Tŷ Glas Llanishen Cardiff UK www.weqas.com Programme
More informationTypes of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationVOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008
VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More informationM Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES
M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,
More informationGENERAL INFORMATION CLINICAL LABORATORY PHONE DIRECTORY
GENERAL INFORMATION CLINICAL LABORATORY PHONE DIRECTORY SECTION PHONE NUMBER Clinical Pathologist 431-5888 Laboratory Main Laboratory Administrative Director Janis Nall Accessioning/Client Services Section
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Laboratory locations: 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK - Cheltenham Hospital Hatherley Lane Cheltenham GL51 6SY Contact: Chris Watson Tel: +44 (0) 1242 246516 E-Mail: chris.watson@nuffieldhealth.com
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationHYPERCALCEMIC GOLDEN RETRIEVER
Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More information1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to Laboratory locations: 60 Whitfield Street London W1N 4EU Contact:
More informationAlaska Native Medical Center Anchorage, AK
ANMC Lab Test Requirements Key: Room Temp (20-25C), Refrigerated (2-8C), (-15 to -25C), Hr (Hours), D (Days), W (Weeks), Mo (Months), Yr (Years). Basic Processing Instructions: Centrifuge all blood specimens
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationHaematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationNORTH SHORE - LONG ISLAND JEWISH HEALTH SYSTEM LONG ISLAND JEWISH MEDICAL CENTER DEPARTMENT OF LABORATORY MEDICINE REFERENCE RANGES
S A2 COLUMN 0D 2.0-3.5 2.0-3.5 % ACETAMINOPHEN 0D 5-25 5-25 > 150 ug/ml > 50 ug/ml 12 hour post ingestion > 100 ug/ml 8 hour post ingestion > 200 ug/ml 4 hour post ingestion ACTIVATED PROTEIN C RESIS 0D
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationAuthorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5
AFP All All < 15 ug/l Albumin All 0-3M 25-40 g/l Albumin All 3-12M 32-45 g/l Albumin All 1-70Y 34-48 g/l Albumin All >70Y 32-46 g/l Alk Phos All 0-10Y 80-350 U/L Alk Phos M 10-14Y 45-400 U/L Alk Phos F
More informationKEY FACTS IN ANAESTHESIA AND INTENSIVE CARE
KEY FACTS IN ANAESTHESIA AND INTENSIVE CARE Alcira Serrano Gomez MD Fellow John Farman Intensive Care Unit Addenbrooke s NHS Trust Cambridge, UK Gilbert R Park MD DMed Sci FRCA Director of Intensive Care
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:
Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationYou will receive an Advance Shipment Notice (ASN), which reminds you of upcoming shipments and test events, before
2015 Test Event Calendar The following Test Event Calendar applies for all Programs in this section. The number of shipments of sample sets is indicated in the program description for each Program. You
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationQuest Diagnostics Drug Testing Index Full Year 2015 Tables
Quest Diagnostics Drug Testing Index Full Year 2015 Tables Table 1. Annual Positivity Rates Urine Drug Tests (For Combined U.S. Workforce) (More than 9.5 million tests from January to December 2015) Year
More informationThe potential of colokinetics to assist in bowel management in people with spinal cord injury Translation from Laboratory to Clinic
The potential of colokinetics to assist in bowel management in people with spinal cord injury Translation from Laboratory to Clinic Principal Investigators: John Furness, Albert Frauman, Andrew Ellis,
More informationWest Suffolk Clinical Commissioning Group (WSCCG) Safety audit for methotrexate prescribing for patients in primary care
West Suffolk Clinical Commissioning Group (WSCCG) Safety audit for methotrexate prescribing for patients in primary care Year 2013-2014 Safety 100% of patients prescribed oral methotrexate should have
More informationGlossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013
Glossary of terms used in IEEM Hong Kong College of Emergency Medicine March 2013 The Hong Kong College of Emergency Medicine IEEM uses several terms in examinations that may cause confusion. The following
More information