HepaRG LX2. HepaRG HepaRG LX2 LX2
|
|
- Joel Hoover
- 5 years ago
- Views:
Transcription
1 C Supporting Figure 1. Experimental design of s between and cells. (A) -hepatocytes were isolated from a 30 days of -progenitors. Differentiation into mature hepatocytes was achieved following a 2-weeks DMSO treatment between day 15 and day 30. () Phase contrast microphaphs of hepatocytes (left) and cells (right) after 48 hrs of. (C) -hepatocytes and cells were d alone or side by side using trawell ierts. After 48hrs, total RNA was extracted from and experiments and subjected to a microarray analysis. CM was simultaneously collected and stored at -80 C.
2 signature: 1% highly expressed genes in (n=163 genes) nb of genes 1% highly expressed genes (n=163) hits P<0.01 DL rat model Sham relative expression signature: genes related to the traformation of quiescent stellate cells into myofibroblasts (n= 97 genes) P<0.05 hits High expression in Low Supporting Figure 2. Validation of as a model of human activated hepatic stellate cells (HSC) by genomic analysis. (A) Distribution of gene expression in. cells were profiled using pangenomic microarrays and genes were ranked based on their relative expression. Genes ranked in the top 1% of highly expressed genes in all experiments (n=3) were further selected (163 genes) and submitted to Ingenuity Pathway Analysis (IPA). The top canonical pathway identified by IPA was related to hepatic fibrosis and HSC activation (P<0.0001) and the top gene network included wellknown genes involved in inflammation, ECM remodeling, HSC activation, and fibrosis (e.g. ACTG2, COL1A1, CXCL12 (SDF1), FGF2, IL1, MMP1, MMP2, PDGFR). () Gene set enrichment analysis (GSEA). Upper panel: GSEA demotrated that the 163 genes highly expressed in were significantly enriched in the hepatic gene profiles established in rats submitted to bile duct ligation (DL), a model of hepatic fibrosis [1]. Lower panel: GSEA demotrated that the genes which sign the traformation of quiescent HSC into myofibroblasts [2] were significantly expressed at a high level in cells. [1] Hepatology. (2010), 51(3): [2] J. iol. Chem. (2006), 281(24):
3 Supporting Figure 3. Cellular and extra-cellular organization of genes included in the / signature. The abundance of an mrna for a protein depicted in red or green was respectively up- or down-regulated in after 48 hrs with cells. Genes were annotated using the official gene symbols (
4 ladder Cancer (Recurrence) MYC targets Invasive reast Cancer R inactivation (fibroblasts) Advanced Gastric Cancer IL6 signaling (fibroblasts) Metastatic stromal cells Acquired therapy resistance (breast) Highly metastatic pancreatic cancer cells Silenced epigenetically (TSA) in pancreatic cancer Supporting Figure 4. Uupervised gene set enrichment analysis in gene expression profiles of and under or condition. Uupervised GSEA was done with the whole C2 collection of curated gene sets from the molecular signatures database (MSigD). Enrichment score was determined after 1,000 permutatio. Relevant gene signatures were retrieved when a significant enrichment (P<0.01) was observed both in and under the condition. Notably, in / s this approach demotrated a specific enrichment of gene signatures associated with a poor prognosis in cancer other than HCC (e.g. breast, pancreas) as well as an association with genes silenced by Trichostatin A (TSA) in pancreatic cancer.
5 P<0.001 HCC (9 months) Moderate dysplasia (3 weeks) CLUSTER 3 CLUSTER 1 Surrounding non-tumor liver (9 months) Severe dysplasia (3 months) CLUSTER 2 Supporting Figure 5. / signature correlates with HCC progression in Myc/Tgfa tragenic mice. (A) Dendrogram overview of and / experiments integrated with 80 cases of HCC derived from 4 tragenic mouse models of HCC (Myc, E2f1, Myc/E2f1 and Myc/Tgfa) [1,2]. Clustering analysis was based on the expression of genes which signed the crosstalk between and ( vs /). Two clusters (1 and 2) were identified. Cluster 2 included / samples and all Myc/Tgfa HCC. This result points out Myc/Tgfa mice as a suitable in vivo model for evaluating the relevance of / signature in HCC oet and progression. () Multidimeional scaling analysis of mouse liver tissues during the course of HCC development in Myc/Tgfa tragenic mice. Gene expression profiles were established previously using liver samples from Myc/Tgfa tragenic mice collected at various time-points ranging from 3 weeks (moderate dysplasia), 3 months (severe dysplasia) and 9 months (HCC) [2]. Here, the samples were clustered by a multidimeional scaling approach using the expression of genes included in the / crosstalk signature. Three main clusters were identified using the first 3 principal components. Cluster 1 included livers with early moderate dysplasia (cyan). Cluster 2 included livers with late severe dysplasia (dark blue) and surrounding non-tumor tissues (green). Of note, we previously demotrated that these two tumor stages exhibited similar gene profiles [2]. Cluster 3 included all fully developed HCC (red). The statistical significance test was based on a null hypothesis that the expression profiles come from the same multivariate Gaussian (normal) unimodal distribution that represents a single cluster. This results demotrate that the / signature was able to discriminate the mouse samples on the basis of HCC progression. [1] Hepatology. (2006), 44(4): [2] Carcinogenesis. (2011), 32(10):
6 Supporting Figure 6. Trichostatin A (TSA) impacts / crosstalk. (A) Expression of AREG and EREG genes in under (white bar) or (black bar) conditio in absence (-TSA) or presence (+TSA) of 500 nm TSA. Shown is relative mrna levels after 48hrs cell (mean±sd; n=3). -induced up-regulation of AREG and EREG was abolished in presence of TSA. () In vitro angiogenesis assay using HUVEC grown on a Geltrex matrix in presence of conditioned medium (CM) derived from the of (-CM) or the of with (/-CM) in absence (upper 2 panels) or presence (lower 2 panels) of 500 nm TSA. After 6hrs, tube formation by HUVEC in wells corresponding to treatment with /-CM was abolished in presence of TSA. Q-RT-PCR analysis demotrated that induction of VEGFA in under condition (black bar) was abolished in presence of TSA. ( P<0.05 ; two-tailed Student s t-test).
7 Supporting Figure 7. Evaluation of / crosstalk specificity and effect of long term conditio on IL6, IL8, VEGFA and MMP9 gene expression. (A) Comparison of IL6 (left panel) and IL8 (right panel) mrna levels detected by Q-RT-PCR in 3 hepatoma cell lines (, Huh7, HepG2) and 1 non-hepatocyte cell line (HuG, biliary cells) [1] after 48 hrs of (white bar) or with (black bar) (mean+/-sd; n=3). Up-regulation of IL6 under condition, as seen in, was not observed for the other cell lines. Surprisingly, IL6 was even found to be repressed in Huh7 d with. In contrast, the up-regulation of IL8 under condition with was observed for all hepatoma cell lines. () Evaluation of / crosstalk after 8 days of (white bar) or (black bar) (mean+/-sd; n=3). Left panel: Q-RT-PCR analysis of IL6 and IL8 in. Up-regulation of both genes under condition was maintained. Right panel: Q-RT-PCR analysis of VEFGA and MMP9 in. VEGFA up-regulation under condition was maintained after 8 days. ( P<0.05 ; two-tailed Student s t-test). [1] J. Hepatol. (1997), 26(6):
8 KEGG_HEDGEHOG_SIGNALING_PATHWAY Enrichment Score P=0.43 / IOCARTA_SHH_PATHWAY Enrichment Score P=0.41 / C Enrichment Score KEGG_HEDGEHOG_SIGNALING_PATHWAY P=0.62 / Enrichment Score IOCARTA_SHH_PATHWAY P=0.34 / Supporting Figure 8. The Hedgehog pathway in / crosstalk. (A) Expression of specific genes from the Hedgehog signaling pathway in and under (white bar) or (black bar) conditio. Shown is relative mrna levels (mean±sd; n=3). No difference was observed between and condition (P>0.05). () and (C) Uupervised analysis of the Hedgehog pathway by GSEA using the gene expression profiles of () or (C) under or conditio.
Microarray Analysis and Liver Diseases
Microarray Analysis and Liver Diseases Snorri S. Thorgeirsson M.D., Ph.D. Laboratory of Experimental Carcinogenesis Center for Cancer Research, NCI, NIH Application of Microarrays to Cancer Research Identifying
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationUnderstanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationMolecular mechanisms of Fibrosis: Targets of Therapy. John P Iredale University of Edinburgh, UK
Molecular mechanisms of Fibrosis: Targets of Therapy John P Iredale University of Edinburgh, UK Take home messages: The wound healing MFBs of the liver and the hepatic macrophages are key players in progressive
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationCHAPTER V LOSS OF HISTONE DEACETYLASE 3 INCREASES SUSCEPTIBILITY FOR GENOMIC DAMAGE AND DISEASE DEVELOPMENT. Background and Significance
CHAPTER V LOSS OF HISTONE DEACETYLASE 3 INCREASES SUSCEPTIBILITY FOR GENOMIC DAMAGE AND DISEASE DEVELOPMENT Background and Significance The metabolic syndrome (MetS) is defined in an individual who has
More informationGene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein
Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationMolecular signature for management of hepatocellular carcinoma
Molecular signature for management of hepatocellular carcinoma Yujin Hoshida, MD, PhD Liver Cancer Program, Tisch Cancer Institute Division of Liver Diseases, Department of Medicine Icahn School of Medicine
More informationAnalysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats
Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Summary of Doctoral Thesis Hidenori Yasuda Graduate School of Veterinary
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationSOMATOSTATIN RECEPTORS IN HEPATOCELLULAR CARCINOMA. Marie LEQUOY Saint-Antoine Hospital, Department of Hepatology, Paris, France
SOMATOSTATIN RECEPTORS IN HEPATOCELLULAR CARCINOMA Marie LEQUOY Saint-Antoine Hospital, Department of Hepatology, Paris, France Somatostatin : SST Somatostatin (SST) protein : 2 active forms (alternative
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More information2.28E E AKT/CAT P-3-4:
Supplemental Table 1: IPA network analysis of the microarray data presented in Figure 6 showing the most significant molecular and cellular function classifications along with the respective number of
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationMilk micro-rna information and lactation
Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?
More informationNon-Invasive Assessment of Liver Fibrosis. Patricia Slev, PhD University of Utah Department of Pathology
Non-Invasive Assessment of Liver Fibrosis Patricia Slev, PhD University of Utah Department of Pathology Disclosure Patricia Slev has no relevant financial relationships to disclose. 2 Chronic Liver Disease
More informationBL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationTITLE: TREATMENT OF ENDOCRINE-RESISTANT BREAST CANCER WITH A SMALL MOLECULE C-MYC INHIBITOR
AD Award Number: W81XWH-13-1-0159 TITLE: TREATMENT OF ENDOCRINE-RESISTANT BREAST CANCER WITH A SMALL MOLECULE C-MYC INHIBITOR PRINCIPAL INVESTIGATOR: Qin Feng CONTRACTING ORGANIZATION: Baylor College of
More informationmicrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
More informationImpact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
More informationWHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF
WHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF ctliver@fegato.it Worldwide estimated prevalence of NAFLD distribution of PNPLA3 genotypes 2017-Younussi
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationMacrophage derived Wnt signalling opposes Notch signalling in a Numb mediated manner to specify HPC fate in chronic liver disease in human and mouse.
Macrophage derived Wnt signalling opposes Notch signalling in a Numb mediated manner to specify HPC fate in chronic liver disease in human and mouse. Luke Boulter, Olivier Govaere, Tom G Bird, Sorina Radulescu,
More informationA quick review. The clustering problem: Hierarchical clustering algorithm: Many possible distance metrics K-mean clustering algorithm:
The clustering problem: partition genes into distinct sets with high homogeneity and high separation Hierarchical clustering algorithm: 1. Assign each object to a separate cluster. 2. Regroup the pair
More informationcontributes to reversal of biliary fibrosis by Popov et al.
Supplementary data to MS Macrophage-mediated phagocytosis of apoptotic cholangiocytes contributes to reversal of biliary fibrosis by Popov et al. Supplementary table 1. Primers and probes used in quantitative
More informationThe use of diagnostic FFPE material in cancer epidemiology research
The use of diagnostic FFPE material in cancer epidemiology research Neil O Callaghan Genetic Epidemiology Laboratory Department of Pathology The University of Melbourne www.pedigree.org.au Overview Who
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationNature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationStudy Design to Validate Biomarkers of Therapeutic Response in NASH Due to Cirrhosis
Study Design to Validate Biomarkers of Therapeutic Response in NASH Due to Cirrhosis Detlef Schuppan Institute of Translational Immunology and Research Center for Immune Therapy, University Medical Center
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationRath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationSUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationLung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
More informationIcd 10 code pancreatic cancer
Free, official coding info for 2018 ICD - 10 -CM C25.9 - includes detailed rules, notes, synonyms, ICD -9-CM conversion, index and annotation crosswalks, DRG grouping and. Free, official coding info for
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationIndex. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Abetalipoproteinemia NASH and, 537 Acquired errors of metabolism NASH and, 536 537 Amiodarone steatohepatitis due to, 527 Anticonvulsant mood
More informationSuppression of the Malignant Phenotype of Bladder Cancer Cells Investigations of the Proteome in Relation to Phenotype and Gene Expression
Suppression of the Malignant Phenotype of Bladder Cancer Cells Investigations of the Proteome in Relation to Phenotype and Gene Expression Topics Modulation of Phenotype by Extracellular Matrix. Bioinformatics
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationTitle: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles
Author's response to reviews Title: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles Authors: Julia Tchou (julia.tchou@uphs.upenn.edu) Andrew V Kossenkov (akossenkov@wistar.org)
More informationIn vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell
Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later
More informationOverview of PSC Making the Diagnosis
Overview of PSC Making the Diagnosis Tamar Taddei, MD Assistant Professor of Medicine Yale University School of Medicine Overview Definition Epidemiology Diagnosis Modes of presentation Associated diseases
More informationDuctal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids
Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationGene expression profiling predicts clinical outcome of prostate cancer. Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M.
SUPPLEMENTARY DATA Gene expression profiling predicts clinical outcome of prostate cancer Gennadi V. Glinsky, Anna B. Glinskii, Andrew J. Stephenson, Robert M. Hoffman, William L. Gerald Table of Contents
More informationANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich
ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum
More informationVUmc. VU University Medical Center, Amsterdam, The Netherlands University of Pisa, Pisa, Italy
MicroRNA-21 (mir-21) in pancreatic adenocarcinoma: correlation with clinical outcome and pharmacological aspects underlying its role in the modulation of gemcitabine activity Elisa Giovannetti, Niccola
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationMark D Gorrell Sumaiya Chowdhury, Fiona Keane, Stephen Twigg, Geoff McCaughan
The protease fibroblast activation protein [FAP] as a biomarker and therapeutic target in chronic liver injury Mark D Gorrell Sumaiya Chowdhury, Fiona Keane, Stephen Twigg, Geoff McCaughan A.W. Morrow
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationp53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs
p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs 2013, Katerina I. Leonova et al. Kolmogorov Mikhail Noncoding DNA Mammalian
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationPortal Fibroblasts in Biliary Fibrosis
Curr Pathobiol Rep (2014) 2:185 190 DOI 10.1007/s40139-014-0054-y MYOFIBROBLAST (TATIANA KISSELEVA, SECTION EDITOR) Portal Fibroblasts in Biliary Fibrosis Rebecca G. Wells Published online: 14 September
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationReview on Tumour Doubling Time (DT) To review the studies that measuring the actual tumour doubling time for human cancers.
Review on Tumour Doubling Time (DT) Objective To review the studies that measuring the actual tumour doubling time for human cancers. Methods We searched the Medline database from January 1966 to January
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationAs outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSUPPLEMENTARY INFORMATION
Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0137 TITLE: Computational models of anti-vegf therapies in prostate cancer PRINCIPAL INVESTIGATOR: Mac Gabhann, Dr. Feilim CONTRACTING ORGANIZATION: Johns Hopkins University,
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationchapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.
chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps
More informationMechanisms of hepatic fibrogenesis in chronic liver disease
Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationHepatotoxicity Test by Stem Cell derived Hepatocyte
Tuesday, April 24, 2012 Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches Hepatotoxicity Test by Stem Cell derived Hepatocyte Seiichi Ishida National Institute of Health Sciences
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationExtensive and coordinated transcription of noncoding RNAs within cell cycle promoters
Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationJournal Club Semmler Lorenz
Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to
More informationDOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationPathological Analysis of Small Hepatocellular Carcinoma with Poor Prognosis
Pathological Analysis of Small Hepatocellular Carcinoma with Poor Prognosis Haeryoung Kim, M.D., Ph.D. Department of Pathology Seoul National University Bundang Hospital Small HCC Definition: HCC < 2cm
More informationTopically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals
Topically Applicable Stromal Cell Growth Factors - Encapsulated Cosmeceuticals Stem cells move to injured area, differentiate into neighboring cells, and replace the damaged cells Cell Eons Stem cells
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationNottingham Patterns of liver fibrosis and their clinical significance
Nottingham 2006 Patterns of liver fibrosis and their clinical significance Alastair D Burt Professor of Pathology and Dean of Clinical Medicine University of Newcastle upon Tyne Collapse of reticulin
More informationSupplementary Materials:
Supplementary Materials: Supplemental Figure 1: Profibrotic markers in wt/wt or ex/ex mouse kidneys 42 days post IRI. The levels of fibronectin and αsma were examined by immunostaining in ADAM17 wt/wt
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More information