The Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
|
|
- Harvey Malone
- 6 years ago
- Views:
Transcription
1 The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D.
2 What can happen to our gene(s) that would cause obesity?
3 Modification via Epigenetic alterations
4
5
6 C
7 C
8
9 Early life determinants of overweight and obesity Obesity Reviews, Monasta et al., 11 (10): , 2010
10 Early life determinants of overweight and obesity Environmental Environmental Environmental Individual Environmental Environmental Environmental Social Social Obesity Reviews, Monasta et al., 11 (10): , 2010
11 Early life determinants of overweight and obesity Environmental Obesity Reviews, Monasta et al., 11 (10): , 2010
12 Epigenetics Epigenetics is an inheritable changes that affects gene expression without DNA base pair sequence changes Examples of epigenetic phenomena - DNA methylation - histone modifications - chromatin remodeling
13
14
15 What your grandparents ate could affect your health For example, when a paternal grandmother experienced drastic changes in food availability as a child, then granddaughters had an increased risk for cardiovascular mortality as an adult
16
17
18
19 Cover, Science, August 15 th, 2014, Vol. 345
20 Do prenatal experiences shape culinary tastes? Pregnant volunteers consumed plain flavored or garlic capsules around 24 weeks of pregnancy Sniffed unlabeled bottles of amniotic fluid and breast milk Volunteers easily sniffed out which came from the garlic consumer
21 Babies born from two groups of volunteers who consumed plain flavored or garlic capsules Videotape images were generated when babies were given garlic milk
22 Other Supporting Evidence (Animal Study) FASEB Journal, 25(7): , 2011
23 Other supporting evidence (animal study) FASEB Journal, 25(7): , 2011 Pregnant Wistar rats standard rat chow Maintained on their respective diets throughout pregnancy and lactation After weaning, offspring were fed either control chow or junk diets for either 3 weeks and for 3 months
24 Conclusions: Mice whose mothers had a junk food diet developed altered development of the central reward system, resulting in increased fat intake and altered response of the reward system to excessive junkfood intake in postnatal life
25 Example of Basic Science Studies of Epigenetics
26 Obesity and Epigenetics of Adipose tissue (USDA ARS Research Program)
27 Large for Gest. Age Normal IUGR
28 LP fed dams and offspring Phenotyes hypertension (Langley-Evans et al, Clin Nutr 1994; 13: ) increased fat deposition and altered feeding behavior (Lucas et al., Br J Nutr 1996; 76: , Bellinger et al., Br J Nutr 2004; 92: , and Bellinger et al., Int J Obes (Lond) 2006; 30: ) impaired glucose homeostasis, dyslipidaemia (Burdge et al., Prostaglandins Leukot Essent Fatty Acids 2008; 78: 73 79) impaired immunity (Calder and Yaqoob, Nutr Res 2000; 20: ) increased susceptibility to oxidative stress (Langley-Evans and Sculley, Mech Ageing Dev 2005; 126: )
29 Intrauterine growth restriction and catch-up growth Maternal under nutrition Normal diet Low birth weight Normal weight Increased propensity for catch up growth Normal growth Sutton et al., Endocrinology 2010;151(4):
30 Maternal under nutrition Epigenetic Programming? Low birth weight High Fat diet Increased propensity for catch up growth
31 Animal model of obesity and epigenetics
32 Experimental Design FO F1 2 wk Gestation Lactation 20% protein 20% protein 20% protein Experimental Diet (12 wks) Normal Energy High Energy 2 wk Gestation Lactation 8 % protein 8 % protein 8 % protein Experimental Diet (12 wks) Normal Energy High Energy
33 2 wk Gestation Lactation 20% protein 20% protein 20% protein Experimental Diet (12 wks) Normal Energy High Energy 2 wk Gestation Lactation 8 % protein 8 % protein 8 % protein Experimental Diet (12 wks) Normal Energy High Energy Adaptive and compensatory programming
34 Body weight (g) Weight (g) 2 wk Gestation Lactation 20% protein 20% protein 20% protein Experimental Diet (12 wks) Normal Energy High Energy 8 % protein 8 % protein 8 % protein Normal Energy High Energy At Birth % 20% LP NE LP HE NP NE NP HE at weaning adipose lean BW
35 How to measure fat tissue changes over time in live animals? Magnetic Resonance Imaging (EchoMRI)
36 2 wk Gestation Lactation 20% protein FO 20% protein 20% protein F1 Experimental Diet (12 wks) Normal Energy High Energy Quantitate fat mass measurement by Echo MRI 2 wk Gestation Lactation 8 % protein 8 % protein 8 % protein Experimental Diet (12 wks) Normal Energy High Energy
37 Low Adipose Tissue Weight and Catch-up Growth 10 fold increase 2.5 fold increase
38 Adipose tissue mass fold increase Adipose tissue mass fold increase LP NE NP NE LP HE NP HE week 0 week 2 week 4 week 6 week 8 week 10 week Claycombe et al., accepted, J Nutr. 2013
39 Effects of prenatal and postnatal diet on imprinted gene expression?
40 Igf2/H19 Locus Insulin-like growth factor 2 (IGF2) was the first imprinted gene identified (Cell, 64: , 1991) IGF2 is a major fetal growth factor (Nature 417: , 2002) Epigenetics is an inheritable changes that affects gene expression without DNA base pair sequence changes (e.g. DNA methylation, histone modifications)
41 IGF-2 mrna Fold increase Effects of LP prenatal and HF postnatal diet on Adipose Tissue IGF2 mrna Expression LPNF NPNF LPHF NPHF Visceral Subcutaneous Claycombe et al., J Nutr. 2013
42
43 IGF2 transcription activation Igf2 DMR2 promter CH 3 CH 3 CH 3 CH 3 CH 3 CH 3 ICR H19 E
44 IGF2 transcription repression Igf2 DMR2 promter CTCF ICR H19 E
45 ICR/ H19 DMR Methylation in Adipose Tissue
46 Dnmt3a mrna Fold increase Effects of LP prenatal and HF postnatal diet on Adipose Tissue Dnmt3a mrna Expression LPNF LPHF NPNF NPHF 0 Visceral Subcutaneous
47 Is there metabolic phenotype associated with catch-up growth?
48 AUC Blood (mg/dl) Effects of LP prenatal and HF postnatal diet on GT LPNF LPHF NPNF NPHF b a.ba a b a a b a,b a,b a a ba min 15 min 30 min 60 min 120 min b ab a a LPNF NPNF LPHF NPHF Claycombe et al., J Nutr. 143(10): , 2013
49 Insulin (pg/ml) Effects of LP prenatal and HF postnatal diet on Plasma Insulin Concentrations Prenatal Postnatal Pre x Post P=0.28 P=0.005 P= LPNF NPNF LPHF NPHF Claycombe et al., J Nutr. 143(10): , 2013
50 Fold Increase Fold Increase Adipose Tissue Mitochondrial Copy Number 2 1 LP-NF NP-NF LP-HF NP-HF ANOVA Pre NS Post p=0.06 Pre x Post NS LP-NF LP-HF a,b NP-NF NP-HF a a,b b Visceral Subcutaneous
51 Effects of LP prenatal and HF postnatal diet on Adipose Tissue IGF2 mrna Expression
52 Adipose Tissue Growth and Regulators Normal Obesity
53 Adipose Tissue Growth and Regulators IGF2 IGF2 Normal Obesity
54 Adipose Tissue Growth and Regulators High Fat Diet + IGF2 IGF2 Normal Obesity
55 Adipose Tissue Growth and Regulators High Fat Diet Exercise + IGF2 IGF2 Normal Obesity
56 Maternal Conditions Developmental Influences of Maternal Diet and Exercise F1 Response High Fat Diet and Obesity Epigenetic Changes Decreased Numbers of Beige Adipocytes and Decreased Energy Utilization Promote Obesity and Insulin Resistance Modulators? Test of Maternal exercise (Human study)
57 Maternal LP Diet Endocrine cross talk Skeletal muscle SDH, SIRT3, mt respiration Adipose tissue IGF2 Brain and BAT UCP-1, PPAR-a Insulin Resistance
58 Other metabolic tissues?
59 Effects of LP prenatal diet on Muscle Metabolism and mt Function
60 Claycombe et al., Journal of nutritional biochemistry 26(2): , 2015
61 Effects of LP prenatal diet on Brown adipose tissue function
62 Claycombe et al., Journal of Nutritional Biochemistry 26(7): , 2015
63 Acknowledgment
64 Thank you
Epigenetic processes are fundamental to development because they permit a
Early Life Nutrition and Epigenetic Markers Mark Hanson, PhD Epigenetic processes are fundamental to development because they permit a range of phenotypes to be formed from a genotype. Across many phyla
More informationJAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health Disclosure Why am I interested in epigenetics?
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 JAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health By Laurel Wilson, IBCLC, CLE, CCCE, CLD Author of The Greatest Pregnancy
More informationMetabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
More informationPerinatal Nutrition. Disclosure Statement. Annual Meeting of the NASPGHAN. Keynote Lecture: Nutrients in the Perinatal Environment: Lessons Learned
Annual Meeting of the NASPGHAN Chicago, ILL October 10-13, 2013 Keynote Lecture: Nutrients in the Perinatal Environment: Lessons Learned Allan Walker, M.D. Boston, MA Disclosure Statement Dr. Allan Walker
More informationOHSU Moore Institute for Nutrition & Wellness OHSU School of Medicine. Diane Stadler, PhD, RD Graduate Programs in Human Nutrition
OHSU Moore Institute for Nutrition & Wellness OHSU School of Medicine Diane Stadler, PhD, RD Graduate Programs in Human Nutrition Moore Institute for Nutrition & Wellness There is no question that a nutritious,
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationMaternal and Infant Nutrition Briefs
Maternal and Infant Nutrition Briefs A research-based newsletter prepared by the University of California for professionals interested in maternal and infant nutrition March/April 2003 New Guidelines on
More informationPrenatal alcohol exposure and metabolic disease in adulthood
8 th International Research Conference on Adolescents and Adults with FASD Prenatal alcohol exposure and metabolic disease in adulthood Prof Karen Moritz Director Child Health Research Centre University
More informationEpigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics
Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects
More informationProf C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA
Trans-generational impact of the double burden of malnutrition A case study from India Prof C.S. Yajnik MD,FRCP KEM HOSPITAL, PUNE, INDIA www.kemdiabetes.org Life can only be understood backwards - Soren
More informationEarly Nutrition: the opportunity for childhood obesity prevention
Early Nutrition: the opportunity for childhood obesity prevention Prof. Cristina Campoy Department of Paediatrics. University of Granada. Spain Member of the ESPGHAN Committee on Nutrition HIGH LEVEL GROUP
More information298 Biomed Environ Sci, 2015; 28(4):
298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK
More informationFeeding the Small for Gestational Age Infant. Feeding the Small for Gestational Age Infant
Feeding the Small for Gestational Age Infant Feeding the Small for Gestational Age Infant What s the right strategy? Infants born small-for-gestational age (SGA) are at higher risk for adult diseases.
More informationBREAST MILK COMPONENTS AND POTENTIAL INFLUENCE ON GROWTH
Note: for non-commercial purposes only CAMPUS GROSSHADERN CAMPUS INNENSTADT BREAST MILK COMPONENTS AND POTENTIAL INFLUENCE ON GROWTH Maria Grunewald, Hans Demmelmair, Berthold Koletzko AGENDA Breast Milk
More informationThe Milk of Paradise?: New Research on Maternal Obesity, Breast Milk Quality, and Infant Metabolic Health
The Milk of Paradise?: New Research on Maternal Obesity, Breast Milk Quality, and Infant Metabolic Health Ellen W. Demerath, PhD Associate Professor, Division of Epidemiology and Community Health School
More informationIndia is one of the diabetes capitals of the world and at the same time the capital
Yajnik Undernutrition and Overnutrition During Pregnancy in India: C. S. Yajnik, MD, FRCP India is one of the diabetes capitals of the world and at the same time the capital for low birth weight (LBW)
More informationM. A. Vithayathil 1, J. R. Gugusheff 1, Z. Y. Ong 1,3, S. C. Langley-Evans 4, R. A. Gibson 1,2 and B. S. Muhlhausler 1,2,3*
Vithayathil et al. Nutrition & Metabolism (2018) 15:17 https://doi.org/10.1186/s12986-018-0253-3 RESEARCH Open Access Exposure to maternal cafeteria diets during the suckling period has greater effects
More informationPreface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena?
Preface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena? Types of Studies Principles of Measurement and Observation
More informationColorado Agriscience Curriculum. Unit 3 Anatomy and Physiology Lesson 1 Animal Growth and Development
Colorado Agriscience Curriculum Unit 3 Anatomy and Physiology Lesson 1 Animal Growth and Development Periods of Growth There are two separate stages we are concerned with in animal growth and development.
More informationEarly Origins of Metabolic Disease and Aging
1 Early Origins of Metabolic Disease and Aging Janet C. King, Ph.D. Senior Scientist, Children s Hospital Oakland Research Institute And Professor Emeritus, UC Berkeley & Davis 2 The Maternal Nutrition-Offspring
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationEpigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University
Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University Prenatal & Postnatal Experiences Individual differences in brain
More informationBPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy
BPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy Paloma Alonso-Magdalena Applied Biology Department and CIBERDEM, Miguel Hernández University, Elche, Spain
More informationInstitute of Developmental Sciences and DOHaD Centre. Healthy Cardiovascular Ageing: the life course perspective Mark
Institute of Developmental Sciences and DOHaD Centre Healthy Cardiovascular Ageing: the life course perspective Mark Hanson @MarkHansonUoS 1 Unlike communicable diseases, globally everyone is at risk of
More informationDEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE. Goals
DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE Goals Evolutionary paradox of obesity/diabetes Thrifty gene hypothesis Thrifty phenotype hypothesis Effects of small for gestational age (SGA)
More informationExercise as an intervention to improve metabolic outcomes after intrauterine growth restriction
Am J Physiol Endocrinol Metab 306: E999 E1012, 2014. First published March 11, 2014; doi:10.1152/ajpendo.00456.2013. Exercise as an intervention to improve metabolic outcomes after intrauterine growth
More informationDevelopmental programming in maternal diabetes and obesity
Developmental programming in maternal diabetes and obesity Frans André Van Assche Department of Obstetrics and Gynecology, University Hospital, K. U. Leuven, Herestraat 49, 3000 Leuven, Belgium Corresponding
More informationAN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
More informationDevelopmental origins of type 2 diabetes in children. DCPNS April 16, 1010
Developmental origins of type 2 diabetes in children DCPNS April 16, 1010 Is there an early window of opportunity? Target pre-pregnancy to impact risk of type 2 diabetes for future generations of children
More informationSHASHA ZHENG DISSERTATION. Urbana, Illinois
THE EFFECTS OF MATERNAL NUTRITION ON OFFSPRING GENE REGULATION VIA EPIGENETIC MODULATION BY SHASHA ZHENG DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy
More informationJOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2009, 60, Suppl 3,
JOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2009, 60, Suppl 3, 17-35 www.jpp.krakow.pl P. GUILLOTEAU 1, R. ZABIELSKI 2, H.M. HAMMON 3, C.C. METGES 3 ADVERSE EFFECTS OF NUTRITIONAL PROGRAMMING DURING PRENATAL
More informationThe optimal nutritional balance needed for preventing metabolic syndrome while achieving optimal development for preterm infants
Pediatric Endocrinology In Premature Infants The optimal nutritional balance needed for preventing metabolic syndrome while achieving optimal development for preterm infants Dr. Iris Morag Prof. Orit Hamiel
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationImpact of Maternal Nutrition on Calf Performance
Impact of Maternal Nutrition on Calf Performance Amy Radunz 1 University of Wisconsin-River Falls Introduction Beef cattle production in the United States is currently facing many challenges. The nation
More informationMesenchymal progenitor cells in intramuscular connective tissue development
Mesenchymal progenitor cells in intramuscular connective tissue development Min Du, Ph.D. Professor and Endowed Chair Department of Animal Sciences Washington State University Pullman, WA Beef Quality:
More informationTransgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions
Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions John Milner, Ph.D. Director, USDA Beltsville Human Nutrition Research Center Beltsville, MD 20705 john.milner@ars.usda.gov
More informationOvernutrition During Pregnancy
Kate Schlag, Berkeley School of Public Health Spring 2014 Overnutrition During Pregnancy And Its Link to Childhood Obesity The purpose of this fact sheet is to discuss the mechanisms by which overnutrition
More informationDoes PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model
Does PAE Cause Metabolic Syndrome? (Non-)Evidence from a Mouse Model Susan M. Smith Nutrition Research Institute University of North Carolina at Chapel Hill C57Bl/6J Teklad 8626 Mouse Model of PAE Our
More informationBIOLOGICAL D E T E R M I N AN T S O F H E AL T H ( )
BIOLOGICAL D E T E R M I N AN T S O F H E AL T H ( 3. 1. 5 ) BIOLOGICAL Body weight Blood pressure Birth weight Impaired glucose regulation Genetics Blood Cholesterol BODY WEIGHT The body weight of an
More informationACCEPTED VERSION. Cambridge University Press and the International Society for Developmental Origins of Health and Disease 2013
ACCEPTED VERSION J. R. Gugusheff, M. Vithayathil, Z. Y. Ong and B. S. Muhlhausler The effects of prenatal exposure to a 'junk food' diet on offspring food preferences and fat deposition can be mitigated
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationControversies in Neonatal Hypoglycemia PAC / LAC CONFERENCE, JUNE 1 ST 2017
Controversies in Neonatal Hypoglycemia PRIYA JEGATHEESAN, MD PAC / LAC CONFERENCE, JUNE 1 ST 2017 Disclosure I have no conflicts of interest to disclose Objectives Review Recommendations from different
More informationExposures and Heritable Health Effects
Exposures and Heritable Health Effects Thaddeus T. Schug Population Health Branch National Institute of Environmental Health Sciences November 30, 2017 Outline Developmental exposures and health effects
More informationRole of vitamin D and folate towards the genetic potential in early life and adult phenotypes
Role of vitamin D and folate towards the genetic potential in early life and adult phenotypes Emeritus Professor Khor Geok Lin Universiti Putra Malaysia Jakarta 13 th November, 2016 The author declares
More informationLike mother, like offspring Does maternal overweight predict health outcomes?
Like mother, like offspring Does maternal overweight predict health outcomes? Patricia Iozzo, MD, PhD Institute of Clinical Physiology National Research Council (CNR), Pisa, Italy Brussels 16 October 2017
More informationBy: Dr. Doaa Khater Yassin, MM and M.D Paed Sr. specialist of Pediatrics SQUH
By: Dr. Doaa Khater Yassin, MM and M.D Paed Sr. specialist of Pediatrics SQUH Born SGA with birth weight of 2.4 kg, had IUGR Hospitalized at the age of 2 month with severe dehydration Diagnosed as DKA
More informationUndernutrition during conception and gestation: Increased risk for the next generation
Undernutrition during conception and gestation: Increased risk for the next generation Reinoud J.B.J. Gemke VU University Medical Center Amsterdam www.abcd-study.nl Genetic disorders One gene => one phenotype
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationFemale offspring born to obese and insulin resistant dams are not at increased risk for obesity and metabolic dysfunction during early development
Female offspring born to obese and insulin resistant dams are not at increased risk for obesity and metabolic dysfunction during early development Journal: Manuscript ID cjpp-217-371.r2 Manuscript Type:
More informationFolic Acid and Protein Content in Maternal Diet and Postnatal High-Fat Feeding Affect the Tissue Levels of Iron, Zinc, and Copper in the Rat
Biol Trace Elem Res (2011) 144:885 893 DOI 10.1007/s12011-011-9048-3 Folic Acid and Protein Content in Maternal Diet and Postnatal High-Fat Feeding Affect the Tissue Levels of Iron, Zinc, and Copper in
More informationEarly life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem
More informationReview Article Current Thoughts on Maternal Nutrition and Fetal Programming of the Metabolic Syndrome
Journal of Pregnancy Volume 2013, Article ID 368461, 13 pages http://dx.doi.org/10.1155/2013/368461 Review Article Current Thoughts on Maternal Nutrition and Fetal Programming of the Metabolic Syndrome
More informationUniversity of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationGestational Diabetes: Long Term Metabolic Consequences. Outline 5/27/2014
Gestational Diabetes: Long Term Metabolic Consequences Gladys (Sandy) Ramos, MD Associate Clinical Professor Maternal Fetal Medicine Outline Population rates of obesity and T2DM Obesity and metabolic syndrome
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationLife-Span Development Thirteenth Edition
Life-Span Development Thirteenth Edition Natural Selection and Adaptive Behavior Natural Selection: an evolutionary process by which those individuals of a species that are best adapted are the ones that
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationTiming and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood
Note: for non-commercial purposes only Timing and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood Anita Hokken-Koelega Professor of Pediatric Endocrinology
More informationSupplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
More informationEffects of perinatal exposure to BPA on obesity and metabolic disease later in life
Effects of perinatal exposure to BPA on obesity and metabolic disease later in life Beverly S. Rubin, PhD, Tufts University School of Medicine, Boston MA 02111 Institute of Medicine Roundtable: The Interplay
More informationKing s Research Portal
King s Research Portal DOI: 10.2217/epi-2016-0131 Document Version Peer reviewed version Link to publication record in King's Research Portal Citation for published version (APA): Cecil, C., Walton, E.,
More informationDisclosure. Michael K. Georgieff, MD Research Support: Mead Johnson Nutrition Brain Iron Deficiency
Disclosure In accordance with the Accreditation Council for Continuing Medical Education Standards, parallel documents from other accrediting bodies, and Annenberg Center for Health Sciences policy, the
More informationNutrition & Diabetes. Marina Kjaergaard 1,2, Cecilia Nilsson 3, Mette Olaf Nielsen 2,KevinGrove 1,4 and Kirsten Raun 1. Abstract
Kjaergaard et al. (2018) 8:44 DOI 10.1038/s41387-018-0051-z Nutrition & Diabetes ARTICLE Hypothalamic oxidative stress and inflammation, and peripheral glucose homeostasis in Sprague-Dawley rat offspring
More informationFrederick vom Saal Division of Biological Sciences University of Missouri-Columbia, USA
INTERNATIONAL SEMINARS ON PLANETARY EMERGENCIES 49th Session SCIENCE FOR PEACE THE WORLD OVER (THE NEW MANHATTAN PROJECT) Erice 20-23 August 2016 SESSION 8: CHILDREN WELFARE DISRUPTION OF DEVELOPMENT BY
More informationR. Leibel Naomi Berrie Diabetes Center 19 March 2010
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52
More informationPerinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study
Perinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study Elizabeth Elliott for the Triple B Research Consortium NSW, Australia: Peter Fransquet,
More informationProfessor Joseph HADDAD Pediatric Department Saint George Univ Hosp Balamand Univ Beirut Lebanon
Nutrition & Growth in Premature Infant Professor Joseph HADDAD Pediatric Department Saint George Univ Hosp Balamand Univ Beirut Lebanon PART ONE : THE GROWTH OF THE PREMATURE INFANT ARE WE ON THE RIGHT
More informationMETABOLIC SYNDROME IN REPRODUCTIVE FEMALES
METABOLIC SYNDROME IN REPRODUCTIVE FEMALES John J. Orris, D.O., M.B.A Division Head, Reproductive Endocrinology & Infertility, Main Line Health System Associate Professor, Drexel University College of
More informationREVIEWS. Intrauterine Growth Restriction: Hungry for an Answer
PHYSIOLOGY 31: 131 146, 2016. Published February 17, 2016; doi:10.1152/physiol.00033.2015 Intrauterine Growth Restriction: Hungry for an Answer Intrauterine growth restriction (IUGR) has been defined in
More informationTHE FIRST NINE MONTHS AND CHILDHOOD OBESITY. Deborah A Lawlor MRC Integrative Epidemiology Unit
THE FIRST NINE MONTHS AND CHILDHOOD OBESITY Deborah A Lawlor MRC Integrative Epidemiology Unit d.a.lawlor@bristol.ac.uk Sample size (N of children)
More informationObesity in Children. JC Opperman
Obesity in Children JC Opperman Definition The child too heavy for height or length Obvious on inspection 10 to 20% over desirable weight = overweight More than 20% = obese Use percentile charts for the
More information5/16/2014. Why is the fetal stage so important for beef cattle? Can Cow Nutrition Affect Performance, Quality and Palatability of Its Calf?
Why is the fetal stage so important for beef cattle? Can Cow Nutrition Affect Performance, Quality and Palatability of Its Calf? Min Du Professor Department of Animal Sciences Washington State University
More informationProblems in PCOS pregnancy
Problems in PCOS pregnancy Miscarriage Admission to NICU Cesarean Section Preeclampsia Mother Prematurity Preterm labour PIH Perinatal mortality Gestational Diabetes Problems with PCOS Pregnancy Problems
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationMaternal malnutrition programmes a prediabetic phenotype in the progeny
Note: for non-commercial purposes only Maternal malnutrition programmes a prediabetic phenotype in the progeny Brigitte Reusens Institut des Sciences de la vie, Université catholique de Louvain, Louvain-la-Neuve,
More informationNEONATAL HYPOGLYCEMIA HEATHER MCKNIGHT-MENCI, MSN, CRNP CHILDREN S HOSPITAL OF PHILADELPHIA
NEONATAL HYPOGLYCEMIA HEATHER MCKNIGHT-MENCI, MSN, CRNP CHILDREN S HOSPITAL OF PHILADELPHIA WHAT IS NEONATAL HYPOGLYCEMIA? Glucose concentration low enough to cause signs and symptoms of impaired brain
More informationPrematurity: Optimizing Growth in the NICU for Later Metabolic Outcomes
Prematurity: Optimizing Growth in the NICU for Later Metabolic Outcomes Malki Miller MS, RD, CNSC Neonatal Dietitian, Maimonides Infants and Children s Hospital Adjunct Lecturer of Human and Pediatric,
More informationDevelopmental Origins of Health and Disease
Developmental Origins of Health and Disease Roles of Maternal Nutrition Matthew W. Gillman, MD, SM Harvard University Thanks to Faculty, Trainees, & Staff Obesity Prevention Program Department of Population
More informationEarly Life Nutrition: Feeding Preterm Babies for Lifelong Health
Early Life Nutrition: Feeding Preterm Babies for Lifelong Health Jane Alsweiler Frank Bloomfield Anna Tottman Barbara Cormack Tanith Alexander Jane Harding Feeding Preterm Babies for Lifelong Health Why
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationMethod of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice
Am J Physiol Regul Integr Comp Physiol 284: R87 R100, 2003; 10.1152/ajpregu.00431.2002. Method of leptin dosing, strain, and group housing influence leptin sensitivity in high-fat-fed weanling mice HEATHER
More informationYiying Zhang, PhD Research Scientist. Research Summary:
Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,
More informationEarly Diet = Lifelong Health for Generations
Early Diet = Lifelong Health for Generations Thank you to: The Late David JP Barker & Helsinki Epidemiology Group OHSU Pregnancy & Fetal Development Group Center for Developmental Health Knight Cardiovascular
More informationObesity Runs in Families. University of Tennessee, Knoxville; Promoting Healthy Weight Colloquium (Early Childhood) March 25, 2011
Family Influences on the Development of Child Eating Behaviors Tanja V.E. Kral, Ph.D. Assistant Professor of Nutrition University of Pennsylvania U.S. Childhood Obesity Trends By school entry, more than
More informationFetal Programming in Meat Production
Fetal Programming in Meat Production Min Du Department of Animal Sciences Washington State University Why is the fetal stage so important for beef cattle? Beef cattle pregnancy lasts for about 9 and half
More information220 SUBJECT INDEX. D Diarrhea and sodium balance, 74 weanling, 161,179,208,212; see also Infection
Subject Index Acid balance, see ph Allergy, food, see also Immunity and beikost, 143-144 and breast milk, 91,143 and formula, 89-90 Antidiuretic hormone, 66 67 Antigens, see also Immunity determinants,
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationBREASTFEEDING TO PREVENT DOUBLE BURDEN OF MALNUTRITION
BREASTFEEDING TO PREVENT DOUBLE BURDEN OF MALNUTRITION Sirinuch Chomtho Department of Pediatrics, Chulalongkorn University, Bangkok, Thailand The double burden of malnutrition means under- and over-nutrition
More informationFAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationDetermining the critical window of influence of PCB perinatally on behavioral and hormonal development in Sprague-Dawley rat pups
Bowling Green State University ScholarWorks@BGSU Honors Projects Honors College Fall 12-15-2014 Determining the critical window of influence of PCB perinatally on behavioral and hormonal development in
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationCarlo Agostoni Fondazione IRCCS Department of Maternal and Pediatric Sciences University of Milan, Italy
Carlo Agostoni Fondazione IRCCS Department of Maternal and Pediatric Sciences University of Milan, Italy Energy Protein Fat quality docosahexaenoic acid Micronutrients Vitamin D Dieting during lactation?
More informationSAB Report to the Board of the Glass Packaging Institute
SAB Report to the Board of the Glass Packaging Institute A Brief Overview of Significant Studies on BPA During 2013 November, 2013 Glass is ENDLESSLY Recyclable Introduction Number and diversity of studies
More information