Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants

Size: px
Start display at page:

Download "Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants"

Transcription

1 SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig cells (red, examples indicated by arrows), the numbers of these cells is reduced before and during early adolescence (P7, P14 and P21) in both mutants. Sections are counterstained with DAPI (blue). Supplemental Figure 2: Uterine morphology is affected in female sterile mutants. Whole mounts show hypoplasic uteri in Sgpl1 -/-, Plekha1 -/- ;Pdgfrα +/-, Schip1 -/- ;Pdgfrα +/- and BC /- ;Pdgfrα +/- mice, while the uteri of Tiparp -/- mice appear enlarged. Histological sections indicate that the layers of the uterine wall (the endometrial stroma and myometrium) are present, but reduced. Sections are stained with hematoxylin and eosin. Supplemental Figure 3: Using CSPG4 as a marker (red), theca cells (arrows) are reduced in most female sterile mutants (Sgpl1 -/-, Plekha1 -/- ;Pdgfrα +/-, Schip1 -/- ;Pdgfrα +/- and BC /- ;Pdgfrα +/- ). Using ASMA as a marker (green), VSMCs are also reduced in throughout the ovaries of these mutants. Tiparp -/- ovaries appear to have normal numbers of both theca cells and VSMCs. The partially fertile Schip1 -/- ;Pdgfrα +/- and BC /- ;Pdgfrα +/- ovaries maintain small regions of CSPG4 positive cells in the stroma. Immunofluorescent sections are counterstained with DAPI (blue). Supplemental Figure 4: LH levels in sterile mutants are not decreased from wildtype. LH was measured in serum using an RIA assay. Error bars indicate SEM. Each bar represents an average of 6-10 mice, with the exception of Sgpl1 -/- and Plekha1 -/- ;Pdgfrα +/-. These mutants had decreased viability and fewer samples were measured (1-2 mice), thus error bars are not shown on these conditions.

2 Supplemental Figure 5: In Plekha1 -/- testes, both ASMA and Desmin (green) are reduced around vasculature in VSMCs (arrows) and around the testis cords, in areas associated with peritubular myoid cells. Sections are counterstained with DAPI (blue). Supplemental Figure 6: A model of the function of PDGF targets in the regulation of the male steroidogenic pathway. In the testis, Plekha1 represses Tiparp expression, allowing the expression of the male steroidogenic enzyme 17HSD3 and the synthesis of testosterone. In the ovary, Tiparp acts to repress this enzyme, preventing the synthesis of testosterone in the theca cell and allowing the synthesis of estrogen in the neighboring granulosa cell. Supplemental Figure 7: Pdgf receptors and ligands are expressed within the testis and ovary. A) In the testis, both receptors (Pdgfrα and Pdgfrβ) are expressed within the interstitial population (arrows) and to a lesser degree in the outer layers of the testis cords. In the ovary, both receptors (Pdgfrα and Pdgfrβ) are expressed with theca cells (arrows) surrounding follicles, as well as in some stroma populations. B) The ligands Pdgfa and Pdgfc are expressed in the testis cords (arrowheads) and interstitial populations. In the ovary, the ligand Pdgfa is expressed in stroma populations, with some weak detection in theca cells (arrow). Pdgfb is expressed in the granulosa of follicles (arrowhead) and the stroma. Pdgfc is broadly expressed in the ovary and found in granulosa, theca and stroma populations. Supplemental Figure 8: Conditional knockout of Pdgfrα leads to defects in the embryonic testis. A) Using Xgal staining, Sf1-Cre (blue) is detected in embryonic Leydig cells between the developing testis cords at E12.5. B, C) Sf1-Cre;Pdgfrα fl-/- testes exhibit impaired testis cord formation at both E13.5 and E14.5. D) Sf1-Cre;Pdgfrα fl-/- testes have reduced numbers of

3 steroidogenic cells (red), detected with an antibody against CYP11A1. Sections are counterstained with DAPI (blue) and the testis is indicated by brackets. Supplemental Figure 9: Schematic of the conditional allele of Pdgfrβ. A) Schematic of conditional allele. A) Map of the PDGFRβ locus, exons are indicated by blue boxes; bottom, red arrowheads indicate loxp sites, blue arrowheads indicate FRT sites flanking a PGK-neo cassette. DTA is a PGK-DTA cassette used for negative selection in ES cells. B) PCR of shows Neo is efficiently removed from the targeted allele in More-Cre + ;Pdgfrβ fl-/- mice. C) Western of Pdgfrβ immunoprecipitated from whole embryo extracts at E18.5 shows loss of PDGFRβ protein in More-Cre + ;Pdgfrβ fl-/- mice.

4 Supplemental Table 1: Sf1-cre + /Pdgfrα fl-/- /Pdgfrβ fl-/- mice have reduced viability after birth. +-/+-/+x --/+-/+- Actual wk 1 Expected wk 1 +-/+-/-- x +-/--/+- Actual E 18.5 Expected E /--/ % 3.1 % % 18.8 % -/--/ % 3.1 % % 6.3 % +/--/ % 6.3 % % 18.8 % -/--/ % 6.3 % % 6.3 % +/+-/ % 6.3 % % 18.8 % -/+-/ % 6.3 % % 6.3 % Total in litters 128 (18 litters) 65 (9 litters)

5 Supplemental Table 2: Primers used for genotyping and real time PCR. For genotyping mutants created with the gene trap array construct (Sgpl1, Plekha1, Tiparp, Schip and BC058969), the primers for the gene are listed in the indicated box, while the primer for splice acceptor region of the construct is indicated separately as GTA. Gene Genotyping PCR Real Time PCR Sgpl1 F: CGCTCAGAAGGCTCTGAGTCATGG na R: CCAAGTGTACCTGCTAAGTTCCAG Plekha1 F: TACTCAGATGAAAAGGCAGGAACC na R: GGATCTGGATTGCATCTCTAGCCC Tiparp F: TGTCAGATCCCTCCTTCGTGAGGC R: GTATAGTACCTAGCACTGTTCACC F: CGACTAATTGAAGAAGCCAACTCTCG R: CTTGGATGAAGTCCTGAGATGGATGC Schip1 F: TGACCATAGAAACTCCACAAGGG R: TACTATGAGGCTAGTAGAGAAGCC na BC F: CAGTATTCAACAGTCCAGTCTTGAG na R: CCTGGCTGTCCTGGAACTCACTCTG GTA R: CATCAAGGAAACCCTGGACTACTG na Pdgfrα and Pdgfrα fl R4: CCCTTGTGGTCATGCCAAAC R5: GCTTTTGCCTCCATTACACTGG R6:ACGAAGTTATTAGGTCCCTCGAC F: GAAACGATCGTGGTGACCTGTG R: TGACGGGCAGCACATTCATACT Pdgfrβ Pdgfrβ fl Cre B1:TGGACTCCGAGGACCTGTTCATT B2: AAAAGTACCAGTGAAACCTCGCTG B3: ATCAGCCTCGACTGTGCCTTCTAG F: GGAAAAGCAGGTTTGTGC R: TACCAGGAAGGCTTGGGAAG B: CCAGTTAGTCCACTTATGTTG F: TCCAATTTACTGACCGTACACCAA F: CATGTCTGAGACCCGGTACGTG R: GCAGCTTGAAGGAGAGCTGGAC R: CCTGATCCTGGCAATTTCGGCTA Cyp11a1 na F: TCCATTACCATCAGATGCAGAG R: GTCCACGATGTAAACTGACTCC Cyp17a1 na F: CTGGCCAGAGAAGTGCTCGTG R: TGCAGCTGCCAGGAGCTACTAC Cyp19a1 na F: TTCATGAGAGTCTGGATCAGTG R: CCACGCTTGCTGCCGAATCG Hsd17b1 na F: CTGCGTGGTTATGAGCAAGC R: CGCATTGCAGTCAAGAAGAGC Hsd17b3 na F: GACCACTGGAAGCTGTGTGAAGAT R: TCTCACCGGAAGTGCTCAGGAAAT Ubc na F: CGAGCCCAGTGTTACCACCAAG R: CACCCAAGAACAAGCACAAGGA na na

6

7

8

9

10

11

12

13

14

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct

More information

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-

Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/- Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!&#12?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!&#1?R'!!

More information

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,

More information

The subcortical maternal complex controls symmetric division of mouse zygotes by

The subcortical maternal complex controls symmetric division of mouse zygotes by The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,

More information

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

stability and tumor suppression

stability and tumor suppression Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish

Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.

More information

REPRODUCCIÓN. La idea fija. Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings

REPRODUCCIÓN. La idea fija. Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings REPRODUCCIÓN La idea fija How male and female reproductive systems differentiate The reproductive organs and how they work How gametes are produced and fertilized Pregnancy, stages of development, birth

More information

Reproductive System. Testes. Accessory reproductive organs. gametogenesis hormones. Reproductive tract & Glands

Reproductive System. Testes. Accessory reproductive organs. gametogenesis hormones. Reproductive tract & Glands Reproductive System Testes gametogenesis hormones Accessory reproductive organs Reproductive tract & Glands transport gametes provide nourishment for gametes Hormonal regulation in men Hypothalamus - puberty

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supporting Information

Supporting Information Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Subcutaneous Autografting Leydig Stem Cells: An Approach to Increase Serum Testosterone

Subcutaneous Autografting Leydig Stem Cells: An Approach to Increase Serum Testosterone Subcutaneous Autografting Leydig Stem Cells: An Approach to Increase Serum Testosterone Ranjith Ramasamy, MD Department of Urology and Interdisciplinary Stem Cell Institute, University of Miami, FL, USA

More information

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice

Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility in mice Xiaopeng Hu 1 *, Zhenzhou Tang 1,2 *, Yang Li 2 *, Wensheng Liu 2, Shuang Zhang 3, Bingyan Wang 3, Yingpu Tian 2, Yinan

More information

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3

More information

UMR 7221CNRS/MNHN Evolution des régulations endocriniennes Muséum National d Histoire Naturelle Paris - France

UMR 7221CNRS/MNHN Evolution des régulations endocriniennes Muséum National d Histoire Naturelle Paris - France Role of Foxl2 and Dlx5/6 on uterine development and function: implications for BPES UMR 7221CNRS/MNHN Evolution des régulations endocriniennes Muséum National d Histoire Naturelle Paris - France TAKE HOME

More information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science

More information

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between

Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice

The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin

More information

Chapter 14 The Reproductive System

Chapter 14 The Reproductive System Biology 12 Name: Reproductive System Per: Date: Chapter 14 The Reproductive System Complete using BC Biology 12, page 436-467 14. 1 Male Reproductive System pages 440-443 1. Distinguish between gametes

More information

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

SISTEMA REPRODUCTOR (LA IDEA FIJA) Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings

SISTEMA REPRODUCTOR (LA IDEA FIJA) Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings SISTEMA REPRODUCTOR (LA IDEA FIJA) How male and female reproductive systems differentiate The reproductive organs and how they work How gametes are produced and fertilized Pregnancy, stages of development,

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina

More information

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high

More information

Supporting Information

Supporting Information Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes

SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins

Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

BIOL 2402 Reproductive Systems!

BIOL 2402 Reproductive Systems! Dr. Chris Doumen! Female Reproductive Anatomy BIOL 2402 Reproductive Systems! Establishing the Ovarian Cycle During childhood, until puberty Ovaries grow and secrete small amounts of estrogens Estrogen

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

Reproductive Endocrinology. Isabel Hwang Department of Physiology Faculty of Medicine University of Hong Kong Hong Kong May2007

Reproductive Endocrinology. Isabel Hwang Department of Physiology Faculty of Medicine University of Hong Kong Hong Kong May2007 Reproductive Endocrinology Isabel Hwang Department of Physiology Faculty of Medicine University of Hong Kong Hong Kong May2007 isabelss@hkucc.hku.hk A 3-hormone chain of command controls reproduction with

More information

18 Urinary system. 19 Male reproductive system. Female reproductive system. Blok 11: Genital and Urinary Tract Diseases

18 Urinary system. 19 Male reproductive system. Female reproductive system. Blok 11: Genital and Urinary Tract Diseases Blok 11: Genital and Urinary Tract Diseases 18 Urinary System 19 Male Genital System 20 Female Genital System 18 Urinary system You should be able to: 1. Describe the structures and associated functions

More information

Spring Elective 2018 Spring. Genito-Urinary system

Spring Elective 2018 Spring. Genito-Urinary system Spring Elective 2018 Spring Genito-Urinary system Human Uterus, fallopian tubes, Ovaries Mouse bi-cornuate uterus, tubes and ovaires Human Male Reproductive system Mouse The mouse seminal vesicles are

More information

Reproduction and Development. Female Reproductive System

Reproduction and Development. Female Reproductive System Reproduction and Development Female Reproductive System Outcomes 5. Identify the structures in the human female reproductive system and describe their functions. Ovaries, Fallopian tubes, Uterus, Endometrium,

More information

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature

Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph

More information

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic

Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic Supplementary information Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic development Shilpi Minocha 1*, Delphine Valloton 1*, Yvan Arsenijevic 2, Jean-René Cardinaux 3, Raffaella

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.

Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice. Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling

More information

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool

More information

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell

In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later

More information

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek

More information

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram

More information

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al. s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

Endocrinology laboratory Department of Zoology Kalyani University Kalyani, West Bengal India

Endocrinology laboratory Department of Zoology Kalyani University Kalyani, West Bengal India Epidermal growth factor (EGF) promotes ovarian steroidogenesis and epidermal growth factor receptor (EGFR) signaling is required for gonadotropin-induced steroid production in common carp Cyprinus carpio

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

Reproductive Hormones

Reproductive Hormones Reproductive Hormones Male gonads: testes produce male sex cells! sperm Female gonads: ovaries produce female sex cells! ovum The union of male and female sex cells during fertilization produces a zygote

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Sperm production. Sperm production. Meiosis. Mitosis. The cells of Leydig in testes secrete

Sperm production. Sperm production. Meiosis. Mitosis. The cells of Leydig in testes secrete Sperm production Ductus deferens Epididymis The cells of Leydig in testes secrete Seminiferous testosterone (T) tubules T secreted at puberty produces 2 o sex characteristics, spermatogenesis, & maintain

More information

Sperm production. Sperm production. Controlling sperm production. Meiosis. Mitosis. The cells of Leydig in testes secrete

Sperm production. Sperm production. Controlling sperm production. Meiosis. Mitosis. The cells of Leydig in testes secrete Ductus deferens Sperm production Epididymis The cells of Leydig in testes secrete Seminiferous testosterone (T) tubules T secreted at puberty produces 2 o sex characteristics, spermatogenesis, & maintain

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Chapter 14 Reproduction Review Assignment

Chapter 14 Reproduction Review Assignment Date: Mark: _/45 Chapter 14 Reproduction Review Assignment Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Use the diagram above to answer the next question.

More information

AMONG THE TROPHIC regulators of gonadal function

AMONG THE TROPHIC regulators of gonadal function 0013-7227/00/$03.00/0 Vol. 141, No. 11 Endocrinology Printed in U.S.A. Copyright 2000 by The Endocrine Society Estrogen Deficiency, Obesity, and Skeletal Abnormalities in Follicle-Stimulating Hormone Receptor

More information

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak

More information

MULTIPLE CHOICE: match the term(s) or description with the appropriate letter of the structure.

MULTIPLE CHOICE: match the term(s) or description with the appropriate letter of the structure. Chapter 27 Exam Due NLT Thursday, July 31, 2015 Name MULTIPLE CHOICE: match the term(s) or description with the appropriate letter of the structure. Figure 27.1 Using Figure 27.1, match the following:

More information

Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and

Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas

More information

Reproductive physiology. About this Chapter. Case introduction. The brain directs reproduction 2010/6/29. The Male Reproductive System

Reproductive physiology. About this Chapter. Case introduction. The brain directs reproduction 2010/6/29. The Male Reproductive System Section Ⅻ Reproductive physiology Ming-jie Wang E-Mail: mjwang@shmu.edu.cn About this Chapter The reproductive organs and how they work the major endocrine functions of sexual glands actions of sex hormones

More information

Balancing intestinal and systemic inflammation through cell type-specific expression of

Balancing intestinal and systemic inflammation through cell type-specific expression of Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia

More information

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR

More information

Hypothalamus & Pituitary Gland

Hypothalamus & Pituitary Gland Hypothalamus & Pituitary Gland Hypothalamus and Pituitary Gland The hypothalamus and pituitary gland form a unit that exerts control over the function of several endocrine glands (thyroid, adrenals, and

More information

Human Anatomy Unit 3 REPRODUCTIVE SYSTEM

Human Anatomy Unit 3 REPRODUCTIVE SYSTEM Human Anatomy Unit 3 REPRODUCTIVE SYSTEM In Anatomy Today Male Reproductive System Gonads = testes primary organ responsible for sperm production development/maintenan ce of secondary sex characteristics

More information

Spermatogenesis Following Experimental Testicular Ischemia

Spermatogenesis Following Experimental Testicular Ischemia Spermatogenesis Following Experimental Testicular Ischemia Frank Hinman, Jr, MD, and Gilbert I Smith, MD REGENERATION of the spermatogenic elements of the testis after depression by testosterone and by

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Information

Supplementary Information Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Which of the following hormones controls the release of anterior pituitary gonadotropins? A) LH

More information

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

More information

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental

More information

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Cheng MH, Fan U, Grewal N, et al. Acquired autoimmune polyglandular

More information