The AP-I binding site in the feline immunodeficiency virus long terminal repeat is not required for virus replication in feline T lymphocytes

Transcription

1 Journal of General Virology (1993), 74, Printed in Great ritain 1573 The AP-I binding site in the feline immunodeficiency virus long terminal repeat is not required for virus replication in feline T lymphocytes Takayuki Miyazawa, 1 Mariko Kohmoto, 1 Yasushi Kawaguchi, 1 Keizo Tomonaga, ~ Tomoko Toyosaki, 1 Kazuyoshi Ikuta, 2 Akio Adachi 3 and Takeshi Mikami 1. 1 Department of Veterinary Microbiology, Faculty of Agriculture, The University of Tokyo, Yayoi, unkyo-ku, Tokyo 113, ~ Section of Serology, Institute of Immunological Science, Hokkaido University, Kita-ku, Sapporo 060 and 3 Department of Viral Oncology, Institute for Virus Research, Kyoto University, Sakyo-ku, Kyoto 606, Japan Sequences of 31 bp containing putative AP-1 and AP-4 binding sequences in the U3 re#on of the feline immunodeficiency virus (FIV) long terminal repeat (LTR) were deleted and the basal promoter activity of the LTR was measured by the chloramphenicol acetyltransferase (CAT) assay. The activity of the FIV LTR was reduced in Fells catus whole foetus 4 (fcwf-4) cells and Crandell feline kidney cells by this deletion. Cotransfection of murine c-fos or c-jun expression plasmids with the FIV LTR-CAT reporter plasmid into fcwf-4 cells revealed that FIV LTR could be activated by c-fos but not c-jun in the cells. The mutated LTR was introduced into an infectious molecular clone of FIV and the replication rate and the cytopathogenic activity of the mutant were compared with those of the wild-type in two feline CD4-positive T lymphoblastoid cell lines. It was found that the rate and activity of the mutant were almost the same as those of the wild-type. From these data, we conclude that the 31 bp fragment is important for achieving maximal expression of the FIV genome, but not required for the replication of FIV in feline T lymphocytes. Introduction Feline immunodeficiency virus (FIV) (Pedersen et al., 1987; Yamamoto et al., 1988) is an exogenous retrovirus of the Lentivirus genus whose other genus members include visna virus, caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus, bovine immunodeficiency-like virus, simian immunodeficiency virus and human immunodeficiency virus (HIV) (for a review see Narayan & Clements, 1990). The control of lentivirus gene expression has been extensively studied in the primate lentiviruses. Replication of HIV is regulated by virally encoded proteins, such as the tat, rev and nef products, and by cellular transcriptional factors, all of which modulate viral gene expression. The locations of cis-acting DNA regulatory sequences in the HIV long terminal repeat (LTR) that mediate the effects of tat and of the cellular transcriptional factors, such as SP1 and NF~c, have been determined (for a review see Cullen & Green, 1989). Recently, we and others found tat and rev gene-like sequences in the FIV genome (Phillips et al., 1990; Maki et al., 1992) and demonstrated the presence of rev gene activity in FIV (Kiyomasu et al., 1991; Phillips et al., 1992). However, the trans-activator gene activity of the tat-like gene remains obscure (Sparger et al., 1992). In the U3 region of FIV LTR, many putative binding sites of enhancer/promoter proteins such as those for AP-1, AP-4, C/EP and ATF have been reported (Phillips et al., 1990; Miyazawa et al., 1991). Of these, AP-1 and AP- 4 binding sites are also present in the LTRs of visna virus and CAEV (Hess et al., 1986), and have been shown to be critical for efficient transcription of visna virus using sequential deletion mutants and linker scanner mutants of the LTR (Hess et al., 1989). Recently, Sparger et al. (1992) reported that mutations of the FIV LTR affecting the first AP-4, AP-1 and ATF sites resulted in decreased basal activity in Crandell feline kidney (CRFK) and G355-5 cells. Moreover, using 5' sequential deletion mutants of the LTR, we found that in Felis catus whole foetus-4 (fcwf-4) cells deletion of the 82 nucleotides from the 5' end (deletion to -133, relative to the cap site) caused no reduction in promoter activity, whereas deletion to caused nearly one-fifth reduction of the activity and further deletion to -79 reduced activity to background levels (Kawaguchi et al., 1992). These data suggested that the sequence between -133 and -79 which contains putative AP-1, AP-4 and C/EP binding sites is important for the basal promoter activity of the FIV LTR in fcwf-4 cells. AP-1 and AP-4 sites have been found in association with other enhancers, and AP-1 and AP-4 have been shown to cooperatively activate transcription of simian virus 40 in vitro (Mermod et al., 1988). Therefore, both SGM

2 1574 T. Miyazawa and others the AP-1- and the adjacent AP-4-related sequences are expected to be important for the promoter activity of the FIV LTR. In this study, we examined the effects of internal deletions of the FIV LTR which contains both AP-Iand the adjacent AP-4-related sequences on the basal promoter activity in fcwf-4 and CRFK cells and on the replication efficiency and cytotoxicity of FIV in two feline CD4-positive T lymphoblastoid cell lines. Furthermore, we examined the responsiveness of FIV LTR to AP-1 by transfection of fcwf-4 cells. Methods Cell culture. Fcwf-4 (Jacobse-Geels & Horzinek, 1983) and CRFK cells (Crandell et al., 1973) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum (FCS). MYA-1 (Miyazawa et al., 1989b, 1992b) and FeL-039 (Tokunaga et al, 1992) cells were maintained in RPMI 1640 growth medium supplemented with 10% FCS, antibiotics, 50 IXM-2-mercaptoethanol, 2 ~tg/ml polybrene and 100 units/ml of recombinant human interleukin-2 (IL-2) at 37 C in a humidified atmosphere of 5 % CO 2 in air. DNA constructs. The chloramphenicol acetyltransferase (CAT) construct under the control of the LTR of FIV, termed ptm1cat, was previously described (Kawaguchi et al., 1991). It was made by placing FIV LTR from the infectious molecular clone of FIV strain TM1 (pftm191cg) (Miyazawa et al, 1989a, 1991) in front of the CAT gene of phdcat which contains the CAT gene and a poly(a) signal (Shibata et al., 1990a, b). To construct deletion reporter plasmids of FIV LTR, psptm1 was first generated by insertion of FIV TM1 LTR prepared from ptm1cat into the psp72 vector (Promega) whose PvuII site was destroyed beforehand by digestion with XhoI and HindlII followed by treatment with T4 DNA polymerase for bluntending and T4 DNA ligase for ligation. Plasmids psptm1an and psptm 1APv were generated from psptm1 by deletion of a amhi- NheI fragment and a PvulI fragment of the U3 region of FIV LTR, respectively. After these deletions, both CAT gene and poly(a) signals from ptm1cat were introduced into psptm1, psptm1an and psptm1apv, which were then designated psptm1cat, TM1 TM1AN TMI~h~ TC~GAAGATTAT'rGGGATCCTGAAGAAATAGAGAAAATGCTQATGGACTQAOGGC TGGGAAGATTATTGGGATC... TGGGAGGATTATTGGGATCCTQAAGAAATAGAGAAA~TCIC'I~ATGGACTGAGGGC _~P-4 AP-1 TM1 GTACATAAACAAGTGACAGATGG~T~AGTTAAATGC TM1AN... C TMIAPv GTACATAAACAAGTGACAGA'IXIGAAAA o -15o -14o -iso -~zo -t 1o AP-4 c/esp C/EP ATF TM1 TA(~--~C~AA~CCACA~CCTATGTAAAGCTTC~~ TM1AN TAG[CAGC~AACCGC/~AAACCACAjTCCTATGTAAAGCTTGCCGAIYGACO, I~ TM1 TMIAN TMIAPv TATA ATC'rTGCTCCATTGTAAGAGTJ~--~CAGTGTTT'I'I~AAAGCTTCGAG ATCTTGCTCCATTGTAAGAGTAIr ATAA[CCAGTGTTTTTTAAAGCTTCGAG ATCTTGCTCCATTGTAAGAGT AA[T_~_A~CAG~AAAGCTTCGAG Fig. 1. Nucleotide sequence of the U3 region of the deletion plasmids psptm 1 CAT (TM 1), psptm 1ANCAT (TM 1AN) and psptm I APvCAT (TM 1APv). The recognition sequences of enhancer and promoter proteins and transcription initiation signal (TATA box) are boxed: AP-1 (TGAGTCA), AP-4 (CAGCTG), C/EP [(T/A)AACC(A/G)CA], ATF (TGACGT) and TATA box (TATAA). psptm1ancat and psptm1apvcat, respectively. The U3 regions of the LTR of these plasmids are shown in Fig. 1. ph1cat which contains the CAT gene under the control of the LTR of HIV-I was described previously (Adachi et al, 1986; Shibata et al, 1990a, b). The phdcat was used as a negative control reporter plasmid. To introduce the mutated and intact LTRs into an infectious molecular clone of FIV, the amhi fragment prepared from the infectious molecular clone of FIV strain TM2, termed ptm219 (Kiyomasu et al., 1991; Maki et al., 1992), was introduced into the amhi sites of psptm1 and psptm1apv, and designated pstm2 and pstm2d 1, respectively. To generate pstm2d2, the SacI fragment of pstm2d1 which contains the 5' LTR of the clone was subcloned into a Pvull site-destroyed psp72, and then the small PvulI fragment in the LTR was deleted. The deleted SacI fragment was substituted with the SacI fragment of pstm2d1. To make deletion mutants of ptm219, ptm219 was digested with restriction enzymes indicated in Fig. 5, and religated with T4 DNA ligase. prsvc-fos and prsvc-jun are expression vectors of murine c-fos and c-jun, in which expression of c-fos or c-jun is regulated by the Rous sarcoma virus (RSV) LTR (Todokoro & Ikawa, 1990). prvsv, which contains the RSV LTR and a poly(a) signal, was used as a control. Transfection of plasmid DNA. For transfection of plasmid DNA, cells were plated in six-well dishes 1 day before transfection. Plasmid DNAs were transfected by the calcium phosphate coprecipitation method (Graham & van der Eb, 1973; Wigler et al., 1979). After 4 h transfection, the cells were washed with PS and glycerol-shocked, and then fresh medium was added. CAT assay. For the CAT assay, cell monolayers in each well of sixwell dishes were harvested by scraping 48 h after transfection. After one wash with cold PS, the cells were lysed by freezing and thawing four times in 100 pl of 250 mm-tris-hc1 ph 7.8. Cell debris was centrifuged for 5 min at 4 C, and various amounts of each extract were assayed for CAT activity (Gorman et al., 1982) by the solvent partition method (Neumann et al., 1987). In brief, a 240 gl reaction mixture containing 100 mm-tris-hcl ph 7.8, 1.0 mm-chloramphenicol, 3.7 kq of [14C]acetyl coenzyme A (De Pont) and the cell extract was overlaid with 5 ml of scintillation fluid (Econofluor; Du Pont). Reactions were carried out at 37 C and the production of radioactively labelled acetylchloramphenicol was monitored by counting in a liquid scintillation counter. The CAT activity of each reporter plasmid was presented as the net d.p.m, of product formed/h. All the CAT assay data reported in this paper are from the points in the linear range of the assay. Virus infection. MYA-1 and FeL-039 cells (1.5 x l0 s cells) were infected with FIV derived from the infectious molecular clones. The cells were seeded at cells/ml in growth medium. The cell numbers were adjusted to cells/ml in fresh growth medium at the indicated time. Reverse transcriptase (RT) activity assay. The Mg2 -dependent RT activities in cell culture supernatants were assayed as described previously (Ohta et al, 1988). Indirect immunofluorescence (IF) assay. For detection of FIV antigens in cell cultures, an indirect IF assay was performed as described previously (Miyazawa et al., 1989a). PCR. For amplification of FIV LTRs, an antisense primer (5' GTCCCTGTTCGGGCGCCAACT 3", nucleotides 381 to 386) and a sense primer (5" CAAAAGAAAAAAGGGTGGACTG 3', nucleotides 9091 to 9112) were synthesized corresponding to the primer binding site and the polypurine tract of FIV, respectively. The sequences of primers were derived from the sequence of FIV TM2 (Maki et al., 1992). PCR

3 Effects of a partial deletion of FIV LTR 1575 was carried out by the method of Saiki et al. (1988) in a 50 lal reaction mix overlaid with an equal volume of mineral oil. A GeneAmp PCR Reagent kit (Perkin-Elmer Cetus) was used for the reactions. Amplification proceeded for 30 cycles in a Thermal Cyclic Reactor Model TC-100 (Hoei Science). One cycle consisted of incubations at 94, 64 and 72 C for 1, 1 and 2 min, respectively. After amplification, a 5 lal sample from the 50 ~tl volume reaction mixture was electrophoresed on a 2 % agarose gel (in Tris-borate EDTA buffer). (a) 800 g "! 600 "~ 400 Results 200 Effects of partial deletions of FIV LTR on basal promoter activity Previously, we reported that the FIV LTR-CAT plasmid, ptm1cat, can efficiently produce CAT in fcwf-4 cells by gene transfection (Kawaguchi et al., 1991, 1992; Miyazawa et al., 1992a). In this study, we used another FIV LTR-CAT plasmid, psptm1cat, for deletion analysis. Preliminary studies revealed that the psptm1cat can produce CAT as efficiently as ptm 1 CAT after transfection of the plasmid into fcwf-4 and CRFK cells. We examined the effects of internal deletions of FIV LTR which contains the AP-1- and the adjacent o (b) Jan - Fos 8 6 > '~ 4 TM1 + TM1APv + + HIV- 1 Control (a) o CL Q ~ 25 e~ ~ o (b) o TM1 TM1AN TM1APv HIV-1 Control Fig. 2. asal promoter activity of FIV LTR and its deletion mutants. Each plasmid (5 lag) was transfected into fcwf-4 (a) and CRFK (b) cells. Two days after transfection, the CAT production in the cells was monitored. CAT expression relative to the level obtained from psptm 1 is shown. Three independent experiments were performed, and the average and the S.D. are presented. For the reporter LTR-CAT constructs, psptm1cat (TM1), psptm1ancat (TM1AN), psptm1apvcat (TM1APv), ph1cat (HIV-1) and phdcat (control) were used. TM 1 TM 1APv HIV- 1 Control Jun Fos Jun Fos Jun Fos Jun Fos Fig. 3. Responsiveness of FIV LTR to murine c-fos and c-jun. Reporter plasmid (2 lag) was transfected with 5 lag of prvsv, prsvcfos or prsvc-jun onto fcwf-4 cells, psptm1cat (TM1), psptm1apvcat (TM1APv), ph1cat (HIV-1) and phdcat (control) were used as the reporter LTR-CAT constructs. (a) The level of CAT activity expressed relative to that obtained by cotransfection with psptm1cat and prvsv. (b) The fold activation by prsvc-fos or prsvc-jun for each reporter plasmid. Three independent experiments were performed, and the average and the S.D. are presented. AP-4-related sequences on the basal promoter activity in fcwf-4 and CRFK cells. These cells are not susceptible to infections by FIV strains TM1 and TM2, although infectious FIV particles are produced rather efficiently by transfection of infectious molecular clones of FIV (Miyazawa et al., 1992a). The psptm1cat and two deleted mutants, psptm1ancat and psptm1a- PvCAT, were introduced into the cells, and the relative CAT activity of these plasmids was determined. The psptm 1ANCAT and psptm 1APvCAT were made by deleting a 90 bp fragment (positions to - 107) and a 31 bp fragment (positions to - 103), respectively (Fig. 1). The levels of CAT activity of the psptm1a- NCAT and psptm1apvcat plasmids were rather

4 1576 T. Miyazawa and others 120 loo..> '~ 80 E- "< 60 = 40 '~ 20 0 TM l TM 1AN TM1APv HIV- 1 TM _ + _ + Control _ + _ Fig. 4. Relative CAT production by various LTR-CAT constructs in CRFK cells. Reporter plasmid (2 lag) was transfected with 9 lag of ptm219, or pfltr, into CRFK cells, psptm1cat (TM1), psptm1ancat (TM1AN), psptm1apvcat (TMIAPv) and ph 1 CAT (HIV- 1) were used as the reporter LTR-CAT constructs. The level of CAT activity is expressed relative to that obtained by cotransfection with psptm1cat and pfltr. Three independent experiments except for ph 1 CAT (which was transfected six times) were performed, and the average and the S.D. are presented. lower than that of psptm1cat (about one-fifth reduction) and both deleted plasmids showed almost the same activity in fcwf-4 cells (Fig. 2a). A similar result was obtained in CRFK cells (Fig. 2b). These results indicated that the 31 bp fragment that contains the AP- 1- and AP-4-related sequences is important for the basal promoter activity of the FIV LTR in fcwf-4 and CRFK cells. Activation of FIV LTR by c-fos The enhancer protein AP-1 consists of the products of the nuclear proto-oncogenes c-jun and c-fos (for a review see Curran & Franza, 1988); the c-fos gene product (c- Fos) combines with the c-jun gene product (c-jun) and then the c-jun/c-fos heterodimer is able to bind to the AP-I binding site more strongly than the monomer, or the homodimer of c-jun; c-fos monomer can not bind to the AP-1 site and can not form a homodimer (Halazometis et al., 1988; Sassone-Corsi et al., 1988). To examine the responsiveness offiv LTR to AP-1, a 2 ~tg sample of psptm1cat, psptm1apvcat, ph1cat (HIV-1 LTR-CAT construct) or phdcat (a promoter-less control) was cotransfected with 5 ~tg of expression plasmid of murine c-fos or c-jun into fcwf-4 cells. When murine c-fos was over-expressed, the level of CAT production of psptm1cat was enhanced about sixfold (Fig. 3). However, psptm1apvcat and ph1cat expressed lower activation regardless of cotransfection with prsvc-fos. When c-jun was over- expressed, the level of CAT production of psptm 1 CAT was reduced to one-fourth. On the other hand, 0 l kb TM219 TM-Nd TM-Ec TM-EN TM-g TM-N I pol,', I revl i / l Ec g Ec g Nd l llll II m / Control il Relative CAT expression Fig. 5. Structure of the various molecular clones of FIV used in this study (left) and the relative CAT production by psptm1cat in the presence of the effector plasmids indicated to the right. A schematic representation of the FIV genome organization with deletions of various lengths introduced is shown. All deletion mutants were constructed by digesting an infectious molecular clone of FIV, termed ptm219, with the restriction enzymes indicated and resealing with T4 DNA ligase, psptm1cat (2 lag) was transfected with 9 lag of each effector plasmid into CRFK cells. The level of CAT activity is expressed relative to that obtained by cotransfection with psptm1cat and pfltr (control). Three independent experiments were performed, and the average and S.D. are presented. Ec, EcoRI; g, glli; Nd, NdeI.

5 - 159 Effects of a partial deletion of FIV LTR 1577 psptm1 ps, v PP ptm219 ~ gag pstm2 pstm2d2 PP pol env ]: ~ puc19 PP,.~'~G~" ~" ~ ia) I ~... ( e ) ~)~ Fig. 6. Construction of the infectious molecular clones containing intact and deleted LTRs of FIV. Details are described in Methods. LTRs offiv TM1 (II) and TM2 ([3) strains are shown., amhi; P, PvulI. psptm 1APvCAT expressed half-reduction ph1cat slight augmentation (Fig. 3). Suppression of the activity of FIV LTR by FIV clones and To assess trans-activation potentials of FIV, the CAT activity in cells cotransfected with the FIV LTR-CAT constructs and an FIV infectious clone (ptm219) was compared with that observed in cells transfected with reporter plasmids and a control plasmid (pfltr) that contains only one FIV LTR. Contrary to our expectation, ptm219 suppressed the activity of the FIV LTR in both CRFK (Fig. 4) and fcwf-4 cells (data not shown). The activity of the two deleted reporter plasmids was also suppressed by ptm219; however, HIV LTR was not affected. When psptm1cat was transfected with several deletion mutants of FIV (indicated in Fig. 5) into CRFK cells, the suppressive effect disappeared on destruction of the rev gene (Fig. 5). In addition, the activity of the FIV LTR was not affected in a deletion mutant that lacks the open reading frame (ORF) A (putative tat). Effect of the deletion of FIV LTR on viral replication Mutated and intact LTRs (psptm1apv and psptm1) were introduced into the infectious molecular clone of FIV TM2, and the replication rates and cytotoxicity were compared in MYA-1 and FeL-039 cells. These cells are feline CD4 CD8- T lymphoblastoid cell lines and sensitive to FIV (Miyazawa et al., 1989b, 1992b; Tokunaga et al., 1992). The constructs pstm2d2 and pstm2 have deleted LTRs and intact LTRs on both sides of the genome, respectively (Fig. 6). We could not introduce the LTRs into the infectious molecular clone of FIV strain TM 1 because of the instability of the clones in Escherichia coil The LTR of strain TM2 differed from "~ 70 t~ O i Time after infection (days) 9 i ( h. ~ Fig. 7. Replication kinetics and cytopathic effects associated with infections induced by virus derived from the infectious clones. MYA- 1 (a to d) and FeL-039 (e to h) cells were mock-infected (11) and infected with viruses derived from pstm2 ( ) and pstm2d2 (&). Virus replication was monitored by the RT assay (a, e) and indirect IF assay (d, h). Cytopathogenic activity was monitored by dye-exclusion (b, c, e,f). that of strain TM1 only at positions -138 (G to A) and (T to C) (Miyazawa et al., 1991 ; Maki et al., 1992) and both the LTRs of TM 1 and TM2 showed almost the same promoter activity in fcwf-4 and CRFK cells (unpublished data). When 10 gg of each clone was transfected into CRFK cells, the amount of RT activity produced by pstm2d2 (mutated clone) (5-6 x 104 c.p.m./ml) was as high as that by the clone of the pstm2 (wild-type) (5.5 x 104 c.p.m./ml) after transfection. When the equivalentamounts ofcell-free progeny viruses ( l "5 x 104 c.p.m. of RT activity) produced by each clone were inoculated onto MYA-1 and FeL-039 cells, the mutant virus grew as well as the wild-type in these cells as determined by RT activity assay (Fig. 7a, e) and indirect IF assay (Fig. 7d, h). When the viable cell percentages and numbers were examined at different times after infection, the

6 1578 T. Miyazawa and others cytopathogenic activity of the mutant virus was similar to that of the wild-type (Fig. 7 b, c, f, g). To rule out the possibility of cross-contamination of viruses from pstm2 and pstm2d2 during the infection experiments, PCR was performed to amplify the LTRs from the extrachromosomal DNA of the infected cells after final sampling. All of the amplified DNA fragments were of the predicted size, confirming that no cross-contamination had occurred (data not shown). Discussion In the present study, we examined the effects of deletions containing AP-1- and AP-4-related sequences in the FIV LTR on the expression of FIV. The deletion of the small 31 bp PvuII fragment (- 133 to - 103) resulted in decreased basal activity in fcwf-4 and CRFK cells, indicating the existence of a functional cis-acting element in these sequences. These results were consistent with the findings reported by Sparger et al. (1992) and Kawaguchi et al. (1992). Next, we examined the influence of c-jun and c-fos on the basal activity of FIV LTR in fcwf-4 cells using murine c-jun and c-fos since feline c-jun and c-fos are not available. We found that the FIV LTR could be activated by murine c-fos but not by murine c-jun. The level of expression of endogenous c-jun and c-fos in fcwf-4 cells has not been examined, but the reduced activity of the FIV LTR lacking the putative AP-1 site suggests that both c-jun and c-fos are constitutively produced in these cells. After transfection of the murine c-fos expression vector, it is hypothesized that the exogenous c-fos binds endogenous feline c-jun monomer or homodimer in the cells, since the c-fos protein can not form homodimers (Halazometis et al., 1988). As a result, the amount of c-jun/c-fos heterodimer increased and the resultant heterodimer binds to the AP-1 site to enhance the promoter activity of FIV LTR. On the other hand, by over-expression of murine c-jun, it might dimerize with feline c-fos or c-jun to form an inactive dimer, thus resulting in suppression of the promoter activity. Furthermore, the responsiveness of the LTR to c-fos and c-jun was reduced after the deletions of the AP-1 site, suggesting that these factors modulate activity through this site. Evidence that FIV LTR can be activated by AP-1 (c- Jun/c-Fos) suggests that replication of FIV might be affected by the expression of c-fos and/or c-jun in the infected cells. It has been reported that the enhancement of c-fos expression is associated with the activation of macrophages (Higuchi et al., 1988) and that tumour necrosis factor ~ (TNF-~), which is secreted by macrophages, stimulates prolonged activation of c-jun expression (renner et al., 1989). In addition, interleukin- 1 (IL-1) enhances the expression of c-jun and the antigenic signal enhances expression of c-fos (Muegge et al., 1989). Therefore, immunological modulators such as IL-1 and TNF-~ may trigger or enhance the replication of FIV in vivo. Sparger et al. (1992) reported that the FIV LTR can be activated by infectious clones of the FIV Petaluma and PPR strains, and that by expression of ORF 2 (referred to here as ORF A) which is considered to be the tat gene of FIV, the LTR can be activated very weakly in CRFK cells. However, it is obvious from their data that the activity of the FIV LTR was slightly suppressed by the expression plasmid containing ORF A, env and rev driven by simian virus 40 early promoter (Sparger et al., 1992). In the present study, we could not detect transactivator gene activity and found instead a suppressive effect similar to the nef gene activity of primate lentiviruses. We can not explain these contradictory results at present; however, they might be due to differences in the FIV strains used. This suppressive activity disappeared on destruction of the rev gene of FIV (Kiyomasu et al., 1991; Phillips et al., 1992). It is possible that either the rev or env gene product mediates the suppressive effect directly or indirectly on the LTR. Furthermore, the fact that the suppressive effect was unaffected by deletion of the putative AP-1- and AP-4- binding sequences suggests that the target of the effect is located at other sites of the LTR. The activity of the FIV LTR was not affected by deletion mutants of ORF A, indicating that the trans-activator gene activity oforf A is quite weak, if it exists. In addition, we found that the mutated infectious clone of FIV TM2 with a non-functional ORF A produced RT levels as high as that of the wild-type by transfection into CRFK cells (unpublished data). Further studies will be required to clarify the function of ORF A. To evaluate the effect of deletion of the 31 bp LTR fragment on virus replication, we compared the replication efficiency of the infectious clone of FIV with that of the deleted mutant. Contrary to our expectations, pstm2d2 (deleted mutant of the infectious clone) produced RT as efficiently as the wild-type by transfection into CRFK cells, despite the fact that the promoter activity of the deleted LTR was significantly reduced when examined by the CAT assay. It is possible that the suppressive effect of FIV compensates for the reduction of the activity of FIV LTR caused by the deletion. The virus derived from the deleted mutant grew to levels comparable to the wild-type in two feline T lymphoblastoid cell lines and the cytotoxic activity was also unimpaired. These results indicate that the 31 bp fragment and the cellular factors that bind to it do not affect replication of FIV in these feline T lymphoblastoid cell lines in vitro. However, it remains possible that the

7 Effects of a partial deletion of FIV LTR 1579 region is needed for full biological activity in vivo. The AP-1 site of the FIV LTR has been reported to be important for the responsiveness to the T cell activation signal as examined by the CAT assay (Sparger et al., 1992), therefore it is likely that the AP-1 site present in the FIV LTR plays a role in an initial increase of viral gene transcription in response to T cell activation signals. After initial augmentation of transcription, viral replication might occur irrespective of the presence of AP-1 and depend on other cellular factors in the cells, although it remains possible that the AP-I in T lymphocytes can bind to another site such as the ATF binding site (Hal & Curran, 1991). In conclusion, this report demonstrates that the 31 bp fragment that contains AP-1- and AP-4-related sequences contributes to the efficient expression of FIV and that the FIV LTR could be activated by murine c- Fos; however, the 31 bp fragment is not essential for virus replication in feline T lymphocytes. To clarify the mechanisms that underlie the termination of FIV latency and progression to immunosuppressive disease, it is important to study the factors that regulate the promoter activity of FIV LTR in more detail. We are grateful to Drs R. Shibata, H. Sakai and J. Sakuragi (Kyoto University, Kyoto, Japan), Dr K. Tokunaga (Hokkaido University, Sapporo, Japan), and Dr M. Fukasawa (Nagasaki University, Nagasaki, Japan) for helpful advice. We thank Dr K. Todokoro (Tsukuba Life Science Center, RIKEN, Tsukuba, Japan) and Dr M. Hattori (Hokkaido University, Sapporo, Japan) for providing expression plasmids of c-fos and c-jun, and recombinant human IL-2-producing Ltk IL-2.23 cells, respectively. This study was supported in part by grants from the Ministry of Education, Science and Culture and from the Ministry of Health and Welfare of Japan. T. Miyazawa and Y. Kawaguchi are supported by the Recruit Scholarship. References ADACHI, A., GENDELMAN, H. E., KOENIG, S., FOLKS, T., WILLEY, R., RASON, A. & MARTIN, M.A. (1986). Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman ceils transfected with an infectious molecular clone. Journal of Virology 59, RENNER, D. A., O'HARA, M., ANGEL, P., CHOJKIER, M. & KARIN, M. (1989). Prolonged activation ofjun and collagenase genes by tumour necrosis factor-or. Nature, London 337, CRANDELL, R.A., FARICANT, C. G. & NELSON-REEs, W. A. (1973). Development, characterization, and viral susceptibility of feline (Fells catus) renal cell line (CRFK). In Vitro 9, CULLEN,. R. & GREEN, W. C. (1989). Regulatory pathways governing HIV-1 replication. Cell 58, CURRAN, T. & FRANZA,.R., JR (1988). Fos and Jun: the Ap-1 connection. Cell 55, GORMAN, C.M., MOFFAT, L. F. & HOWARD,.H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Molecular and Cellular iology 2, GRAHAM, F. L. & VAN DER E, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, HAl, T. & CURRAN, T. (1991). Cross-family dimerization of transcriptional factors Fos/Jun and ATF/CRE alters DNA-binding specificity. Proceedings of the National Academy of Sciences, U.S.A. 88, HALAZOMETIS, T. n., GEORGOPOULOS, K, GREENERG, M. E. & LEDER, P. (1988). c-jun dimerizes with itself and with c-fos, forming complexes of different DNA binding affinities. Cell 55, Hzss, J. L., PYPER, J. M. & CLieNTS, J. E. (1986). Nucleotide sequence and transcriptional activity of the caprine arthritis-encephalitis virus long terminal repeat. Journal of Virology 60, HEss, J. L., SMALL, J. D. & CLEM~NTS, J. E. (1989). Sequences in the viana virus long terminal repeat that control transcriptional activity and respond to viral trans-activation: involvement of AP-1 sites in basal activity and trans-activation. Journal of Virology 63, HIGUCHI, Y., SETOGUCHI, M., YOSHIDA, S., AKIZUKI, S. & YAMAMOTO, S. (1988). Enhancement of c-los expression is associated with activated macrophages. Oncogene 2, JACOsE-GEELS, H. E. L. & HORZINEK, M.C. (1983). Expression of feline infectious peritonitis coronavirus antigens on the surface of feline macrophage-like cells. Journal of General Virology 64, KAWAGUCHI, Y., MIYAZAWA, T., HORIMOTO, T., ITAGAKI, S., FUKASAWA, M., TAKAHASHI, E. & MIKAMI, T. (1991). Activation of feline immunodeficiency virus long terminal repeat by feline herpesvirus type 1. Virology 184, KAWAGUCHI, Y., NORIMINE, J., MIYAZAWA, T., KAI, C. & MIKAMI, T. (1992). Sequences within the feline immunodeficiency virus long terminal repeat that control transcriptional activity and respond to activation by feline herpesvirus type 1. Virology 190, KIYOMASU, T., MIYAZAWA, T., FURUYA, T., SHIATA, R., SAKAI, H., SAKURAGI, J., FUKASAWA, M., MAKI, N., HASEGAWA, A., MIKAMI, T. & ADACHI, A. (1991 ). Identification of the feline immunodeficiency virus rev gene activity. Journal of Virology 65, MAKI, N., MIYAZAWA, T., FUKASAWA, M., HASEGAWA, A., HAYAMI, M., Mini, K. & MIKAMI, T. (1992). Molecular characterization and heterogeneity of feline immunodeficiency virus isolates. Archives of Virology 123, MERMOD, N., WILLIAMS, T. J. t~ TJIAN, R. (1988). Enhancer binding factors AP-4 and AP-1 act in concert to activate SV40 late transcription in vitro. Nature, London 332, MIYAZAWA, T., FURUYA, T., ITAGAKI, S., TOHYA, Y., NAKANO, K., TAKAHASHI, E. &: MIKAMI, T. (1989a) Preliminary comparisons of the biological properties of two strains of feline immunodeficiency virus (FIV) isolated in Japan with FIV Petaluma strain isolated in the United States. Archives of Virology 108, MIYAZAWA, T., FURUYA, Z., ITAGAKI, S., TOHYA, Y., TAKAHASHI, E. MIKAMI, T. (1989 b). Establishment of a feline T-lymphoblastoid cell line highly sensitive for replication of feline immunodeficiency virus. Archives of Virology 108, MIYAZAWA, T., FUKASAWA, M., HASEGAWA, A., MAKI, N., IKUTA, K., TAKAHASHI, E., HAYAMI, M. & MIKAMI, T. (1991). Molecular cloning of a novel isolate of feline immunodeficiency virus biologically and genetically different from the original U.S. isolate. Journal of Virology 65, MIYAZAWA, T., KAWAGUCHI, Y., KOHOMOTO, M., SAKURAGI, J., ADACHI, A., FUKASAWA, M. & MIKAMI, T. (1992a). Production of feline immunodeficiency virus in feline and non-feline non-lymphoid cell lines by transfection of an infectious molecular clone. Journal of General Virology 73, MIYAZAWA, T., TOYOSAKI, T., TOMONAGA, K., NORIMINE, J., OHNO, K., HASEGAWA, A., KAI, C. & MIr~MI, T. (1992b). Further characterization of a feline T-lymphoblastoid cell line (MYA-1 cells) highly sensitive for feline immunodeficiency virus. Journal of Veterinary Medical Science 54, MUEGGE, K., WILLIAMS, T.M., KANT, J., KARrN, M., CHIU, R., SCHMIDT, A., SIEENLIST, U., YOUNG, H. g. t~ DURUM, S. K. (1989). Interleukin-1 costimulatory activity on the interleukin-2 promoter via AP-1. Science 246, NARAYAN, O. t~ CLEMENTS, J. E. (1990). Lentiviruses. In Virology, 2nd edn, pp Edited by. N. Fields & D. M. Kuipe. New York: Raven Press. NEUMANN, J. R., MORENCY, C. A. & RUSSIAN, K. O. (1987). A novel rapid assay for chlorampheuicol acetyltransferase gene expression. iotechniques 5, 4a, OHTA, Y., MASUDA, T., TSUJIMOTO, n., ISHIKAWA, K., KODAMA, T., MORIKAWA, S., NAKAI, M., HONJO, S. & HAYAMI, M. (1988).

8 1580 T. Miyazawa and others Isolation of simian immunodeficiency virus from African green monkeys and seroepidemiologic survey of the virus in various nonhuman primates. International Journal of Cancer 42, PEDERSEN, N. C., Ho, E. W., ROWN, M. L. & YAMAMOTO, J. (1987). Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome. Science 235, PHILLIPS, T. R., TALOTT, R. T., LAMONT, C., MUIR, S., LOVELACE, K. & ELDER, J. H. (1990). Comparison of two host cell range variants of feline immunodeficiency virus. Journal of Virology 64, PHILLIPS, T. R., LAMONT, C., KONINGS, D. A. M., SHACKLETT,. L., HAMSON, C. A., LucIw, P. A. & ELDER, J. H. (1992). Identification of the Rev transactivation and Rev-responsive element of feline immunodeficiency virus. Journal of Virology 66, Saira, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULL/S, K.. & ERLICH, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, SASSONE-CORsI, P., RANSONE~ L.J., LAMPH, W.W. VERMA, I.M. (1988). Direct interaction between Fos and Jun nuclear oncoproteins: role of the 'leucine zipper' domain. Nature, London 336, SHIATA, R., MIURA, T., HAYAMI, M., OGAWA, K., SAKAI, H., KIYOMASU, T., ISHIMOTO, A. & ADACHI, A. (1990a). Mutational analysis of the human immunodeficiency virus type 2 (HIV-2) genome in relation to HIV-1 and simian immunodeficiency virus SIVAc~M. Journal of Virology 64, SmATA, R., MIURA, T., HAYAMI, M., OGAWA, K., SAKAI, H., KIYOMASU, T., ISHIMOTO, A. & ADACHI, A. (1990b). Construction and characterization of an infectious DNA clone and of mutants of simian immunodeficiency virus isolated from the African green monkey. Journal of Virology 64, SPARGER, E. E., SHACKLETT,. L., RENSHAW-GEGG, L., ARRY, P. A., PEDERSEN, N. C., ELDER, J. H. & Luc1w, P. A. (1992). Regulation of gene expression directed by the long terminal repeat of the feline immunodeficiency virus. Virology 187, TODOKORO, K. t~; IKAWA, Y. (1990). Gene regulation and protooncogenes. Japanese Journal of Clinical Medicine 48, TOKUNAGA, K., NISHINO, Y., OIKAWA, H., ISHIHARA, C., MIKAMI, T. & IKUTA, K. (1992). Altered cell tropism and cytopathicity of feline immunodeficiency viruses in two different feline CD4-positive, CDSnegative cell lines. Journal of Virology 66, WIGLER, M., PELLICER, A., S1LVERSTEIN, S., AXEL, R., URLAU, G. & CHASIN, L. (1979). DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells. Proceedings of the National Academy of Sciences, U.S.A. 76, YAMAMOTO, J.K., SPARGER, E., HO, E.W., ANDERSEN, P.R., O'CONNOR, T. P., MANDELL, C. P., LOWENST1NE, L., MUNN, R. & PEDERSEN, N.C. (1988). Pathogenesis of experimentally induced feline immm~odeficiency virus infection in cats. American Journal of Veterinary Research 49, (Received 18 December 1992; Accepted 19 March 1993)