Herpes Simplex Virus 1 Protein Kinase Us3 and Major Tegument Protein UL47 Reciprocally Regulate Their Subcellular Localization in Infected Cells

Transcription

1 JVI Accepts, published online ahead of print on July 0 J Virol doi:0/jvi00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions All Rights Reserved Herpes Simplex Virus Protein Kinase Us and Major Tegument Protein UL Reciprocally Regulate Their Subcellular Localization in Infected Cells Akihisa Kato, Zhuoming Liu, Atsuko Minowa, Takahiko Imai, Michiko Tanaka, Ken Sugimoto, Yukihiro Nishiyama, Jun Arii, + and Yasushi Kawaguchi * Division of Viral Infection, Department of Infectious Disease Control, International Research Center for Infectious Diseases, The Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 0-, Department of Pathology, National Institute of Infectious Disease, Shinjuku-ku, Tokyo -0, and Department of Virology, Nagoya University Graduate School of Medicine, Showa-ku, Nagoya -0, Japan Running title: Interaction between HSV- Us and UL *Address correspondence to: Dr Yasushi Kawaguchi Division of Viral Infection Department of Infectious Disease Control International Research Center for Infectious Diseases The Institute of Medical Science The University of Tokyo -- Shirokanedai, Minato-ku, Tokyo 0-, Japan Phone: Fax: ykawagu@imsu-tokyoacjp + Present address: Department of Biochemistry, University of Utah, Salt Lake City, UT -0, USA

2 0 ABSTRACT Us is a serine-threonine protein kinase encoded by herpes simplex virus (HSV-) We have identified UL, a major virion protein, as a novel physiological substrate of Us In vitro kinase assays and systematic analysis of mutations at putative Us phosphorylation sites near the nuclear localization signal of UL showed that serine at residue (Ser-) was required for Us phosphorylation of UL Substitution of UL Ser- by alanine produced aberrant accumulation of UL at the nuclear rim and impaired nuclear localization of UL in a significant fraction of infected cells The same defect in UL localization was produced by an amino acid substitution in Us that inactivated its protein kinase activity In contrast, a phosphomimetic mutation at UL Ser- restored wild-type nuclear localization The UL SA mutation also reduced viral replication in the mouse cornea and development of herpes stroma keratitis in mice In addition, UL formed a stable complex with Us in infected cells and nuclear localization of Us was significantly impaired in the absence of UL These results suggested that Us phosphorylation of UL Ser- promoted nuclear localization of UL in cell cultures and had a critical role in viral replication and pathogenesis in vivo Furthermore, UL appeared to be required for efficient nuclear localization of Us in infected cells Therefore, Us protein kinase and its UL substrate demonstrated a unique regulatory feature in that they reciprocally regulated the subcellular localization of each other in infected cells

3 0 0 INTRODUCTION Us is a serine/threonine protein kinase encoded by herpes simplex virus (HSV-) with an amino acid sequence that is conserved in the subfamily Alphaherpesvirinae (, 0, ) R n X(S/T)YY is the consensus target sequence of an HSV- Us homologue encoded by pseudorabies virus (PRV), where n is, X can be Arg, Ala, Val, Pro, or Ser and Y can be any amino acid except an acidic residue (,, ) This sequence also appears to be the target sequence of HSV- Us, based on the reports that the phosphorylation sites of HSV- Us identified to date match the consensus target sequence (-,, ) The phosphorylation target site specificity of HSV- Us has also been reported to be similar to that of protein kinase A (PKA), a cellular cyclic AMP-dependent protein kinase () and Akt () Some antibodies to the phosphorylated substrate sequences of PKA can also react with Us phosphorylation sites (,, ) The Us protein and its catalytic activity have been suggested to play a critical role in HSV- replication and pathogenicity, based on studies showing that recombinant Us-null mutant viruses and recombinant viruses encoding catalytically inactive Us have impaired growth properties in cell cultures and reduced virulence, pathogenicity and replication in mouse models (,, 0,, ) In general, the activity of a protein kinase is tightly regulated; eg, by autophosphorylation, transphosphorylation by other protein kinases, or interaction with other proteins () The activated protein kinase phosphorylates substrate(s) and, as a result, the phosphorylated substate(s) expresses its functions Although it has recently been reported that the Us kinase activity in infected cells is, in part, regulated by autophosphorylation (, ), it remains largely unknown how HSV- Us kinase activity is regulated in infected cells In

4 0 0 contrast, numerous studies have elucidated the potential downstream effects of HSV- Us, including blocking apoptosis (,,, ), promoting nuclear egress of progeny nucleocapsids through the nuclear membrane (NM) (, 0,, ), redistributing and phosphorylating NM-associated viral nuclear egress factors UL and UL and cellular factors lamin A/C and emerin (,, -,, ), mediating phosphorylation of histone deacetylases (HDACs) and promoting gene expression by blocking histone deacetylation (, ), controlling infected cell morphology (,, 0), and down-regulating cell surface expression of viral envelope glycoprotein B (gb) by promoting endocytosis of gb (, ), and stimulating mrna translation by mimicking Akt and activating mtorc () These data suggest that Us is a multifunctional protein that plays various roles in viral replication by phosphorylating a number of viral and cellular substrates In agreement with this hypothesis, it has been reported that HSV- Us is a promiscuous protein kinase and may phosphorylate more substrates than originally predicted () Therefore, there may be Us substrates other than those reported to date, and their identification and characterization are required to determine Us functions and understand their mechanisms UL, another protein encoded by HSV-, is a major structural protein in the virion tegument () HSV- UL is posttranslationally modified by phosphorylation in infected cells () and its amino acid sequence is conserved in the subfamily Alphaherpesvirinae (, ) Deletion of the UL gene from HSV-, PRV, Marek s disease virus, avian infectious laryngotracheitis virus (ILTV) or bovine herpesvirus (BHV-) usually impairs viral replication in cell cultures (0, ) (,, ), and UL-null mutants of PRV, ILTV and BHV- have attenuated virulence in mouse models and their natural hosts (,, ) From

5 0 0 these observations, UL proteins have been considered to be positive regulators of alphaherpesvirus replication and pathogenicity Although the precise function(s) of UL in viral replication and virulence remains largely unknown at present, the mechanisms by which UL proteins act in infected cells have been gradually elucidated Early studies revealed that HSV- UL is involved in modulating the activity of tegument protein VP, which is released into the cytoplasm upon HSV- infection, transported into the nucleus, and transactivates expression of α genes, the class of HSV- genes expressed first in infected cells () Later studies have shown that the UL proteins of HSV- and BHV- are nucleocytoplasmic shuttling proteins (,, ), functionally similar to human immunodeficiency virus (HIV-) Rev, HSV- ICP and influenza virus NS (, 0, ) These viral proteins also have RNA binding activity (), implying a role in RNA biogenesis in infected cells similar to other viral-encoded RNA binding proteins In the present study, we identified the UL protein as a novel physiological substrate of Us in HSV- infected cells Studies investigating the effect(s) of Us phosphorylation of UL suggested that this phosphorylation promoted UL nuclear localization in cell cultures and played a critical role in viral replication and pathogenesis in vivo In addition, we have shown that UL formed a stable complex with Us in infected cells and presented data suggesting that UL was required for efficient nuclear localization of Us in infected cells Thus, it appeared that Us and UL reciprocally regulated the subcellular localization of each other in infected cells

6 0 0 MATERIALS AND METHODS Cells and viruses Vero and rabbit skin cells were described previously, as was HSV- wild-type strain HSV-(F) () Recombinant virus YK0 encoding Us fused to the fluorescent protein Venus with an A0K mutation (VenusA0K) and recombinant virus YK0 encoding UL fused to mrfp were described previously (, ) Plasmids To generate a fusion protein of maltose binding protein (MBP) and part of UL, plasmid pmal-ul-p was constructed by amplifying the domains encoding UL codons -0 by PCR from pbc00 () and cloning the DNA fragments into pmal-c (New England BioLabs) in frame with the MBP To generate a fusion protein of MBP fused to UL carrying an SA or SA mutation, pmal-ul-p-sa and pmal-ul-p-sa, respectively, were constructed as described previously () prsetb-mrfp-kan was generated by amplifying a fragment encoding the I-SceI site and the kanamycin resistance gene from pepkan-s (), cloning it into the PstI site of prsetb-mrfp(), and using it as template for the two-step Red-mediated mutagenesis procedure described below The transfer plasmid pbs-mcherry-ul for generating a recombinant HSV- expressing UL fused to mcherry (mcherry-ul) was constructed as described previously () Mutagenesis of viral genomes in E coli and generation of recombinant HSV- To generate YK encoding UL fused to mrfp fluorescent protein (mrfp-ul) (Fig ), the two-step Red-mediated mutagenesis procedure was carried out as described previously () except with the primers listed in Table and the prsetb-mrfp-kan template Recombinant virus YK encoding mrfp-ul with an alanine substitution for serine at

7 0 0 residue Ser- (mrfp-ulsa), and YK encoding mrfp-ul with an aspartic acid substitution for serine at residue Ser- (mrfp-ulsd) (Fig ) were constructed by the two-step Red-mediated mutagenesis procedure described previously () except with the primers listed in Table and E coli containing a YK genome Recombinant virus YK, in which the mrfp-ulsa mutation in YK was repaired (mrfp-ulsa-repair) (Fig ), was generated with the primers listed in Table as described previously () Recombinant virus YK, a Us kinase-dead mutant virus in which UL was tagged with mrfp and Us Lys-0 was replaced with methionine (mrfp-ul/usk0m), and its repaired virus YK in which UsK0M in YK was repaired (Fig ) were generated as described above using the primers listed in Table Recombinant virus YK in which Us was tagged with Venus fluorescent protein carrying the mutation A0K (VenusA0K) () and the UL gene was disrupted by insertion of a foreign gene cassette encoding a stop codon (TGA), an I-SceI site, a kanamycin resistance gene, and 0 bp of a sequence upstream of the second codon of the UL gene inserted just downstream of the UL start codon (VenusA0K-Us/ UL) (Fig ) was generated by the Red-mediated mutagenesis procedure as described previously () except with the primers listed in Table and E coli containing the YK0 genome () Recombinant viruses in which the same foreign gene cassette was inserted into just downstream of the UL or UL start codon were not able to express UL or UL protein in infected cells (M T and Y K, unpublished observations) Recombinant virus YK in which the foreign gene cassette inserted into the UL locus of YK was excised (VenusA0K-Us/ UL-repair) (Fig ) was generated by the

8 0 0 Red-mediated mutagenesis procedure as described above using the primers listed in Table Recombinant virus YK encoding VenusA0K-Us and mrfp-ul (VenusA0K-Us/mRFP-UL) (Fig ) was generated by coinfection with YK0 (VenusA0K-Us) () and YK0 (mrfp-ul) () as described previously () Recombinant virus YK in which non-tagged UL was disrupted by insertion of the foreign gene cassette described above just downstream of the UL start codon ( UL), YK in which the foreign gene cassette inserted into the UL gene of YK was excised ( UL-repair), YK in which the Ser- in non-tagged UL was substituted with alanine (ULSA), and YK in which the SA mutation in non-tagged UL of YK was repaired (ULSA-repair) were constructed as described above using the primers listed in Table Recombinant viruses YK ( UL/ BAC), YK ( UL-repair/ BAC), YK (ULSA/ BAC) and YK (ULSA-repair/ BAC) (Fig ), in which the bacmids were excised from YK ( UL), YK ( UL-repair), YK (ULSA) and YK (ULSA-repair), respectively, were constructed by coinfection of Vero cells with YK, YK, YK or YK, and a recombinant adenovirus AxCANCre expressing Cre recombinase as described previously () Recombinant virus YK encoding mcherry-ul was generated as described previously () except that the transfer plasmid pbs-mcherry-ul was used Production and purification of MBP fusion proteins in E coli MBP fusion proteins MBP-UL-P, MBP-UL-P-SA, MBP-UL-P-SA and MBP-LacZ were expressed in E coli that had been transformed with pmal-ul-p, pmal-ul-p-sa, pmal-ul-p-sa or pmal-c, respectively, and purified as described previously ()

9 0 0 In vitro kinase assays MBP fusion proteins were captured on amylose beads (New England BioLabs) and used as substrates in in vitro kinase assays with purified GST-Us and GST-UsK0M as described previously () Antibodies Rabbit polyclonal antibodies to Us, UL and UL were described previously (,, ) Phospho-PKA substrate (00G) rabbit monoclonal antibody was purchased from Cell Signaling Technology Rabbit polyclonal antibody to RFP and mouse monoclonal antibody to RFP (G) coupled to agarose beads were purchased from MBL Rabbit polyclonal antibody to DsRed was purchased from Clontech: this antibody recognizes mrfp and mcherry, since these fluorescent proteins were generated by modification of DsRed (, ) Immunoblotting, immunoprecipitation and live-cell imaging Immunoblotting, immunoprecipitation and live-cell imaging were performed as described previously (, ) The amount of protein in immunoblot bands was quantitated using the Dolphin Doc image capture system with Dolphin-D software (Wealtec) For quantitation of the fluorescence intensity of VenusA0K-Us in live Vero cells infected with YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) or YK (VenusA0K-Us/ UL-repair), images of ten cells were randomly selected for each viral infection, three circular areas of each infected cell were randomly selected, each covering the same size area of the cytoplasm or nucleus, and the fluorescence intensity of each area was determined using software supplied with the LSM confocal microscope (Zeiss) Phosphatase treatment MBP fusion proteins after in vitro kinase assays and immunoprecipitates were treated with λ protein phosphatase (λ-ppase) (New England

10 0 BioLabs) as described previously () Animal studies Female ICR mice were purchased from Charles River For ocular infection, five-week-old female mice were infected with each HSV- strain as described previously () The scoring scale for the severity of herpes stroma keratitis (HSK) was described previously () Viral titers in tear films were determined as described previously () All animal studies were carried out with the approval of the Ethics Committee for Animal Experimentation of the University of Tokyo Downloaded from on January, 0 by guest

11 RESULTS Us-dependent phosphorylation of UL in infected cells We previously 0 0 identified physiological substrates of Us by a combination of bioinformatics analysis, in vitro kinase assays using Us and specific substrates, and detection of phosphorylation in infected cells with anti-phospho-pka substrate antibody (00G), that detects proteins containing a phosphorylated serine or threonine residue with an arginine at residues - and - (RRXS or RRXT) (, ) Based on the consensus sequence of the Us phosphorylation site, we identified four putative Us phosphorylation sites in UL, at codons 0- (RRRAS), codons - (RRRAS), codons - (RRAS) and codons - (RRAT), all of which would be expected to be detected by anti-phospho-pka substrate antibody (00G) if they were phosphorylated To monitor UL in infected cells easily, we generated recombinant virus YK in which UL was tagged with mrfp fluorescent protein, by the two-step Red-mediated mutagenesis procedure The YK (mrfp-ul) growth curve was similar to that of wild-type HSV-(F) in Vero cells infected at a multiplicity of infection (MOI) of, but YK (mrfp-ul) produced a slightly lower (-fold) progeny virus yield than wild-type HSV-(F) at h post-infection (Fig A), suggesting that tagging of UL with mrfp had a little effect on viral growth This was consistent with our previous observation with recombinant virus YK0 encoding mrfp-ul, which was constructed by the homologous recombination procedure () To investigate the effects of Us protein kinase activity on UL in infected cells, we also constructed YK, a Us kinase-dead mutant virus with a K0M mutation in Us () and expressing mrfp-ul (mrfp-ul/usk0m), and YK, its repaired virus in which the Us K0M mutation

12 0 0 in YK was repaired (mrfp-ul/usk0m-repair) The YK (mrfp-ul/usk0m) growth curve was almost identical to that of YK (mrfp-ul) and YK (mrfp-ul/usk0m-repair) in Vero cells infected at an MOI of (Fig B), indicating that the kinase activity had no growth effect on the virus in which UL was tagged with mrfp To examine whether Us mediated phosphorylaton of UL in infected cells, Vero cells were infected with YK (mrfp-ul), YK (mrfp-ul/usk0m) or YK (mrfp-ul/usk0m-repair) at an MOI of, harvested at h post-infection, solubilized, immonoprecipitated with the anti-rfp antibody coupled to agarose beads and analysed by immunoblotting with anti-dsred antibody and anti-phospho-pka substrate antibody (00G) As shown in Fig A, anti-phospho-pka substrate antibody reacted with mrfp-ul purified from YK (mrfp-ul)-infected Vero cells by immunoprecipitation (Fig A, lane ) To confirm that mrfp-ul detected by the anti-phospho-pka substrate antibody was due to phosphorylation of UL, mrfp-ul from YK-infected cells was purified by immunoprecipitation with anti-rfp antibody and treated with λ-ppase As shown in Fig C, the reactivity of mrfp-ul with anti-phospho-pka substrate antibody was eliminated by phosphatase treatment, indicating that the anti-phospho-pka substrate antibody had reacted with phosphorylated mrfp-ul Furthermore, phosphorylation of mrfp-ul detected by the anti-phospho-pka substrate antibody was significantly reduced in YK (mrfp-ul/usk0m)-infected cells (Fig A, lane and Fig B) compared to mrfp-ul in YK (mrfp-ul)- and YK (mrfp-ul/usk0m-repair)-infected cells (Fig A, lanes and, respectively, and Fig

13 0 0 B) These results indicated that UL was phosphorylated in infected cells at epitope(s) of the anti-phospho-pka substrate antibody (00G) and Us protein kinase mediated most of this phosphorylation We noted that phosphorylation of mrfp-ul was slightly but consistently detected by the anti-phospho-pka substrate antibody in the absence of Us kinase activity in infected cells (Fig B), indicating that a protein kinase(s) other than Us mediated this phosphorylation in infected cells In agreement with this hypothesis, the phosphorylation target site specificity of HSV- Us has been reported to be similar to those of cellular protein kinaes, PKA and Akt (, ) Effect of the Us protein kinase activity on localization of UL in infected cells Three of the four putative Us phosphorylation sites (Ser-, Ser- and Thr-) in UL described above are located close to the protein's nuclear localization signal (NLS) (codons 0-) and nuclear export signal (NES) (codons -) (, ) This led us to examine whether Us is involved in regulation of subcellular localization of UL in infected cells Therefore, Vero cells were infected with YK (mrfp-ul), YK (mrfp-ul/usk0m) or YK (mrfp-ul/usk0m-repair) at an MOI of for h and then examined by confocal microscopy In agreement with previous reports (), mrfp-ul was predominantly localized in the nucleus of cells infected with YK (mrfp-ul) (Fig A) In contrast, the mrfp-ul distribution was significantly different in approximately % of 00 cells infected with the Us kinase-dead mutant YK (mrfp-ul/usk0m), with aberrant accumulation of mrfp-ul at the nuclear rim and impaired nuclear localization (Fig A) The percent of YK (mrfp-ul/usk0m)-infected cells with aberrant accumulation of mrfp-ul at the

14 0 0 nuclear rim was approximately -fold higher than that in YK (mrfp-ul)-infected cells (Fig B) However, nuclear localization of mrfp-ul was restored in cells infected with YK in which the UsK0M mutation was repaired (Fig A and B) These results indicated that Us protein kinase activity was required for proper nuclear localization of UL in a fraction (almost half) of infected cells Us phosphorylation of the amino-terminal domain of UL in vitro It has been reported that nuclear localization of viral and cellular proteins is controlled by phosphorylation in or close to the NLS of the proteins (, ) Therefore, in view of our results above, we hypothesized that Us phosphorylation at a site(s) close to the UL NLS may regulate nuclear localization of UL To test this hypothesis, we examined whether Us can phosphorylate the amino-terminal domain of UL containing its NLS in vitro For this study, we generated and purified a chimeric proteins consisting of MBP fused to a peptide encoded by UL codons -0 (MBP-UL-P) (Fig A) and tested it as a substrate in in vitro kinase assays with purified wild-type GST-Us and the kinase-negative mutant GST-UsK0M As shown in Fig C, MBP-UL-P was labeled with [γ- P] ATP in kinase assays using GST-Us (Fig C, lane ), while MBP-LacZ was not (Fig C, lane ) When the kinase negative mutant GST-UsK0M was used, neither MBP fusion protein was labeled (Fig C, lanes and ) To confirm that MBP-UL-P labeling of MBP-UL-P by GST-Us was due to phosphorylation, the labeled MBP-UL-P was treated with λ-ppase As shown in Fig E, MBP-UL-P labeling by GST-Us was eliminated by phosphatase treatment, indicating that MBP--P was labeled by phosphorylation The presence of each MBP fusion protein was verified by Coomassie brilliant blue (CBB) staining (Fig B and D)

15 0 0 These results indicated that Us specifically and directly phosphorylated the UL amino terminal peptide encoded by codons -0 in vitro Identification of the amino acids in the amino-terminal domain of UL required for Us phosphorylation in vitro As described above, the UL amino-terminal peptide encoded by codons -0 contains two putative Us phosphorylation sites, at codons - (RRAS) and - (RRAS), that may be epitopes recognized by anti-phospho-pka substrate antibody (00G) Therefore, we substituted alanine for the serine in each MBP-UL-P phosphorylation site and tested these mutants as substrates in in vitro Us kinase assays As shown in Fig G, MBP-UL-P carrying an SA mutation was not phosphorylated by Us, whereas MBP-UL-P carrying an SA mutation was efficiently phosphorylated by Us These results indicated that Ser- was required for Us phosphorylation of the amino-terminal domain of UL in vitro Effect of amino acid substitution of UL Ser- on localization of UL in infected cells To investigate the linkage between Us phosphorylation in the amino-terminal domain of UL in vitro and regulation of UL nuclear localization in infected cells, we constructed recombinant viruses YK (mrfp-ulsa) encoding mrfp-ul in which UL Ser- was replaced with alanine (Fig ) We also generated recombinant virus YK (mrfp-ulsa-repair) in which the UL SA mutation in YK was repaired (Fig ) We then examined localization of mrfp-ul in Vero cells infected with YK (mrfp-ul), YK (mrfp-ulsa) or YK (mrfp-ulsa-repair) at an MOI of for h As found with the Us kinase-dead virus YK (mrfp-ul/usk0m) (Fig ), in approximately % of 00 cells infected with YK

16 0 0 (mrfp-ulsa) the intracellular distribution of mrfp-ulsa was different from that of mrfp-ul in cells infected with YK (mrfp-ul), with mrfp-ulsa showing aberrant accumulation at the nuclear rim and impaired nuclear localization (Fig A) The percent of YK (mrfp-ulsa)-infected cells with aberrant accumulation of mrfp-ulsa at the nuclear rim was approximately -fold higher than that of mrfp-ul in YK (mrfp-ul)-infected cells (Fig B) However, nuclear localization of mrfp-ul was restored in cells infected with YK (mrfp-ulsa-repair) in which the SA mutation in UL was repaired These results indicated that UL Ser- was required for proper nuclear localization of UL in a significant fraction of infected cells, and that the effect of the UL SA mutation in impairing proper UL nuclear localization was similar to that observed in cells infected with a Us kinase-inactive virus To further investigate the hypothesis that phosphorylation of UL at Ser-, which is close to the UL NLS, is critical for proper nuclear localization of UL, we generated recombinant virus YK encoding mrfp-ul in which Ser- was replaced with aspartic acid (mrfp-ulsd) and examined the localization of mrfp-ulsd in Vero cells infected with YK (mrfp-ulsd) at an MOI of for h It is known that an acidic amino acid, such as glutamic or aspartic acid, mimics the negative charge produced by phosphorylation (,,, ) As shown in Fig A and B, mrfp-ulsd was predominantly localized in the nucleus of YK (mrfp-ulsd)-infected cells and its localization was indistinguishable from that of mrfp-ul in YK (mrfp-ul)-infected cells These results indicated that a negatively charged amino acid at

17 0 0 UL residue, either by phosphorylation of Ser- or an SD substitution, was required for proper nuclear localization of UL in infected cells and further supported the hypothesis that phosphorylation of UL at Ser- was critical for proper nuclear localization of UL in infected cells Effect of the UL SA or UL-null mutation on viral replication and pathogenesis in mice The YK (mrfp-ulsa) growth curve was almost identical to those of YK (mrfp-ul), YK (mrfp-ulsa-repair) and YK (mrfp-ulsd) in Vero cells infected at an MOI of (Fig C), indicating that phosphorylation of UL at Ser- does not have a measurable effect on viral growth in Vero cells To investigate the clinical relevance of the phosphorylation of UL Ser- in HSV- infection, we examined the effect of the UL SA mutation in a mouse herpes stroma keratitis (HSK) model for HSV- infection In addition, we examined the effect of a UL-null mutation in the mouse model, since HSV- UL has not been reported to have a role in viral replication and pathogenesis in vivo Although the mrfp tag on UL had a small effect on viral growth in cell cultures as described above, our earlier mouse experiments (, ) indicated that the mrfp tag might have a more significant effect in the mouse model Therefore, we generated recombinant virus YK in which Ser- in non-tagged UL was substituted with alanine and the bacmid was excised from the viral genome (ULSA/ BAC), YK in which the UL SA mutation in YK was repaired (ULSA-repair/ BAC), YK in which the UL gene was inactivated by insertion of a foreign gene cassette and the bacmid was excised from the viral genome ( UL/ BAC), and YK in which the inactivated UL gene in YK was repaired ( UL-repair/ BAC)

18 0 0 (Fig ) The YK (ULSA/ BAC) growth curve in Vero cells infected at an MOI of was almost identical to that of YK (ULSA-repair/ BAC) (Fig D), in agreement with the results for the mrfp-tagged viruses described above, including YK (mrfp-ulsa), YK (mrfp-ul) and YK (mrfp-ulsa-repair) In contrast, YK ( UL/ BAC) produced a -fold lower progeny yield than YK (ULSA-repair/ BAC) in Vero cells infected at an MOI of at h post-infection (Fig E) This result is in agreement with an earlier report that a UL deletion impaired viral growth in cell cultures () When these recombinant viruses were tested in the mouse HSK model, mice infected with YK (ULSA/ BAC) or YK ( UL/ BAC) exhibited a significantly reduced severity of HSK compared to mice infected with YK (ULSA-repair/ BAC) or YK ( UL-repair/ BAC), respectively (Fig A and C) In addition, YK (ULSA/ BAC) and YK ( UL/ BAC) replicated significantly less efficiency in the tear films of these infected mice compared to YK (ULSA-repair/ BAC) and YK ( UL-repair/ BAC), respectively (Fig B and D) These results indicated that UL was required for efficient viral replication and development of HSK in mice and that one of the sites in UL responsible for its function(s) in mice was the Us phosphorylation site at UL Ser- Interaction of Us with UL in infected cells Herpesvirus protein kinases sometimes form a stable complex with their substrates () Therefore, to investigate this for Us and UL, Vero cells were mock-infected or infected with YK (mrfp-ul) at an MOI of for h Then the whole lysates of Vero cells mock-infected or infected with YK

19 0 0 (mrfp-ul) were immunoprecipitated with anti-rabbit Us or control rabbit antibody, and the immunoprecipitates were analyzed by immunoblotting with anti-dsred antibody As shown in Fig A, anti-us antibody co-precipitated mrfp-ul from lysates of cells infected with YK (mrfp-ul) (Fig A, lane ), whereas the control antibody did not (Fig A, lane ) In a reciprocal experiment, anti-mrfp antibody co-precipitated Us from lysates of cells infected with YK (mrfp-ul) (Fig B, lane ), but not from lysates of cells infected with YK expressing UL tagged with mcherry (Fig B, lane ) These results indicated that Us formed a stable complex with UL in infected cells Next, to examine subcellular localization of Us and UL in infected cells, we generated recombinant virus YK expressing mrfp-ul and Us tagged with VenusA0K fluorescent protein (VenusA0K-Us/mRFP-UL) and examined localization of mrfp-ul and VenusA0K-Us in Vero cells infected with YK (VenusA0K-Us/mRFP-UL) at an MOI of at and h post-infection As shown in Fig, at h post-infection VenusA0K-Us was localized predominantly in the cytoplasm as described previously (), but VenusA0K-Us was also faintly detectable in the nucleus At h post-infection, nuclear localization of VenusA0K-Us was more evident than at h post-infection At both time points, nuclear VenusA0K-Us co-localized with mrfp-ul, and VenusA0K-Us in some cytoplamic areas co-localized with mrfp-ul although most of Us and UL did not colocalize in the cytoplasm These results supported our conclusion that Us formed a stable complex with UL in infected cells Effect of UL on subcellular localization of Us in infected cells The results above, that Us formed a stable complex with UL in infected cells and Us co-localized with

20 0 0 0 UL, led us to examine whether UL regulated localization of Us in infected cells Therefore, we constructed recombinant virus YK in which the UL gene was inactivated by insertion of a foreign gene cassette and Us was tagged with VenusA0K (VenusA0K-Us/ UL), and its repaired virus YK in which the UL-null mutation in YK was repaired (VenusA0K-Us/ ULrepair) (Fig ) Insertion of the foreign gene cassette into UL in YK had no effect on expression of the UL-neighboring genes UL and UL, based on the observation that wild-type HSV-(F), YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) and YK (VenusA0K-Us/ UL-repair) produced indistinguishable levels of UL and UL in infected Vero cells, as determined by immunoblotting (Fig 0) However, at h post-infection, in Vero cells infected at an MOI of, YK (VenusA0K-Us/ UL) produced a -fold lower progeny virus yield than YK0 (VenusA0K-Us) and an -fold lower progeny virus yield than YK (VenusA0K-Us/ UL-repair) (data not shown) These results were consistent with those with YK ( UL/ BAC) and YK ( UL-repair/ BAC) described above Vero cells were infected at an MOI of with YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) or YK (VenusA0K-Us/ UL-repair) and localization of VenusA0K-Us was examined at, and h post-infection In agreement with the results in Fig, VenusA0K-Us predominantly localized in the cytoplasm of cells infected with YK0 (VenusA0K-Us) and YK (VenusA0K-Us/ UL-repair) at and h post-infection, with nuclear localization of VenusA0K-Us evident at h post-infection (Fig A) In contrast, at h post-infection in cells infected with YK

21 (VenusA0K-Us/ UL), nuclear localization of VenusA0K-Us was significantly impaired (Fig A) Quantitation of VenusA0K-Us fluorescence in cells infected with YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) or YK (VenusA0K-Us/ UL-repair) at h post-infection confirmed the significant decrease in nuclear accumulation of VenusA0K-Us in cells infected with YK (VenusA0K-Us/ UL) compared to that in cells infected with YK0 (VenusA0K-Us) or YK (VenusA0K-Us/ UL-repair) These results indicated that UL was required for efficient nuclear localization of Us in infected cells Downloaded from on January, 0 by guest

22 0 0 DISCUSSION More than putative HSV- Us substrates have been reported to date (, -,, -,,,, ) However, only a few of these substrates have been shown to be both a physiological substrate of Us in infected cells and directly linked with Us functions in infected cells These include gb, UL, Us itself and tuberous sclerosis complex (TSC) (,,,, ) It has been reported that Us phosphorylation of these substrates appears to regulate cell surface expression of gb (, ), nuclear egress of nucleocapsids (, ), the catalytic activity of Us () and mrna translation () in infected cells Furthermore, Us phosphorylation of both gb and Us itself appears to play critical roles in viral replication in vivo and HSV- pathogenesis, based on data that viral replication and pathogenecity in mice were attenuated in infections with HSV- recombinant viruses in which the Us phosphorylation site in gb or Us was mutated, or with an HSV- Us kinase-dead mutant virus (, ) An important finding of this study was that UL was a physiological substrate of Us in infected cells and Us phosphorylation of UL appeared to be critical for viral replication and pathogenesis in vivo This conclusion was based on the results that: (i) purified UL was phosphorylated by purified Us in vitro, (ii) detection of UL in infected cells with anti-phospho-pka substrate antibody (00G) was dependent on Us kinase activity, and (iii) alanine substitution of UL Ser-, which was identified as a Us phosphorylation site in in vitro kinase assays, significantly reduced viral replication and pathogenesis in a mouse HSK model A similar reduction in viral replication and pathogenesis was reported in studies of mice infected with a Us kinase-dead virus () Our conclusion is also supported by the

23 0 0 recent report that BHV- Us homologue phosphorylated BHV- UL homologue in vitro although the biological significance of the phosphorylation remains to be addressed () Thus, our present study adds UL to the known physiological substrates of Us that are biologically relevant in HSV- infection However, as is usual with such mutational analyses, we cannot completely eliminate the possibility that the UL SA mutation caused a conformational change in UL that directly impaired UL function(s) in vivo rather than by blocking a site of Us-mediated phosphorylation Therefore, further analyses of the functions of UL and their relation to Us phosphorylation of UL Ser- will be necessary to define the precise role(s) of UL phosphorylation in viral infection and disease in vivo However, taken together with the data showing that the UL-null mutant virus significantly attenuated viral replication and pathogenicity in mice, this study is the first report demonstrating that HSV- UL played a critical role in HSV- replication and pathogenesis in vivo As described above, other alphaherpesvirus homologues of UL, including PRV UL, BHV- UL and ILTV UL, have been reported to be important for viral pathogenesis in vivo (,, ) Therefore, UL homologues appear to be common virulence factors in alphaherpesviruses The UL NLS has been mapped to UL residues 0-, which contain a cluster of arginine residues () The arginine-rich nature of the UL NLS suggests that it is not related to the classical monopartite and bipartite NLS sequences which contain a lysine-rich domain, but that it is a member of the class of NLSs that contain an arginine-rich domain, as reported for HIV- Rev and Tat, and human T-lymphotropic virus (HTLV-) Rex (,,,, ) In the nuclear transport of proteins carrying a lysine- or arginine-rich NLS, proteins are recognized in the cytoplasm by an importin α/β heterodimer or importin β alone, respectively

24 0 0 (, ) In either case, importin β mediates passage through the nuclear pore and release into the nucleus, dependent on the GTP-binding protein Ran (, ) Phosphorylation of a protein near its NLS, mediated by many different protein kinases, is a key and common mechanism by which transport of NLS-containing proteins into the nucleus can be regulated (0-) Like other proteins carrying a phosphorylation-regulated NLS, Us phosphorylation of UL Ser-, which is adjacent to the UL NLS, appeared to promote nuclear localization of UL in a significant fraction of infected cells This conclusion was based on the results that: (i) alanine substitution of the Us physiological phosphorylation site Ser- in UL induced aberrant accumulation of UL at the nuclear rim and impaired nuclear localization of UL in a significant fraction of infected cells, (ii) aberrant accumulation of UL at the nuclear rim and impaired nuclear localization of UL were also observed in a significant fraction of cells infected with a Us kinase-dead mutant virus, and (iii) a phosphomimetic substitution at UL Ser- (SD), which mimicked constitutive phosphorylation (,,, ), restored wild-type localization of UL in infected cells The aberrant accumulation of UL at the nuclear rim is assumed to reflect inhibition of UL passage through the nuclear pore, probably mediated by importin(s), although it remains to be shown whether importin(s) mediates nuclear transport of UL It has been reported that phosphorylation of sites adjacent to the NLS of simian virus 0 T antigen enhanced binding of importins to the NLS, leading to efficient nuclear localization of the protein (, ) Similarly, Us phosphorylation of UL near its NLS might enhance the affinity of an import receptor(s), such as an importin, resulting in promotion of nuclear transport of UL in infected cells At present, we cannot eliminate the possibility that a protein kinase(s) other than Us also phosphorylates UL Ser- in

25 0 0 infected cells and is involved in nuclear transport of UL, based on the observations that the phosphorylation target site specificity of HSV- Us appears to be similar to those of cellular protein kinaes, PKA and Akt (, ) and that in the absence of Us kinase activity in infected cells, the low but consistent phosphorylation of UL was detected It is noteworthy that, in this study, the SA mutation in UL not only altered subcellular localization of UL in infected cells but also reduced viral replication and pathogenesis in a mouse HSK model, suggesting that proper nuclear localization of UL in infected cells is critical for HSV- replication and pathogenesis in vivo Furthermore, it has been reported that UL NLS also functions as RNA binding domain () Therefore, it is of interest to investigate whether Us phosphorylation of UL near its NLS (Ser-) affects the ability of UL to bind RNAs in infected cells It was surprising that aberrant accumulation of UL at the nuclear rim was observed in only a fraction (~0%) of cells infected with the recombinant virus with a UL SA mutation It is of interest that this seems to be consistent with the observation that YK(ULSA) gave twice as much severity of HSK in mice than YK ( UL/ BAC) At present, it is not known why the SA mutation in UL only affected UL localization in some infected cells However, a similar observation has recently been reported for histone deacetylase (HDAC), in that alanine substitutions in the physiological phosphorylation sites within its NLS impaired nuclear localization in only some cells () One possible explanation of these observations may be that subcellular localization of these proteins is regulated by multiple factors In agreement with this hypothesis, it has been reported that, when expressed in transiently transfected cells, UL shuttled rapidly between

26 0 0 the nucleus and cytoplasm, with an overall localization in the nucleus (, ), suggesting that at least two cellular functions, including those involved in nuclear import and export, may regulate UL localization in transfected cells It has also been reported that UL was localized in both the nucleus and cytoplasm in HSV--infected cells, suggesting that a viral factor(s) and/or cellular factor(s) induced by viral infection may play a role in keeping UL in the cytoplasm of infected cells () In addition, in this study we have shown that phosphorylation of UL Ser-, near the UL NLS, by Us optimally regulated its localization in infected cells It is also possible that each of Us and cellular protein kinases with the phosphorylation target site specificity similar to Us such as PKA and Akt may phosphorylate the same multiple sites including Ser- in UL and the multiple phosphorylation events mediated by the multiple protein kinases may regulate subcellular localization of UL in infected cells In agreement with this hypothesis, we identified a putative Us phosporylation site in UL at codons - which is located close to UL NES (codons -) as described above Subcellular localization of UL in infected cells may be determined by the balance among these and/or yet to be recognized cellular and/or viral function(s) Blocking phosphorylation of UL Ser- may cause a subtle imbalance among the factors that determine localization of UL in infected cells, resulting in aberrant localization of UL in only a fraction of infected cells In the present study, we showed that HSV- Us protein kinase formed a stable complex with its UL substrate in infected cells It appears that the stable interaction between Us and UL is conserved in other alphaherpesviruses, based on the observation that BHV- Us homologue was co-precipitated with transiently expressed BHV- UL homologue from

27 0 0 BHV- infected cells () These observations raised the possibility that UL affected Us function(s) in infected cells In agreement with this possibility, we also showed that the absence of UL in infected cells significantly impaired nuclear localization of Us However, we should note that most Us remained in the cytoplasm throughout infection regardless of the presence of UL, indicating that UL was in part required for proper nuclear localization of Us in infected cells Therefore, Us and UL exhibited a unique feature in that they reciprocally regulated the subcellular localization of each other in infected cells Since some HSV- Us functions, including regulation of nuclear egress of nucleocapsids by phosphorylation of NM-associated viral and cellular proteins, are carried out in the nucleus of infected cells, Us needs to localize in the nucleus of infected cells It has recently been reported that the kinase activity of HSV- Us is required for efficient nuclear localization of the protein when expressed in transiently transfected cells (0) This observation is consistent with earlier reports showing that the kinase activity of HSV- Us is required for proper localization of Us in infected cells (, ) However, it remains to be elucidated whether HSV- Us kinase activity is in fact involved in regulation of its nuclear localization in infected cells, since it has been reported that the roles of HSV- Us kinase activity in infected cells are remarkably different from those of HSV- Us () Therefore, there is a lack of information on how nuclear localization of HSV- Us is regulated in infected cells In the present study, we have identified UL as a factor in the regulation of proper nuclear localization of Us in infected cells It has been reported that HSV- ICP associated with and translocated to the nucleus of HSV--infected cells the major form of polyadenylate-binding protein (PABP), PABPC, which localizes predominantly in the cytoplasm of un-infected cells and plays

28 central roles in posttranscriptional gene regulation via modulation of translation initiation and mrna metabolism (,, ) Similarly, UL might associate with Us in the cytoplasm of infected cells and take the viral protein kinase to the nucleus with its nuclear transport As reported previously (,, ), HSV- Us played critical roles in viral replication and pathogenesis in mice Therefore, involvement of UL in the proper nuclear localization of Us in cultured cells may in part account for the reduced viral replication and pathogenesis in mice infected with the UL-null mutant virus Downloaded from on January, 0 by guest

29 0 ACKNOWLEDGEMENTS We thank Shihoko Koyama for excellent technical assistance This study was supported by Funding Program for Next Generation World-Leading Researchers and Grants for Scientific Research from Japan Society for the Promotion of Science (JSPS), a Grant for Scientific Research in Priority Areas, a contract research fund for Program of Japan Initiative for Global Research Network on Infectious Diseases and Global COE Program Center of Education and Research for the Advanced Genome-Based Medicine -For personalized medicine and the control of worldwide infectious diseases- from the Ministry of Education, Culture, Science, Sports and Technology (MEXT) of Japan, and grants from the Takeda Science Foundation, Daiichi-Sankyo Foundation of Life Science, the Uehara Memorial Foundation and the Asahi Glass Foundation K S, J A and T I were supported by a research fellowship of JSPS for Young Scientists

30 REFERENCES Asai, R, A Kato, and Y Kawaguchi 00 Epstein-Barr virus protein kinase BGLF interacts with viral transactivator BZLF and regulates its transactivation activity J Gen Virol 0:- Benetti, L, and B Roizman 00 Herpes simplex virus protein kinase US activates and functionally overlaps protein kinase A to block apoptosis Proc Natl Acad Sci U S A 0:- Campbell, R E, O Tour, A E Palmer, P A Steinbach, G S Baird, D A Zacharias, and R Y Tsien 00 A monomeric red fluorescent protein Proc Natl Acad Sci U S A :- Chuluunbaatar, U, R Roller, M E Feldman, S Brown, K M Shokat, and I Mohr 00 Constitutive mtorc activation by a herpesvirus Akt surrogate stimulates mrna translation and viral replication Genes Dev :- Dobrikova, E, M Shveygert, R Walters, and M Gromeier 00 Herpes simplex virus proteins ICP and UL associate with polyadenylate-binding protein and control its subcellular distribution J Virol :0- Donnelly, M, and G Elliott 00 Fluorescent tagging of herpes simplex virus tegument protein VP/ in virus infection J Virol :- Donnelly, M, and G Elliott 00 Nuclear localization and shuttling of herpes simplex virus tegument protein VP/ J Virol :- Donnelly, M, J Verhagen, and G Elliott 00 RNA binding by the herpes simplex virus type nucleocytoplasmic shuttling protein UL is mediated by an N-terminal arginine-rich domain that also functions as its nuclear localization signal J Virol :- Dorange, F, B K Tischer, J F Vautherot, and N Osterrieder 00 Characterization of Marek's disease virus serotype (MDV-) deletion mutants that lack UL to UL genes: MDV- UL, encoding VP, is indispensable for virus growth J Virol :-0 0 Finnen, R L, B B Roy, H Zhang, and B W Banfield Analysis of filamentous process induction and nuclear localization properties of the HSV- serine/threonine kinase Us Virology :- Frame, M C, F C Purves, D J McGeoch, H S Marsden, and D P Leader

31 0 0 0 Identification of the herpes simplex virus protein kinase as the product of viral gene US J Gen Virol ( Pt 0):-0 Fuchs, W, H Granzow, and T C Mettenleiter 00 A pseudorabies virus recombinant simultaneously lacking the major tegument proteins encoded by the UL, UL, UL, and UL genes is viable in cultured cells J Virol :-00 Greco, T M, F Yu, A J Guise, and I M Cristea 00 Nuclear import of histone deacetylase by requisite nuclear localization signal phosphorylation Mol Cell Proteomics Hammerschmid, M, D Palmeri, M Ruhl, H Jaksche, I Weichselbraun, E Bohnlein, M H Malim, and J Hauber Scanning mutagenesis of the arginine-rich region of the human immunodeficiency virus type Rev trans activator J Virol :- Hauber, J, M H Malim, and B R Cullen Mutational analysis of the conserved basic domain of human immunodeficiency virus tat protein J Virol :- Helferich, D, J Veits, J P Teifke, T C Mettenleiter, and W Fuchs 00 The UL gene of avian infectious laryngotracheitis virus is not essential for in vitro replication but is relevant for virulence in chickens J Gen Virol :- Hubner, S, C Y Xiao, and D A Jans The protein kinase CK site (Ser/) enhances recognition of the simian virus 0 large T-antigen nuclear localization sequence by importin J Biol Chem :- Imai, T, J Arii, A Minowa, A Kakimoto, N Koyanagi, A Kato, and Y Kawaguchi 0 Role of the Herpes Simplex Virus Us Kinase Phosphorylation Site and Endocytosis Motifs in Envelope Glycoprotein B in Its Intracellular Transport and Neurovirulence J Virol Imai, T, K Sagou, J Arii, and Y Kawaguchi 00 Effects of phosphorylation of herpes simplex virus envelope glycoprotein B by Us kinase in vivo and in vitro J Virol :- 0 Jans, D A The regulation of protein transport to the nucleus by phosphorylation Biochem J ( Pt ):0- Jans, D A, and S Hubner Regulation of protein transport to the nucleus: central role of phosphorylation Physiol Rev :- Jans, D A, C Y Xiao, and M H Lam 000 Nuclear targeting signal recognition: a

32 0 0 0 key control point in nuclear transport? Bioessays :- Kahvejian, A, Y V Svitkin, R Sukarieh, M N M'Boutchou, and N Sonenberg 00 Mammalian poly(a)-binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms Genes Dev :0- Kato, A, J Arii, I Shiratori, H Akashi, H Arase, and Y Kawaguchi 00 Herpes simplex virus protein kinase Us phosphorylates viral envelope glycoprotein B and regulates its expression on the cell surface J Virol :0- Kato, A, M Tanaka, M Yamamoto, R Asai, T Sata, Y Nishiyama, and Y Kawaguchi 00 Identification of a physiological phosphorylation site of the herpes simplex virus -encoded protein kinase Us which regulates its optimal catalytic activity in vitro and influences its function in infected cells J Virol :- Kato, A, M Yamamoto, T Ohno, H Kodaira, Y Nishiyama, and Y Kawaguchi 00 Identification of proteins phosphorylated directly by the Us protein kinase encoded by herpes simplex virus J Virol :- Kato, K, T Daikoku, F Goshima, H Kume, K Yamaki, and Y Nishiyama 000 Synthesis, subcellular localization and VP interaction of the herpes simplex virus type UL gene product Arch Virol :- Kawaguchi, Y, C Van Sant, and B Roizman Herpes simplex virus alpha regulatory protein ICP0 interacts with and stabilizes the cell cycle regulator cyclin D J Virol :- Klopfleisch, R, J P Teifke, W Fuchs, M Kopp, B G Klupp, and T C Mettenleiter 00 Influence of tegument proteins of pseudorabies virus on neuroinvasion and transneuronal spread in the nervous system of adult mice after intranasal inoculation J Virol :- 0 Kopp, M, B G Klupp, H Granzow, W Fuchs, and T C Mettenleiter 00 Identification and characterization of the pseudorabies virus tegument proteins UL and UL: role for UL in virion morphogenesis in the cytoplasm J Virol :0- Labiuk, S L, L A Babiuk, and S van Drunen Littel-van den Hurk 00 Major tegument protein VP of bovine herpesvirus is phosphorylated by viral US and cellular CK protein kinases J Gen Virol 0:- Leach, N, S L Bjerke, D K Christensen, J M Bouchard, F Mou, R Park, J Baines, T Haraguchi, and R J Roller 00 Emerin is hyperphosphorylated and

33 0 0 0 redistributed in herpes simplex virus type -infected cells in a manner dependent on both UL and US J Virol :0-00 Leader, D P Viral protein kinases and protein phosphatases Pharmacol Ther :- Leader, D P, A D Deana, F Marchiori, F C Purves, and L A Pinna Further definition of the substrate specificity of the alpha-herpesvirus protein kinase and comparison with protein kinases A and C Biochim Biophys Acta 0:- Leopardi, R, C Van Sant, and B Roizman The herpes simplex virus protein kinase US is required for protection from apoptosis induced by the virus Proc Natl Acad Sci U S A :- Lobanov, V A, S L Maher-Sturgess, M G Snider, Z Lawman, L A Babiuk, and S van Drunen Littel-van den Hurk A UL gene deletion mutant of bovine herpesvirus type exhibits impaired growth in cell culture and lack of virulence in cattle J Virol :- Loret, S, G Guay, and R Lippe 00 Comprehensive characterization of extracellular herpes simplex virus type virions J Virol :0- Malim, M H, S Bohnlein, J Hauber, and B R Cullen Functional dissection of the HIV- Rev trans-activator--derivation of a trans-dominant repressor of Rev function Cell :0- Mangus, D A, and A van Hoof 00 Making and breaking the message Genome Biol : 0 McGeoch, D J, and A J Davison Alphaherpesviruses possess a gene homologous to the protein kinase gene family of eukaryotes and retroviruses Nucleic Acids Res :- Meignier, B, R Longnecker, P Mavromara-Nazos, A E Sears, and B Roizman Virulence of and establishment of latency by genetically engineered deletion mutants of herpes simplex virus Virology :- Meredith, D M, J A Lindsay, I W Halliburton, and G R Whittaker Post-translational modification of the tegument proteins (VP and VP) of herpes simplex virus type by glycosylation and phosphorylation J Gen Virol ( Pt ):- Meyer, B E, and M H Malim The HIV- Rev trans-activator shuttles between the nucleus and the cytoplasm Genes Dev :-

34 0 0 0 Morimoto, T, J Arii, M Tanaka, T Sata, H Akashi, M Yamada, Y Nishiyama, M Uema, and Y Kawaguchi 00 Differences in the regulatory and functional effects of the Us protein kinase activities of herpes simplex virus and J Virol :- Morris, J B, H Hofemeister, and P O'Hare 00 Herpes simplex virus infection induces phosphorylation and delocalization of emerin, a key inner nuclear membrane protein J Virol :- Mou, F, T Forest, and J D Baines 00 US of herpes simplex virus type encodes a promiscuous protein kinase that phosphorylates and alters localization of lamin A/C in infected cells J Virol :-0 Mou, F, E Wills, and J D Baines 00 Phosphorylation of the U(L) protein of herpes simplex virus by the U(S)-encoded kinase regulates localization of the nuclear envelopment complex and egress of nucleocapsids J Virol :- Munger, J, A V Chee, and B Roizman 00 The U(S) protein kinase blocks apoptosis induced by the d0 mutant of herpes simplex virus at a premitochondrial stage J Virol :- Munger, J, and B Roizman 00 The US protein kinase of herpes simplex virus mediates the posttranslational modification of BAD and prevents BAD-induced programmed cell death in the absence of other viral proteins Proc Natl Acad Sci U S A : O'Neill, R E, J Talon, and P Palese The influenza virus NEP (NS protein) mediates the nuclear export of viral ribonucleoproteins EMBO J :- Ogg, P D, P J McDonell, B J Ryckman, C M Knudson, and R J Roller 00 The HSV- Us protein kinase is sufficient to block apoptosis induced by overexpression of a variety of Bcl- family members Virology :- Phelan, A, and J B Clements Herpes simplex virus type immediate early protein IE shuttles between nuclear compartments and the cytoplasm J Gen Virol ( Pt ):- Poon, A P, H Gu, and B Roizman 00 ICP0 and the US protein kinase of herpes simplex virus independently block histone deacetylation to enable gene expression Proc Natl Acad Sci U S A 0:- Poon, A P, Y Liang, and B Roizman 00 Herpes simplex virus gene expression is accelerated by inhibitors of histone deacetylases in rabbit skin cells infected with a

35 0 0 0 mutant carrying a cdna copy of the infected-cell protein no 0 J Virol :- Purves, F C, A D Deana, F Marchiori, D P Leader, and L A Pinna The substrate specificity of the protein kinase induced in cells infected with herpesviruses: studies with synthetic substrates [corrected] indicate structural requirements distinct from other protein kinases Biochim Biophys Acta :0- Purves, F C, R M Longnecker, D P Leader, and B Roizman Herpes simplex virus protein kinase is encoded by open reading frame US which is not essential for virus growth in cell culture J Virol :-0 Purves, F C, W O Ogle, and B Roizman Processing of the herpes simplex virus regulatory protein alpha mediated by the UL protein kinase determines the accumulation of a subset of alpha and gamma mrnas and proteins in infected cells Proc Natl Acad Sci U S A 0:0-0 Purves, F C, D Spector, and B Roizman The herpes simplex virus protein kinase encoded by the US gene mediates posttranslational modification of the phosphoprotein encoded by the UL gene J Virol :- Reynolds, A E, B J Ryckman, J D Baines, Y Zhou, L Liang, and R J Roller 00 U(L) and U(L) proteins of herpes simplex virus type form a complex that accumulates at the nuclear rim and is required for envelopment of nucleocapsids J Virol :0-0 Reynolds, A E, E G Wills, R J Roller, B J Ryckman, and J D Baines 00 Ultrastructural localization of the herpes simplex virus type UL, UL, and US proteins suggests specific roles in primary envelopment and egress of nucleocapsids J Virol :- Roux, P P, and J Blenis 00 ERK and p MAPK-activated protein kinases: a family of protein kinases with diverse biological functions Microbiol Mol Biol Rev :0- Ryckman, B J, and R J Roller 00 Herpes simplex virus type primary envelopment: UL protein modification and the US-UL catalytic relationship J Virol :- Sagou, K, T Imai, H Sagara, M Uema, and Y Kawaguchi 00 Regulation of the catalytic activity of herpes simplex virus protein kinase Us by autophosphorylation and its role in pathogenesis J Virol :-

36 0 0 0 Shaner, N C, R E Campbell, P A Steinbach, B N Giepmans, A E Palmer, and R Y Tsien 00 Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp red fluorescent protein Nat Biotechnol :- Siomi, H, H Shida, M Maki, and M Hatanaka 0 Effects of a highly basic region of human immunodeficiency virus Tat protein on nucleolar localization J Virol :0-0 Siomi, H, H Shida, S H Nam, T Nosaka, M Maki, and M Hatanaka Sequence requirements for nucleolar localization of human T cell leukemia virus type I px protein, which regulates viral RNA processing Cell :-0 Sugimoto, K, M Uema, H Sagara, M Tanaka, T Sata, Y Hashimoto, and Y Kawaguchi 00 Simultaneous tracking of capsid, tegument, and envelope protein localization in living cells infected with triply fluorescent herpes simplex virus J Virol :- Tanaka, M, H Kagawa, Y Yamanashi, T Sata, and Y Kawaguchi 00 Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type : viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo J Virol :- Verhagen, J, M Donnelly, and G Elliott 00 Characterization of a novel transferable CRM--independent nuclear export signal in a herpesvirus tegument protein that shuttles between the nucleus and cytoplasm J Virol 0: Walters, M S, P R Kinchington, B W Banfield, and S Silverstein 00 Hyperphosphorylation of histone deacetylase by alphaherpesvirus US kinases J Virol :- Williams, P, J Verhagen, and G Elliott 00 Characterization of a CRM-dependent nuclear export signal in the C terminus of herpes simplex virus type tegument protein UL J Virol :0-0 Wisner, T W, C C Wright, A Kato, Y Kawaguchi, F Mou, J D Baines, R J Roller, and D C Johnson 00 Herpesvirus gb-induced fusion between the virion envelope and outer nuclear membrane during virus egress is regulated by the viral US kinase J Virol :- Yokoyama, A, M Tanaka, G Matsuda, K Kato, M Kanamori, H Kawasaki, H Hirano, I Kitabayashi, M Ohki, K Hirai, and Y Kawaguchi 00 Identification of major phosphorylation sites of Epstein-Barr virus nuclear antigen leader protein

37 (EBNA-LP): ability of EBNA-LP to induce latent membrane protein cooperatively with EBNA- is regulated by phosphorylation J Virol :- Zhang, Y, D A Sirko, and J L McKnight Role of herpes simplex virus type UL and UL in alpha TIF-mediated transcriptional induction: characterization of three viral deletion mutants J Virol :- Downloaded from on January, 0 by guest

38 FIGURE LEGENDS 0 0 Fig Schematic diagram of the genome of wild-type YK0 and YK viruses and the relevant domains of the recombinant viruses in this study Line, linear representation of the YK0 genome carrying a bacmid (BAC) in the intergenic region between UL and UL Line, domains encoding the UL to UL, and Us to Us open reading frames (ORFs) Line, domains of the UL and Us genes Lines -, schematic diagrams of recombinant viruses carrying the BAC used in this study Line, linear representation of the YK genome in which the BAC sequence was excised from the YK0 genome Line, domains encoding the UL to UL, and Us to Us open reading frames (ORFs) Lines -, schematic diagrams of recombinant viruses used in this study in which the BAC sequence was excised Fig Growth curves of recombinant viruses Vero cells were infected at an MOI of with wild-type HSV-(F) (A, D and E), YK (mrfp-ul) (A, B, and C), YK (mrfp-ul/usk0m) (B), YK (mrfp-ul/usk0m-repair) (B), YK (mrfp-ulsa) (C), YK (mrfp-ulsa-repair) (C), YK (mrfp-ulsd) (C), YK(ULSA/ BAC) (D), YK(ULSA-repair/ BAC) (D), YK( UL/ BAC) (E) or YK( UL-repair/ BAC) (E) Total virus from the cell culture supernatants and the infected cells was harvested at the indicated times and assayed on Vero cells

39 0 0 Fig (A) Immunoblots of electrophoretically separated mrfp-ul immunoprecipitates from Vero cells mock-infected (lanes and ) or infected with YK (mrfp-ul) (lanes and ), YK (mrfp-ul/usk0m) (lanes and ) or YK (mrfp-ul/usk0m-repair) (lanes and ) at an MOI of, harvested at h post-infection, immunoprecipitated with anti-rfp antibody and analyzed by immunoblotting with anti-dsred antibody (left panel) or anti-phospho-pka substrate antibody (00G) (right panel) A molecular mass marker (kda) is shown on the left (B) Quantitation of the amount of phosphorylated mrfp-ul, determined from the anti-phospho-pka substrate antibody (00G) immunoblot in (A), relative to the amount of total mrfp-ul, determined from the anti-dsred antibody immunoblot in (A) The data were normalized to the relative amount in YK-infected cells (C) RFP immunoprecipitates of YK-infected cells prepared as in panel A, lane, were either mock-treated (lanes ) or treated with λ-ppase (lanes ) and analyzed by immunoblotting with anti-dsred antibody (left panel) or anti-phospho-pka substrate antibody (right panel) A molecular mass marker (kda) is shown on the left Fig (A) Digital confocal microscope images showing localization of mrfp-ul proteins in infected Vero cells Vero cells were infected with YK (mrfp-ul), YK (mrfp-ul/usk0m) or YK (mrfp-ul/usk0m-repair) at an MOI of, and examined at h post-infection by confocal microscopy Scale bars, 0 µm (B) Quantitation of infected cells exhibiting aberrant accumulation of mrfp-ul at the nuclear rim Infected Vero cells were examined by confocal microscopy as described in (A) and the percent of cells showing aberrant accumulation of mrfp-ul at the nuclear rim was

40 0 determined in a sample of 00 cells infected with each of the recombinant viruses Data are shown as the mean and standard error of three independent experiments (*, P=x0 -, **, P=x0 -, two-tailed Student s t-test) 0 0 Fig (A) Schematic diagram of UL Line, structure of the UL open reading frame The shaded areas represent arginine-rich motifs in the amino-terminal domain of the protein Line, amino terminal domain of UL containing residues -0, which was used in these studies to generate the MBP-UL-P fusion protein Line, amino acid sequence of UL residues - Two sites with the consensus sequence for phosphorylation by Us are underlined and the UL NLS is indicated by an open square Line, the domain of UL gene encoding UL residues -0, which were used in these studies to generate the MBP-UL-P-SA fusion protein Line, the domain of UL gene encoding UL residues -0, which were used in these studies to generate the MBP-UL-P-SA fusion protein (B) Purified MBP-UL-P (lanes and ) and MBP-LacZ (lanes and ) were incubated in kinase buffer containing [γ- P]ATP and purified GST-Us (lanes and ) or GST-UsK0M (lanes and ) for 0 min, separated on a denaturing gel, and stained with CBB A molecular mass marker (kda) is shown on the left (C) Autoradiograph of the gel in panel B (D) Purified MBP-UL-P were incubated in kinase buffer containing [γ- P]ATP and purified GST-Us for 0 min and then either mock-treated (lane ) or treated with λ-ppase (lane ), separated on a denaturing gel, and stained with CBB A molecular mass marker (kda) is shown on the left (E) Autoradiograph of the gel in panel D (F) Purified MBP-UL-P (lanes and ), MBP-UL-P-SA (lanes and ) and MBP-UL-P-SA (lanes and )

41 0 were incubated in kinase buffer containing [γ- P]ATP and purified GST-Us (lanes,, and ) or GST-UsK0M (lanes,, and ) for 0 min, separated on a denaturing gel, and stained with CBB A molecular mass marker (kda) is shown on the left (G) Autoradiograph of the gel in the lower panel Fig Digital confocal microscope images showing localization of mrfp-ul proteins in infected Vero cells Vero cells were infected with YK (mrfp-ul), YK (mrfp-ulsa), YK (mrfp-ulsa-repair) or YK (mrfp-ulsd) at an MOI of, and the cells were examined at h post-infection by confocal microscopy Scale bars, 0 µm (B) Quantitation of infected cells exhibiting aberrant accumulation of mrfp-ul and its mutants at the nuclear rim Infected Vero cells were examined by confocal microscopy as described in (A) and the percent of cells showing aberrant accumulation of mrfp-ul at the nuclear rim was determined in a sample of 00 cells infected with each of the recombinant viruses Data are shown as the mean and standard error of three independent experiments (*, P=x0 -, **, P=x0 -, ***, P=x0 -, two-tailed Student s t-test) Fig Effect of the UL SA substitution and UL-null mutation on HSK and virus growth in the tear films in mice (A) Twenty (A and B) or ten (C and D) five-week-old female 0 ICR mice were infected with x0 PFU YK (ULSA/ BAC) or YK (ULSA-repair/ BAC) (A and B), or with x0 PFU YK ( UL/ BAC) or YK ( UL-repair/ BAC) (C and D) per the eye by corneal scarification and scored for HSK

42 0 every other day for d (A and C) Each data point is the mean and standard error of the observations (A: *; p=x0 -, C: *; p=x0 -, two-tailed Student s t-test) (B and D) Viral titers in the tear films of infected mice at and d post-infection were determined by standard plaque assays Each data point represents the titer in the tear film of one mouse The horizontal bars and figures in parentheses show the average for each group (B: *; p=x0 -, **; P=x0 -, D: *; p=x0 -, P=x0 -, two-tailed Student s t-test) Fig Interaction of Us with UL (A) Vero cells mock-infected (lanes and ) or infected with YK (mrfp-ul) (lanes, and ) at an MOI of for h were harvested, immunoprecipitated with anti-us (lanes and ) or with rabbit normal serum (lane ) and analyzed by immunoblotting with anti-dsred antibody One percent of the amount of Vero whole-cell extract (WCE) used in the reaction mixture for lane was loaded in lane, and one percent of the WCE used for lanes and was loaded in lane A molecular mass marker (kda) is shown on the left (B) Vero cells mock-infected (lanes and ) or infected with YK (mrfp-ul) (lanes and ) or YK (mcherry-ul) (lanes and ) at an MOI of for h were harvested, immunoprecipitated with anti-rfp and analyzed by immunoblotting with anti-us antibody One percent of the amount of Vero WCE used in the reaction mixtures for lanes,, and was loaded in lanes, and, respectively 0 Fig Digital confocal microscope images showing localization of mrfp-ul and VenusA0K-Us proteins in infected Vero cells Vero cells were infected with YK (VenusA0K-Us/mRFP-UL) at an MOI of, and cells were examined at and h

43 post-infection by confocal microscopy Nuclear Us in the columns and is marked Scale bars, 0 µm 0 0 Fig 0 Effect of the UL-null mutation on expression of neighboring UL and UL genes Vero cells infected with wild-type HSV-(F), YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) or YK (VenusA0K-Us/ UL-repair) at an MOI of for h were harvested and analyzed by immunoblotting with anti-us, anti-ul and anti-ul antibodies Molecular mass markers (kda) are shown on the left Fig (A) Digital confocal microscope images showing localization of VenusA0K-Us proteins in infected Vero cells Vero cells were infected with YK0 (VenusA0K-Us), YK (VenusA0K-Us/ UL) or YK (VenusA0K-Us/ UL-repair) at an MOI of and the infected cells were examined at, and h post-infection by confocal microscopy Nuclear Us in the columns and is marked Scale bars, 0µm (B) Quantitation of fluorescence intensity (FI) of VenusA0K-Us in the nuclei relative to that in the cytoplasm of infected Vero cells at h post-infection Infected Vero cells were examined by confocal microscopy as described in (A) Images of ten infected cells were randomly selected for each virus infection Three circular areas, each with the same size, were randomly selected in the cytoplasm and in the nucleus of each of the 0 infected cells and FI of each circular area was analyzed For each virus infection, the relative FI was calculated as the mean FI of the 0 circular areas in the nucleus divided by the mean FI of the 0 circular areas in the cytoplasm The data are shown as the mean and standard error from three independent

44 experiments (*, P=x0 -, **, P=x0 -, two-tailed Student s t-test) The mean Relative FI for YK0 (VenusA0K-Us)-infected cells was normalized to 00%

45 Table Primer sequences used for construction of recombinant viruses Mutation Sequence mrfp-ul UL-SA UL-SA-repair UL-SD ΔUL Us-K0M Us-K0M-repair '-TTCTTTTTTGGGGGGTAGCGGACATCCGATAACCCGCGTCTATCG CCACCATGGCCTCCTCCGAGGACGT-' '-CGGGGGCGGGTGGATGCGCGCCTCCTGCGCCCCGCGGGTTCGCGA GCCGACAAGGCGCCGGTGGAGTGGC -' '-TCGACGGGAAGGCCCGCGAGCCCGACGACGGCGCGCGGCGGAAG CCCCGCCCACATCCCAAGGATGACGACGATAAGTAG-' '-GCCGGGACGCTCGGCGATGGGATGTGGGCGGGGCTTCCGCCGCGC GCCGTCGTCGGGCTCCAACCAATTAACCAATTCTG -' -TCGACGGGAAGGCCCGCGAGCCCGACGACGGCGCGCGTCGGAAGC CCCGCCCACATCCCAAGGATGACGACGATAAGTAG- -GCCGGGACGCTCGGCGATGGGATGTGGGCGGGGCTTCCGACGCGCG CCGTCGTCGGGCTCCAACCAATTAACCAATTCTG- -TCGACGGGAAGGCCCGCGAGCCCGACGACGGCGCGCGGACGAAG CCCCGCCCACATCCCAAGGATGACGACGATAAGTAG- -GCCGGGACGCTCGGCGATGGGATGTGGGCGGGGCTTCGTCCGCGC GCCGTCGTCGGGCTCCAACCAATTAACCAATTCTG- '-GGTCTTTTTCTTTTTTGGGGGGTAGCGGACATCCGATAACCCGCGTC TATCGCCACCATGTAAAGGATGACGACGATAAGTAGGG -' '-ATGCGCGCCTCCTGCGCCCCGCGGGTTCGCGAGCCGACATGGTGGC GATAGACGCGGGTTCAACCAATTAACCAATTCTGATTAG-' '-CAGCAGCCATCCAGATTACCCCCAACGGGTAATCGTGATGGCGGGG TGGTACACGAGCACAGGATGACGACGATAAGTAGGG-' '-GCAGTCGCGCCTCGTGGCTCGTGCTCGTGTACCACCCCGCCATCACG ATTACCCGTTGGGCAACCAATTAACCAATTCTGATTAG-' '-CAGCAGCCATCCAGATTACCCCCAACGGGTAATCGTGAAGGCGGGG TGGTACACGAGCACAGGATGACGACGATAAGTAGGG-' '-GCAGTCGCGCCTCGTGGCTCGTGCTCGTGTACCACCCCGCCTTCACG ATTACCCGTTGGGCAACCAATTAACCAATTCTGATTAG-''

46 UL UL BAC YK0 (wild-type) U L U s UL UL UL Us Us Us Us UL Us YK (VenusA0K-Us/ UL) KAN R I-Sce YK (VenusA0K-Us/ UL-repiar) YK (VenusA0K-Us/mRFP-UL) mrfp YK (mrfp-ul) mrfp YK (mrfp-ul/usk0m) mrfp YK (mrfp-ul/usk0m-repair) mrfp YK (mrfp-ulsa) mrfp S A YK (mrfp-ulsa-repair) YK (mrfp-ulsd) mrfp mrfp S D YK (wild-type) U L UL UL UL UL YK ( UL/ BAC) KAN R I-Sce YK ( UL-repair/ BAC) YK (ULSA/ BAC) S A YK (ULSA-repair/ BAC) Venus 0 K M Venus 0 K M Venus 0 K U s M K 0 Us Us Us Us M Us 0 Fig A Kato et al

47 A 0 0 PFU/ml 0 0 HSV-(F) YK (mrfp-ul) 0 0 B 0 0 PFU/ml C 0 0 PFU/ml D 0 0 PFU/ml E 0 0 PFU/ml YK (mrfp-ul) YK (mrfp- UL/UsK0 YK M) (mrfp- UL/UsK0Mrepair) YK (mrfp-ul) YK (mrfp-ul SA) YK (mrfp-ul SA-repair) YK (mrfp-ul SD) HSV-(F) YK (ULSA/ BAC) YK (ULSArepair/ BAC) HSV-(F) YK ( UL/ BAC) YK ( UL- repair/ BAC) Fig A Kato et al

48 0 Fig A Kato et al mrfp-ul IB:α-DsRed IB:α-00G (kda) λ-ppase C IP:α-RFP YK ( mrfp-ul) YK (mrfp-ul/ UsK0M) YK (mrfp-ul/ UsK0M-repair) 0 Relative amount (%) B mrfp-ul IB:α-DsRed IB:α-00G (kda) Mock YK (mrfp-ul) YK(mRFP-UL/ UsK0M) YK(mRFP-UL/ UsK0M-repair) Mock YK (mrfp-ul) YK(mRFP-UL/ UsK0M) YK(mRFP-UL/ UsK0M-repair) IP:α-RFP A

49 A YK ( mrfp-ul) YK (mrfp-ul/ UsK0M) YK (mrfp-ul/ UsK0M-repair) B UL accumulation at nuclear rim in cells (%) YK (mrfp-u) * YK (mrfp-ul/ UsK0M) ** YK (mrfp-ul/ UsK0M-repair) Fig A Kato et al

50 B (kda) F (kda) MBPlacZ MBP- UL-P MBP- UL-P (wild-type) GST-Us GST-UsK0M CBB-staining GST-Us GST-UsK0M GST-Us GST-UsK0M MBP- UL-P SA GST-Us GST-UsK0M MBP- UL-P SA CBB-staining C MBP- UL-P MBPlacZ MBP- UL-P Autoradiograph GST-Us GST-UsK0M GST-Us GST-UsK0M G GST-Us GST-UsK0M MBP- UL-P (wild-type) GST-Us GST-UsK0M MBP- UL-P SA D (kda) GST-Us GST-UsK0M MBP- UL-P SA Autoradiograph GST-Us CBB-staining GST-Us GST-UsK0M E MBPlacZ MBP- UL-P GST-Us Autoradiograph λ-ppase MBP- UL-P Fig A Kato et al

51 A YK (mrfp-ul) YK (mrfp-ulsa) YK (mrfp-ulsd) YK (mrfp-ulsa repair) Downloaded from B UL accumulation at nuclear rim in cells (%) YK (mrfp-ul) * ** YK (mrfp-ulsa) YK (mrfp-ulsd) *** YK (mrfp-ul SA-repair) on January, 0 by guest Fig A Kato et al

52 A HSK Disease Score YK (ULSA/ΔBAC) YK (ULSA-repair/ΔBAC) * * * * * * * * * B PFU/ml C D HSK Disease Score x0 0x0 YK (ULSA/ΔBAC) YK (ULSA-repair/ΔBAC) * * * Days after infection x0 Days after infection YK (ΔUL/ΔBAC) YK (ΔUL-repair/ΔBAC) * * * * * * * * Days after infection x0 ** * ** * * x0 * PFU/ml 0 0 0x0 x YK (ΔUL/ΔBAC) YK (ΔUL-repair/ΔBAC) x0 Days after infection Fig A Kato et al

53 Fig A Kato et al IB: α-us Us (kda) Mock YK (mrfp-ul) YK (mcherry-ul) Mock YK (mrfp-ul) YK (mcherry-ul) B WCE IP : α-rfp IB: α-dsred mrfp-ul (kda) Mock YK (mrfp-ul) Mock YK (mrfp-ul) YK (mrfp-ul) WCE IP :α-us A IP: α-control

54 hpi hpi YK (VenusA0K-Us/mRFP-UL) VenusA0K-Us mrfp-ul Merge Fig A Kato et al

55 Fig 0 A Kato et al α-ul UL α-ul UL α-us Us Venus-Us (kda) Mock HSV-(F) (Wild type) YK0 (VenusA0K-Us) YK (VenusA0K-Us/ UL) YK (VenusA0K-Us/UL-repair)

56 A YK0 (VenusA0K-Us) YK(Venus YK(VenusA0K A0K-Us/ UL) -Us/ UL-repair) hpi hpi hpi B Relative FI (FI in the nuclei/fi in the cytoplasms) YK0 (VenusA0K-Us) * YK (VenusA0K-Us/ UL) ** YK (VenusA0K-Us/ UL-repair) Fig A Kato et al