Industrial production of Human Milk Oligosaccharides through industrial biotechnology. Prof. Wim Soetaert
|
|
- Shona Franklin
- 6 years ago
- Views:
Transcription
1 Industrial production of Human Milk Oligosaccharides through industrial biotechnology Prof. Wim Soetaert
2 Inbiose at a glance Core competence in the development and production of specialty carbohydrates through industrial biotechnology Proprietary production platform based on fermentative synthesis of specialty carbohydrates (cell factory) Specialty carbohydrates Started in 2013 Ghent University spin-off Fast growing: >30 FTE in 2016 Access to pilot and production facilities Capacity up to 100tpa Experienced team with industrial and academic background Confidential 2
3 Carbohydrates are everywhere 3
4 Carbohydrates are everywhere glucose From the simplest form typically used as food Specialty carbohydrate To very complex structures used as an active ingredient 4
5 What are specialty carbohydrates? Very complex carbohydrates with unconventional structures Rare in nature or difficult to impossible to produce Price range: 10 /kg /kg (reference sugar: 0.5 /kg) Quantities: 1 kg tpa High-end applications in pharmaceuticals, nutraceuticals, cosmetics, chemicals, plant protection,... 5
6 What are specialty carbohydrates? Carbohydrates consisting of unconventional building blocks: L-Fucose Sialic acid Glucosamine Glucose Galactose Example: Human Milk Oligosaccharides
7 Disialyl-Lacto-N-Tetraose (dslnt) as an example of a very complex specialty carbohydrate N-acetylneuraminate HO OH HO O HN CH 3 HO OH OH HO O O HO HO O O HN HO CH 3 OH O O O HO O O OHHO O O HO NH CH 3 O OH O OH OH O O OH OH OH Lacto-N-Tetraose Lactose
8 Occurrence What are specialty carbohydrates? sucrose glucose fructose lactose galactose xylose chitin deoxyribose FOS N-acetylglucosamine mannose D-ribose LactoNbiose lactontetraose sialic acid L-fucose Complexity/difficulty to produce L-ribose Lewis X
9 Price What are specialty carbohydrates? Lewis X galactose glucose fructose lactose sucrose GOS XOS xylose L-ribose HMO L-fucose sialic acid lactontetraose lactonbiose Deoxyribose D-ribose mannose N-acetylglucosamine FOS chitosan chitin Complexity/difficulty to produce
10 Specialty carbohydrate production Extraction Chemical synthesis Enzymatic synthesis Microbial synthesis Natural source required, availability problems High price volatility due to natural variability Complex extraction procedures Very complex synthesis and costly substrates Low yields Use of toxic chemicals and high waste generation Simple and cheap Only for simple one-step conversions Equilibrium can be unfavourable Very complex carbohydrates produced in one step Cheap and readily available substrates Environmentally sustainable Confidential
11 Inbiose production platform Metabolically engineered microbes Fermentation Microbes at work Down-stream processing Specialty carbohydrate 11
12 Microbial synthesis of building blocks Sucrose Microbes at work Carbohydrate building blocks 12
13 Microbial assembly of the building blocks Assembly of the different monosaccharide building blocks into an oligosaccharide Pathway engineering 13
14 Biochemical pathway assembly Cloned genes with tunable elements such as promoters and ribosome binding sites Assemble in an artificial chromosome 14
15 Biochemical pathway assembly Transfer into the base strain Specialty carbohydrate Sucrose 15
16 Selection of best strain from the library carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate carbohydrate 16
17 Strain development Technology platform for high throughput development of specialty carbohydrate production strains Enzyme engineering Analytics Fermentation technology Synthetic Biology & Automation Bioinformatics & Statistics Confidential 17
18 Integrated technology development bug Metabolic engineering of the production organism Process Development of the fermentation process Product Development of the product recovery process 18
19 Integrated technology development Bug Biochemical pathway design Expression of suitable genes in the production host Strain selection for optimal producer organism ATGGTTGCAGTAGCGATAGC GCCTTTATAAAT GCTATAGATCT GATCTTCGGAA CTGAGCTTCAA CTATGCGGCTTA TAATATTTATTCCAAA CC TTATCCTTCTCGGAGGCTCT AGGGGCCTTAAAATTCCCGA GCSSDSGLYKCRYGYRSIGFG SSESRDLSFNSEIYAAYRRLI FIPNSLSFSEALGALKFPNSM LKKIDPAQTESWKRLGRHYDG VKDLAMDDLFQQDPDRFKRLS MAFKDMVVDVSKNRITDKTLA LLMDLARETGVKEAIAMMFRG DRINETEGRSVLHVALRNLAD TPVLVDGKDVMPGVRGVLEDR Identify the optimal biosynthesis pathway in the production host Screen biosynthesis associated genes and proteins in DNA and protein databases Pathway library assembly 19
20 Integrated technology development Process Development of the fermentation process Optimisation of yield and production rate Scale-up of the fermentation process Titer Time 20
21 HMO strain & process improvement g/l Final titer (g/l) g/l mg/l 182 mg/l 2,3 g/l 5,7 g/l 21
22 Scale-up of the fermentation process 22
23 Integrated technology development Product Development of down-stream processing of fermentation broth Product recovery and purification Product conditioning 23
24 Scale-up of the down-stream process Confidential 24
25 Build-up of production capacity Two new 15 m 3 fermenters are operational HMO Production capacity: 100 tonnes per year 25
26 Industrial biotechnology process hall
27 Industrial biotechnology process hall
28 Industrial biotechnology process hall
29 Industrial biotechnology process hall
30
31
32 Actiefoto s
33 Our technology in a nutshell Sucrose or glucose Cell factory HMOs 33
34 Integrated technology development 34
35 Human Milk Oligosaccharides Human mother s milk composition: Protein: 8 g/l Fat: 42 g/l Lactose: 70 g/l Human Milk Oligosaccharide: 15 g/l Galactose Fucose Glucose Inbiose s first target is 2 fucosyllactose as the most abundant HMO 35
36 Human Milk Oligosaccharides 1 st market Infant milk formula Prebiotics Functional foods Feed/Pet care Confidential
37 HMOs are currently our main targets 120 Pubmed - human milk oligosaccharide publication count per yr HMO Applications Patent Families by Year Confidential 37
38 2 FL is our first HMO Enabling Closest to breast milk Enabling Health Benefits to the infant Confidential 38
39 Inbiose - DuPont Partnership Licence and JDA DuPont to commercialize 2 FL and possibly 2 other fucosylated HMO s for Human Nutrition DuPont to lead up-scaling, manufacturing and sales Inbiose is supporting customers with samples until commercial launch by DuPont Parties working diligently to support customers to launch new products with HMO s Strategic and technology fit Science 50 yrs in (early life) nutrition (proteins, cultures, pre- & probiotics, hydrocolloids, enzymes) Leader in microbiome science Production Strong position in large scale fermentation, carbohydrate production and DSP Market reach Global market access and reach with local support Can supply customers with scale, supply security and good safety track record Confidential 39
40 In a nutshell Generic and scaleable technology platform for producing HMOs through industrial biotechnology Inbiose can produce any complex carbohydrate for which a biotechnological pathway can be designed Inbiose can quickly develop new processes through its base strains Inbiose process starts from cheap substrates and delivers high yields and productivities Inbiose can currently produce 100 tpa of HMOs 40
41 Turning specialty carbohydrates into an industrial reality 2016 Inbiose NV
Nutritional Sweeteners and Saccharides from Renewable Feedstocks
Nutritional Sweeteners and Saccharides from Renewable Feedstocks 1 David Demirjian, Ph. D. President & CEO World Congress on Industrial Biotechnology July 22, 2015 1 2 Who is zuchem? Industrial Biotechnology
More informationChapter 1. Chemistry of Life - Advanced TABLE 1.2: title
Condensation and Hydrolysis Condensation reactions are the chemical processes by which large organic compounds are synthesized from their monomeric units. Hydrolysis reactions are the reverse process.
More informationFood Specialties Patrick Niels President DSM Food Specialties ROYAL DSM HEALTH NUTRITION MATERIALS
Food Specialties Patrick Niels President DSM Food Specialties ROYAL DSM HEALTH NUTRITION MATERIALS Safe harbor statement This presentation may contain forward-looking statements with respect to DSM s future
More informationCarbohydrates. Organic compounds which comprise of only C, H and O. C x (H 2 O) y
Carbohydrates Organic compounds which comprise of only C, H and O C x (H 2 O) y Carbohydrates Monosaccharides Simple sugar Soluble in water Precursors in synthesis triose sugars of other (C3) molecules
More informationDefinition of a Carbohydrate
* Atoms held together by covalent bonds Definition of a Carbohydrate * Organic macromolecules * Consist of C, H, & O atoms * Usually in a 1:2:1 ratio of C:H : O Functions Performed by Carbohydrates Used
More informationIndustrial biotechnology agustin krisna wardani
Industrial biotechnology agustin krisna wardani Nutraceuticals The term Nutraceuticals, launched by Stephen De-Felici in the 1980s A food or part of a food that may provide medicinal or health benefits,
More information24.1 Introduction to Carbohydrates
24.1 Introduction to Carbohydrates Carbohydrates (sugars) are abundant in nature: They are high energy biomolecules. They provide structural rigidity for organisms (plants, crustaceans, etc.). The polymer
More information-are poly-hydroxylated aldehydes and ketones -can cyclise -can form polymeric chains
CARBOHYDRATES -compounds of C, H and O -originally thought of as hydrates of carbon e.g. glucose C 6 H 12 O 6 thought to be C(H 2 O) carbohydrates: -are poly-hydroxylated aldehydes and ketones -can cyclise
More informationNext generation pre, pro, and synbiotics
LP-LDL : Cholesterol & hypertension reduction Next generation pre, pro, and synbiotics Prevention Management Treatment February 2017 Stephen OHara Chief Executive Officer 1 Company Overview Founded in
More informationCarbon. p Has four valence electrons p Can bond with many elements p Can bond to other carbon atoms
Organic Compounds Carbon p Has four valence electrons p Can bond with many elements p Can bond to other carbon atoms n Gives carbon the ability to form chains that are almost unlimited in length. p Organic
More informationCarbohydrates for Improving Health! CarboHealth Research Results
Carbohydrates for Improving Health! CarboHealth Research Results Zwolle, 30 November, 2017 A demand-driven Public-Private Partnership in the field of carbohydrate research: 6 private companies and 3 knowledge
More informationBCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud
BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud 1 Carbohydrates Carbohydrates: Compounds composed of carbon, oxygen, and hydrogen arranged as monosaccharides or multiples of monosaccharides. Most,
More informationEnzymatic Extraction of High-value Ingredients from Food Waste
Enzymatic Extraction of High-value Ingredients from Food Waste Dr. Amit Kumar Jaiswal Prof. Nissreen Abu-Ghannam School of Food Science and Environmental Health, Dublin Institute of Technology, Dublin
More informationChemical Composition of the Cell. B. Balen
Chemical Composition of the Cell B. Balen Table 2-2 Molecular Biology of the Cell ( Garland Science 2008) 1. Water the most abundant substance in the cell! Where did it come from? several hypothesis: -
More informationDevelopment of tailor-made carbohydrate-based products by bioconversion. German-Russian Forum Biotechnology th of October 2011
Development of tailor-made carbohydrate-based products by bioconversion German-Russian Forum Biotechnology 2011 10 th of October 2011 Company Overview aevotis GmbH Operational since 1 st of March 2010,
More informationOrganic Molecules. 8/27/2004 Mr. Davenport 1
Organic Molecules 8/27/2004 Mr. Davenport 1 Carbohydrates Commonly called sugars and starches Consist of C, H, O with H:O ration 2:1 Usually classified as to sugar units Monosaccharide are single sugar
More informationEnzymatic Extraction of High-Value Ingredients From Food Waste
Dublin Institute of Technology ARROW@DIT Conference papers School of Food Science and Environmental Health 2014-02-07 Enzymatic Extraction of High-Value Ingredients From Food Waste Amit Jaiswal Dublin
More informationHuman Nutrition Jeremy Xu President Human Nutritional & Health ROYAL DSM HEALTH NUTRITION MATERIALS
Human Nutrition Jeremy Xu President Human Nutritional & Health ROYAL DSM HEALTH NUTRITION MATERIALS Safe harbor statement This presentation may contain forward-looking statements with respect to DSM s
More informationCompany presentation Frankfurt, Enzymes and carbohydrate ingredients for a healthy nutrition
Company presentation Frankfurt, 9.11.2016 Enzymes and carbohydrate ingredients for a healthy nutrition Lars Wiemann BD-Manager evoxx technologies GmbH Agenda Evoxx technologies GmbH - History, overview,
More information2 3 Carbon Compounds Slide 1 of 37
1 of 37 The Chemistry of Carbon The Chemistry of Carbon Organic chemistry is the study of all compounds that contain bonds between carbon atoms. Carbon atoms have four valence electrons that can join with
More informationA BEGINNER S GUIDE TO BIOCHEMISTRY
A BEGINNER S GUIDE TO BIOCHEMISTRY Life is basically a chemical process Organic substances: contain carbon atoms bonded to other carbon atom 4 classes: carbohydrates, lipids, proteins, nucleic acids Chemical
More informationCarbon. Has four valence electrons Can bond with many elements. Can bond to other carbon atoms. Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
Organic Compounds Carbon Has four valence electrons Can bond with many elements Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen Can bond to other carbon atoms Gives carbon the ability to form chains
More informationCarbohydrates. Chapter 12
Carbohydrates Chapter 12 Educational Goals 1. Given a Fischer projection of a monosaccharide, classify it as either aldoses or ketoses. 2. Given a Fischer projection of a monosaccharide, classify it by
More informationGlycan Standards. For microarrays and the identification/ quantification of glycans. Cambridge Isotope Laboratories, Inc. isotope.
Cambridge Isotope Laboratories, Inc. isotope.com RESEARCH PRDUCTS Glycan Standards For microarrays and the identification/ quantification of glycans The emerging field of glycomics focuses on the structure
More informationHMOs. ( 2'-Fucosyllactose) Cell Factory For. Human
HMOs ( 2'-Fucosyllactose) Cell Factory For Human Introduction 1. Vision "Cell factory for human" Redesign of microorganisms High cell density culture High efficiency purification Commercialization technology
More informationBIOCHEMISTRY UNIT 2 Part 4 ACTIVITY #4 (Chapter 5) CARBOHYDRATES
AP BIOLOGY BIOCHEMISTRY UNIT 2 Part 4 ACTIVITY #4 (Chapter 5) NAME DATE PERIOD CARBOHYDRATES GENERAL CHARACTERISTICS: Polymers of simple sugars Classified according to number of simple sugars Sugars 3
More informationSome Interesting Nutritional Biochemistry of Sugars
Some Interesting Nutritional Biochemistry of Sugars 1 The Fructose Paradox: Sweet Poison Very sweet sugar Cheap to produce (high fructose corn syrup) Low Glycemic Index.but, it s a nutritional nightmare!
More informationCHEMISTRY OF LIFE 05 FEBRUARY 2014
CHEMISTRY OF LIFE 05 FEBRUARY 2014 In this lesson we will: Lesson Description Discuss inorganic compounds and their importance Discuss organic compounds and their biological importance. Summary Inorganic
More informationThe Structure and Function of Macromolecules
The Structure and Function of Macromolecules I. Polymers What is a polymer? Poly = many; mer = part. A polymer is a large molecule consisting of many smaller sub-units bonded together. What is a monomer?
More informationThis place covers: Reducing the size of material from which sugars are to be extracted; Presses and knives therefor,
CPC - C13B - 2017.08 C13B PRODUCTION OF SUCROSE; APPARATUS SPECIALLY ADAPTED THEREFOR (chemically synthesised sugars or sugar derivatives C07H; fermentation or enzyme-using processes for preparing compounds
More informationLITTLE TREASURE. Premium Australian Made Powdered Milk Products
LITTLE TREASURE Premium Australian Made Powdered Milk Products Little Treasure Infant Formula and other Milk Powder products. Made in Australia to the highest possible standard, using milk from Australian
More informationName a property of. water why is it necessary for life?
02.09.18 Name a property of + water why is it necessary for life? n Cohesion n Adhesion n Transparency n Density n Solvent n Heat capacity + Macromolecules (2.3 & some of 2.4) + Organic Molecules All molecules
More informationCARBOHYDRATES. Produce energy for living things Atoms? Monomer Examples? Carbon, hydrogen, and oxygen in 1:2:1 ratio.
CARBOHYDRATES Produce energy for living things Atoms? Carbon, hydrogen, and oxygen in 1:2:1 ratio Monomer Examples? Sugars, starches MONOSACCHARIDES--- main source of energy for cells Glucose Know formula?
More informationCarbohydrates. Monosaccharides
Carbohydrates Carbohydrates (also called saccharides) are molecular compounds made from just three elements: carbon, hydrogen and oxygen. Monosaccharides (e.g. glucose) and disaccharides (e.g. sucrose)
More informationI. ROLE OF CARBON IN ORGANISMS: Organic compounds = compounds that contain carbon Ex: Carbohydrates, lipids, proteins
I. ROLE OF CARBON IN ORGANISMS: Organic compounds = compounds that contain carbon Ex: Carbohydrates, lipids, proteins Inorganic compounds = compounds that DO NOT contain carbon Ex: Vitamins, minerals,
More informationBiological Chemistry. Is biochemistry fun? - Find it out!
Biological Chemistry Is biochemistry fun? - Find it out! 1. Key concepts Outline 2. Condensation and Hydrolysis Reactions 3. Carbohydrates 4. Lipids 5. Proteins 6. Nucleic Acids Key Concepts: 1. Organic
More informationOrganic Chemistry. Organic chemistry is the chemistry of carbon compounds. Biochemistry is the study of carbon compounds that crawl.
Organic Chemistry Organic chemistry is the chemistry of carbon compounds. Biochemistry is the study of carbon compounds that crawl. Organic Compounds - have carbon bonded to other atoms and determine structure/function
More informationNew Technology in Vaccine Engineering
Viruses in May Katoomba, August, 2012 New Technology in Vaccine Engineering Anton Middelberg Australian Institute for Bioengineering and Nanotechnology The University of Queensland, Australia Introduction
More informationDehydration Synthesis and Hydrolysis Reactions. ne_content/animations/reaction_types.ht ml
Glucose Molecule Macromolecules Carbohydrates, proteins, and nucleic acids are polymers Polymers long molecules made from building blocks linked by covalent bonds Monomers the building blocks to polymers
More informationChemistry of Carbon. All living things rely on one particular type of molecule: carbon
Ach Chemistry of Carbon All living things rely on one particular type of molecule: carbon Carbon atom with an outer shell of four electrons can form covalent bonds with four atoms. In organic molecules,
More informationIn vitro and in vivo fermentation behaviour of prebiotic carbohydrates
Nov 30th, 2017 Zwolle In vitro and in vivo fermentation behaviour of prebiotic carbohydrates Fangjie Gu & Henk Schols Laboratory of Food Chemistry Introducing prebiotic fibres Resistant to human GI digestion
More informationCarbohydrate Structure
IN THE NAME OF GOD Carbohydrate Structure Disaccharides Simple Carbs Sucrose (glucose & fructose) Cookies, candy, cake, soft drinks Maltose (glucose & glucose) Beans Lactose (glucose & galactose) Yogurt,
More informationChapter 2 pt 2. Atoms, Molecules, and Life. Gregory Ahearn. John Crocker. Including the lecture Materials of
Chapter 2 pt 2 Atoms, Molecules, and Life Including the lecture Materials of Gregory Ahearn University of North Florida with amendments and additions by John Crocker Copyright 2009 Pearson Education, Inc..
More informationMacromolecules. Macromolecules. What are the macromolecules? Organic molecules. The human body uses complex organic molecules known as macromolecules.
Macromolecules Macromolecules Biochemistry The human body uses complex organic molecules known as macromolecules. Macro - long or large It is a large molecule that is made up of smaller units joined together.
More informationBiochemistry: Macromolecules
1 Biology: Macromolecules 2 Carbohydrates Carbohydrate organic compound containing carbon, hydrogen, & oxygen in a 1:2:1 ratio Meaning: hydrated carbon ratio of h:0 is 2:1 (same as in water) Source: plants
More informationCh13. Sugars. What biology does with monosaccharides disaccharides and polysaccharides. version 1.0
Ch13 Sugars What biology does with monosaccharides disaccharides and polysaccharides. version 1.0 Nick DeMello, PhD. 2007-2015 Ch13 Sugars Haworth Structures Saccharides can form rings. That creates a
More informationCarbohydrates. Prof. Ramune Morkuniene
Carbohydrates Prof. Ramune Morkuniene Topics Monosaccharides and their derivatives Disaccharides. Lactose intolerance Carbohydrate sweeteners. Artificial sweeteners Blood type and monosaccharides Important
More informationSugar Sensing Using Boronic Acid Modified Poly(amidoamine) Dendrimers. Xiaoli Liang
Sugar Sensing Using Boronic Acid Modified Poly(amidoamine) Dendrimers Xiaoli Liang Waste water in sweetener industry lactose glucose sucrose fructose maltose http://www.arieschem.com/ Synthetic Sensors
More informationCarbohydrates. 1. Using the terms provided below, complete the concept map showing the characteristics of organic compounds.
Name: Class: Date: Grade 10 Science Related Reading/Biology Carbohydrates Biology Gr10 1. Using the terms provided below, complete the concept map showing the characteristics of organic compounds. maltose
More informationName: Per. HONORS: Molecules of Life
Name: Per. HONORS: Molecules of Life Carbohydrates, proteins, and fats are classes of organic molecules that are essential to the life processes of all living things. All three classes of molecules are
More informationIB Biology BIOCHEMISTRY. Biological Macromolecules SBI3U7. Topic 3. Thursday, October 4, 2012
+ IB Biology SBI3U7 BIOCHEMISTRY Topic 3 Biological Macromolecules Essential Questions: 1.What are the 4 main types of biological macromolecules and what is their function within cells? 2.How does the
More informationCLASS 12th. Biomolecules
CLASS 12th Biomolecules 01. Introduction Biomolecules may be defined as complex lifeless chemical substances which form the basis of life. i.e. they not only build up living system (creatures) but are
More informationBREAKTHROUGH SOLUTION TO ADDRESS PET OBESITY
BREAKTHROUGH SOLUTION TO ADDRESS PET OBESITY A NATURAL SOLUTION FROM GnuBiotics Sciences 1st product is GNU100, which is a Microbiota Accessible Carbohydrate (MAC) that serves as a dense protective barrier
More informationThe. Crash Course. Basically, almost all living things are made up of these 4 Elements: - Carbon (C) - Nitrogen (N) - Hydrogen (H) - Oxygen (O)
The Biochemistry Crash Course Basically, almost all living things are made up of these 4 Elements: - Carbon (C) - Nitrogen (N) - Hydrogen (H) - Oxygen (O) This exercise is designed to familiarize you with
More informationMicrobial Metabolism & Growth
Microbial Metabolism & Growth Basic Organic Chem Review Four Basic Types of Macromolecules A) Proteins (Made up of Amino Acids) B) Nucleic Acids (Made up of NucleoEdes) C) Carbohydrates (Mainly Carbon,
More informationCompetitive Inhibitor
is a substance that reduces the activity of an enzyme by entering the active site in place of the substrate whose structure it mimics. Competitive Inhibitor Identify the following molecule: Polysaccharide
More informationCarbon. Isomers. The Chemical Building Blocks of Life
The Chemical Building Blocks of Life Carbon Chapter 3 Framework of biological molecules consists primarily of carbon bonded to Carbon O, N, S, P or H Can form up to 4 covalent bonds Hydrocarbons molecule
More informationWhat are the molecules of life?
Molecules of Life What are the molecules of life? Organic Compounds Complex Carbohydrates Lipids Proteins Nucleic Acids Organic Compounds Carbon- hydrogen based molecules From Structure to Function Ø Carbon
More informationLearning Target: Describe characteristics and functions of carbohydrates, lipids, and proteins. Compare and contrast the classes of organic
Learning Target: Describe characteristics and functions of carbohydrates, lipids, and proteins. Compare and contrast the classes of organic compounds. What are inorganic molecules? Molecules that CANNOT
More informationCell Chemistry - Intro
Cell Chemistry - Intro SBI 3C Cell Chemistry All things are made of atoms, including living things. As we explore the cell we need to have a basic understanding of the chemistry and molecules that make
More informationPhotosynthesis Digestion Respiration. ., proteins. ... Glucose,.., fatty acids and glycerol, respectively.
BIOMOLECULES Dear Reader In the previous chapter you have read about DNA present in the chromosomes. It is one of the many organic chemical compounds present in all living organisms. The organic compounds
More informationLesson 2. Biological Molecules. Introduction to Life Processes - SCI 102 1
Lesson 2 Biological Molecules Introduction to Life Processes - SCI 102 1 Carbon in Biological Molecules Organic molecules contain carbon (C) and hydrogen (H) Example: glucose (C 6 H 12 O 6 ) Inorganic
More informationMacro molecule = is all the reactions that take place in cells, the sum of all chemical reactions that occur within a living organism Anabolism:
Macromolecule Macro molecule = molecule that is built up from smaller units The smaller single subunits that make up macromolecules are known as Joining two or more single units together form a M is all
More informationSome Interesting Nutritional Biochemistry of Sugars
Some Interesting Nutritional Biochemistry of Sugars 1 The Fructose Paradox: Sweet Poison Very sweet sugar Cheap to produce (high fructose corn syrup) Low Glycemic Index.but, it s a nutritional nightmare!
More informationBiological Molecules 1
Biological Molecules 1 Overview Macromolecules Monomers and polymers The four classes of biological molecules Lipids Saturated, unsaturated, trans fats Phospholipids Steroids Carbohydrates Monosaccharides,
More informationBiological Molecules
Chemical Building Blocks of Life Chapter 3 Biological Molecules Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent
More informationFor more important question's visit :
For more important question's visit : www.4ono.com Unit - 14 BIOMOLECULES POINTS TO REMEMBER 1. Carbohydrates are optically active polyhydroxy aldehydes or ketones or molecules which provide such units
More informationWallington County Grammar School
Wallington County Grammar School Y11 to Lower Sixth Bridging Work Subject: Subject Leader to direct questions to (email enquiries@wcgs.org.uk): Estimated hours of work needed to complete this work successfully:
More informationLesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 The Chemistry of Carbon What elements does carbon bond with to make up life s molecules? Carbon can bond with many elements, including Hydrogen, Oxygen, Phosphorus, Sulfur, and Nitrogen
More informationLecture 2 Carbohydrates
Lecture 2 Carbohydrates Sources of CHOs Wholegrains major dietary intake Vegetables, legumes ad fruit contain dietary fibre Milk products provide lactose essential for infants Glycogen is a storage carbohydrate,
More informationTopic 4 - #2 Carbohydrates Topic 2
Topic 4 - #2 Carbohydrates Topic 2 Biologically Important Monosaccharide Derivatives There are a large number of monosaccharide derivatives. A variety of chemical and enzymatic reactions produce these
More informationThe Structure and Func.on of Macromolecules: GRU1L4 Carbohydrates
The Structure and Func.on of Macromolecules: GRU1L4 Carbohydrates Do Now: WHAT IS TABLE SUGAR MADE UP OF? Sucrose (table sugar) Composed of a glucose molecule and a fructose molecule Please draw the structure
More informationCarbohydrates 1. Steven E. Massey, Ph.D. Assistant Professor Bioinformatics Department of Biology University of Puerto Rico Río Piedras
Carbohydrates 1 Steven E. Massey, Ph.D. Assistant Professor Bioinformatics Department of Biology University of Puerto Rico Río Piedras Office & Lab: NCN#343B Tel: 787-764-0000 ext. 7798 E-mail: stevenemassey@gmail.com
More informationThe Chemical Building Blocks of Life. Chapter 3
The Chemical Building Blocks of Life Chapter 3 Biological Molecules Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent
More informationUnit 3: Chemistry of Life Mr. Nagel Meade High School
Unit 3: Chemistry of Life Mr. Nagel Meade High School IB Syllabus Statements 3.2.1 Distinguish between organic and inorganic compounds. 3.2.2 Identify amino acids, glucose, ribose and fatty acids from
More informationBiological Molecules
The Chemical Building Blocks of Life Chapter 3 Biological molecules consist primarily of -carbon bonded to carbon, or -carbon bonded to other molecules. Carbon can form up to 4 covalent bonds. Carbon may
More informationBiochemistry Name: Practice Questions
Name: Practice Questions 1. Carbohydrate molecules A and B come in contact with the cell membrane of the same cell. Molecule A passes through the membrane readily, but molecule B does not. It is most likely
More information2-3 Carbon Compounds 10/22/2013. The Chemistry of Carbon. More Carbon. Chemistry (cont) More Macromolecules. Macromolecules
The Chemistry of Carbon 2-3 Carbon Compounds Because of carbons 4 valence electrons it can form covalent bonds with many other elements (octet rule) 2 Chemistry (cont) Plus, it can bond with itself More
More informationEnhanced microbial lipid production with genetically modified yeast and fungus
Enhanced microbial lipid production with genetically modified yeast and fungus Pacific Rim Summit on Industrial Biotechnology and Bioenergy 2014 Kari Koivuranta, Marilyn Wiebe, Laura Ruohonen and Merja
More informationMany of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called organic chemistry
1 2 3 4 Bio 1101 Lecture 3 Chapter 3: Molecules of Life Organic Molecules Many of the compounds we are concerned with in biology are carbon-based compounds The study of carbon-based compounds is called
More informationCh 2 Molecules of life
Ch 2 Molecules of life Think about (Ch 2, p.2) 1. Water is essential to life. If there is water on a planet, it is possible that life may exist on the planet. 2. Water makes up the largest percentage by
More information2/25/2015. Chapter 6. Carbohydrates. Outline. 6.1 Classes of Carbohydrates. 6.1 Classes of Carbohydrates. 6.1 Classes of Carbohydrates
Lecture Presentation Chapter 6 Carbohydrates Julie Klare Fortis College Smyrna, GA Outline 6.7 Carbohydrates and Blood The simplest carbohydrates are monosaccharides (mono is Greek for one, sakkhari is
More informationHuman Milk Oligosaccharides: Where Do We Go from Here?
Human Milk Oligosaccharides: Where Do We Go from Here? Satelite Symposium Abstracts ESPGHAN 2018 Human Milk Oligosaccharides: Where Do We Go from Here? Dr. Norbert Sprenger Switzerland Physiological Significance:
More informationCarbohydrates. b. What do you notice about the orientation of the OH and H groups in glucose? Are they in the axial or equatorial position?
1. The 3D structure of glucose and galactose are shown. Carbohydrates D-glucose D-galactose a. Is the axial or equatorial position more stable in the chair conformation? b. What do you notice about the
More informationsports nutrition seminar
sports nutrition seminar 08.03.2017 Sports Nutrition Seminar 2017 Blokken 21 DK-3460 Birkerød Inspiration for future product development Together with our suppliers, Alsiano has the pleasure of inviting
More informationLesson Overview. Carbon Compounds. Lesson Overview. 2.3 Carbon Compounds
Lesson Overview 2.3 THINK ABOUT IT In the early 1800s, many chemists called the compounds created by organisms organic, believing they were fundamentally different from compounds in nonliving things. We
More informationThe Cell and Its Chemical Compounds
Cell Theory Cell - The basic unit of structure and function in living things. All of an organism s process or functions are carried out in the cell. Robert Hooke - One of the first people to observe cells
More informationGeneral Biology 1004 Chapter 3 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 3 The Molecules of Life PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Copyright 2004 Pearson
More informationA. Incorrect! No, this is not the description of this type of molecule. B. Incorrect! No, this is not the description of this type of molecule.
Biochemistry - Problem Drill 08: Carbohydrates No. 1 of 10 1. have one aldehyde (-CHO) or one keto (-C=O) group and many hydroxyl (-OH) groups. (A) Amino acids (B) Proteins (C) Nucleic Acids (D) Carbohydrates
More informationBIOCHEMISTRY NOTES Pre AP
BIOCHEMISTRY NOTES Pre AP I. Chemistry study of what are made of and how they (text pages 35 43) A. Atom fundamental unit of matter 1. Subatomic particles: n o = neutron p + = proton e - = electron B.
More informationCarbohydrates are a large group of organic compounds occurring in and including,, and. They contain hydrogen and oxygen in the same ratio as (2:1).
Carbohydrates are a large group of organic compounds occurring in and and including,, and. They contain hydrogen and oxygen in the same ratio as (2:1). Why we study carbohydrates 1) carbohydrates are the
More informationName: Class: Honors Biology Period: Question: What is the molecular formula of this molecule?
Chapter 3: The Chemistry of Organic Molecules Exercise 1 Diversity of Carbon-Based Molecules (3.1) The great variety of organic compounds results from the ability of carbon atoms to bond with four other
More informationQuality control of probiotics, the ESLP initiative
European Scientific League for Probiotics ESLP Quality control of probiotics, the ESLP initiative Warzée Jean-Pol, MD ESLP President PreProPed2016 Ghent, 29th April ESLP European Scientific League for
More informationDisaccharides. Three Important Disaccharides Maltose, Lactose, and Sucrose. The formation of these three common disaccharides are:
DISACCHARIDES Disaccharides Three Important Disaccharides Maltose, Lactose, and Sucrose The formation of these three common disaccharides are: 2 Disaccharides Maltose (Malt Sugar) Maltose is known as malt
More informationChapter 3 Guided Reading Notes Carbon and the Molecular Diversity of Life
AP Biology Name: Block Chapter 3 Guided Reading Notes Carbon and the Molecular Diversity of Life Most of this chapter is new material. We will discuss it all in detail. Section 1 1. Make an electron distribution
More information9.A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic acids
9.A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic acids o o o Food is a good source of one or more of the following: protein,
More informationIntroducKon to Carbohydrates
Carbohidratos IntroducKon to Carbohydrates Carbohydrates (sugars) are abundant in nature: They are high energy biomolecules. They provide structural rigidity for organisms (plants, crustaceans, etc.).
More informationWhat is an atom? An atom is the smallest component of all living and nonliving materials.
What is an atom? An atom is the smallest component of all living and nonliving materials. It is composed of protons (+), neutrons (0), and electrons (-). The Periodic Table Elements are composed of all
More informationSelecting Beneficial Protein Components From all Dairy Animals for Manufacturing Next Generation Infant Formulas FOOD AND NUTRITION
Selecting Beneficial Protein Components From all Dairy Animals for Manufacturing Next Generation Infant Formulas FOOD AND NUTRITION Jared Raynes 14 th September 2017 What is the Problem? Breast milk is
More informationWhy Carbon? What does a carbon atom look like?
Biomolecules Organic Chemistry In the 1800 s it was believed to be impossible to recreate molecules in a lab Thus, the study of organic chemistry was originally the study of molecules in living organisms
More information