Evidence for Immunosuppressive Effects of Human Semenogelin, a Major Protein of Seminal Plasma

Transcription

1 FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF St. Marianna Med. J. Original Article Vol. 31, pp. 7382, 2003 FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF Evidence for Immunosuppressive Effects of Human Semenogelin, a Major Protein of Seminal Plasma Tomohiko Matsushita 12, Noboru Suzuki 2, Kaoru Yoshida 1, Miki Yoshiike 1, Teruaki Iwamoto 1, and Tsuyoshi Sakane 2 (Received for Publication: April 21, 2003) Abstract Semenogelin (Sg) is secreted from the seminal vesicle and constitutes a major gel-forming protein in semen. Sg plays an important role for inhibiting sperm motility. Human seminal plasma has immunosuppressive effects on human peripheral blood lymphocytes (PBL). Here, we studied whether human Sg exerted immunosuppressive effects on human lymphocyte functions in vitro. We found that Sg reduced proliferation of PBL induced by phytohaemagglutinin (PHA) and anti-cd3 antibody. Anti- Sg antibody reversed the immunosuppressive effect, indicating that Sg was responsible for the effect. IL-2 secretion and IL- 2 mrna expression in PHA-activated PBL were reduced by Sg. However, Sg had no effect on IL-2 receptor expression of PHA- activated PBL. Immunoglobulin production induced by pokeweed mitogen was inhibited by Sg. Collectively, Sg has suppressive effects on T cell-mediated immune responses and immunoglobulin production. Sg is associated with immunosuppressive effects on sperm in female reproductive tract at fertilization by reducing anti-sperm immune responses. Key Words: Semenogelin, Immunosuppression, Lymphocyte, Interleukin-2, Immunoglobulin. Introduction Human semen transforms into a soft gel-like structure immediately after ejaculation. The soft gel-like structure consists of sperm rich epididymal fluid and proteins secreted by the prostate and seminal vesicles 1 ~ 3 ). Sg is a predominant component of the seminal vesicle derived proteins, constituting more than 50% of total proteins of human semen 4). Sg is consisted of a predominant 52 kda protein, known as Sg I and two forms of less abundant Sg I-related protein with molecular mass of 71 and 76 kda (Sg I I ) 2 ). Sg is digested by prostate specific antigen (PSA), a serine protease secreted from the prostate 1, 5). Sg and its partially digested protein (see Discussion; seminal plasma motility inhibitor, SPMI) have an inhibitory effect on sperm motility. Sg and SPMI may be responsible for the temporary immobilization of sperm in coagulated semen. The temporary immobilization of sperm contributes to 1 Department of Urology, St.Marianna University School of Medicine, Kawasaki, Japan. 2 Departments of Immunology and Medicine, St.Marianna University School of Medicine, Kawasaki, Japan. 35

2 Tomohiko Matsushita et al some extent in preventing the outflow of spermatozoa from the female reproductive tract and subsequent mobilization of sperm during semen liquefaction accompanying complete digestion of Sg and SPMI 6, 7). It has been recognized that human seminal plasma has suppressive effects on lymphocyte functions. The immunosuppressive effects may be responsible for immunological acceptance of allogenic male sperm in the female reproductive tract 8, 9). Prostaglandin 10 ), spermine and spermidine 11, 12), TGF- 13 ) and prostasomes 14 ) h a v e been shown to exert immunosuppressive effects. It has been shown that the major protein secreted from rat seminal vesicle has non-species specific immunosuppressive and anti-inflammatory properties 15, 16). However, the effects of human Sg on human lymphocyte functions have not been fully elucidated. In this study we have studied whether Sg has suppressive effects on lymphocyte proliferation, cytokine production, and immunoglobulin production in humans. We found that Sg indeed had such suppressive activities. Materials and Methods Reagents Phytohaemagglutinin (PHA) and pokeweed mitogen (PWM) were purchased from Funakoshi (Tokyo, Japan). Anti-CD3 monoclonal antibody was from Ortho Clinical Diagnostics (Tokyo, Japan). Purification of Human Sg Semen was provided by healthy volunteers with their informed consent at the office on the Department of Urology, St.Marianna University School of Medicine. Sg was prepared as described 7). Briefly, semen samples were collected in bottles containing 8 M urea in HEPES buffered saline (HSS; 25 mm HEPES, 100 mm NaCl, ph 8.0), and were centrifuged 10,000 g for 15 minutes. After treatment with 25 mm DTT (Sigma Chemical, St. Louis, MO) and 125 mm iodoacetamide (Wako Pure Chemical, Osaka, Japan), the protein solution was loaded on a column of SP- Sepharose Fast Flow (Pharmacia LKB, Uppsala, Sweden). The column was washed with 1 M urea in HSS. Proteins bound to the column were eluted first with 8 M urea in HSS and then a linear gradient of NaCl (0-400 mm) in 8 M urea and HSS. Fractions containing Sg were pooled and loaded on a Vydac (The Separations Group, Hesperia, CA) semipreparative C4 protein column equilibrated in 0.1 % trifluoroacetic acid (TFA). Proteins were eluted with a linear gradient from 25 % to 50 % of 80 % acetonitrile containing 0.1 % TFA. Fractions containing the purified Sg were pooled and lyophilized. Sg preparations contained Sg I and II. Protein concentration was measured by the bicinchoninic acid assay 17) using BSA as a standard. Preparation and Purification of Anti-Human Sg Antibody Polyclonal antibody against human Sg was prepared in the following immunization procedure. Three rabbits were immunized intradermally with 0.1 mg of purified human Sg per body in 1 ml of PBS emulsified with an equal volume of complete Freund's adjuvant in 4 times at an interval of 2 weeks. One week after the last booster injection the antiserum was collected to confirm the reactivity with Sg. After the confirmation of the antigen specificity the blood was collected by cardiac puncture. The antiserum was treated with ammonium sulfate and the IgG fraction was purified from each antiserum by affinity chromatography on a protein A column. Immunoblotting Seminal plasma and purified Sg were run on 12.5% SDS-polyacrylamide gels and electrotransferred to a PVDF membrane (Millipore, Tokyo, Japan). A part of the membrane was stained with Coomassie Brilliant Blue (CBB) R-250 to ascertain equal protein loading. The membranes were preincubated with a solution of skim milk (5% w/v) in Tris-buffered saline (20mM ph 7.8) supplemented with Tween 20 (0.05%; TTBS). Thereafter, the membrane was incubated with the anti-sg antibody (12 /ml, 1 hour, 37 ), followed by incubation with goat anti-rabbit IgG conjugated with alkaline phosphatase (BioRad, CA) at a dilution of 1:3000 in TTBS. Positive immunoreactive bands were detected by BCIP/NBT ( S i g m a ). The control incubation was performed by the antibody preabsorbed with excess purified Sg-I and -II proteins. Preparation of Human Peripheral Blood Lymphocytes (PBL) Human PBL were obtained by Ficoll-Hypaque 36

3 Immunosuppressive effects of semenogelin centrifugation of heparinized blood of healthy volunteers. The PBL were suspended in RPMI 1640 medium containing 10 % FCS, 100 units/ml penicillin, and 100 /ml streptomycin at a concentration of 1 x 10 6 cells/ml. We used this medium throughout the study. Treatment of PBL with Sg Average volume of human semen was about 3 ml, and about 25 mg of Sg was obtained at one ejaculation 18). Therefore, the estimated concentration of Sg in female reproductive tract after coitus was around 10 mg/ml. We examined effects of Sg 10 /ml, 50 /ml, and 100 /ml in the in vitro assays, which corresponded to 1000, 200, and 100 times dilution, respectively, of the estimated concentration of Sg. PBL were pretreated for 2 hours at 37 in the absence (control) or presence of graded amounts of Sg. After preincubation with Sg, PBL were stimulated with mitogens. The Sg introduced into the cell cultures has been kept during whole cell culture periods. Quantitation of Mitogen Induced Proliferation Proliferation of PBL was assessed by 3 H - t h y m i d i n e incorporation technique. The final volume of the assay was 200 l (5 x 10 5 PBL per well). PHA was used at 1 /ml. Anti-CD3 monoclonal antibody was at 100 ng/ml. The cells were incubated for 3 days at 37 in a 5% CO2/95% air incubator, each culture being in triplicates. Six hours before termination of cell culture, 1Ci of 3 H-thymidine (2 Ci/m mole) was added to each well. Cell harvesting, washing, and counting were performed according to conventional procedures. Lymphocyte proliferation induced by mitogens was expressed as cpm of 3 H-thymidine incorporated/5 x 10 5 cells. In some experiments, anti-sg antibody was introduced into the cell culture. Each sample (control, the antibody treated PBL, Sg treated PBL, and the antibody and Sg treated PBL) was preincubated for 2 hours, and was stimulated with PHA. In the preliminary experiments we determined the optimal concentration of the antibody to neutralize Sg; the concentrations of Sg and the antibody in the culture were both 100 /ml. Quantitation of PHA Induced Interleukin-2 (IL-2) Production IL-2 production was measured by commercial ELISA (Biosource International, Camarillo, CA). PBL (1 x 10 6 cells/ml) were pretreated for 2 hours in the absence (control) or presence of Sg, and were stimulated with PHA (1 /ml). Final concentrations of Sg in the culture were 50 and 100 /ml. After 24 hour incubation, the supernatants were harvested. RT-PCR PBL (1 x 10 6 cells/ml in a 24 well plate) were activated for 12 hours with PHA (1 /ml) in the absence or presence of Sg. Total cellular RNA of the cells was isolated by using guanidium thiocyanate buffer for disruption of the cells, followed by centrifugation through cesium chloride gradient. Precipitated RNA was reverse transcribed by the reverse transcriptase 19). -actin primers were used to compare and monitor efficient cdna synthesis between different samples. Sequences of the primers were as follows; -actin (314 bp), sense primer TCCTGTGGCATCCACGAAACT, antisense primer GAAGCATTTGCGGTGGACGAT. IL-2 (441 bp), sense primer AACTCCTGTCTTGCATTGCA, antisense primer GTGTTGAGATGATGCTTTGAC. For all reactions, temperature cycling was as follows; step 1, seconds; step 2, seconds; and step 3, 72 1 minute. These 3 steps were repeated 30 times and followed by the last step: 72 for 10 minutes. Quantitation of PWM Induced IgG Production To induce immunoglobulin production, PBL were cultured with PWM 100 ng/ml for 7 days in the absence or presence of Sg; thereafter culture supernatants were harvested. IgG concentration was measured as described 20). 96-well-microtiter plates (Dynatech, Chanitilly, VA) were coated with goat anti-human IgG antibody and were kept overnight at 4. After blocking with 20 % FCS-PBS of the wells, samples and standards were added to each well and were incubated overnight at 4. After washing, biotin-conjugated anti-human IgG antibody was added. Thereafter streptavidin-alkaline phosphatase and p- nitrophenyl phosphate were used for color development. The absorbance of the samples at 405 nm was determined. 37

4 Tomohiko Matsushita et al Figure 1. Effects of Sg on proliferation of normal PBL. (a) Normal PBL were preincubated with Sg for 2 hours. Thereafter the PBL were stimulated with PHA (1 /ml) for 3 days. The cell culture was conducted in triplicates, and the mean of the triplicate culture was shown. SEM of the triplicate culture never exceeded 10% of the mean, thus was omitted. The results shown are representative of 5 independent experiments with similar results. Medium, incubated in medium. PHA, stimulated with PHA. Sg 100 /ml + PHA, incubated with Sg (100 /ml) for 2 hours before stimulation with PHA. Sg 50 /ml + PHA, treated with Sg (50 /ml) before PHA stimulation. Sg 10 /ml + PHA, treated with Sg (10 /ml) before PHA stimulation. Treatment with Sg of PBL inhibited PHA induced proliferation in a dose dependent manner. (b) Normal PBL were preincubated with Sg for 2 hours. Thereafter the PBL were stimulated with anti- CD3 monoclonal antibody (100 ng/ml) for 3 days. The culture was done in triplicates, and the mean of the triplicate culture was shown. SEM of the triplicate culture never exceeded 10% of the mean, thus was omitted. The results shown are representative of 5 independent experiments with similar results. Medium, incubated in medium. Anti-CD3, stimulated with anti- CD3. Sg 100 /ml + anti-cd3, incubated for 2 hours with Sg (100 /ml) before stimulation with anti-cd3. Sg 50 /ml + anti-cd3, treated with Sg (50 / m l ) before stimulation with anti-cd3. Inhibition of anti- CD3 induced proliferation of PBL was observed in the presence of Sg. (c) Normal PBL were preincubated with Sg for 2 hours. Thereafter the PBL were cultured with PHA (1 /ml) for up to 4 days, and subsequent proliferation was measured at 24 hour interval. The cell culture was conducted in triplicates, and the mean of the triplicate culture was shown. SEM of the triplicate culture never exceeded 10% of the mean, thus was omitted. PHA, stimulated with PHA. Sg + PHA, pretreated for 2 hours with Sg (100 /ml) before stimulation with PHA. Suppression of the PHA induced proliferation was evident at each time point tested. (d) Immunoblotting analysis of seminal plasma and purified Sg with anti-sg antibody. Urea treated seminal plasma was loaded to lane 1, 4, 7, liquefied seminal plasma was loaded to lanes 2, 5, and 8, whereas the purified Sg was applied to lanes 3, 6, and 9. Filled arrowheads indicate Sg II, and an open arrowheads indicates Sg I. Lanes 1, 2, and 3: CBB staining. Lanes 4, 5, and 6: immunostaining by anti-sg antibody. Lanes 7, 8, and 9: immunostaining by anti- Sg antibody pre-incubated with Sg. 38

5 Immunosuppressive effects of semenogelin Flowcytometric Analysis of IL-2 Receptor Expression Two color staining with FITC-anti-CD3 and PE-anti- CD25 (IL-2 receptor) monoclonal antibodies was performed on PBL which had been activated for 12 hours with PHA (1 /ml) in the absence or presence of Sg (100 /ml). The IL-2 receptor expression was analyzed using a flowcytometer (Cytron Absolute; Ortho Clinical Diagnostics). Results Sg Inhibits Mitogen Induced Proliferation of PBL The aim of our study is to clarify whether Sg inhibits human lymphocyte functions. We first focused onto whether Sg inhibited PHA induced proliferation of PBL. Treatment with Sg of PBL inhibited PHA induced proliferation in a dose dependent manner. Potent inhibition was observed at the concentrations of 50 and 100 /ml of Sg (Figure 1a). Inhibition of anti-cd3 induced proliferation of PBL was similarly observed (Figure 1b). Suppression of PHA induced proliferation by the Sg treatment was observed at each time point tested during the whole cell culture period (Figure 1c). This effect was not due to cytotoxicity of the Sg. Because we have determined cell viability by trypan blue exclusion test; the cell viability was not significantly affected by the presence of Sg in the concentrations from 1 to 100 /ml (data not shown). We have developed anti-sg antibody by immunizing rabbits with purified human Sg. This antibody recognized Sg I, II and their degradation products in both seminal plasma and purified Sg fraction (Figure 1d). When the membrane was incubated with the antibody in the presence of Sg (100 /ml), the positive immunoreactive bands disappeared (Figure 1d). We wanted to confirm that the inhibition of proliferation of PBL was mediated by the Sg, but not by other possible contaminants in the Sg preparation. Introduction of anti-sg antibody into the cell culture consisted of PBL, PHA and Sg resulted in reversal of the reduced proliferation (Figure 2). Thus, we concluded that Sg was responsible for the reduced proliferation of PBL. Figure 2. Effect of anti-sg antibody on the proliferation of PHA activated PBL cultured with Sg. Normal PBL were preincubated with Sg (100 /ml) for 2 hours and thereafter the PBL were stimulated with PHA (1 /ml). Anti- Sg antibody was introduced into the cell culture to confirm that Sg was responsible for the inhibition of lymphocyte proliferation. Medium, incubated in medium. Sg (-) Anti-Sg Ab (-) + PHA, stimulated with PHA. Sg (+) Anti-Sg Ab (-) + PHA, treated for 2 hours with Sg (100 /ml) before stimulation with PHA. Sg (-) Anti-Sg Ab (+) + PHA, treated for 2 hours with anti-sg antibody (100 /ml) before PHA stimulation. Sg (+) Anti-Sg Ab (+) + PHA, treated for 2 hours with Sg (100 /ml) and anti-sg antibody (100 /ml) before PHA stimulation. Anti-Sg antibody reversed the reduced proliferation by Sg treatment of PBL, indicating that Sg was responsible for the reduced proliferation. Sg Inhibits IL-2 Protein Production and IL-2 mrna Expression Because Sg inhibits proliferation of human T lymphocytes in vitro, IL-2 production by and IL-2 receptor expression on the T cells, both of which are essential for T cell proliferation, could be affected by the Sg treatment. We studied IL-2 production by PHA activated T cells in the presence of Sg. Sg treatment of PBL suppressed IL-2 secretion at the concentrations of 50 and 100 /ml (Figure 3a). Furthermore, the inhibition of IL-2 protein production occurred at the level of mrna expression. IL-2 mrna expression was clearly suppressed by Sg at the same concentrations (Figure 3b). 39

6 Tomohiko Matsushita et al Figure 3. Effects of Sg on IL-2 secretion and IL-2 mrna expression. (a) Normal PBL were preincubated with Sg for 2 hours and thereafter the PBL were stimulated with PHA (1 /ml) for 24 hours. IL-2 secretion was determined by ELISA. The results shown are representative of 3 independent experiments with similar results. Medium, incubated in medium. PHA, stimulated with PHA. Sg 100 /ml + PHA, treated for 2 hours with Sg (100 /ml) before stimulation with PHA. Sg 50 /ml + PHA, treated with Sg (50 /ml) before PHA stimulation. Sg treatment of PBL suppressed IL-2 secretion. (b) Normal PBL were preincubated with Sg for 2 hours and thereafter the PBL were stimulated with PHA (1 /ml) for 12 hours. IL-2 mrna expression was estimated by RT-PCR. The result shown is a representative of 3 independent experiments with similar results. Medium, incubated in medium. PHA, stimulated with PHA. Sg 100 /ml + PHA, treated for 2 hours with Sg (100 /ml) before stimulation with PHA. Sg 50 /ml + PHA, treated with Sg (50 /ml) before PHA stimulation. IL-2 mrna expression was suppressed by Sg at the concentrations of 50 and 100 /ml. 40

7 Immunosuppressive effects of semenogelin Sg Inhibits in Vitro Ig Production It is interesting to study whether Sg inhibits B cell functions in vitro. We thus analyzed immunoglobulin production by PWM activated PBL. PWM stimulates B cells to produce IgG in the presence of helper T cells. PWM induced IgG production was inhibited by the introduction of Sg into the cell cultures (Figure 4). It was evident that Sg suppressed immunoglobulin production by PBL. Discussion Figure 4. Effect of Sg on IgG production. Normal PBL were preincubated with Sg for 2 hours and thereafter the PBL were cultured with PWM (100 ng/ml) for 7 days. IgG production was determined by ELISA. The result shown is a representative of 3 independent experiments with similar results. Medium, incubated in medium. PWM, stimulated with PWM. Sg 100 /ml + PWM, treated for 2 hours with Sg (100 /ml) before stimulation with PWM. Sg 50 /ml + PWM, treated with Sg (50 /ml) before PWM stimulation. PWM induced IgG production by the PBL was inhibited by Sg. Effects of Sg on IL-2 Receptor Expression We next turned our attention onto IL-2 receptor expression of the Sg treated T lymphocytes. PBL were stimulated with PHA for 12 hours in the presence of Sg. IL- 2 receptor expression on T lymphocytes was assessed by PE-anti-CD25 and FITC-anti-CD3 monoclonal antibodies. PHA stimulation induced IL-2 receptor expression on T cells moderately, and the Sg treatment did not affect the expression. The percentage of IL-2 receptor positive T cells in nonactivated PBL, PHA activated PBL, and PHA activated PBL treated with Sg were %, %, and % (mean + SEM of 4 separate experiments), respectively. Thus, Sg did not affect IL-2 receptor expression of T cells. In this paper, we report that Sg, the major seminal gel-forming protein secreted from human seminal vesicle, possesses immunosuppressive activities on human lymphocytes. We found that Sg had suppressing effects on mitogen induced PBL proliferation, and that the inhibitory effects were not due to cytotoxic activity of the Sg. It has been reported that seminal plasma was cytotoxic when used in lymphocyte cultures 21 ). It is possible that ingredients other than Sg, such as spermine 21), may be responsible for the cytotoxic activity of seminal plasma. We found that Sg reduced cytokine production by T cells and antibody secretion by B cells. Therefore, Sg seems to effect not only on T cell function but also on B cell function. The mechanism of suppression of PBL proliferation by Sg was at least due in part to its inhibitory effect on IL-2 mrna expression and IL-2 production. In contrast IL-2 receptor expression was not affected by the Sg treatment. Sg may block intracellular signal transduction pathway from T cell receptor to promoter region of human IL-2 gene. Sg on the spermatozoa enters the uterus and exerts its biological effects. Sg is digested by the chymotrypsin-like prostatic protease (prostate-specific antigen: PSA) to several smaller fragments after ejaculation. Some of the cleavage products may have various biological functions 5), e.g. an inhibitory activity on sperm motility as seminal plasma motility inhibitor, SPMI 22, 23). It is possible that Sg, its degradation peptides, or both may be a natural factor with immunosuppressive activities on human lymphocytes. Biological significance of the immunosuppressive effects of Sg in the female reproductive tract is not clear at present. The estimated concentration of Sg in the female 41

8 Tomohiko Matsushita et al lower genital tract after coitus is high enough to exert its immunosuppressive effects (see Materials and Methods). In addition, Sg is observed clinging to the surface even on the sperm in the female peritoneum (unpublished observation). There are resident T cells and B cells on the normal female genital mucosa 24) as possible target cells of Sg. Human seminal plasma contains several immunosuppressive molecules, and Kelly et al. reviewed the recent publications; the main active agent in immunosuppressive effects of seminal plasma is prostaglandin E (PGE), and the main effect of PGE may be the stimulation of IL-10 production and the inhibition of IL-12 production 8). Beside the molecules reported so far, it is now evident that Sg exerts direct inhibitory effects on lymphocyte functions. We found that Sg inhibits B cell function as well. It is thus possible that Sg suppresses anti-sperm antibody production. The detection of anti-sperm antibodies is not always associated with impairment of fertility 9 ). Nevertheless, sperm immobilizing anti-sperm antibodies were shown to block fertilization at least in part by inhibiting the acrosomal reaction of human spermatozoa 24). It was reported that intravenous deposition of the immunosuppressive component, isolated from boar seminal vesicle secretion, led to suppression of primary and secondary antibody responses to boar epididymal sperm (not coated with the seminal vesicle secretion) in mice 25). It should be clarified whether Sg inhibits development of sperm immobilizing anti-sperm antibody in humans. Acknowledgement This research was partially supported by grants from Grant-in-Aids for Scientific Research (B), The Ministry of Education, Science and Culture, Japan ( ) to T.I., and the SRF Foundation Grant for Biomedical Research (Tokyo, Japan) to N.S. Reference 1) Lilja, H. A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J. Clin. Invest. 1985; 76: ) Lilja, H. and Laurell, C.B. The predominant protein in human seminal coagulate. Scand. J. Clin. Lab. Invest. 1985;45: ) Lilja, H., Oldbring, J., Rannevik, G. and Laurell, C.B. Seminal vesicle-secreted proteins and their reactions during gelation and liquefaction of human semen. J. Clin. Invest. 1987;80: ) Lilja, H., Laurell, C.B and Jeppsson, J.O. Characterization of the predominant basic protein in human seminal plasma, one cleavage product of the major seminal vesicle protein. Scand. J. Clin. Lab. Invest. 1984;44: ) Robert, M., Gibbs, B.F., Jacobson, E and Gagnon, C. Characterization of prostate-specific antigen proteolytic activity on its major physiological substrate, the sperm motility inhibitor precursor /semenogelin I. Biochemistry. 1997;36: ) Iwamoto, T. and Gagnon, C. A human seminal plasma protein blocks the motility of human spermatozoa. J. Urol. 1988;140: ) Robert, M. and Gagnon, C. Purification and characterization of the active precursor of a human sperm motility inhibitor secreted by the seminal vesicles: identity with semenogelin. Biol. Reprod. 1996; 55: ) Kelly, R.W. and Critchley, H.O. Immunomodulation by human seminal plasma: a benefit for spermatozooa and pathogen? Hum. Reprod. 1997; 12: ) Bates, C.A. Antisperm antibodies and male subfertility. Br. J. Urol. 1997; 80: ) Tarter, T.H., Cunningham-Rundles and S., Koide, S.S. Suppression of natural killer cell activity by human seminal plasma in vitro: identification of 19-OH-PGE as the suppressor factor. J. Immunol. 1986; 136: ) Quan, C.P., Roux, C., Pillot, J and Bouvet, J.P. Delineation between T and B suppressive molecules from human seminal plasma: II. Spermine is the major suppressor of T-lymphocytes in vitro. Am. J. Reprod. Immunol. 1990; 22: ) Evans, C.H., Lee, T.S. and Flugelman, A.A. Spermine-directed immunosuppression of cervical carcinoma cell sensitivity to a majority of 42

9 Immunosuppressive effects of semenogelin lymphokine-activated killer lymphocyte cytotoxicity. Nat. Immun. 1995; 14: ) Nocera, M. and Chu, T.M. Transforming growth factor beta as an immunosuppressive protein in human seminal plasma. Am. J. Reprod. Immunol. 1993; 30: ) Kelly, R.W., Holland, P., Skibinski, G., Harrison, C., McMillan, L., Hargreave and T., James, K. Extracellular organelles (prostasomes) are immunosuppressive components of human semen. Clin. Exp. Immunol. 1991; 86: ) Metafora, S., Porta, R., Ravagnan, G., Peluso, G., Tufano, M.A., De Martino, L., Ianniello, R. and Galdiero, F. Inhibitory effect of SV-IV, a major protein secreted from the rat seminal vesicle epithelium, on phagocytosis and chemotaxis of human polymorphonuclear leukocytes. J. Leukoc. Biol. 1989; 46: ) Galdiero, F., Tufano, M.A., De Martino, L., Capasso, C., Porta, R., Ravagnan, G., Peluso, G. and Metafora, S. Inhibition of macrophage phagocytic activity by SV-IV, a major protein secreted from the rat seminal vesicle epithelium. J Reprod Immunol. 1989; 16: ) Smith, P.K., Krohm, R.I., Hermanson, G.T., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J and Klenk, D.C. Measurement of protein using bicinochoninic acid. Anal. Biochem. 1985; 150: ) Malm, J., Hellman, J., Magnusson, H., Laurell, C.B and Lilja, H. Isolation and characterization of the major gel proteins in human semen, semenogelin I and semenogelin II. Eur. J. Biochem. 1996; 238: ) Kashiwakura, J-I., Suzuki, N., Nagafuchi, H., Takeno, M., Takeba, Y., Shimoyama, Y. and Sakane, T. Txk, a nonreceptor tyrosine kinase of the Tec family, is expressed in T helper type 1 cells and regulates interferon production in human T lymphocytes. J. Exp. Med. 1999; 190: ) Sanbongi, C., Suzuki, N. and Sakane, T. Polyphenols in chocolate, which have antioxidant activity, modulate immune functions in humans in vitro. Cell. Immunol. 1997; 177: ) Fiore, J.R., La Grasta, L., Di Stefano, M., Buccoliero, G., Pastore, G. and Angarano, G. The use of serumfree medium delays, but does not prevent, the cytotoxic effects of seminal plasma in lymphocyte cultures: implications for studies on HIV infection. New Microbiol. 1997; 20: ) Iwamoto, T. and Gagnon, C. Purification and characterization of a sperm motility inhibitor in human seminal plasma. J. Androl. 1988; 9: ) Iwamoto, T., Tsang, A., Luterman, M., Dickson, J., de Lamirande, E., Okuno, M., Mohri. H. and Gagnon, C. Purification and characterization of a sperm motilitydynein ATPase inhibitor from boar seminal plasma. Mol. Reprod. Dev. 1992; 31: ) Crowley-Nowich, P.A, Bell,M., Edwards, R.P., McCallister, D., Gore,H., Kanbour-Shakir, A., Mestecky J., and Partridge, E.E. Normal uterine cervix: characterization of isolated lymphocyte phenotypes and immunoglobulin secretion. Am J Reprod Immunol. 1995; 34: ) Bandoh. R., Yamano, S., Kamada, M., Daitoh, T. and Aono, T. Effect of sperm-immobilizing antibodies on the acrosome reaction of human spermatozoa. Fertil. Steril. 1992; 57: ) Dostal, J., Veselsky, L., Marounek, M., Zelezna, B. and Jonakova, V. Inhibition of bacterial and boar epididymal sperm immunogenicity by boar seminal immunosuppressive component in mice. J. Reprod. Fertil. 1997; 111:

10 Tomohiko Matsushita et al (Sg) PHA Sg OKT-3 Sg S g Sg Sg Sg IL-2 Sg IL-2 mrna IL-2 receptor Sg PWM 1 IgG Sg T B Sg T Sg B Sg