- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)"

Transcription

1 Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of GdA for 48 hours. IL-6 secretion to the culture medium was measured by ELISA (N=8). IL-6 secretion to the culture medium of monocytes and THP-1 cells were measured after LPS activation for different duration (0-6 hours). Data are mean ± SEM. *P<0.05 when compared to corresponding control without GdA treatment. Cell types Monocytes THP-1 cells Macrophages LPS Treatment time (Hour) IL-6 level (pg/ml) ± ± ± ± ± ± ±275.9 GdA (10 μg/ml) ± ± ± ±652.9* ± ± ±185.9* ±719.2* - 1 -

2 Supplementary Table ST2: Effect of GdA on the phagocytic activity of monocytes/macrophages. Monocytes, macrophages and THP-1 cells (2x10 5 ) were incubated in 100 μl of culture medium containing 10 μg/ml GdA in a 96-well plate for 24 hours (N=9). Ten µl of latex beads coated with FITC-labeled rabbit-igg solution was then added. After 24 hours of incubation, trypan blue solution was added to quench the extracellular fluorescence. The intracellular fluorescent intensity of each well was measured with an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The results are expressed as percentage of control without GdA treatment. Relative phagocytic activity = (Fluorescence of GdA-treated cells Fluorescence of blank)/(fluorescence of control cells Fluorescence of blank) x 100%. Data are mean ± SEM. *P<0.05 when compared to corresponding control without GdA treatment. Relative Phagocytic activity (%) GdA Monocytes ± 5.44 THP-1 cells ± 8.97 Macrophages ±

3 Supplementary Figure S1: Analysis of purified GdA in 12% SDS-PAGE with silver staining, western blot and the mass spectrometric analysis. (A) Purified GdA (0.5 μg/ml) was analyzed by silver staining (Lane 1) and western blotting (Lane 2). (B) Identification of GdA by MALDI-TOF-MS/MS of the ~26 kda protein band in Lane 1. The peptide sequence was obtained and searched against Homo sapiens proteins from NCBInr database. The protein sequence had total sequence coverage of 46%. A B Protein Accession no. Protein Peptide Sequence m/z Name Score Glycodelin IPI VHITSLLPTPEDNLEIVLHR DTTTPIQSMMCQYLAR VLVEDDEIMQGFIR AFRPLPR HLWYLLDLK QMEEPCRF

4 Supplementary Figure S2: Purification of blood monocytes and T-helper cell from female peripheral blood. Isolated monocyte and T-helper cells (5x10 5 ) were incubated with FITC-conjugated anti-human CD14 or FITC-conjugated anti-human CD4/APC-conjugated anti-human CD3 antibodies respectively, for 30 minutes on ice followed by the flow cytometric analysis. Isolated monocyte Isolated T-helper cell CD4-FITC CD14-FITC CD3-APC - 4 -

5 Supplementary Figure S3: Effect of GdA on the viability and cell death of monocytes/macrophages. (A) Cell viability was determined by XTT assay on monocytes, macrophages and THP-1 cells (3x10 4 ) after GdA treatment (0.01, 0.1, 1 and 10 μg/ml) for 72 hours (N=5). Freshly prepared XTT labeling mixture (50 μl) was added to the culture 6 hours before the end of the experiment. Data are expressed as percentage of control without GdA treatment = (Absorbance of GdA-treated cells Absorbance of blank) / (Absorbance of control cells Absorbance of blank) x 100%. (B) Viable, necrotic and apoptotic monocytes, THP-1 cells and macrophages (5x10 5 ) after GdA treatment (10 μg/ml) for 72 hours were quantified by bivariate Yo-Pro -1/PI flow cytometry (N=5). Cells negative for both Yo-Pro -1 and PI staining were counted as viable cells. Cells labeled with Yo-Pro -1 only were apoptotic cells, while those with Yo-Pro -1 and propidium iodide were necrotic cells. Data are mean ± SEM. A GdA (μg/ml) Viability (% of control) Monocytes THP-1 cells Macrophages ± ± ± ± ± ± ± ± ± ± ± ± 3.0 B Monocytes Blood monocyte Necrosis: 2.1 ± 1.0% Viable: 91.6 ± 2.5% Apoptosis: 6.3 ± 2.5% GdA (10μg/ml) Necrosis: 1.7 ± 0.9% Viable: 92.8 ± 2.3% Apoptosis: 5.6 ± 2.5% THP-1 cells THP-1 cell Necrosis: 5.3 ± 1.0% Viable: 89.3 ± 1.3% Apoptosis: 5.4 ± 3.1% GdA (10μg/ml) Necrosis: 6.4 ± 1,8% Viable: 87.7 ± 3.2% Apoptosis: 6.0 ± 1.5% GM-CSF-differentiated macrophage Macrophages Necrosis: 7.7 ± 5.3% Viable: 81.8 ± 2.6% Apoptosis: 10.6 ± 3.6% GdA (10μg/ml) Necrosis: 7.6 ± 3.4% Viable: 84.5 ± 1.4% Apoptosis: 7.9 ± 3.9% - 5 -

6 Supplementary Figure S4: Effects of ERK kinase, NF-κB and p38 inhibitors on viability of THP-1 cells. Cell viability was determined by the XTT proliferation assay on THP-1 cells incubated with ERK kinase inhibitors (PD98059: 10 μm; U0126: 1 μm), NF-κB inhibitors (CAPE and BAY-11708: 10 μm) or p38 inhibitors (of SB202190: 5 μm; SB203580: 10 μm) for 48 hours (N=12). Data are expressed as percentage of control without inhibitor treatment. Data are mean ± SEM. Stimulation Index (%) = (Absorbance of inhibitor treated cells Absorbance of blank) / (Absorbance of control cells Absorbance of blank) x 100%

7 Supplementary Figure S5: Expression of L-selectin in monocytes/macrophages. Monocytes, macrophages and THP-1 cells (5x10 5 ) were treated with anti-l-selectin-fitc followed by flow cytometry analysis (N=4)

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Johannes F Fahrmann and W Elaine Hardman *

Johannes F Fahrmann and W Elaine Hardman * Fahrmann and Hardman Lipids in Health and Disease 2013, 12:36 RESEARCH Open Access Omega 3 fatty acids increase the chemo-sensitivity of B-CLL-derived cell lines EHEB and and of B-PLL-derived cell line

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris

Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris Effects of Gelsolin on Macrophage Inflammatory Responses to Implant Wear Debris William Michael Mihalko, MD PhD, Lev Djenderedjian, Paramjeet S. Cheema, Richard A. Smith, PhD. University of Tennessee,

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

IFN-γ Secretion Assay Detection Kit (PE) human

IFN-γ Secretion Assay Detection Kit (PE) human Miltenyi Biotec GmbH Friedrich-Ebert-Straße 68 51429 Bergisch Gladbach, Germany Phone +49 2204 8306-0 Fax +49 2204 85197 macs@miltenyibiotec.de Miltenyi Biotec Inc. 12740 Earhart Avenue Auburn CA 95602,

More information

10/18/2012. A primer in HLA: The who, what, how and why. What?

10/18/2012. A primer in HLA: The who, what, how and why. What? A primer in HLA: The who, what, how and why What? 1 First recognized in mice during 1930 s and 1940 s. Mouse (murine) experiments with tumors Independent observations were made in humans with leukoagglutinating

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Role of the respiratory burst in co-operative reduction in neutrophil survival by influenza A virus and Escherichia coli

Role of the respiratory burst in co-operative reduction in neutrophil survival by influenza A virus and Escherichia coli J. Med. Microbiol. Vol. 51 (22), 484 49 # 22 Society for General Microbiology ISSN 22-2615 MICROBIAL PATHOGENICITY Role of the respiratory burst in co-operative reduction in neutrophil survival by influenza

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Rose et al. Supplementary Material. 1. Supplementary Materials and Methods

Rose et al. Supplementary Material. 1. Supplementary Materials and Methods Rose et al. Supplementary Material 1. Supplementary Materials and Methods 1.1. Synthesis of the biotinylated CrA modules. 1.1.1. Instrumentation and reagents: All solvents were purchased from Carl Roth

More information

International Conference on Biomedical and Biological Engineering (BBE 2016)

International Conference on Biomedical and Biological Engineering (BBE 2016) International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/418/ra27/dc1 Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu,

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

Global Histone H3 Acetylation Assay Kit

Global Histone H3 Acetylation Assay Kit Global Histone H3 Acetylation Assay Kit Catalog Number KA0633 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of rat TNF-alpha concentrations in cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Fig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h.

Fig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h. Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Experiment Cleavage of dinucleotides Dinucleotides (ApA, CpC, GpG, UpU) were purchased from

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures DURACLONE IF earch tria l res lc a om ic il n c n nio pa Yo ur BE CERTAIN ABOUT THE RESPONSE For Research Use Only - Not for use in Diagnostic procedures BE CERTAIN ABOUT THE RESPONSE The sensitive and

More information

Bioactivity Assays: Putting the Puzzle Together

Bioactivity Assays: Putting the Puzzle Together Bioactivity Assays: Putting the Puzzle Together Dr. Ulrike Herbrand Department for Biosafety & Bioassay Services Charles River Biologics Testing Solutions Outline General Remarks MoA reflecting bioassays

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

EPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024

InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024 User Protocol CBA024 Rev. 23 May 2005 RFH Page 1 of 6 InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024 Table of Contents Page Storage 1 Intended Use 1 Background 1 Principle of the Assay 2 Materials

More information

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator

Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Assays for Immuno-oncology Research Real-time automated measurements of immune and tumor cell dynamics within your incubator See what your cells are doing and when they

More information

A novel bfgf antagonist peptide inhibits breast cancer cell growth

A novel bfgf antagonist peptide inhibits breast cancer cell growth 210 A novel bfgf antagonist peptide inhibits breast cancer cell growth QUCHOU LI 1, SUSU GAO 1, YONGLIN YU 1, WENHUI WANG 1, XILEI CHEN 1, RUIXUE WANG 1, TAO LI 1, CONG WANG 1, XIAOKUN LI 1,2 and XIAOPING

More information

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 3 ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of human whole blood with the ezkine Th1/Th17 Whole Blood Intracellular

More information

Supporting Information for:

Supporting Information for: Supporting Information for: Ultrasensitive Fluorescent Probes Reveal an dverse ction of Dipeptide Peptidase IV and Fibroblast ctivation Protein during Proliferation of Cancer Cells Qiuyu Gong,, Wen Shi,

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Apoptosis of lymphocytes in SLE: the level, correlation with dosage prednisolone and lymphocyte phenotypes

Apoptosis of lymphocytes in SLE: the level, correlation with dosage prednisolone and lymphocyte phenotypes Apoptosis of lymphocytes in SLE: the level, correlation with dosage prednisolone and lymphocyte phenotypes ABDELMAROUF MOHIELDEIN 1, NATALIA BELUSHKINA 2, ULIANA PETROVA 3. 1,2 Department of Biochemistry,

More information

Annexin V-FITC Apoptosis Detection Kit with SYTOX

Annexin V-FITC Apoptosis Detection Kit with SYTOX ab14086 Annexin V-FITC Apoptosis Detection Kit with SYTOX Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in living cells. This product is for research use only and

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Triptycene-Based Small Molecules Modulate (CAG) (CTG) Repeat Junctions

Triptycene-Based Small Molecules Modulate (CAG) (CTG) Repeat Junctions Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Triptycene-Based Small Molecules Modulate (CAG) (CTG) Repeat Junctions Stephanie A. Barros

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

02006B 1 vial 02006B 1 vial Store at -20 C. Lyophilized recombinant IL-2

02006B 1 vial 02006B 1 vial Store at -20 C. Lyophilized recombinant IL-2 For detection and measurement of human interleukin 2 Catalog #02006 Catalog #02007 2 Plates 10 Plates Product Description The Human Interleukin 2 (IL-2) ELISA Kit is designed for the quantitative detection

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Received: 14 Mar 2003 Revisions requested: 24 Apr 2003 Revisions received: 8 Aug 2003 Accepted: 11 Aug 2003 Published: 3 Sep 2003

Received: 14 Mar 2003 Revisions requested: 24 Apr 2003 Revisions received: 8 Aug 2003 Accepted: 11 Aug 2003 Published: 3 Sep 2003 Available online http://arthritis-research.com/content/5/6/r317 Research article Impact of VIP and camp on the regulation of TNF-α and IL-10 production: implications for rheumatoid arthritis Andrew D Foey

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

RayBio Annexin V-FITC Apoptosis Detection Kit Plus

RayBio Annexin V-FITC Apoptosis Detection Kit Plus RayBio Annexin V-FITC Apoptosis Detection Kit Plus User Manual Version 1.0 May 25, 2014 RayBio Annexin V-FITC Apoptosis (Cat#: 68FT-AnnVP-) RayBiotech, Inc. We Provide You With Excellent upport And ervice

More information

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015

IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IMMUNOLOGY BIO 463 LABORATORY EXERCISE FALL 2015 IL-2 Production in mouse splenocytes INTRODUCTION Interleukin-2, or IL-2, is a potent cytokine produced by T-cells, stimulating their proliferation. As

More information

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Endah Puji Septisetyani, Muthi Ikawati, Barinta Widaryanti and Edy Meiyanto* ) Cancer Chemoprevention Research Center,

More information

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]

MANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit] MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Enhancing the baculovirus expression system with VANKYRIN technology. Kendra Steele, Ph.D.

Enhancing the baculovirus expression system with VANKYRIN technology. Kendra Steele, Ph.D. Enhancing the baculovirus expression system with VANKYRIN technology Kendra Steele, Ph.D. Insect cells Can express mammalian proteins Similarities with mammalian cells Eukaryotic systems How protein are

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric*

SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric* SensoLyte 520 Cathepsin K Assay Kit *Fluorimetric* Catalog # 72171 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect Cathepsin K activity. Enhanced Value: Ample

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

RayBio Human Phosphotyrosine BTK ELISA Kit

RayBio Human Phosphotyrosine BTK ELISA Kit RayBio Human Phosphotyrosine BTK ELISA Kit Catalog #: PEL-BTK-Y User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

EGFR (py1045)/ Pan EGFR (Human) ELISA Kit

EGFR (py1045)/ Pan EGFR (Human) ELISA Kit EGFR (py1045)/ Pan EGFR (Human) ELISA Kit Catalog Number KA2156 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION EGFR (py1045)/pan EGFR (Human) ELISA (Enzyme-Linked Immunosorbent

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William

More information

HLA DRA (alpha chain) and LAG-3 (Human) Binding AlphaLISA Kit

HLA DRA (alpha chain) and LAG-3 (Human) Binding AlphaLISA Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Research Use Only. Not for use in diagnostic procedures. HLA DRA (alpha chain) and LAG-3 (Human) Binding AlphaLISA Kit Product No.: AL3066 Contents Product

More information

Legionella pneumophila SG1 Kit for the CellStream

Legionella pneumophila SG1 Kit for the CellStream Legionella pneumophila SG1 Kit for the CellStream Ultrafast Detection Including Viability Assessment Speed Separation, concentration and purification of Legionella in 1-2 hours Specificity High specificity

More information

MTS assay in A549 cells

MTS assay in A549 cells Project: VIGO MTS assay in A549 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17

Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 Following T-cell activation and differentiation with HTRF reagents: IL-2, IFN-γ and IL-17 4 th HTRF Symposium for Drug Discovery Avignon, Sept. 24-26, 28 Introduction: T-cells have effector and helper

More information

Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation

Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation Signaling through Fc RIII is required for optimal T helper type (Th)2 responses and Th2-mediated airway inflammation Hozefa S. Bandukwala, 1 Bryan S. Clay, 1 Jiankun Tong, 2 Purvi D. Mody, 1 Judy L. Cannon,

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment Supplementary Data for Kang et al. (Title) Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells by Regulating the Interaction of Tumor with its Immune Microenvironment Tae-Wook Kang 1,3,,

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Step 4. Step 4. Choose MW markers. Choose MW markers. Gel Electrophoresis of Proteins

Step 4. Step 4. Choose MW markers. Choose MW markers. Gel Electrophoresis of Proteins Gel Electrophoresis of Proteins Choose MW markers 16 Step 4 Gel Electrophoresis of Proteins A Practical Approach, Third Edition An overview of basic techniques to benefit any life scientist using electrophoretic

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

Supporting Information

Supporting Information Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Exo-Glow TM Exosome Labeling Kits

Exo-Glow TM Exosome Labeling Kits Exo-Glow TM Exosome Labeling Kits Cat# EXOR100A-1 Cat# EXOG200A-1 Cat# EXOC300A-1 User Manual Store kit at -20 o C on receipt Version 8 3/10/2017 A limited-use label license covers this product. By use

More information

Elementary tetrahelical protein design for diverse oxidoreductase functions

Elementary tetrahelical protein design for diverse oxidoreductase functions Title: Elementary tetrahelical protein design for diverse oxidoreductase functions Authors: Tammer A. Farid 1,4, Goutham Kodali 1,4, Lee A. Solomon 1,4, Bruce R. Lichtenstein 1,2, Molly M. Sheehan 1, Bryan

More information