L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
|
|
|
- Marshall Roberts
- 5 years ago
- Views:
Transcription
1 A MHCI B PD-L1 Fold expression Fold expression No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow cytometry of MHCI expression in Py117 and cells after 1 Gy, 2 Gy, or IFN-γ. Both tumors respond with greater MHCI expression after RT but there is little MHCI response to IFN-γ in the cells. (B) Similarly PD-L1 is increased in both cell lines after radiation but to a much less extent than after IFN γ stimulation (bar represents mean). 1
2 Supplementary Figure 2. Gating strategy of infiltrating leukocytes by flow cytometry. The scatter, live cell, and CD45 gates are shown from PyMT infiltrating leukocytes. Immature myeloid cells (CD45 + CDllb + Gr1 Hi ) are shown in the bottom left panel showing the small population with very high GR1 expression. The lower middle panel shows the macrophage panel (CD45 + CDllb + F4/8 + ) and the lower right shows isotype control with CD11b + cells. 2
3 A B C Py117 RT + CD8 Py117 RT + CD Py117 RT + NK1.1 Volume (mm 3 ) * NT 12Gy Blocking Ab Time (days) Supplementary Figure 3. CD8 + T cells are important to radiation response. (A) Radiation (RT) response after 12 Gy was diminished in wild type C57BL/6 mice treated with CD8 blocking antibody (black curves) compared to 12 Gy of RT with isotype Ab (orange)(*p=4). (B) Blocking CD4 T cells lead to a greater response than RT alone. (C) There was no difference in radiation response when blocking NK cells with the NK1.1 Ab suggesting NK cells do not play a rule in the immune response. (5 mice each, isotype control mice that did not receive radiation are shown in blue; 12 Gy RT was given 13 days after implantation.) 3
4 A B VC CrAxl#4 CrAxl#5 Axl Cr#1 Axl Cr#2 Axl Cr#3 Axl pooled Py117 Axl Cr#4 Axl Cr#5 Isotype Axl Fig. S4 Supplementary Figure 4. Surface expression of Axl was successfully knocked out in CRISPR clones of tumor cells which impacts invasiveness in 3D culture. (A) Flow cytometry of Axl surface expression on wild type cells and 5 different Axl CRISPR clones stimulated with IFN-γ to confirm knockout. (B) Compared to vector controlled tumor cells Axl Cr#4, Cr#5, pooled Axl Cr, and Py117 have less invasion into matrigel 4 days after plating (representative phase contrast images, scale bars = 5 µm). 4
5 A No IFN- + IFN- B CIITA Transcription 8 Axl Cr#2 C Isotype pstat-1 STAT-1 -actin k 1 k VC MHCI (H-2kB) Axl Cr#1 Axl Cr#2 Axl Cr#3 Py117 D Axl Cr#1 + IFN + IFN Axl Cr#1 CIITA mrna/ 18s Py117 Cr vector Axl Cr #1 Axl Cr #2 Loss of Axl doesnt effect PD-L1 Isotype PD-L1 Supplementary Figure 5. Loss of Axl leads to increase in MHCI but no change in PD-L1. (A) In the absence of IFN- γ stimulation MHCI expression is increased in the CRISPR Axl Cr#2 cells compared to parental cells. After overnight stimulation with 25 ng/ml of IFN- γ MHCI is further is induced compared to parental IFN-γ stimulated cells. (B) qrt-pcr of CIITA MHCI co-activator reveals no change in transcription between vector control cells compared to Axl Cr#1 and Cr#2 (Bars= mean and ±s.d.). (C) Western blot of VC, 3 different Axl Cr clones, and Py117 cells reveals greater pstat-1 and STAT-1 levels in knockout cells. (D) Expression of PD-L1 in parental cells in culture is not influenced by Axl Cr#1 knockout cells and remains inducible by IFN- γ. 5
6 A PyMT Signature PanCancer TCGA Cancer Encyclopedia n=9,755 n= B Disease Pearson r Spearman r PanCancer.42.4 Head and Neck Lung (SCC/AC) Melanoma Cervical Prostate Liver Cancer Encyclopedia Axl Expression Fig. S6 Supplementary Figure 6. The PyMT signature significantly correlates with Axl expression in the Pan-Cancer TCGA and Cancer Cell Line Encyclopedia. (A) RNAseq gene expression of the PyMT signature correlation with Axl was significant in the Pan-Cancer RNAseq data set with 9,755 patient samples and the Cancer Cell Line Encyclopedia of all types of cancer cell line gene expression. (B) Pearson and Spearman r-values were calculated for these data sets are listed as well as a selection of certain tumor types from the Pan-Cancer data set (p<.1 for all correlations). 6
7 15 CRISPR Axl Cr#2 in Nude Mice Volume (mm 3 ) 1 5 C57Bl6 NoTx C57Bl6 2Gy Nude NoTx Nude 2Gy Time (days) Supplementary Figure 7. Axl Cr#2 tumors are less responsive to radiation when implanted into immunodeficient nude mice. Axl Cr#2 tumors were implanted into wild type C57Bl6 mice and athymic nude mice, and then treated with 2 Gy of radiation days after implantation. Growth curves reveal that the radiation response is suppressed in nude mice confirming the importance of a T cell response in the radiosensitivity of the Axl Cr#2 tumors (5 mice per treatment group). 7
8 Supplementary Figure 8. Gating scheme for myeloid dendritic cells, CD11b + CD11c + MHCII +. Cells were isolated, labeled, and then gated by flow cytometry on live cells, CD45 + cells, and CD11b + CD11c +, and MHCII +. Isotype controls are included for comparison. Representative gates on CD11c + MHCII + cells are shown. 8
9 Supplementary Figure 9. Gating scheme for functional T cell assay to interrogate cytokine expression by flow cytometry. (A) Scatter gate, TCRβ/live dead cell gate, and T cell gates are shown in upper panels. TNFα and IFN-γ labeling for flow cytometry reveal a significant proportion of cytokine producing cells. Quantitative data for the proportion of CD8 + T cells (B) and CD4 + T cells (C) expressing high levels TNF-α and absent IFN-γ. 9
10 A 1 CD8+ T cell PD1+ B 4 CD8+ to Treg ratio % CD8 T Cells CD8/Treg Gy Axl Cr#1 Axl Cr#1 + 2Gy 2Gy Axl Cr#1 Axl Cr#1 2Gy Axl Cr Pool Axl Cr Pool 2Gy Supplementary Figure 1. T cells are functionally active in Axl knockout tumors with an effector phenotype. (A) PD-1 expression on CD8 + T cells reveals little change in Axl Cr#1 tumors with and without radiation compared to. The proportion of PD-1 + cells is higher in the untreated tumors. (B) The CD8 + T cells to T reg ratio is elevated in after radiation and much greater in Axl Cr pool tumors suggesting greater antitumor activity at the 1 day time point in CRISPR pool tumors compared to wild type tumors and Axl Cr#1 tumors. 1
11 + RT + Immunotherapy CRISPR Axl + RT + Immunotherapy Volume (mm 3 ) 4 2 No RT CTLA-4 + PD1 2Gy 2Gy + CTLA-4 + PD1 Volume (mm 3 ) 4 2 No RT PD1 CTLA-4 + PD-1 2Gy 2Gy + PD1 2Gy + CTLA4 + PD Time (days) Time (days) Supplementary Figure 11. Radiation and immunotherapy is effective in Axl knockout tumors but not wild type tumors. The combination of PD-1 + CTLA Gy RT in Axl Cr#1 tumors is sufficient for improved antitumor response after radiation (right panel from Fig. 5) compared to little to no response in parental tumors. Mice were treated with 2 Gy on day 1 for tumors and 2 Gy on day 14 for Axl Cr#1 when the tumors were similar size. (5 mice per treatment group) 11
12 A Figure 4C Axl Protein Marker * * HSP7 15 k 5 k B Figure 4E Protein Marker * * * -actin Axl Gas6 15 k Protein paxl -actin Marker * * * 15 k 5 k 37 k Merged bright feild C Figure 4K Protein Marker * NF- B-p65 5 k -actin D Supplemental Figure 5C STAT-1 pstat-1 -actin 15 k 1 k 5 k 37 k Supplementary Figure 12. Western Blot analysis with protein markers. All western blots in the figures and supplementary figures are displayed here with a wider view and depicting evidence of protein markers (labeled with a red box). (A) Shows blots from Figure 4C, (B) from Figure 4E, (C) from Figure 4K, and (D) Supplementary Figure 5C. 12
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Appendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In the manuscript Rational Combination of CXCL11-Expressing Oncolytic Virus and PD-L1 Blockade Works Synergistically to Enhance Therapeutic Efficacy
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Immune Checkpoints. PD Dr med. Alessandra Curioni-Fontecedro Department of Hematology and Oncology Cancer Center Zurich University Hospital Zurich
Immune Checkpoints PD Dr med. Alessandra Curioni-Fontecedro Department of Hematology and Oncology Cancer Center Zurich University Hospital Zurich Activation of T cells requires co-stimulation Science 3
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
SUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
NKTR-214 plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology
plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology Jonathan Zalevsky SVP, Biology and Preclinical Development Nektar Therapeutics World Preclinical Congress, 2017
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
SUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)
Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Emerging Concepts of Cancer Immunotherapy
Emerging Concepts of Cancer Immunotherapy Jeffrey Schlom, Ph.D. Laboratory of Tumor Immunology and Biology (LTIB) Center for Cancer Research National Cancer Institute, NIH Immune Cell Infiltrate in Primary
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Fig. S1 A. week 4 week 6
Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
Supporting Information
Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;
Balancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Supplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
Enhanced Cancer Vaccine Effectiveness with NKTR-214, a CD122-Biased Cytokine
Enhanced Cancer Vaccine Effectiveness with NKTR-214, a CD122-Biased Cytokine Jonathan Zalevsky SVP, Biology and Preclinical Development Nektar Therapeutics SMI Cancer Vaccines, September 2017 Nektar Therapeutics
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Immunological alterations in mice irradiated with low doses
Immunological alterations in mice irradiated with low doses "Frédéric Joliot-Curie" National Research Institute for Radiobiology and Radiohygiene, Budapest, Hungary The structure of the immune system INNATE
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells
Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,
Myeloid cell-derived inducible nitric oxide synthase suppresses M1 macrophage polarization
Received 28 Oct 24 Accepted 7 Feb 25 Published 27 Mar 25 DOI:.38/ncomms7676 OPEN Myeloid cell-derived inducible nitric oxide synthase suppresses M macrophage polarization Geming Lu, Ruihua Zhang, Shuo
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
An interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy
CORRECTION NOTICE Nat. Med. 9, 111 113 (13) An interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy Alicia S Chung, Xiumin Wu, Guanglei Zhuang, Hai Ngu, Ian Kasman,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Depletion of FAP + cells reduces immunosuppressive cells and improves metabolism and functions CD8 + T cells within tumors
/, Vol. 7, No. 17 Depletion of FAP + cells reduces immunosuppressive cells and improves metabolism and functions CD8 + T cells within tumors Ying Zhang 1,2, Hildegund C.J. Ertl 2 1 Gene Therapy and Vaccines
Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Supporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.