Supporting Information

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Chapuis et al /pnas SI Methods Selection of Patients, Targets, Isolation, and Expansion of Melanoma- Specific CTL Clones. Patients were HLA-typed, and their tumors were tested for the expression of melanoma-associated antigens (MART-1, tyrosinase, and gp100). Only patients with previously identified HLA-restricted, melanoma-specific peptides were selected for enrollment in the study (1 3). Between March 2007 and December 2010, 22 patients were enrolled on protocol Fred Hutchinson Cancer Research Center (FHCRC) 2140 and their PBMCs were collected by way of leukapheresis. Because a period of 3 mo was required for the generation of antigen-specific T-cell clones, patients were encouraged to receive alternate treatments in the interval. One patient received melanomaspecific T cells on a different clinical protocol, 8 patients were ineligible to receive T cells (death or development of brain metastasis), 2 patients responded to the alternate treatment deferring T-cell infusion, and 11 patients received melanomaspecific T-cell clones. Antigen-specific T-cell clones were obtained for all 18 enrolled patients for whom manufacturing was initiated. All ex vivo manipulations involving processing of products destined for reinfusion were performed as previously described (4, 5). Before infusions, CTL clones were tested for surface expression of CD3, CD8, CD4, CD45RO, CD28, CD62L, binding to the corresponding MHC-peptide specific multimer, lysis of HLA-matched B-lymphoblastoid cell lines (B-LCL) pulsed with titrating amounts of the relevant peptide, and monoclonality by analysis of TCR Vβ use (6) (Table S1). Treatment Plan. Patients were scheduled to receive 4,000 mg/m 2 of CY administered over 2 d, 72 h, and 48 h before the infusion of melanoma-specific CTL clones/m 2 [determined safe from previous studies (4)]. Eight patients (cohort 1) received LD s.c. IL-2 (500,000 U/m 2 twice daily) within 6 h of the T-cell infusion for 14 d, and three patients (cohort 2) received HD IL-2 i.v. (600,000 IU/kg) every 8 h for a target of 14 total doses. Patients were monitored for toxicities based on Common Toxicity Criteria v4.0 (7), as well as for persistence and function of transferred cells for at least 8 wk after infusion. Staging studies were obtained at 4 and 8 wk as well as at later time points 12 and/or 16 wk after the T-cell infusion. Radiological responses were evaluated after infusion according to RECIST 1.1 criteria (8, 9) (Fig. S2). Cytotoxicity Assays. Cytotoxic responses of HIV antigen-specifict cells were examined as previously described (10). Telomere Lengths. Telomere lengths were measured as previously described (11). T-Cell Tracking in Paraffin-Embedded Blocks. For patient 1, genomic DNA was purified using PureGene or a QIAxtractor System (Qiagen) on both the skin biopsy paraffin-embedded block and infused clone. TCR-γ rearrangements were amplified by multiplex PCR and then size-fractionated on an Applied Biosystems 3130 Sequence Analyzer as described (12). T-Cell Tracking by MHC-Peptide Multimers. Where possible, melanoma-specific MHC-peptide multimers [FHCRC in-house production (13)] were preferentially used to detect transferred CTL clones in PBMCs collected after infusions (Table S1). The sensitivity of multimer staining was fixed at 0.1% of total CD8 + T cells, below which the capacity to distinguish between transferred cells and background was greatly diminished. Persistence was calculated as the last time point at which multimer-positive T cells were twofold background levels or >0.1%. T-Cell Tracking by Quantitative PCR. Primers flanking the CDR3 region of infused melanoma-specific CTL clones were designed as described (14), and genomic DNA isolated from PBMCs was used as a template for quantitative real-time PCR. Clone-specific TCR copies were normalized to β-actin copies assuming each live cell in each sample analyzed contained two copies of β-actin. Total CD8 + T cells were determined by flow cytometry for each sample, and an equation (100/[% total CD8 + T cells in each sample] [TCR copies/{β-actin copies/2} 100]) was used to determine the number of TCR copies per 100 CD8 + T cells. This method can detect as low as 1 TCR copy per 100,000 DNA cell equivalents (0.001%) as determined by serial dilutions of clonal cells in autologous preinfusion PBMCs. Flow Cytometry. Infused autologous CTL clones in PBMCs obtained after transfer were identified by binding to specific multimer constructs (Table S1) and analyzed by flow cytometry after staining with fluorochrome-conjugated mabs to CD3, CD4, CD16, CD19, CD8, CD28, CD27, CD62L, CCR7, CD45RA, CD45RO, CD137 (4-1BB), CD132 [IL-2 receptor (R) γ], CD127 (IL-7Rα), CD57, and PD-1 (BD Pharmingen). Intracellular cytokine expression of IFN-γ, TNF-α, and IL-2 by responding CTLs pulsed for 4 5 h with relevant peptide was assessed as described (15). Cells were analyzed on an LSRII (Becton Dickinson) using FACS-Diva software. ELISpots. Human IFN-γ ELISpot assays were performed as previously described (16) using capture and detection antibodies D1K and 7-B6-1 (10 μg/ml; Mabtech and Nacka), respectively. Results are presented as the mean number of spot-forming cells per 10 5 PBMCs. Plasma Cytokine Levels. Plasma samples were drawn at a preinfusion time point and at days 0, 7, 14, and 21 of the second T-cell infusion. Plasma samples were frozen, thawed, and analyzed simultaneously by the Cytokine Analysis Facility at the FHCRC for IL-7, IL-15, and, in selected cases, IL-2 by sandwich ELISA. Statistical Analysis. Statistical tests were performed with GraphPad Prism software version 3.0 or with the R-package for statistical analysis. Two-tailed signed-rank tests were used to determine P values. 1. Brichard V, et al. (1993) The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 178: Brichard VG, et al. (1996) A tyrosinase nonapeptide presented by HLA-B44 is recognized on a human melanoma by autologous cytolytic T lymphocytes. Eur J Immunol 26: Kawakami Y, et al. (1994) Identification of the immunodominant peptides of the MART-1 human melanoma antigen recognized by the majority of HLA-A2-restricted tumor infiltrating lymphocytes. J Exp Med 180: Wallen H, et al. (2009) Fludarabine modulates immune response and extends in vivo survival of adoptively transferred CD8 T cells in patients with metastatic melanoma. PLoS ONE 4:e Yee C, et al. (2002) Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: In vivo persistence, migration, and antitumor effect of transferred T cells. Proc Natl Acad Sci USA 99: Monteiro J, et al. (1995) Oligoclonality in the human CD8+ T cell repertoire in normal subjects and monozygotic twins: Implications for studies of infectious and autoimmune diseases. Mol Med 1: of5

2 7. Trotti A, et al. (2003) CTCAE v3.0: Development of a comprehensive grading system for the adverse effects of cancer treatment. Semin Radiat Oncol 13(3): Eisenhauer EA, et al. (2009) New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1). Eur J Cancer 45: Schwartz LH, et al. (2009) Evaluation of lymph nodes with RECIST 1.1. Eur J Cancer 45: Riddell SR, et al. (1992) Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones. Science 257: Lansdorp PM (2006) Stress, social rank and leukocyte telomere length. Aging Cell 5: Juarez T, et al. (2005) Analysis of T-cell receptor gene rearrangement for predicting clinical outcome in patients with cutaneous T-cell lymphoma: A comparison of Southern blot and polymerase chain reaction methods. Arch Dermatol 141: Altman JD, et al. (1996) Phenotypic analysis of antigen-specific T lymphocytes. Science 274: Hunder NN, et al. (2008) Treatment of metastatic melanoma with autologous CD4+ T cells against NY-ESO-1. N Engl J Med 358: Papagno L, Almeida JR, Nemes E, Autran B, Appay V (2007) Cell permeabilization for the assessment of T lymphocyte polyfunctional capacity. J Immunol Methods 328(1-2): Scheibenbogen C, et al. (2000) Quantitation of antigen-reactive T cells in peripheral blood by IFNgamma-ELISPOT assay and chromium-release assay: A four-centre comparative trial. J Immunol Methods 244(1-2): of5

3 Fig. S1. Phenotypic and functional characteristics of melanoma-specific CD8 + T-cell clones isolated and expanded for infusion. (A) Lytic activity of each of the melanoma-specific CD8 + T-cell clones to established melanoma cell lines (A375 [HLA-B* ] and/or Mel-526 [HLA-A* ], effector/target ratio = 10:1) and HLA-matched B-lymphoblastoid cell lines (B-LCL) pulsed with decreasing concentrations of specific peptide in a 51 Cr-release assay. No HLA A* melanoma cell line was available for patient (Pt) 4. (B) Expression of CD45RO (Left), CD27 (Center), and CD28 (Right) on melanoma-specific CD8 + T-cell clones (bold line) compared with isotype control (gray area). Inset values represent percentages of CD45RO +, CD27 +, and CD28 + CD8 + T cells, respectively. (C) Expression of CD127, CD62L, and CCR7 (bold line) on a representative CTL clone used for infusion (patient 7, HLA B*4402/Tyr). All clones were otherwise negative for CD45RA, CD62L, CCR7, CD127, CD137, CD132 (IL-2Rγ), CD57, and PD-1. 3of5

4 Fig. S2. Treatment plan. All patients received MART-1 or tyrosinase-specific CD8 + T-cell clones on day 0 ( cells), preceded by 2 g/m 2 of CY on days 3 and 2. Infusions for patients 1 8 were followed by LD IL-2 for 14 d ( IU twice daily). Infusions for patients 9 11 were followed by HD IL-2 (600,000 IU/ kg i.v.) administered every 8 h for a target total of 14 doses. Patients were evaluated for responses 4, 8, and 12/16 wk after infusions. Fig. S3. Increased plasma levels of IL-2, IFN-γ, IL-18, and MCP-1 evaluated after infusions. Plasma samples were obtained before CY, immediately before T-cell infusions, and up to 56 d after T-cell infusions. (A) Plasma levels of IL-2 in patients who received LD IL-2 (Left) and HD IL-2 (Right) increased in a dose-dependent manner. Plasma levels of proinflammatory cytokines IFN-γ (B) and IL-18 (C) measured after CTL infusions. (D) Plasma levels of the proinflammatory cytokine MCP-1 in patients who received LD IL-2 (Left) and HD IL-2 (Right). Note the difference in the y-axis scale: maximum of 2,000 pg/ml (Left) and maximum of 20,000 pg/ml (Right). The lower limit of detection was 3.6 pg/ml for plasma levels of IL-2, IL-18, and Monocyte chemotactic protein-1 (MCP-1), and it was 0.3 pg/ml for IFN-γ. Plasma levels of IFN-α, IL-1α, IL-1β, IL-10, IL-12p70, IL-17, IL-1Rα, IL-21, IL-2Rα, IL-4, IL-5, IL-6, IL-7, IL-8, macrophage inflammatory protein-1α (MIP-1α), TNF-α, and VEGF were evaluated after infusions, and no changes were detected throughout the evaluation period. 4of5

5 Fig. S4. Dynamics of CD4 + T-regs after CY lymphodepletion followed by exogenous IL-2. (A) Percentages of CD4 +, CD127 lo, CD25 hi, and FOXP3 + cells (T-regs) (y axis) plotted over time (x axis) for all patients. Gray lines show individual patients, and filled circles show mean and SD. (B) Absolute numbers of T-regs (y axis) plotted over time (x axis) for all patients. Gray lines show individual patients, and filled circles show mean and SD. (C) Box and whisker plots of percentages of K i -67 expressing cells expressed by (Left to Right) T-regs before treatment (CY and T cells), CD4 + T-effector cells (defined as CD4 + CD25 lo, CD127 hi, FOXP3 cells) before treatment, T-regs 14 d after T-cell infusion, and CD4 + T-effector cells 14 d after T-cell infusion. Bars represent medians. A two-tailed paired signed-rank test was used for statistical analysis. Table S1. Characteristics of infused melanoma-specific CD8 + T-cell clones Patient no. T-cell specificity Class I restriction Epitope Corresponding tetramer TCR Vβ use LD IL-2 1 MART1 HLA-A*0201 AAGIGILTV A*0201/AAGIGILTV-Mart1 Vβ3 2 Tyrosinase HLA-B*4402 SEIWRDIDF NA Vβ8 3 gp100 HLA-A*0201 KTWGQYWQV A*0201/KTWGQYWQV-gp100 Vβ17 4 gp100 HLA-A*0301 ALLAVGATK A*0301/ALLAVGATK-gp100 Vβ22 5 Tyrosinase HLA-A*0201 YMDGTMSQV A*0201/YMDGTMSQV-Tyr Vβ7 6 Tyrosinase HLA-A*0201 YMDGTMSQV *0201/YMDGTMSQV-Tyr Vβ14 7 Tyrosinase HLA-B*4402 SEIWRDIDF NA Vβ7 8 MART1 HLA-A*0201 AAGIGILTV A*0201/AAGIGILTV-Mart1 Vβ7 HD IL-2 9 MART1 HLA-A*0201 AAGIGILTV A*0201/AAGIGILTV-Mart1 Vβ2 10 MART1 HLA-A*0201 AAGIGILTV A*0201/AAGIGILTV-Mart1 Vβ14 11 MART1 HLA-A*0201 AAGIGILTV A*0201/AAGIGILTV-Mart1 Vβ3 NA, not available. Table S2. Telomere lengths of infused melanoma-specific CD8 + T-cell clones Patient no. Age at time of infusion, y Infused CD8 + T-cell clone MTL Estimated normal lymphocyte MTL at age * MTL, median telomere length. *Consistent with previous studies (1, 2), telomere lengths were shorter than in vivo age-matched lymphocyte subpopulations. 1. Shen X, et al. (2007) Persistence of tumor infiltrating lymphocytes in adoptive immunotherapy correlates with telomere length. J Immunother 30: Zhou J, et al. (2005) Telomere length of transferred lymphocytes correlates with in vivo persistence and tumor regression in melanoma patients receiving cell transfer therapy. J Immunol 175: of5

Supplemental materials

Supplemental materials Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Emerging Concepts of Cancer Immunotherapy

Emerging Concepts of Cancer Immunotherapy Emerging Concepts of Cancer Immunotherapy Jeffrey Schlom, Ph.D. Laboratory of Tumor Immunology and Biology (LTIB) Center for Cancer Research National Cancer Institute, NIH Immune Cell Infiltrate in Primary

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Current Tumor Immunotherapy

Current Tumor Immunotherapy Current Tumor Immunotherapy Part 1: On the preclinical and clinical efficacy of the current cancer vaccines. Part 2: The critical role of cancer vaccines in new integrative approaches. The State of the

More information

Developing Novel Immunotherapeutic Cancer Treatments for Clinical Use

Developing Novel Immunotherapeutic Cancer Treatments for Clinical Use Developing Novel Immunotherapeutic Cancer Treatments for Clinical Use Oncology for Scientists March 8 th, 2016 Jason Muhitch, PhD Assistant Professor Department of Urology Email: jason.muhitch@roswellpark.org

More information

Cancer Immunotherapy. What is it? Immunotherapy Can Work! 4/15/09. Can the immune system be harnessed to fight cancer? T CD4 T CD28.

Cancer Immunotherapy. What is it? Immunotherapy Can Work! 4/15/09. Can the immune system be harnessed to fight cancer? T CD4 T CD28. Cancer Immunotherapy CANCER BIOLOGY April 15, 2009 Can the immune system be harnessed to fight cancer? Can the immune system see cancer? What is the best way to turn on the immune system to fight cancer?

More information

Multi-Virus-Specific T cell Therapy for Patients after HSC and CB Transplant

Multi-Virus-Specific T cell Therapy for Patients after HSC and CB Transplant Multi-Virus-Specific T cell Therapy for Patients after HSC and CB Transplant Hanley PJ, Krance BR, Brenner MK, Leen AM, Rooney CM, Heslop HE, Shpall EJ, Bollard CM Hematopoietic Stem Cell Transplantation

More information

Neoadjuvant Nivolumab in Early-Stage, Resectable Non-Small Cell Lung Cancers

Neoadjuvant Nivolumab in Early-Stage, Resectable Non-Small Cell Lung Cancers Neoadjuvant Nivolumab in Early-Stage, Resectable Non-Small Cell Lung Cancers Abstract 8508 Chaft JE, Forde PM, Smith KN, Anagnostou V, Cottrell TR, Taube JM, Rekhtman N, Merghoub T, Jones DR, Hellmann

More information

Releasing the Brakes on Tumor Immunity: Immune Checkpoint Blockade Strategies

Releasing the Brakes on Tumor Immunity: Immune Checkpoint Blockade Strategies Releasing the Brakes on Tumor Immunity: Immune Checkpoint Blockade Strategies Jason Muhitch, PhD MIR 509 October 1 st, 2014 Email: jason.muhitch@roswellpark.org 0 Holy Grail of Tumor Immunity Exquisite

More information

Immunotransplant for Mantle Cell Lymphoma: A phase I/II study demonstrating amplification of tumor-reactive T cells

Immunotransplant for Mantle Cell Lymphoma: A phase I/II study demonstrating amplification of tumor-reactive T cells Immunotransplant for Mantle Cell Lymphoma: A phase I/II study demonstrating amplification of tumor-reactive T cells Joshua Brody MD Division of Oncology Stanford University Medical Center Presenter Disclosure

More information

EBV Infection and Immunity. Andrew Hislop Institute for Cancer Studies University of Birmingham

EBV Infection and Immunity. Andrew Hislop Institute for Cancer Studies University of Birmingham EBV Infection and Immunity Andrew Hislop Institute for Cancer Studies University of Birmingham EBV Introduction Large ds DNA virus Spread by saliva contact Lifelong infection Predominantly B-lymphotropic

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Masashi Takahara,* Manami Miyai,* Mai Tomiyama,* Masato Mutou,* Andrew J. Nicol, and Mie Nieda*,1

Masashi Takahara,* Manami Miyai,* Mai Tomiyama,* Masato Mutou,* Andrew J. Nicol, and Mie Nieda*,1 Copulsing tumor antigen-pulsed dendritic cells with zoledronate efficiently enhance the expansion of tumor antigen-specific CD8 T cells via V 9 T cell activation Masashi Takahara,* Manami Miyai,* Mai Tomiyama,*

More information

Immunotherapy for the Treatment of Cancer

Immunotherapy for the Treatment of Cancer Immunotherapy for the Treatment of Cancer Jason Muhitch, PhD Assistant Professor Department of Urology Department of Immunology Roswell Park Comprehensive Cancer Center Oncology for Scientists March 15,

More information

Interleukin-2 Single Agent and Combinations

Interleukin-2 Single Agent and Combinations Interleukin-2 Single Agent and Combinations Michael K Wong MD PhD Norris Cancer Center University of Southern California mike.wong@med.usc.edu Disclosures Advisory Board Attendance Merck Bristol Myers

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Cancer Immunotherapy: Active Immunization Approaches

Cancer Immunotherapy: Active Immunization Approaches Cancer Immunotherapy: Active Immunization Approaches Willem W. Overwijk, PhD Department of Melanoma Medical Oncology MD Anderson Cancer Center Houston, TX, USA Disclosures No relevant financial relationships

More information

LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies

LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies LAMPvax DNA Vaccines as Immunotherapy for Cancer - Three Case Studies Cancer immunotherapy has emerged as a clinically validated tool for fighting certain kinds of cancers. These therapeutic cancer vaccines

More information

CD8+ cytotoxic T cells can be harvested from a patient with

CD8+ cytotoxic T cells can be harvested from a patient with The new england journal of medicine brief report Treatment of Metastatic Melanoma with Autologous CD4+ T Cells against NY-ESO-1 Naomi N. Hunder, M.D., Herschel Wallen, M.D., Jianhong Cao, Ph.D., Deborah

More information

Micro 204. Cytotoxic T Lymphocytes (CTL) Lewis Lanier

Micro 204. Cytotoxic T Lymphocytes (CTL) Lewis Lanier Micro 204 Cytotoxic T Lymphocytes (CTL) Lewis Lanier Lewis.Lanier@ucsf.edu Lymphocyte-mediated Cytotoxicity CD8 + αβ-tcr + T cells CD4 + αβ-tcr + T cells γδ-tcr + T cells Natural Killer cells CD8 + αβ-tcr

More information

Therapeutic efficacy of MUC1- specific CTL and CD137 costimulation. mammary cancer model. Pinku Mukherjee & Sandra Gendler

Therapeutic efficacy of MUC1- specific CTL and CD137 costimulation. mammary cancer model. Pinku Mukherjee & Sandra Gendler Therapeutic efficacy of MUC1- specific CTL and CD137 costimulation in a spontaneous mammary cancer model Pinku Mukherjee & Sandra Gendler Goal of Immunotherapy Boosting the low level anti-tumor immune

More information

Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma

Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma Goding SR et al. J Immunol 2013; 190:4899-4909 C. Nikolowsky Christian Doppler Laboratory for Cardiac and Thoracic

More information

Cellular Therapy: Pharmacokinetics David Stroncek, MD Chief, Cellular Processing Section DTM, CC, NIH

Cellular Therapy: Pharmacokinetics David Stroncek, MD Chief, Cellular Processing Section DTM, CC, NIH Cellular Therapy: Pharmacokinetics David Stroncek, MD Chief, Cellular Processing Section DTM, CC, NIH 1 Cellular Therapies Cell suspensions used for therapeutic purposes Examples Red Cells Platelets Granulocytes

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Exploring Therapeutic Combinations with anti-ctla-4 Antibody

Exploring Therapeutic Combinations with anti-ctla-4 Antibody Exploring Therapeutic Combinations with anti-ctla-4 Antibody Padmanee Sharma, MD, PhD Associate Professor GU Medical Oncology and Immunology M. D. Anderson Cancer Center isbtc Hot Topic Symposium October

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 13 Effector Responses: Cell- and Antibody-Mediated Immunity Copyright 2013 by W. H.

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

Bioassays for Quality Control of Cell & Gene Therapy Products

Bioassays for Quality Control of Cell & Gene Therapy Products Bioassays for Quality Control of Cell & Gene Therapy Products Erik Rutjens, Cell & Gene Therapy, Novartis Pharma AG CASSS Bioassays, Silver Spring, March2015 CTL019 Introduction CARTs = Chimeric Antigen

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells

ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells BY BENJAMIN JAMES MECKIFF A thesis submitted to the University of Birmingham for the degree of MRes in Cancer Sciences School of Cancer Sciences College

More information

MHC class I MHC class II Structure of MHC antigens:

MHC class I MHC class II Structure of MHC antigens: MHC class I MHC class II Structure of MHC antigens: MHC class I antigens consist of a transmembrane heavy chain (α chain) that is non-covalently associated with β2- microglobulin. Membrane proximal domain

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Ex-Vivo heat shock protein 70-peptide-activated, autologous natural killer cells adoptive therapy: from the bench to the clinic

Ex-Vivo heat shock protein 70-peptide-activated, autologous natural killer cells adoptive therapy: from the bench to the clinic Ex-Vivo heat shock protein 70-peptide-activated, autologous natural killer cells adoptive therapy: from the bench to the clinic isbtc 10-13 November 2005 Valeria Milani, MD, PhD Munich Agenda 1. NK ligands

More information

A second type of TCR TCR: An αβ heterodimer

A second type of TCR TCR: An αβ heterodimer How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

Focus on TILs: Prognostic significance of tumor infiltrating lymphocytes in human melanoma

Focus on TILs: Prognostic significance of tumor infiltrating lymphocytes in human melanoma Cancer Immun 1424-9634Academy of Cancer Immunology Cancer Immunity (2 April 2009) Vol. 9, p. 3 Copyright 2009 by Martin C. Mihm Jr. 090101 Review Focus on TILs: Prognostic significance of tumor infiltrating

More information

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center

General Overview of Immunology. Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center General Overview of Immunology Kimberly S. Schluns, Ph.D. Associate Professor Department of Immunology UT MD Anderson Cancer Center Objectives Describe differences between innate and adaptive immune responses

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

Tumors arise from accumulated genetic mutations. Tumor Immunology (Cancer)

Tumors arise from accumulated genetic mutations. Tumor Immunology (Cancer) Tumor Immunology (Cancer) Tumors arise from accumulated genetic mutations Robert Beatty MCB150 Mutations Usually have >6 mutations in both activation/growth factors and tumor suppressor genes. Types of

More information

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses Li Wang Dartmouth Medical School The B7 Immunoglobulin Super-Family immune regulators APC T cell Co-stimulatory:

More information

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate

Dendritic cell subsets and CD4 T cell immunity in Melanoma. Ben Wylie 1 st year PhD Candidate Dendritic cell subsets and CD4 T cell immunity in Melanoma Ben Wylie 1 st year PhD Candidate Melanoma Melanoma is the 4 th most common cancer in Australia. Current treatment options are ineffective resulting

More information

Prophylactic and Therapeutic Vaccines for Cervical Cancer

Prophylactic and Therapeutic Vaccines for Cervical Cancer Prophylactic and Therapeutic Vaccines for Cervical Cancer Geneva, March 2003 Immune response against cancer? Lymphocytes as killers Lymphocyte Nucleus granules FasL Fas Perforine Granzymes Activation

More information

Tumor responses (patients responding/ patients treated)

Tumor responses (patients responding/ patients treated) Table 1. ACT clinical trial tumor responses and toxicities. a Target antigen Cancer(s) Receptor type Tumor responses (patients responding/ patients treated) Immune-mediated toxicities (patients experiencing

More information

Dissecting therapy-induced T-cell responses in melanoma

Dissecting therapy-induced T-cell responses in melanoma Dissecting therapy-induced T-cell responses in melanoma Tumor-infiltrating lymphocyte (TIL) therapy of melanoma TIL are grown from melanoma tumors Rapid Expansion Infusion of TIL + IL-2 Patient pretreated

More information

Management of Incurable Prostate Cancer in 2014

Management of Incurable Prostate Cancer in 2014 Management of Incurable Prostate Cancer in 2014 Julie N. Graff, MD, MCR Portland VA Medical Center Assistant Professor of Medicine Knight Cancer Institute, OHSU 2014: Cancer Estimates Stage at Diagnosis

More information

MONITORING IMMUNE RESPONSES IN CANCER PATIENTS RECEIVING TUMOR VACCINES

MONITORING IMMUNE RESPONSES IN CANCER PATIENTS RECEIVING TUMOR VACCINES Intern. Rev. Immunol., 22: 283 319, 2003 Copyright # 2003 Taylor & Francis 0883-0185/03 $12.00 +.00 DOI: 10.1080/08830180390206886 MONITORING IMMUNE RESPONSES IN CANCER PATIENTS RECEIVING TUMOR VACCINES

More information

Naive, memory and regulatory T lymphocytes populations analysis

Naive, memory and regulatory T lymphocytes populations analysis Naive, memory and regulatory T lymphocytes populations analysis Jaen Olivier, PhD ojaen@beckmancoulter.com Cellular Analysis application specialist Beckman Coulter France Introduction Flow cytometric analysis

More information

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model

Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Regulatory functions of CD8 + CD28 T cells in an autoimmune disease model Nader Najafian, 1,2 Tanuja Chitnis, 2,3 Alan D. Salama, 1,2 Bing Zhu, 3 Christina Benou, 3 Xueli Yuan, 1 Michael R. Clarkson, 1

More information

Tumor Immunology. Wirsma Arif Harahap Surgical Oncology Consultant

Tumor Immunology. Wirsma Arif Harahap Surgical Oncology Consultant Tumor Immunology Wirsma Arif Harahap Surgical Oncology Consultant 1) Immune responses that develop to cancer cells 2) Escape of cancer cells 3) Therapies: clinical and experimental Cancer cells can be

More information

Therapeutic Cancer Vaccines

Therapeutic Cancer Vaccines Therapeutic Cancer Vaccines Goal for all therapeutic cancer vaccines: To enhance the natural immune response so that it becomes an effective therapy Approaches being investigated in clinical studies: Whole

More information

Madhav V. Dhodapkar, Joseph Krasovsky, Ralph M. Steinman, and Nina Bhardwaj

Madhav V. Dhodapkar, Joseph Krasovsky, Ralph M. Steinman, and Nina Bhardwaj Mature dendritic cells boost functionally superior CD8 + T-cell in humans without foreign helper epitopes Rapid PUBLICATION Madhav V. Dhodapkar, Joseph Krasovsky, Ralph M. Steinman, and Nina Bhardwaj Laboratory

More information

ACTR (Antibody Coupled T-cell Receptor): A universal approach to T-cell therapy

ACTR (Antibody Coupled T-cell Receptor): A universal approach to T-cell therapy ACTR (Antibody Coupled T-cell Receptor): A universal approach to T-cell therapy European Medicines Agency Workshop on Scientific and Regulatory Challenges of Genetically Modified Cell-based Cancer Immunotherapy

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects When Engineering Meets Immunology Engineered Immune Cells for Cancer Therapy : Current Status and Prospects Yong Taik Lim, Ph.D. Nanomedical Systems Laboratory (http://www.nanomedicalsystems.org) SKKU

More information

Effector memory T helper cells secrete IFN-γ upon stimulation with cytokines: a role in chronic inflammation

Effector memory T helper cells secrete IFN-γ upon stimulation with cytokines: a role in chronic inflammation Excerpt from MCS&more Vol 13 1/211 Effector memory T helper cells secrete upon stimulation with cytokines: a role in chronic inflammation rne Sattler 1 *, Ulf Wagner 2, Manuela Rossol 2, Joachim Sieper

More information

CTLA-4 regulates pathogenicity of antigen-specific autoreactive T cells by cell-intrinsic and -extrinsic mechanisms

CTLA-4 regulates pathogenicity of antigen-specific autoreactive T cells by cell-intrinsic and -extrinsic mechanisms Class 15, BBS821: Control of pathogenic self-reactive T cells by co-inhibitory molecules, J. Kang Oct 29, 2015 CTLA-4 regulates pathogenicity of antigen-specific autoreactive T cells by cell-intrinsic

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

Immunotherapy of HNC: immune mechanisms and therapeutic targets

Immunotherapy of HNC: immune mechanisms and therapeutic targets Immunotherapy of HNC: immune mechanisms and therapeutic targets Ourania Tsitsilonis, MD, PhD Department of Biology National & Kapodistrian University of Athens What does the Immune System see in Cancer?

More information

Richard S. Kornbluth, M.D., Ph.D.

Richard S. Kornbluth, M.D., Ph.D. Treatment of established tumors with peritumoral injections of CD40 ligand (CD40L), CpG, poly(i:c), and extracellular ATP in murine models Richard S. Kornbluth, M.D., Ph.D. Disclosure: Richard Kornbluth

More information

NY-ESO SPEAR T-cells in Synovial Sarcoma

NY-ESO SPEAR T-cells in Synovial Sarcoma NY-ESO SPEAR T-cells in Synovial Sarcoma ASCO Update June 6, 2017 Disclaimer This presentation contains forward-looking statements, as that term is defined under the Private Securities Litigation Reform

More information

CHAPTER 18: Immune System

CHAPTER 18: Immune System CHAPTER 18: Immune System 1. What are four characteristics of the specific immune system? a. b. c. d. 2. List the two main types of defense mechanisms and briefly describe features of each. 3. Give examples

More information

Cell adoptive cancer Immunotherapy

Cell adoptive cancer Immunotherapy SCI. Barcelona, 18/11/2016 Cell adoptive cancer Immunotherapy Daniel Benítez Ribas, PhD Dept of Immunology. Hospital Clínic Barcelona Breakthrough of the year 2013 Cancer Immunotherapy Specificity Block

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

2/16/2018. The Immune System and Cancer. Fatal Melanoma Transferred in a Donated Kidney 16 years after Melanoma Surgery

2/16/2018. The Immune System and Cancer. Fatal Melanoma Transferred in a Donated Kidney 16 years after Melanoma Surgery C007: Immunology of Melanoma: Mechanisms of Immune Therapies Delphine J. Lee, MD, PhD Chief and Program Director, Dermatology, Harbor UCLA Medical Center Principal Investigator, Los Angeles Biomedical

More information

A high-throughput single-cell analysis of human CD8 + T cell functions reveals discordance for cytokine secretion and cytolysis

A high-throughput single-cell analysis of human CD8 + T cell functions reveals discordance for cytokine secretion and cytolysis Technical advance A high-throughput single-cell analysis of human CD8 + T cell functions reveals discordance for cytokine secretion and cytolysis Navin Varadarajan, 1 Boris Julg, 2 Yvonne J. Yamanaka,

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Radiation Therapy as an Immunomodulator

Radiation Therapy as an Immunomodulator Radiation Therapy as an Immunomodulator Yvonne Mowery, MD, PhD February 20, 2017 Tumor/Immune System Balance Kalbasi, JCI 2013 UNC-Duke-NC State-Wake Forest Spring 2017 2 RT Can Shift Balance Toward Elimination

More information

Early Induction and Maintenance of Env-Specific T-Helper Cells following Human Immunodeficiency Virus Type 1 Infection

Early Induction and Maintenance of Env-Specific T-Helper Cells following Human Immunodeficiency Virus Type 1 Infection JOURNAL OF VIROLOGY, Feb. 2003, p. 2663 2674 Vol. 77, No. 4 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.4.2663 2674.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Early Induction

More information

were isolated from the freshly drawn blood of healthy donors and ACS patients using the

were isolated from the freshly drawn blood of healthy donors and ACS patients using the Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF-

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Immunity, Volume 38 Supplemental Information Human CD1c + Dendritic Cells Drive the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Chun I. Yu Christian Becker Yuanyuan

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard

More information

The development of T cells in the thymus

The development of T cells in the thymus T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called

More information

Dissecting the immune response to colorectal cancer. Edus H. Warren, MD, PhD Fred Hutchinson Cancer Research Center April 25, 2013

Dissecting the immune response to colorectal cancer. Edus H. Warren, MD, PhD Fred Hutchinson Cancer Research Center April 25, 2013 Dissecting the immune response to colorectal cancer Edus H. Warren, MD, PhD Fred Hutchinson Cancer Research Center April 25, 2013 Increasing evidence suggests that the immune system influences the natural

More information

Microbiology 204: Cellular and Molecular Immunology

Microbiology 204: Cellular and Molecular Immunology Microbiology 204: Cellular and Molecular Immunology Class meets MWF 1:00-2:30PM (*exceptions: no class Fri Sept 23, Fri Oct 14, Nov 11, or Wed Nov 23) Lectures are open to auditors and will be live-streamed

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Tumor Immunology: A Primer

Tumor Immunology: A Primer Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION Justin Kline 1, Long Zhang 1, and Thomas F. Gajewski 1,2 Departments

More information

Chapter 10 (pages ): Differentiation and Functions of CD4+ Effector T Cells Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group

Chapter 10 (pages ): Differentiation and Functions of CD4+ Effector T Cells Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group FIT Board Review Corner September 2015 Welcome to the FIT Board Review Corner, prepared by Andrew Nickels, MD, and Sarah Spriet, DO, senior and junior representatives of ACAAI's Fellows-In-Training (FITs)

More information

Ahmad A. Tarhini, MD, PhD. BS in Biology, American University of Beirut, Doctor of Medicine, Kaunas University of Medicine, 1999

Ahmad A. Tarhini, MD, PhD. BS in Biology, American University of Beirut, Doctor of Medicine, Kaunas University of Medicine, 1999 Overcoming Melanoma Immune Tolerance: Non-specific CTLA-4 Blockade/Interferon-α and Antigen Specific Immunization with TLR-9 Stimulation/Local GM-CSF as Components of a Melanoma Immunotherapeutic Strategy

More information

PEPTIDES AS TUMOR ANTIGENS

PEPTIDES AS TUMOR ANTIGENS REVIEW Cancer Immunotherapy With Peptide-Based Vaccines: What Have We Achieved? Where Are We Going? Giorgio Parmiani, Chiara Castelli, Piero Dalerba, Roberta Mortarini, Licia Rivoltini, Francesco M. Marincola,

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Mass Cytometry Applications for Immunology Research. Pub Note PN 13 01_150505

Mass Cytometry Applications for Immunology Research. Pub Note PN 13 01_150505 Mass Cytometry Applications for Immunology Research Pub Note PN 13 01_150505 Contents Continuum of CD8 + T cell phenotypes revealed by deep profiling with mass cytometry 3 The transcriptional landscape

More information

Introduction to Immunology Part 2 September 30, Dan Stetson

Introduction to Immunology Part 2 September 30, Dan Stetson Introduction to Immunology Part 2 September 30, 2016 Dan Stetson stetson@uw.edu 441 Lecture #2 Slide 1 of 26 CLASS ANNOUNCEMENT PLEASE NO TREE NUTS IN CLASS!!! (Peanuts, walnuts, almonds, cashews, etc)

More information

Stem Cell Sources 2/22/13. Cellular Therapy Today and Tomorrow. Cellular Therapy in HCT. Bone Marrow

Stem Cell Sources 2/22/13. Cellular Therapy Today and Tomorrow. Cellular Therapy in HCT. Bone Marrow 2/22/13 Cellular Therapy Today and Tomorrow Robert S. Negrin, MD Division Chief, Stanford Bone and Marrow Transplant Program Professor of Medicine Cellular Therapy in Clinical Medicine Established Hematopoietic

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,

Immunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity

More information