Supplemental Information. Nodal Signaling Regulates Germ Cell. Development and Establishment of Seminiferous. Cords in the Human Fetal Testis
|
|
- Helena Patrick
- 5 years ago
- Views:
Transcription
1 Cell Reports, Volume 25 Supplemental Information Nodal Signaling Regulates Germ Cell Development and Establishment of Seminiferous Cords in the Human Fetal Testis Anne Jørgensen, Joni Macdonald, John E. Nielsen, Karen R. Kilcoyne, Signe Perlman, Lene Lundvall, Lea Langhoff Thuesen, Kristine Juul Hare, Hanne Frederiksen, Anna-Maria Andersson, Niels E. Skakkebæk, Anders Juul, Richard M. Sharpe, Ewa Rajpert-De Meyts, and Rod T. Mitchell
2 Fig. S1 Supplementary Figure 1. Key factors of Nodal and Activin signaling pathways are expressed in human fetal gonads. Related to Figure 1. Expression of Nodal, Cripto, Lefty, ALK4, ALK5, ActRIIB, INHBA, and INHBB in fetal ovary and testis samples from 1 st trimester and testis samples from 2 nd trimester. Gene expression is normalized to RPS29 and expressed relative to fetal testis samples from GW 7 9, which were set to a value of 1. Values represent mean ± SEM and for each age-group N=5-11. Significant difference compared to fetal testis GW 7-9, *** p<0.001, ** p<0.01, * p<0.05. Note, no fetal ovary samples were available for analysis for GW and GW ND: not determined, GW: gestational week.
3 Fig. S2 Supplementary Figure 2. Effects of inhibiting Nodal and Activin signaling in 1 st trimester human fetal testis ex vivo cultures. Related to Figure 1. A) Effects of SB treatment (20 µm for 14 days) in ex vivo culture of 1st trimester fetal testis on expression of the germ cell marker VASA and the meiosis marker SCP3. Adult human testis sample was included as a positive control. B) Effects of SB treatment (20 µm for 14 days) in ex vivo culture of 1st trimester fetal testis on expression of the granulosa cell marker FOXL2 to examine possible Sertoli-to-granulosa cell trans-differentiation. Fetal ovary sample was included as positive control. Counterstaining with Mayer s haematoxylin, scale bar corresponds to 50 µm.
4 Fig. S3 Supplementary Figure 3. Effects of simultaneous inhibition of Nodal and Activin signaling in 1 st trimester human fetal testis ex vivo cultures on proliferation and apoptosis. Related to Figure 1. A) Effects on expression of markers of proliferation and apoptosis following SB treatment (20 µm), for 7 or 14 days in ex vivo culture of 1 st trimester fetal testis. Immunohistochemical staining for the proliferation marker BrdU (which was added to culture media for the last 6 hours of culture), the apoptosis markers cleaved PARP (cparp) and staining determining TUNEL-positive cells, was examined with N=3 for the 7-day culture period and N=9 for the 14-day culture period. Counterstaining with Mayer s haematoxylin, scale bar corresponds to 50 µm. B) Quantification of proliferating (BrdU + ) germ cells and apoptotic (cparp + ) cells per mm 2 after 14 days of culture. Values represent mean ± SEM, with N=9. Significant difference compared to vehicle controls, *** P<0.001, ** P<0.01.
5 Fig. S4 Supplementary Figure 4. Effects of inhibiting Nodal and Activin signaling in 2 nd trimester human fetal testis. Related to Figure 3. Multinucleated germ cells present in 2 nd trimester fetal testis treated with SB (20 µm, 6 days) followed by xenografting for 6 weeks. Higher magnification of haematoxylin eosin staining shown in Figure 3A, scale bar corresponds to 50 µm and 10 µm, respectively. Boxes indicate area containing multinucleated germ cells.
6 Fig. S5 Supplementary Figure 5. Effects of manipulating Activin signalling in 1 st trimester fetal testis ex vivo cultures. Related to Figure 4. Morphology and expression pattern of germ cell markers OCT4 (gonocyte) and MAGE-A4 (pre-spermatogonia), Sertoli cell marker (AMH), interstitial cell marker (COUP-TFII), and Leydig cell marker (CYP11A1) investigated in 1 st trimester fetal testis samples treated with recombinant Activin A and Follistatin. With N=12 fetuses for Activin A treatment and N=12 for Follistatin treatment. Counterstaining with Mayer s haematoxylin, scale bar corresponds to 50 µm.
7 Fig. S6 Supplementary Figure 6. Effects of manipulating Nodal signalling in 1 st trimester ex vivo cultures. Related to Figure 4 and 5. A) Effects on proliferation and apoptosis of Nodal and Lefty treatment for 2 weeks in ex vivo culture of 1 st trimester fetal testis. Immunohistochemical staining for the proliferation marker BrdU (which were added to culture media for the last 6 hours of culture) and the apoptosis marker cleaved PARP (cparp). Counterstaining with Mayer haematoxylin, scale bar corresponds to 50 µm. B) Quantification of proliferating (BrdU + ) germ cells and apoptotic (cparp + ) cells per mm 2. Values represent mean ± SEM, with N=7 (Nodal) and N=10 (Lefty).
8 Fig. S7 Supplementary Figure 7. Effects of manipulating Activin signalling in 1 st trimester ex vivo cultures. Related to Figure 4 and 5. A) Quantification of androgens produced in the fetal testis tissue ex vivo cultures and secreted to the media droplets. Media was collected every 48 hours throughout the 14-day culture period and was pooled for each individual tissue piece. Androgens were measured by LC-MS/MS and are shown as ratios compared to vehicle controls for each metabolite. Values represent mean ± SEM, with N=10 for each treatment. B) Effects on proliferation and apoptosis of Activin and Follistatin treatment for 2 weeks in ex vivo culture of 1 st trimester fetal testis. Immunohistochemical staining for the proliferation marker BrdU (which were added to culture media for the last 6 hours of culture) and the apoptosis marker cleaved PARP (cparp). Counterstaining with Mayer haematoxylin, scale bar corresponds to 50 µm. C) Quantification of proliferating (BrdU + ) germ cells and apoptotic (cparp + ) cells per mm 2. Values represent mean ± SEM, with N=10.
9 Table S1 Supplementary table 1. Antibody dilutions, retrieval buffer and details. Related to Figure 1-6. For all antibodies, antigen retrieval was conducted by microwaving or placing sections in a pressure cooker in indicated retrieval buffer. Citrate buffer: 10 mm, ph 6.0; TEG buffer: 10 mmtris, 0.5 mm EGTA, ph 9.0; Urea buffer: 5% w/v carbamide, ph 5.5. Antibody Dilution (formalin/bouin fixed tissue) Retrieval buffer Company Number OCT4 1:50 / 1:100 TEG Santa Cruz Sc-5279 NANOG 1:50 Citrate R&D Systems AF-1997 AP2γ 1:50 / 1:50 Urea Santa Cruz Sc SALL4 1:100 TEG Santa Cruz Sc LIN28 1:500 Citrate R&D Systems AF-3757 C-KIT 1:200 TEG Dako A4502 MAGE-A4 1:250 / 1:250 TEG Non-commercial Gift from Prof. Spagnoli AMH 1:400 / 1:600 Citrate Santa Cruz Sc-6886 SOX9 1:400 / 1:2000 Citrate Millipore AB5535 cparp 1:75 / 1:75 Citrate Cell Signaling 5625 BrdU 1:100 Citrate Dako M0744 COUP-TFII 1:50 / 1:50 Citrate Perseus Proteomics PP-H CYP11A1 1:250 /1:300 TEG Sigma HPA γh2ax 1:800 TEG Abcam Ab26350 SCP3 1:800 TEG Novus NB VASA 1:1200 Citrate Abcam Ab13840 FOXL2 1:75 Citrate Non-commercial Gift from Dr. Wilhelm DMRT1 1:400 / 1:800 Citrate Sigma HPA027850
10 Table S2 Supplementary table 2. LC-MS/MS validation parameters for androgens and corticosteroids in cell media from fetal testis cultures. Related to Figure 1 and 5. Limits of quantification (LOQ), range of calibration curves based on 10 standards and results of inter-day control materials (n=32) at low and high levels from 11 batches. Control Low Control high LOQ Range mean RSD recovery mean RSD recovery (nm) (nm) (nm) (%) (%) (nm) (%) (%) Estrone 1-sulfate LOQ Cortisone 0.19 LOQ Cortisol 1.9 LOQ dehydroepiandrosterone sulfate 19 LOQ Corticosterone 0.1 LOQ deoxycortisol LOQ Δ4-androstenedione LOQ Testosterone LOQ α-hydroxyprogesterone 0.1 LOQ Progesterone LOQ
11 Table S3 Supplementary table 3. Primer sequences. Related to Figure 1 and Figure S1. Gene Fwd primer 5-3 Rev primer 5-3 Amplicon size GenBank Accession no. Activin βa (INHBA) GAACTTATGGAGCAGACCTCGG TTGCCATCACACTCCAAGCC 608 bp NM_ Activin βb (INHBB) GCCAGGAGCGCGTTTCCGAAATC CCGCTCGCCCCGCTCAAACAAG 326 bp NM_ ActRIIB (ACVR2B) CAACTTCTGCAACGAACGCTT GCGCCCCCGAGCCTTGATCTC 283 bp NM_ ALK4 (ACVR1B) GGAGCGTCTTGTCTTTGGAG TGCAACAGGATCGACTTGAG 238 bp NM_ ALK5 (TGFBR1) GATGGGCTCTGCTTTGTCTC CAAGGCCAGGTGATGACTTT 214 bp NM_ ALK7 (ACVR1C) GACATGAAAACATCCTTGGT ACTTCTGGTCACAAACAACC 585 bp NM_ LEFTY GCCTCGACAGTGCATCGCCTC CAAGTAAACAATGACACATTGGGC 477 bp NM_ NODAL AGCATGGTTTTGGAGGTGAC CCTGCGAGAGGTTGGAGTAG 160 bp NM_ CRIPTO (TDGF1) TCCTTCTACGGACGGAACTG ATCACAGCCGGGTAGAAATG 153 bp NM_ RPS20 AACAAGCCGCAACGTAAAATC ACGATCCCACGTCTTAGAACC 166 bp NM_ RPS29 CGCTCTTGTCGTGTCTGTTCA CCTTCGCGTACTGACGGAAA 91 bp NM_001032
Sal-like protein 4 (SALL4)
Assessment Run 43 205 Sal-like protein 4 (SALL4) The slide to be stained for SALL4 comprised:. Appendix, 2. Testis, 3. Renal clear cell carcinoma, 4. Seminoma, 5. Intratubular germ cell neoplasia (IGCN),
More informationFigure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
More informationFertility Diagnostics
Fertility Diagnostics Fertility hormones measured on PATHFAST For internal use only Diagnostics PATHFAST Chemiluminescence-immuno-analyzer 1 Content: page 1. Fertility hormones - general aspects 1.1 Reproductive
More information11. SEXUAL DIFFERENTIATION. Germinal cells, gonocytes. Indifferent stage INDIFFERENT STAGE
11. SEXUAL DIFFERENTIATION INDIFFERENT STAGE Early in pregnancy, (within 10-15 % of the pregnancy s expected length) a genital ridge is formed in the sides of the embryonic tissue, ventral to the mesonephros
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationMAGE-A1, GAGE and NY-ESO-1 cancer/testis antigen expression during human gonadal development
Human Reproduction Vol.22, No.4 pp. 953 960, 2007 Advance Access publication January 5, 2007 doi:10.1093/humrep/del494 MAGE-A1, GAGE and NY-ESO-1 cancer/testis antigen expression during human gonadal development
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Intratubular germ cell neoplasia of the human testis Citation for published version: Mitchell, RT, E Camacho-Moll, M, Macdonald, J, Anderson, R, Kelnar, CJH, O'Donnell, M, Sharpe,
More informationTo determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationKnockout TM SR : ; ; ; : R ; R : A : X(2013) , ,, B. , (Knockout TM
33 1 Vol.33 No.1 013 1 Dec. 013 Reproduction & Contraception doi: 10.7669/j.issn.03-37X.013.1.0804 E-mail: randc_journal@163.com Knockout TM SR ; ; ; 400014 : FBS Knockout TM SRKSR : FBS KSR HE TUNEL RT-PCR
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationMicroscopic Anatomy of Sertoli and Leydig Cells During Fetal Development in Baladi Rabbit
International Journal of Animal Science and Technology 2018; 2(1): 1-5 http://www.sciencepublishinggroup.com/j/ijast doi: 10.11648/j.ijast.20180201.11 Microscopic Anatomy of Sertoli and Leydig Cells During
More informationDAX1, testes development role 7, 8 DFFRY, spermatogenesis role 49 DMRT genes, male sex differentiation role 15
Subject Index N-Acetylcysteine, sperm quality effects 71 Ambiguous genitalia, origins 1, 2 Anti-Müllerian hormone function 13 receptors 13 Sertoli cell secretion 10, 38 Apoptosis assays in testes 73, 74
More informationIB 140 Midterm #1 PRACTICE EXAM (lecture topics 1-5)
IB 140 Midterm #1 PRACTICE EXAM (lecture topics 1-5) For all the questions on this exam, the correct answer is the single best answer that is available in the answer key. 1) Which of the following is NOT
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
More informationSPERMATOGENESIS IN VITRO
SPERMATOGENESIS IN VITRO INDUCTION OF PROLIFERATION, MEIOSIS AND DIFFERENTIATION Mário Sousa Lab Cell Biology Institute of Biomedical Sciences (ICBAS) University of Porto msousa@icbas.up.pt Spermatogonia
More informationAnalysis of Testosterone, Androstenedione, and Dehydroepiandrosterone Sulfate in Serum for Clinical Research
Analysis of Testosterone, Androstenedione, and Dehydroepiandrosterone Sulfate in Serum for Clinical Research Dominic Foley, Michelle Wills, and Lisa Calton Waters Corporation, Wilmslow, UK APPLICATION
More informationWhen testes make no testosterone: Identifying a rare cause of 46, XY female phenotype in adulthood
When testes make no testosterone: Identifying a rare cause of 46, XY female phenotype in adulthood Gardner DG, Shoback D. Greenspan's Basic & Clinical Endocrinology, 10e; 2017 Sira Korpaisarn, MD Endocrinology
More informationTopic No. & Title: Topic 4 Biosynthesis and secretion of adrenal, ovarian and testicular hormones-factors influencing secretion
[Academic Script] Biosynthesis and secretion of adrenal, ovarian and testicular hormones-factors influencing secretion Subject: Zoology Course: B.Sc. 2 nd Year Paper No. & Title: Z-203B Vertebrate Endocrinology
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationTests that have had changes to the method/ CPT code, units of measurement, scope of analysis, reference comments, or specimen requirements.
Updates In our continuing effort to provide you with the highest quality toxicology laboratory services available, we have compiled important changes regarding a number of tests we perform. Listed below
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants
SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig
More informationChapter 22 The Reproductive System (I)
Chapter 22 The Reproductive System (I) An Overview of Reproductive Physiology o The Male Reproductive System o The Female Reproductive System 22.1 Reproductive System Overview Reproductive system = all
More informationSpermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis?
Spermatogenesis What is it and what does it look like? How do hormones regulate spermatogenesis? FSH, androgens, growth factors Animal Physiology (Hill, Wise, Anderson): Ch. 15 435-438 1 Spermatogenesis:
More informationLi et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
More informationExperimentally induced testicular dysgenesis syndrome originates in the masculinization programming window
Experimentally induced testicular dysgenesis syndrome originates in the masculinization programming window Sander van den Driesche, 1 Karen R. Kilcoyne, 1 Ida Wagner, 1 Diane Rebourcet, 1 Ashley Boyle,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationGrowth pattern of the sex ducts in foetal mouse hermaphrodites
/. Embryol. exp. Morph. 73, 59-68, 1983 59 Printed in Great Britain The Company of Biologists Limited 1983 Growth pattern of the sex ducts in foetal mouse hermaphrodites By C. YDING ANDERSEN 1, A. G. BYSKOV
More informationRobust extraction, separation, and quantitation of structural isomer steroids from human plasma by SPE-UHPLC-MS/MS
TECHNICAL NOTE 21882 Robust extraction, separation, and quantitation of structural isomer steroids human plasma by SPE-UHPLC-MS/MS Authors Jon Bardsley 1, Kean Woodmansey 1, and Stacy Tremintin 2 1 Thermo
More informationGenesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationHistology of Male Reproductive system (1)
Histology of Male Reproductive system (1) Prof. Dr. Malak A. Al-yawer Learning Objectives At the end of this lecture, the medical student will be able to: State the organization of the testis Define seminiferous
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationBIOSYNTHESIS OF STEROID HORMONES
BIOSYNTHESIS OF STEROID HORMONES Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI sw/steroidrepro/inter/08 1 STEROID HORMONES Progestins (21 C) Glucocorticoids (21 C) Mineralocorticoids
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationOntogenesis of testicular function in humans
FOLIA HISTOCHEMICA ET CYTOBIOLOGICA Vol. 47, No. 5, 2009 pp. S19-S24 Review article Ontogenesis of testicular function in humans Virginie Rouiller-Fabre 1,2,3, Vincent Muczynski 1,2,3, Romain Lambrot 1,2,3,
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/3/e1400244/dc1 Supplementary Materials for PlGF-induced VEGFR1-dependent vascular remodeling determines opposing antitumor effects and drug resistance to
More informationGametogenesis. Omne vivum ex ovo All living things come from eggs.
Omne vivum ex ovo All living things come from eggs. William Harvery, 1651 Gametogenesis This lecture is the preface, so to speak, to embryology; that is, it introduces the development of the specialized
More informationAnimal Science 434 Reproductive Physiology
Animal Science 434 Reproductive Physiology Development of the Pituitary Gland Lec 5: Embryogenesis of the Pituitary and Sexual Development Stomodeum Brain Infundibulum Rathke s Pouch Germ Cell Migration
More informationTwo important cells in female are the theca cells and the granulose cells. Granulosa cells are affected by the two gonadotropin hormones; FSH and LH.
1 UGS physiology sheet #13 lecture 3 Dr.Saleem Khresha. Now we will start discussing the female reproductive system Ovarian Steroids Two important cells in female are the theca cells and the granulose
More informationYK290 DHEA (Saliva) EIA
YK290 DHEA (Saliva) EIA Product Instructions FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA-SHI SHIZUOKA, JAPAN 418-0011 Our website: www.yanaihara.co.jp E-mail: ask@yanaihara.co.jp
More informationRat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit
Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit Catalog No. E0228r (96 tests) Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS!
More informationFemale androgen profiles by MS for PCOS patients. CS Ho APCCMS 2010, Hong Kong 14 January 2010
Female androgen profiles by MS for PCOS patients CS Ho APCCMS 2010, Hong Kong 14 January 2010 873 women with increased serum androgens Androgen-secreting neoplasms 0.2% Classical CAH 0.6% Non-classical
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Western blotting with ERβ antibodies Full blots corresponding to Fig. 2, along with replicated experiments at different time points, different batches,
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationReproductive FSH. Analyte Information
Reproductive FSH Analyte Information 1 Follicle-stimulating hormone Introduction Follicle-stimulating hormone (FSH, also known as follitropin) is a glycoprotein hormone secreted by the anterior pituitary
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Effect of fetal or neonatal exposure to monobutyl phthalate (MBP) on testicular development and function in the marmoset Citation for published version: McKinnell, C, Mitchell,
More informationW.S. O University of Hong Kong
W.S. O University of Hong Kong Development of the Genital System 1. Sexual differentiation 2. Differentiation of the gonads a. Germ cells extragonadal in origin b. Genital ridge intermediate mesoderm consisting
More informationfollicles and spermatogonia
5 th World Congress of the International Society for Fertility Preservation Vienna, Austria. November 16-18; 2017 Session 2: Stem cells and in vitro growth of gametes Development, sex differentiation and
More informationSynthesis of sex steroids
Synthesis of sex steroids CH 3 NAD(P)H NAD(P)+ Dehidroepiandroszteron Androszténdion 17- -hidroxiszteroid dehidrogenáz CH 3 dehydroepiandrosterone Dehidroepiandroszteron (DHEA) 3SDH Koleszterin CH 3 aromatase
More informationSUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationAbstract. Introduction. RBMOnline - Vol 18. No Reproductive BioMedicine Online; on web 20 March 2009
RBMOnline - Vol 18. No 5. 2009 694-699 Reproductive BioMedicine Online; www.rbmonline.com/article/3738 on web 20 March 2009 Article Anti-Müllerian hormone in pregnant women in relation to other hormones,
More informationReproduction. Inhibin B. Analyte Information
Reproduction Inhibin B Analyte Information - 1-2011-01-11 Inhibin B Introduction Inhibins are polypeptides belonging to the transforming growth factor-β (TGF-β) superfamily which also includes TGF-β, activin
More informationSupplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)
Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) Confocal images of septal olfactory epithelium of an adult Gγ8-sypGFP-tdTom mouse showing colocalization
More informationInduction of spermatogenic synchrony by retinoic acid in neonatal mice
EDITOR'S Letter to CORNER the Editor Spermatogenesis 3:1, e23180; January/February/March 2013 2013; 2013 Landes Bioscience EDITOR'S CORNER Induction of spermatogenic synchrony by retinoic acid in neonatal
More informationSingle-Cell RNA-Seq Analysis Maps Development of Human Germline Cells and Gonadal Niche Interactions
Resource Single-Cell RNA-Seq Analysis Maps Development of Human Germline Cells and Gonadal Niche Interactions Graphical Abstract Authors Li Li, Ji Dong, Liying Yan,..., Lu Wen, Fuchou Tang, Jie Qiao Correspondence
More informationMethod Development for the Analysis of Endogenous Steroids Using Convergence Chromatography with Mass Spectrometric Detection
Method Development for the Analysis of Endogenous Steroids Using Convergence Chromatography with Mass Spectrometric Detection Christopher J. Hudalla, Stuart Chadwick, Fiona Liddicoat, Andrew Peck, and
More informationExtraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE. SLE+ Prior to LC/MS-MS Analysis
Application Note AN890 Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE SLE+ Page Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE SLE+ Prior to LC/MS-MS
More informationBiology of Reproduction- Zool 346 Exam 2
Biology of Reproduction- Zool 346 Exam 2 ANSWER ALL THE QUESTIONS ON THE ANSWER SHEET. THE ANSWER ON THE ANSWER SHEET IS YOUR OFFICIAL ANSWER. Some critical words are boldfaced. This exam is 7 pages long.
More informationSupplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
More information1. Both asexual and sexual reproduction occur in the animal kingdom
1. Both asexual and sexual reproduction occur in the animal kingdom Asexual reproduction involves the formation of individuals whose genes all come from one parent. There is no fusion of sperm and egg.
More informationREPRODUCTIVE ENDOCRINOLOGY OF THE MALE
Reproductive Biotechnologies Andrology I REPRODUCTIVE ENDOCRINOLOGY OF THE MALE Prof. Alberto Contri REPRODUCTIVE ENDOCRINOLOGY OF THE MALE SPERMATOGENESIS AND REPRODUCTIVE BEHAVIOR RELATED TO THE ACTIVITY
More informationFig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
More informationM2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination
Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.
More informationPHYSIOLOGY AND PATHOLOGY OF SEXUAL DIFFERENTIATION
PHYSIOLOGY AND PATHOLOGY OF SEXUAL DIFFERENTIATION Prof. Dr med. Jolanta Słowikowska-Hilczer Department of Andrology and Reproductive Endocrinology Medical University of Łódź, Poland Sexual determination
More informationAnimal Science 434 Reproductive Physiology"
Animal Science 434 Reproductive Physiology" Embryogenesis of the Pituitary and Sexual Development: Part A Development of the Pituitary Gland" Infundibulum" Brain" Rathke s Pouch" Stomodeum" Germ Cell Migration"
More information74. Hormone synthesis in the adrenal cortex. The glucocorticoids: biosynthesis, regulation, effects. Adrenal cortex is vital for life!
74. Hormone synthesis in the adrenal cortex. The glucocorticoids: biosynthesis, regulation, effects. Adrenal cortex is vital for life! 5 g each Zona glomerulosa : Mineralocorticoids ALDOSTERON Zona fasciculata:
More informationMitosis. Single Nano Micro Milli Macro. Primary. PCNA expression
a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationMode of action (MoA) in toxicology: general concept
Toxicogenomics toxicology at a molecular level (mrna, mirna, proteins, metabolites ) Mode of action (MoA) in toxicology: general concept Chemical substance Key event 1 (Molecular initiating event) Key
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationAll stocks and calibration levels were prepared in water: methanol (50:50) v/v to cover range of all steroid concentrations (refer Table 1).
Application LCMS-8040 Simultaneous determination of 11 steroids and Vitamin D2/D3 in human serum using LC/MS/MS - Introduction Quantification of endogenous hormonal steroids and their precursors is essential
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationPRODUCT LIST 2018 Immunoassays RIA, IRMA, REA
PRODUCT LIST 2018 Immunoassays RIA, IRMA, REA REPRODUCTIVE - FERTILITY REPRODUCTIVE ANDROGENS Androstanediol glucuronide DSL9200 RIA CT 100 185 Androstenedione IM0674 RIA CT 100 185 Androstenedione DSL3800
More informationPRODUCT LIST 2011 Immunoassays RIA, IRMA, REA
PRODUCT LIST 2011 Immunoassays RIA, IRMA, REA REPRODUCTIVE ANDROGENS Androstanediol glucuronide DSL9200 RIA CT 100 185 Androstenedione IM0674 RIA CT 100 185 Androstenedione DSL3800 RIA CT 100 185 DHEA
More informationEnvironmental contaminants and food safety
Environmental contaminants and food safety Agneta Oskarsson Department of Biomedical Sciences and Veterinary Public Health, Swedish University of Agricultural Sciences, Uppsala Sweden 26 th NKVet Symposium
More informationIdentifying disruptors of male germ cell development by small molecule screening in ex vivo gonad cultures
Wakeling et al. BMC Research Notes 2013, 6:168 TECHNICAL NOTE Open Access Identifying disruptors of male germ cell development by small molecule screening in ex vivo gonad cultures Stephanie I Wakeling
More informationFollicle-Stimulating Hormone (Follitropin) As many people know, the vast complexities and intricacies involved in the
Wayne Heath Professor Champlin BIO 421 19 February 2014 Follicle-Stimulating Hormone (Follitropin) As many people know, the vast complexities and intricacies involved in the functioning of the human body
More informationBi-potent Gonads. Sex Determination
יצירת הגונדות Primordial Germ Cells (PGCs) Somatic cells Genital ridge Bi-potent Gonads Sex Determination Testis and Sperm Ovary and Oocyte Migration of Primordial Germ Cells in the Chick Embryo The
More informationDevelopment, sex differentiation and clonal expansion of PGCs to create primordial follicles and spermatogonia. Scenarios for in vitro gametogenesis
5 th World Congress of the International Society for Fertility Preservation Vienna, Austria. November 16-18; 2017 Session 2: Stem cells and in vitro growth of gametes Development, sex differentiation and
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationIntegration of steroids analysis in serum using LC-MS/MS with full-automated sample preparation
PO-CON69E Integration of steroids analysis in serum using LC-MS/MS with full-automated sample preparation MSACL 6 EU Stéphane Moreau, Daisuke Kawakami, Toshikazu Minohata Shimadzu Europe GmbH, Duisburg,
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationMelatonin and its Role in the Inhibition of Breast Cancer Ciara Nicol Ross Copyright 2014 by Ciara Ross and Koni Stone
1 Melatonin and its Role in the Inhibition of Breast Cancer Ciara Nicol Ross Copyright 2014 by Ciara Ross and Koni Stone Cancer is a disease caused by out of control division of abnormal cells within a
More informationReproductive Hormones
Reproductive Hormones Male gonads: testes produce male sex cells! sperm Female gonads: ovaries produce female sex cells! ovum The union of male and female sex cells during fertilization produces a zygote
More information