a b c Physical appearance of mice Lean mass Adipocyte size d e f

Size: px

Start display at page:

Download "a b c Physical appearance of mice Lean mass Adipocyte size d e f"

Ada Hampton
5 years ago
Views:

LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD

## 5 d e f 7 6 5 4 3 4 AUC glucose AUC insulin Hepatic fat accumulation ## 8 ### ## 6 4 Figure S.

physical appearance of animals (a) and lean mass (b).

1 LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte size (mm) a b c Physical appearance of mice Lean mass Adipocyte size 5 Yadav et al, Figure S 5 ## 5 d e f AUC glucose AUC insulin Hepatic fat accumulation ## 8 ### ## 6 4 Figure S. VSL#3 treatment reduced adipocyte size (c), area under curve (AUC) during GTT (d) and ITT (e) and hepatic fat accumulation (f) without any change in physical appearance of animals (a) and lean mass (b). All values presented here are mean and error bars are standard error of means of 8-9 animals in each group Bars indicated with asterisk () are significantly different at the level of: <.5, <. in comparison to LFD, while bars indicated with # are significantly different at the level of # <.5, ## <. and ###<.in comparison HFD group.

Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD

HFD Body weight (gm) Lean mass (gm) Mean adipocyte size (mm) a b c Body weight Lean mass Adipocyte size 45 45 43 4 4 39 37 35 33 3 9 7 5 Control-LFD VSL#3-LFD Control-HFD VSL#3-HFD 3 4 5 6 7 8 9 Time

2 Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Area Under Curve (GTT) Area Under Curve (ITT) Liver weight (gm) Liver TG content (% ) Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Control - LFD VSL#3 - LFD Control - HFD VSL#3 - HFD Body weight (gm) Lean mass (gm) Mean adipocyte size (mm) a b c Body weight Lean mass Adipocyte size Control-LFD VSL#3-LFD Control-HFD VSL#3-HFD Time (weeks) Yadav et al, Figure S d e f g AUCglcuose AUCinsulin Liver weight Hepatic TG content Figure S. Oral administration of VSL#3 significantly reduced body weight (a), adipocyte size (c), area under curve (AUC) during GTT (d) and ITT (e), liver weight (f) and hepatic TG content (g), with no change in lean mass (b). All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <..

mrna expression (fold change) mrna expression (fold change) Yadav et al,

mrna expression of Agrp, Npy and Pomc in hypothalamus of VSL#3

Data shows significant reduction of Agrp and Npy, whilst Pomcs was

3 mrna expression (fold change) mrna expression (fold change) Yadav et al, Figure S3 a b Gene expression in hypothalamus Figure S3. mrna expression of Agrp, Npy and Pomc in hypothalamus of VSL#3 administered diet induced obese (a) and Lepob/ob (b) mice. Data shows significant reduction of Agrp and Npy, whilst Pomcs was dramatically increased in hypothalamus of VSL#3 treated mice, in both models. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <..

4 VSL#3 treated Control Weight (gm) Yadav et al, Figure S4 a 5 Organ Weights 4 3 ns Control-ob/ob VSL#3 treated-ob/ob b ns ns ns ewat rwat scwat BAT qmuscle Stomach Liver Pancreas Spleen Body fat WAT BAT Muscle Stomach Small Intestine Large Intestine Figure S4. a). VSL#3 treated Lepob/ob mice significantly reduced fat depot weights, stomach and liver weight (a) in comparison to control Lepob/ob mice. b). Body fat appearance, adipocyte morphology in white adipose tissue (WAT) and brown adipose tissue (BAT), fat accumulation ins muscle tissue was significantly decreased in VSL#3 treated Lepob/ob mice without significant change in stomuch, small and large intestine morphology, as compared to control group. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <..

Control ob/ob VSL#3 treated ob/ob Control ob/ob VSL#3 treated ob/ob Control ob/ob Lean mass (gm) Area Under Curve (GTT) VSL#3 treated ob/ob Control ob/ob VSL#3 treated ob/ob Area Under

Area under curve (AUC) during GTT (b) and ITT (c), and hepatic triglyceride content were significantly decreased in VSL#3 treated Lepob/ob mice compared to their control littermates fed

5 Control ob/ob VSL#3 treated ob/ob Control ob/ob VSL#3 treated ob/ob Control ob/ob Lean mass (gm) Area Under Curve (GTT) VSL#3 treated ob/ob Control ob/ob VSL#3 treated ob/ob Area Under Curve (ITT) Liver TG content (%) Yadav et al, Figure S5 a b c d Figure S5. a-d). Area under curve (AUC) during GTT (b) and ITT (c), and hepatic triglyceride content were significantly decreased in VSL#3 treated Lepob/ob mice compared to their control littermates fed with PBS only. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <.. : Nonsignificant, GTT: Glucose tolerance test, ITT: Insulin tolerance test

6 Serum hormone levels (g/ml) Yadav et al, Figure S6 a b c LFD HFD HFD + VSL# Control-LFD VSL#3-LFD Control-HFD VSL#3-HFD Control-ob/ob VSL#3 treated-ob/ob Ghrelin PYY Amylin GIP PP Ghrelin PYY Amylin GIP PP Ghrelin PYY Amylin GIP PP Figure S6. a). VSL#3 treatment does n exhibited any effects on serum levels of amylin, gastric inhibitory polypeptide (GIP) and pancreatic polypeptide (PP) in HFD-fed mice. b,c). During weight loss study VSL#3 significantly reduced ghrelin levels, and increased GLP- and PYY (b), with no effects on amylin, GIP and PP (c). d,e). In addition, serum levels of ghrelin was significantly reduced, whilst GLP- levels were dramatically increased (d), with no change in amylin, GIP and PP levels in VSL#3 treated Lepob/ob mice in comparison to conrol ob/ob mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <.. : Non-significant

7 Bacterial abundance (%) Bacterial abundance (%) a b c Cecum LFD 5 Small intestine (free) Small intestine (adhered) HFD HFD + VSL# Yadav et al, Figure S d Large intestine (free) e Large intestine (adhered) Figure S7. a-e). Oral administration of VSL#3 significantly increased bacteriodetes and bifidobacteria abundance, while decresed firmicutes abundance in ceum (a), flush of small intestine (b), small intestine scrap (c), flushed large intestine (d) and scrape of large intestine (e) of HFDfed mice in compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <.. : Non-significant

8 Bacterial abundance (%) Bacterial abundance (%) a b c Yadav et al, Figure S8 8 Fecal 5 5 Cecum Small intestine (free) Control-LFD 8 VSL#3-LFD 6 Control-HFD VSL#3-HFD 5 d e f 6 Small intestine (adhered) Large intestine (free) Large intestine (adhered) Figure S8. a-f). VSL#3 feeding significantly increased bacteriodetes and bifidobacteria abundance, while decreased firmicutes abundance in feces (a) cecum (b), flush of small intestine (c), small intestine scrap (d), flushed large intestine (e) and scrape of large intestine (f) of both LFD and HFD-fed mice in compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <.. : Non-significant

9 Bacterial abundance (%) Bacterial abundance (%) a b c Fecal Cecum Small intestine (free) Control-ob/ob 8 VSL#3 treated -ob/ob Yadav et al, Figure S9 d e f 5 Small intestine (adhered) Large intestine (free) Large intestine (adhered) Figure S9. a-f). Bacteriodetes, lactobacilli and bifidobacteria abundance was significantly increased, while firmicutes were decreased in cecum (a), flush of small intestine (b), small intestine scrap (c), flushed large intestine (d) and scrape of large intestine (e) of VSL#3 treated Lep ob/ob mice compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <..

mrna expression (fold change) mrna expression (fold change) a b c d Pcsk Slca Slc5a4 Slca5 Yadav et al, Figure S e f g Glpr Ffar Ffar LFD HFD HFD + VSL#3 Figure S. a-g).

carrier family member 5 (Slca5) (d), GLP- receptor (Glpr) (e) and free fatty acid receptor and (Ffar and Ffar) (f,g) were not affected by VSL#3 treatement in different parts of

10 mrna expression (fold change) mrna expression (fold change) a b c d Pcsk Slca Slc5a4 Slca5 Yadav et al, Figure S e f g Glpr Ffar Ffar LFD HFD HFD + VSL#3 Figure S. a-g). mrna expression of proprotein convertase (Pcsk) (a), solute family carried (Slca; facilitated glucose transporter) (b), solute carrier family 5 member 4 (Slc5a4), (c) solute carrier family member 5 (Slca5) (d), GLP- receptor (Glpr) (e) and free fatty acid receptor and (Ffar and Ffar) (f,g) were not affected by VSL#3 treatement in different parts of intestine i.e. jejunum, Ileum and colon of HFD-fed mice compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group.

11 mrna expression (fold change) mrna expression (fold change) a b c d e VSL#3-HFD Gcg Pcsk Pcsk Slc5a Slca Control-LFD.8 6 VSL#3-LFD Control-HFD Yadav et al, Figure S f g h i j k Slc5a4 Slca5 Glpr Ffar Ffar Ffar Figure S. a-k). Gene expression of Gcg (proglucagon), proprotein covertase (Pcsk), solute carrier family 5 member (Slc5a) and free fatty acid receptor 3 (Ffar3) was significantly increased, with no change in mrna expression of proprotein convertase (Pcsk), solute family carried (Slca), solute carrier family 5 member 4 (Slc5a4) and solute carrier family member 5 (Slca5), GLP- receptor (Glpr) and free fatty acid receptor and (Ffar and Ffar) upon VSL#3 treatment in different parts of intestine i.e. jejunum, Ileum and colon of both LFD and HFD-fed mice compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <..

12 mrna expression (fold change) mrna expression (fold change) a b c d e f Gcg Pcsk Pcsk Slc5a Slca Slc4a Yadav et al, Figure S Control-ob/ob VSL#3 treated-ob/ob g h i j k Slca5 Glpr Ffar Ffar Ffar Control-ob/ob VSL#3 treated-ob/ob Figure S. a-k). mrna levels of Gcg (proglucagon), proprotein covertase (Pcsk), solute carrier family 5 member (Slc5a) and free fatty acid receptor 3 (Ffar3) were significantly increased, while no change in expression of proprotein convertase (Pcsk), solute family carried (Slca), solute carrier family 5 member 4 (Slc5a4) and solute carrier family member 5 (Slca5), GLP- receptor (Glpr) and free fatty acid receptor and (Ffar and Ffar) upon VSL#3 treatment in different parts of intestine i.e. jejunum, Ileum and colon of both LFD and HFD-fed mice compared to their control mice. All values presented here are mean and error bars are standard error of means of 8-9 animals in each group. Bars indicated with asterisk () are significantly different at the level of: <.5, <., <..

13 Control-LFD VSL#3-LFD Control-HFD VSL#3-HFD Expression of buk (fold change) Yadav et al, Figure S week Figure S3. VSL#3 treatment dramatically increased butyrate producing bacterial population in feces. VSL#3 feeding dramatically increased butyrate producing bacterial population in terms of butyrate kinase (buk) expression in fecal samples. All values presented here are mean and error bars are standard error of means. Bars indicated with asterisk () are significantly different at the level of: <.5, <..

14 Plasma butyrate (%) Yadav et al, Figure S Figure S4. VSL#3 treatment dramatically increased plasma butyrate. Plasma butyrate levels were significantly increased in LFD and HFD mice fed with VSL#3 in comparison to their control treatment groups. All values presented here are mean and error bars are standard error of means. Bars indicated with asterisk () are significantly different at the level of: <.5, <..

15 mrna expression (fold change) Yadav et al, Figure S5 3 Control Butyrate Pcsk Slca Slc5a4 Slca5 Glpr Ffar Ffar Figure S5. Expression of proprotein convertase (Pcsk), solute family carried (Slca), solute carrier family 5 member 4 (Slc5a4) and solute carrier family member 5 (Slca5), GLP- receptor (Glpr) and free fatty acid receptor and (Ffar and Ffar) in butyrate treated NCI-H76 cells as compared to non-treated cell (control). All values presented here are mean and error bars are standard error of means of three independent experiments.

16 Table S. Biochemical effects of VSL#3 treatment during weight reducing study in mice S. No. Measures LFD + VSL#3 LFD- Control HFD- Control HFD + VSL#3. Body weight gain (gm) 4.66± ±.98 a 5.4±.3 a 3.77±.9 b. Energy Intake (Kcal/mice/day).4±..±.3 5.9±.9 a 3.±.4 b 3. Fasting blood glucose (mg/dl) 88.3±.3 88.±.39.±4. a 98.4±.55 b 4. Fed blood glucose (mg/dl).4± ±8. 8.±9..3± Serum insulin (pm) 56.± ±8.5 a 939.3±5.6 a 35.±.5 b 6. Total cholesterol (mg/dl) 58.± ± ± ±4. 7. Triglycerides (mg/dl) 67.3±.7 4.± ±47.3 a.4±4.5 b 8. Free fatty acids (µm) 485.9± ± ±34.3 a 67.7±5.9 b 9. Adiponectin (µg/ml) 7.4±. 4.±3.4.34±. 5.3±.9. Resistin (pg/ml) 74.5± ± ±89.3 a 93.±8.8 b. IL-6 (pg/ml) 8.4±.6 8.9±.4 6.3±.3 a.6±.9 b. MCP- (pg/ml) 78.5±. 67.9±9.6.4±. a 89.5±.4 b 3. PAI- (pg/ml) ± ± ±434.5 a 74.±.4 b 4. TNF-α (pg/ml) 77.6± ±5.4.8±8.43 a 87.5±8.4 b Values present here are mean (n = 9) ± standard error of mean a Values are different in comparison to LFD-control b Values are different in comparison to HFD-control Control: Lepob/ob mice fed with normal chow; VSL#3: Lepob/ob mice fed with normal chow and treated with VSL#3-5 -

17 Table S. Effects of VSL#3 treatment on biochemical measures in Lepob/ob mice S.No. Measures Control VSL#3. Body weight gain (gm) 3.± ±.3. Energy Intake (Kcal/mice/day).9±.7 9.±.9 3. Fasting blood glucose (mg/dl) 99.8±. 63.5±. 4. Fed blood glucose (mg/dl) 49.4±7.8.7±9. 5. Serum insulin (pm) 3.±. 89.3±.5 6. Total cholesterol (mg/dl).±.5 8.3± Triglycerides (mg/dl) 334.4± ± Free fatty acids (µm) 87.± ± Adiponectin (µg/ml) 3.3±4. 9.3±5.. Resistin (pg/ml) 43.± ±.5. IL-6 (pg/ml) 3.±7.3.4±.9. MCP- (pg/ml) 3.4±.5 9.± PAI- (pg/ml) 5.± ± TNF-α (pg/ml) 739.± ±35.9 Values present here are mean (n = 9) ± standard error of mean Values are different in comparison to LFD ## Values are different in comparison to HFD Control: Lepob/ob mice fed with normal chow; VSL#3: Lepob/ob mice fed with normal chow and treated with VSL#3-6 -

18 Table S3: Primer sequences used in this study for gene expression and microbial abundance Gene name Gene symbol Sequence Agouti related Agrp Forward 5 -CTCCGCGTCGCTGTGTAAG-3 peptide Reverse 5 -GAAGCGGCAGTAGCACGTAG-3 Neuropeptide Y Npy Forward 5 -ATGCTAGGTAACAAGCGAATG-3 G Reverse 5 -TGTCGCAGAGCGGAGTAGTAT-3 3 Pro-opiomelanocortin Pomc Forward 5 -ATGCCGAGATTCTGCTACAGT-3 Reverse 5 -CCACACATCTATGGAGGTCTGAA-3 4 Pro-glucagon Gcg Forward 5 -TGAATGAAGACAAACGCCACT-3 Reverse 5 -CCACTGCACAAAATCTTGGGC-3 5 Proprotein convertase Pcsk Forward 5 -TGTACTGCTTTCGCCTTCTTTT-3 type 6 Proprotein convertase type 7 Solute carrier protein 5 member (Sodium/glucose cotransporter) Pcsk Slc5a Reverse 5 -CGCCGCCCATTCATTAACA-3 Forward 5 -GTGTGATGGTTTTTGCGTCTG-3 Reverse 5 -GGGAGCTTTCGGACTCCAA-3 Forward 5 -CACCGAGGGCTGACTCATTC-3 Reverse 5 -TGATCCGTACACCAGTACCAC-3 8 Solute carrier protein member Slca Forward 5 -GCAGTTCGGCTATAACACTGG-3 Reverse 5 -GCGGTGGTTCCATGTTTGATTG-3 9 Solute carrier protein 5 member 4 Slc5a4 Forward 5 -GGCTTGGCATCCGTGATTTAC-3 Reverse 5 -CAAACGCGAATACCATGAGGA-3 Solute carrier protein member 5 Slca5 Forward 5 -TTCCAATATGGGTACAACGTAGC-3 Reverse 5 -GCGTCAAGGTGAAGGACTCAA-3 GLP- receptor Glpr Forward 5 -ACGGTGTCCCTCTCAGAGAC-3 Reverse 5 -ATCAAAGGTCCGGTTGCAGAA-3 Free fatty acid receptor type Ffar Forward 5 -CCTTCGCTCTCTATGTATCTGCC-3 Reverse 5 -CGCAGTTTAGCGTGGGACA-3 3 Free fatty acid receptor type Ffar Forward 5 -ATCCTCCTGCTTAATCTGACCC-3 Reverse 5 -CGCACACGATCTTTGGTAGGT-3 4 Free fatty acid receptor type 3 Ffar3 Forward 5 -CTTCTTTCTTGGCAATTACTGGC-3 Reverse 5 -CCGAAATGGTCAGGTTTAGCAA-3 5 Bacteriodetes Bac Forward 5 -GAAGGTCCCCCACATTG-3 Reverse 5 -CAATCGGAGTTCTTCGTG-3 6 Firmicutes Firm Forward 5 -GGAGYATGTGGTTTAATTCGAAGCA-3 Reverse 5 -AGCTGACGACAACCATGCAC-3 7 Lactobacilli Lac Forward 5 -AGCAGTAGGGAATCTTCCA-3 Reverse 5 -CACCGCTACACATGGAG-3 8 Bifidobacteria Bifid Forward 5 -GCGTGCTTAACACATGCAAGTC-3 Reverse 5 -CACCCGTTTCCAGGAGCTATT-3 9 Universal Univ Forward 5 -TCCTACGGGAGGCAGCAGT-3 Reverse 5 -GACTACCAGGGTATCTAATCCTGTT-3 Ref - 7 -

19 Table S4: Primer sequences used for buk gene expression Primer Sequences Ref Buk-5F CCATGCATTAAATCAAAAAGC Buk-5F CCATGCGTTAAACCAAAAAGC Buk-6R AGTACCTCCACCCATGTG Buk-6R AATACCTCCGCCCATATG Buk-6R3 AATACCGCCRCCCATATG Total-F GCAGGCCTAACACATGCAAGTC Total-R CTGCTGCCTCCCGTAGGAGT. United States Patent, Patent No. US B, Inventor : Xiangyang Zhu,

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous