Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood"

Transcription

1 Dale and Betty Bumpers Vaccine Research Center National Institute of Allergy and Infectious Diseases National Institutes of Health Identification and Characterization of CD4 T cells actively transcribing HIV RNA in Peripheral Blood Richard A. Koup, MD June 29, 2013

2 Quantifying Intracellular HIV RNA Quantification of cell-associated HIV DNA is often used as a measure of past infection. Often used as a measure of the latent reservoir However, a large proportion of that DNA may be replication incompetent, and certainly transcriptionally inactive. Quantifying cell-associated HIV RNA could tell us: Which cells are transcriptionally active with respect to HIV Which cells are contributing to the plasma virus pool What is the viral burst size of HIV from a peripheral CD4 T cell How HIV antigens are expressed on the CD4 T cell surface in vivo What cellular processes are affected by active HIV transcription We therefore sought to quantify active HIV transcription in PBMC directly ex vivo

3 Which HIV RNA Should Be Measured?

4 9 Kb (genomic/gag) RNA without 2 Kb (Tat/Rev) RNA expression 9 Kb (genomic/gag) RNA and 2 Kb (Tat/Rev) RNA expression Viral protein expression and budding should be associated with CD4 down regulation

5 CD4 (+) Bright, Dim and Null Gating Strategy

6 Determining Active Expression of HIV RNA in CD4 T Cell Populations Sort CD4 Bright, Dim, and Null cells into multiple wells at varying numbers of cells per well Perform quantitative PCR for HIV Gag, Rev, and Tat RNA on each well Determine precursor frequency of cells actively expressing HIV Gag, Rev, and Tat RNA Use wells that are statistically likely to contain only a single HIV RNA expressing cell to determine the copy number of HIV RNA per cell in CD4 Bright, Dim, and Null cells + RNA PCR 9 Kb 2 Kb Gag Rev Tat

7 Determining Active Expression of HIV RNA CD4 Bright 3000 cells/well in CD4 T Cell Populations 1000 cells/well 300 cells/well Gag RNA 1:850 cells Rev RNA 1:3936 cells Tat RNA 1:4449 cells + RNA PCR 9 Kb 2 Kb Gag Rev Tat

8 Determining Active Expression of HIV RNA in CD4 T Cell Populations CD4 Bright CD4 Dim 3000 cells/well 30 cells/well 1000 cells/well 10 cells/well 300 cells/well Gag RNA 1:850 cells Rev RNA 1:3936 cells Tat RNA 1:4449 cells Gag RNA 1:64 cells Rev RNA 1:66 cells Tat RNA 1:80 cells + RNA PCR 9 Kb 2 Kb Gag Rev Tat

9 Determining Active Expression of HIV RNA in CD4 T Cell Populations CD4 Bright CD4 Dim 3000 cells/well 30 cells/well CD4 Null 500 cells/well 1000 cells/well 300 cells/well 10 cells/well Gag RNA 1:4746 cells Rev RNA 1:4746 cells Tat RNA 1:14749 cells Gag RNA 1:850 cells Rev RNA 1:3936 cells Tat RNA 1:4449 cells Gag RNA 1:64 cells Rev RNA 1:66 cells Tat RNA 1:80 cells + RNA PCR 9 Kb 2 Kb Gag Rev Tat

10 HIV Gag RNA copy number increases with decreasing CD4 surface expression Proportion of CD4 T cells Frequency of cells expressing 2kb RNA Copy No/2kB RNA + Cell 87% 1: % 1:58 11% 1:4746 VL = 47,259 CD4 = 244 Composite from 9 subjects

11 Activation Markers Further Identify Cells Expressing Spliced HIV RNA CD4 ICOS Rev RNA + = 1:34 CD8 CD38 Active HIV transcription is greatest in activated CD4 T cells

12 Question: Can we detect HIV-producing T cells using broadly neutralizing antibodies? Kwong, P.D, Mascola, J.R Immunity 37(3):

13 Broadly Neutralizing mab Staining of In Vitro BAL Infected CD4 T cells Mab concentration 3-5µg/ml

14 Can Broadly Neutralizing mabs Be Used to Sort In Vitro HIV-infected CD4 T Cells?

15 HIV RNA Copy Number Is Associated with CD4 Down-Regulation

16 Ex Vivo Index Sorting for HIV RNA PCR Index sorted 168 T cells into individual PCR wells (VL: >500,000, CD4: 24) 99 CD4 dim, 69 null CD56 - TCRγδ - Also stained with VRC07, PG9, CD27, CD45RO, ICOS and CD38 Fluorescence profile of each cell was stored Single-cell Sorting (e.g., CD4 dim vs null) CD4 CD27 PG9 CD45RO

17 Detecting HIV Transcription Ex Vivo Four wells were positive for HIV Tat, Rev, and Gag RNA One was positive for only Gag RNA All were CD4 dim (not null) HIV RNA + cells were PG9 dim and CD27 - Cells were variably positive for CD38 and ICOS

18 Conclusions Cell-associated viral replication in vivo can be quantified using cell sorting and Q-PCR for spliced and unspliced forms of HIV RNA Full HIV RNA transcription is associated with CD4 down-regulation in vivo The number of HIV RNA copies per cell increases with CD4 down-regulation HIV transcription is most frequent in T cells that express known activation markers The level of HIV env expression during active HIV replication in vivo is far less than it is on in vitro activated and infected T cells, making their detection by broadly neutralizing monoclonal antibodies difficult

19 Acknowledgements Immunology Laboratory Joseph Casazza David Ambrozak Alex Vostal Human Immunology Section Daniel Douek Brenna Hill Eli Boritz Special thanks to: Frank Maldarelli John Mellors John Coffin

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys

Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Establishment and Targeting of the Viral Reservoir in Rhesus Monkeys Dan H. Barouch, M.D., Ph.D. Center for Virology and Vaccine Research Beth Israel Deaconess Medical Center Ragon Institute of MGH, MIT,

More information

Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs

Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs https://doi.org/10.1186/s12977-018-0392-7 Retrovirology REVIEW Open Access Beyond the replication competent HIV reservoir: transcription and translation competent reservoirs Amy E. Baxter 1,2, Una O Doherty

More information

Towards an HIV Cure. Steven G. Deeks Professor of Medicine University of California, San Francisco

Towards an HIV Cure. Steven G. Deeks Professor of Medicine University of California, San Francisco Towards an HIV Cure Steven G. Deeks Professor of Medicine University of California, San Francisco Why are we now talking about a cure? Emerging recognition that HAART does not fully restore health and/or

More information

Can HPV, cervical neoplasia or. HIV transmission?

Can HPV, cervical neoplasia or. HIV transmission? Interactions between HPV and HIV: STIs and HIV shedding, regulation of HPV by HIV, and HPV VLP influence upon HIV Jennifer S. Smith Department of Epidemiology pd University of North Carolina Can HPV, cervical

More information

Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere

Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere Droplet Digital PCR, the new tool in HIV reservoir quantification? Ward De Spiegelaere Droplet Digital PCR, the new tool in HIV reservoir quantification? Content: - Digital PCR - Applications - Total HIV

More information

Section Lectures: Immunology/Virology Time: 9:00 am 10:00 am LRC 105 A & B

Section Lectures: Immunology/Virology Time: 9:00 am 10:00 am LRC 105 A & B Section Director: Cliff Bellone, Ph.D. Office: Doisy Hall - R 405 Phone: 577-8449 E-Mail: bellonec@slu.edu Lecturers: James Swierkosz, Ph.D. Office: Medical School Rm. 412 Phone: 577-8430 E-Mail: swierkoszje@slu.edu

More information

HIV-DNA: nuovo marcatore virologico. Metodiche a confronto per la quantificazione di HIV-DNA

HIV-DNA: nuovo marcatore virologico. Metodiche a confronto per la quantificazione di HIV-DNA HIV-DNA: nuovo marcatore virologico Metodiche a confronto per la quantificazione di HIV-DNA Maria Carla Re Laboratorio Retrovirus e Agenti infettivi HIV correlati UO di Microbiologia, Università di Bologna

More information

Alexander O. Pasternak, Mirte Scherpenisse, Ben Berkhout

Alexander O. Pasternak, Mirte Scherpenisse, Ben Berkhout Cell-associated HIV-1 unspliced to multiply spliced RNA ratio at 12 weeks ART correlates with markers of immune activation and apoptosis and predicts the CD4 + T-cell count at 96 weeks ART Alexander O.

More information

HIV INFECTION: An Overview

HIV INFECTION: An Overview HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ

More information

Julianne Edwards. Retroviruses. Spring 2010

Julianne Edwards. Retroviruses. Spring 2010 Retroviruses Spring 2010 A retrovirus can simply be referred to as an infectious particle which replicates backwards even though there are many different types of retroviruses. More specifically, a retrovirus

More information

What do we measure when we measure cell associated HIV RNA

What do we measure when we measure cell associated HIV RNA https://doi.org/10.1186/s12977-018-0397-2 Retrovirology REVIEW Open Access What do we measure when we measure cell associated HIV RNA Alexander O. Pasternak * and Ben Berkhout Abstract Cell-associated

More information

HIV recombination in the development of drug resistance

HIV recombination in the development of drug resistance HIV recombination in the development of drug resistance A. Schultz T. Tänzer Department of Virology J. Reiter University of the Saarland T. Breinig A. Meyerhans J-P. Vartanian Unité de Rétrovirologie Moléculaire

More information

Loss of Circulating CD4 T Cells with B Cell Helper Function during Chronic HIV Infection

Loss of Circulating CD4 T Cells with B Cell Helper Function during Chronic HIV Infection Loss of Circulating CD4 T Cells with B Cell Helper Function during Chronic HIV Infection Kristin L. Boswell 1, Robert Paris 1,2, Eli Boritz 3, David Ambrozak 1, Takuya Yamamoto 1, Sam Darko 3, Kaska Wloka

More information

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study

Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a Case Study Note: I have added some clarifying comments to the slides -- please click on Comments under View to see them. Current Strategies in HIV-1 Vaccine Development Using Replication-Defective Adenovirus as a

More information

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS:

SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: SEROLOGICAL DIAGNOSIS OF VIRAL INFECTIONS: POSSIBILITIES OF SEROLOGICAL DIAGNOSIS TYPES OF SEROLOGICAL REACTIONS SEROLOGICAL REACTIONS Ag-Ab reactions used for the detection of unknown Ag or Ab, in vitro

More information

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit

More information

DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED

DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED DEBATE ON HIV ENVELOPE AS A T CELL IMMUNOGEN HAS BEEN GAG-GED Viv Peut Kent Laboratory, University of Melbourne, Australia WHY ENVELOPE? Env subject to both humoral and cellular immune responses Perhaps

More information

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection

Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Massive infection and loss of memory CD4 + T cells in multiple tissues during acute SIV infection Joseph J. Mattapallil 1, Daniel C. Douek 2, Brenna Hill 2, Yoshiaki Nishimura 3, Malcolm Martin 3 & Mario

More information

HIV & AIDS: Overview

HIV & AIDS: Overview HIV & AIDS: Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL SEMINAR VJ TEMPLE 1 What

More information

Modeling and Simulation of HIV-1 Intracellular Replication

Modeling and Simulation of HIV-1 Intracellular Replication Modeling and Simulation of HIV-1 Intracellular Replication MSc Thesis Author Narges Zarrabi Supervisor: Prof. Dr. Peter M.A. Sloot Submitted to Faculty of Science in partial fullfilment of the requirments

More information

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003

Chapter 13 Viruses, Viroids, and Prions. Biology 1009 Microbiology Johnson-Summer 2003 Chapter 13 Viruses, Viroids, and Prions Biology 1009 Microbiology Johnson-Summer 2003 Viruses Virology-study of viruses Characteristics: acellular obligate intracellular parasites no ribosomes or means

More information

In vivo analysis of HIV replication and persistence in the myeloid compartment

In vivo analysis of HIV replication and persistence in the myeloid compartment In vivo analysis of HIV replication and persistence in the myeloid compartment J. Honeycutt, A. Wahl, J. Foster, R.A. Spagnulo and J. Victor Garcia Division of Infections Diseases UNC Center for AIDS Research

More information

Chapter 13B: Animal Viruses

Chapter 13B: Animal Viruses Chapter 13B: Animal Viruses 1. Overview of Animal Viruses 2. DNA Viruses 3. RNA Viruses 4. Prions 1. Overview of Animal Viruses Life Cycle of Animal Viruses The basic life cycle stages of animal viruses

More information

System Biology analysis of innate and adaptive immune responses during HIV infection

System Biology analysis of innate and adaptive immune responses during HIV infection System Biology analysis of innate and adaptive immune responses during HIV infection Model of T cell memory persistence and exhaustion Naive Ag+APC Effector TEM (Pfp, Gr.B, FasL, TNF) Ag stim. IL-2, IL-7,

More information

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA.

DATA SHEET. Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter calf thymus DNA. Viral Load DNA >> Standard PCR standard 0 Copies Catalog Number: 1122 Lot Number: 150298 Release Category: A Provided: 500 µl of 5.6 mm Tris HCl, 4.4 mm Tris base, 0.05% sodium azide 0.1 mm EDTA, 5 mg/liter

More information

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1

5. Over the last ten years, the proportion of HIV-infected persons who are women has: a. Increased b. Decreased c. Remained about the same 1 Epidemiology 227 April 24, 2009 MID-TERM EXAMINATION Select the best answer for the multiple choice questions. There are 60 questions and 9 pages on the examination. Each question will count one point.

More information

Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure

Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure Final Report - Summer Research Project 1 Introduction Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure Katherine Miller, Year 3, Dalhousie University (Supervisor: Dr. Lisa Barrett,

More information

A Query by HIV. I. A query by HIV. II. Recursion

A Query by HIV. I. A query by HIV. II. Recursion A Query by HIV I. A query by HIV Human immunodeficiency virus (HIV) is a kind of lentivirus (lenti- means "slow") that belongs to the Retroviridae family. HIV is known for slow disease progression. In

More information

HLA-DR CD38 CD4 T Lymphocytes Have Elevated CCR5 Expression and Produce the Majority of R5-Tropic HIV-1 RNA In Vivo

HLA-DR CD38 CD4 T Lymphocytes Have Elevated CCR5 Expression and Produce the Majority of R5-Tropic HIV-1 RNA In Vivo JOURNAL OF VIROLOGY, Oct. 2011, p. 10189 10200 Vol. 85, No. 19 0022-538X/11/$12.00 doi:10.1128/jvi.02529-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. HLA-DR CD38 CD4 T Lymphocytes

More information

CDC site UNAIDS Aids Knowledge Base http://www.cdc.gov/hiv/dhap.htm http://hivinsite.ucsf.edu/insite.jsp?page=kb National Institute of Allergy and Infectious Diseases http://www.niaid.nih.gov/default.htm

More information

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of

More information

VIRUSES. 1. Describe the structure of a virus by completing the following chart.

VIRUSES. 1. Describe the structure of a virus by completing the following chart. AP BIOLOGY MOLECULAR GENETICS ACTIVITY #3 NAME DATE HOUR VIRUSES 1. Describe the structure of a virus by completing the following chart. Viral Part Description of Part 2. Some viruses have an envelope

More information

Changes in CD4+ cells mirna expression following exposure to HIV 1 Claudio Casoli

Changes in CD4+ cells mirna expression following exposure to HIV 1 Claudio Casoli Changes in CD4+ cells mirna expression following exposure to HIV 1 Claudio Casoli University of Milan Rationale There is evidence that mirnas can modulate host innate immunity against viruses. Specifically

More information

Small-Molecule Chemotherapeutic Drugs Reactivate HIV-1 via Non-Canonical Pathways and Modulate CD8 T cell response

Small-Molecule Chemotherapeutic Drugs Reactivate HIV-1 via Non-Canonical Pathways and Modulate CD8 T cell response Small-Molecule Chemotherapeutic Drugs Reactivate HIV-1 via Non-Canonical Pathways and Modulate CD8 T cell response ~ Dr. Isa Munoz-Arias, Ph.D Lab of Dr. Timothy Henrich, M.D UCSF Department of Experimental

More information

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein

Structure of HIV. Virion contains a membrane envelope with a single viral protein= Env protein. Capsid made up of Gag protein Structure of HIV Virion contains a membrane envelope with a single viral protein= Env protein Important in receptor recognition Capsid made up of Gag protein (group-specific antigen) Icosahedral Interior

More information

Biol115 The Thread of Life"

Biol115 The Thread of Life Biol115 The Thread of Life" Lecture 9" Gene expression and the Central Dogma"... once (sequential) information has passed into protein it cannot get out again. " ~Francis Crick, 1958! Principles of Biology

More information

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group

Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group report Immunogens and Antigen Processing: Report from a Global HIV Vaccine Enterprise Working Group John Mascola, C Richter King & Ralph Steinman on behalf of a Working Group convened by the Global HIV

More information

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance

Title: Neutralization resistance of HIV-1 virological synapse-mediated infection is. Running Title: Virological-synapse neutralization resistance JVI Accepts, published online ahead of print on 2 May 2012 J. Virol. doi:10.1128/jvi.00230-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Title: Neutralization resistance

More information

Viruses. Rotavirus (causes stomach flu) HIV virus

Viruses. Rotavirus (causes stomach flu) HIV virus Viruses Rotavirus (causes stomach flu) HIV virus What is a virus? A virus is a microscopic, infectious agent that may infect any type of living cell. Viruses must infect living cells in order to make more

More information

The Hepatitis B-e antigen-positive

The Hepatitis B-e antigen-positive The Hepatitis B-e antigen-positive Dental Student Developing an Equitable Policy Hepatitis B Virus Serology 1 HBsAg A protein on the surface of HBV; it can be detected in high levels in serum during acute

More information

Women and Viral Load. Together, we can change the course of the HIV epidemic one woman at a time.

Women and Viral Load. Together, we can change the course of the HIV epidemic one woman at a time. Women and Viral Load Together, we can change the course of the HIV epidemic one woman at a time. #onewomanatatime #thewellproject What Is Viral Load? Viral load is the amount of HIV (number of viruses

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES

CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES [Frontiers in Bioscience 5, d527-555, May 1, 2000] CURRENT DEVELOMENTS AND FUTURE PROSPECTS FOR HIV GENE THERAPY USING INTERFERING RNA-BASED STRATEGIES Betty Lamothe, Sadhna Joshi Department of Medical

More information

19/06/2013. Viruses are not organisms (do not belong to any kingdom). Viruses are not made of cells, have no cytoplasm, and no membranes.

19/06/2013. Viruses are not organisms (do not belong to any kingdom). Viruses are not made of cells, have no cytoplasm, and no membranes. VIRUSES Many diseases of plants and animals are caused by bacteria or viruses that invade the body. Bacteria and viruses are NOT similar kinds of micro-organisms. Bacteria are classified as living organisms,

More information

Ongoing HIV Replication During ART Reconsidered

Ongoing HIV Replication During ART Reconsidered Open Forum Infectious Diseases PERSPECTIVES Ongoing HIV Replication During ART Reconsidered Mary F. Kearney, 1 Ann Wiegand, 1 Wei Shao, 2 William R. McManus, 1 Michael J. Bale, 1 Brian Luke, 2 Frank Maldarelli,

More information

Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia

Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia Eradication of HIV Bonaventura Clotet Hospital Universitàri Germans Trias i Pujol Badalona. Barcelona. Catalonia Dr Bonaventura Clotet Transparency declaration I have served during the past 2 years as

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir.

Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir. Abstract no. MOLBPEA13 Towards a block and lock strategy: LEDGINs hamper the establishment of a reactivation competent HIV reservoir. G. Vansant,,A. Bruggemans, L. Vranckx, S. Saleh, I. Zurnic, F. Christ,

More information

Laboratory diagnostics CH/HIV/0052/17/10/2017

Laboratory diagnostics CH/HIV/0052/17/10/2017 Laboratory diagnostics CH/HIV/0052/17/10/2017 This slide set was created by ViiV Healthcare GmbH with great care in order to provide balanced information about ViiV products and / or application areas.

More information

Cell-associated HIV RNA: a dynamic biomarker of viral persistence

Cell-associated HIV RNA: a dynamic biomarker of viral persistence Pasternak et al. Retrovirology 2013, 10:41 REVIEW Open Access Cell-associated HIV RNA: a dynamic biomarker of viral persistence Alexander O Pasternak *, Vladimir V Lukashov and Ben Berkhout Abstract In

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates

HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates Research article HERV-K specific T cells eliminate diverse HIV-1/2 and SIV primary isolates R. Brad Jones, 1 Keith E. Garrison, 2 Shariq Mujib, 1 Vesna Mihajlovic, 1 Nasra Aidarus, 1 Diana V. Hunter, 1

More information

HIV Infection and Epidemiology: Can There Be a Cure? Dr. Nedwidek

HIV Infection and Epidemiology: Can There Be a Cure? Dr. Nedwidek HIV Infection and Epidemiology: Can There Be a Cure? Dr. Nedwidek The Viral Life Cycle A typical virus (DNA or RNA + protein) enters the host cell, makes more of itself, and exits. There are two major

More information

HVTN Laboratory Program: Immunogenicity and Research Assays

HVTN Laboratory Program: Immunogenicity and Research Assays HVTN Laboratory Program: Immunogenicity and Research Assays Erica Andersen-Nissen, PhD Director, Cape Town HVTN Immunology Laboratory Considerations for a Pan-African HIV Vaccine Development Agenda Kigali,

More information

Test Name Results Units Bio. Ref. Interval

Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 135091606 Age 24 Years Gender Male 30/8/2017 92800AM 30/8/2017 94631AM 31/8/2017 90306AM Ref By Final HEATITIS A & B VIRUS EVALUATION HEATITIS A ANTIBODY (ANTI HAV),

More information

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell

HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES. Elizabeth Susan Russell HIV-1 SUBTYPE C MOTHER-TO-CHILD TRANSMISSION: GENETIC AND IMMUNOLOGIC CORRELATES Elizabeth Susan Russell A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial

More information

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons

More information

JANELLE MARISA NOVAK UNIVERSITY OF FLORIDA

JANELLE MARISA NOVAK UNIVERSITY OF FLORIDA ORF-A/2 DEFICIENT MOLECULAR CLONE OF FELINE IMMUNODEFICIENCY VIRUS (FIV) DEMONSTRATES DIMINISHED VIRAL GENE EXPRESSION IN LYMPHOID TISSUES OF NEONATAL CATS DURING ACUTE AND LATENT INFECTION By JANELLE

More information

Progesterone Increases are Associated With HIV Susceptibility Factors in Women

Progesterone Increases are Associated With HIV Susceptibility Factors in Women Progesterone Increases are Associated With HIV Susceptibility Factors in Women Alison Y Swaims 1, Tammy Evans-Strickfaden 1, L Davis Lupo 1, Alfredo Aguirre 2, Anandi Sheth 2, Igho Ofotokun 2, Clyde E

More information

Explain the laboratory diagnosis of Rabies?

Explain the laboratory diagnosis of Rabies? Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable

More information

ASTARTE IN ACTION. Using a Recall Antigen Assay as a Tool for Understanding Immunity CASE STUDY

ASTARTE IN ACTION. Using a Recall Antigen Assay as a Tool for Understanding Immunity CASE STUDY ASTARTE IN ACTION Using a Recall Antigen Assay as a Tool for Understanding Immunity CASE STUDY Introduction While there is no industry-accepted protocol for measuring the functionality of peripheral blood

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

HIV life cycle revisited: What s new in basic science? Theresa Rossouw

HIV life cycle revisited: What s new in basic science? Theresa Rossouw HIV life cycle revisited: What s new in basic science? Theresa Rossouw Outline of the Presentation Lifecycle overview New drugs & therapies Cell entry Co-receptor binding Attachment Keeping it Simple

More information

HS-LS4-4 Construct an explanation based on evidence for how natural selection leads to adaptation of populations.

HS-LS4-4 Construct an explanation based on evidence for how natural selection leads to adaptation of populations. Unit 2, Lesson 2: Teacher s Edition 1 Unit 2: Lesson 2 Influenza and HIV Lesson Questions: o What steps are involved in viral infection and replication? o Why are some kinds of influenza virus more deadly

More information

HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial

HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial HIV-1 DNA levels after antiretroviral therapy in primary infection predict disease progression: the SPARTAC Trial James Williams 1,2,3, Jacob Hurst 1,2,3, Nicola Robinson 1,2,3, Sarah Fidler 4, Jonathan

More information

Pro5 MHC Pentamers. Dr. Jeremy Fry. Copyright ProImmune Limited All Rights Reserved

Pro5 MHC Pentamers. Dr. Jeremy Fry. Copyright ProImmune Limited All Rights Reserved Pro5 MHC Pentamers Dr. Jeremy Fry Pro5 MHC Pentamers The most consistent technology for detecting antigenspecific T cells The most-cited commercially available MHC Multimer Used by most-leading academic

More information

New HIV Tests and Algorithm: A change we can believe in

New HIV Tests and Algorithm: A change we can believe in New HIV Tests and Algorithm: A change we can believe in Esther Babady, PhD, D (ABMM) Memorial Sloan-Kettering Cancer Center New York, New York Learning Objectives After this presentation you should be

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

Chapter 19: Viruses. 1. Viral Structure & Reproduction. 2. Bacteriophages. 3. Animal Viruses. 4. Viroids & Prions

Chapter 19: Viruses. 1. Viral Structure & Reproduction. 2. Bacteriophages. 3. Animal Viruses. 4. Viroids & Prions Chapter 19: Viruses 1. Viral Structure & Reproduction 2. Bacteriophages 3. Animal Viruses 4. Viroids & Prions 1. Viral Structure & Reproduction Chapter Reading pp. 393-396 What exactly is a Virus? Viruses

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

Pathogens and the immune system

Pathogens and the immune system Pathogens and the immune system Veronica Leautaud, Ph.D. vl2@ rice.edu Keck Hall 224 / 232-lab Lecture 8 BIOE 301-Bioengineering and World Health Review of lecture 7 Science Science is the human activity

More information

Chapter 12: Acellular Agents: Viruses, Viroids and Prions

Chapter 12: Acellular Agents: Viruses, Viroids and Prions Chapter 12: Acellular Agents: Viruses, Viroids and Prions Viruses Viruses are acellular infectious agents that are much smaller than bacteria and are usually measured in nanometers (Figure 12.1). They

More information

The DNA -> RNA -> Protein Pathway

The DNA -> RNA -> Protein Pathway The DNA -> RNA -> Protein Pathway RNA Polymerase = enzyme that makes mrna from the DNA gene template http://www.bioteach.ubc.ca/molecularbiology/amonksflourishinggarden/ Plus-strand RNA Viruses Plus-strand

More information

The Alphabet Soup of Viral Hepatitis Testing

The Alphabet Soup of Viral Hepatitis Testing The Alphabet Soup of Viral Hepatitis Testing August 18, 2011 Patricia Slev, PhD, DABCC Medical Director, Serologic Hepatitis and Retrovirus Laboratory, ARUP Laboratories Assistant Professor of Pathology,

More information

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3*

ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* ADCC Assay Protocol Vikram Srivastava 1, Zheng Yang 1, Ivan Fan Ngai Hung 2, Jianqing Xu 3, Bojian Zheng 3 and Mei- Yun Zhang 3* 1 Department of Microbiology, Li Ka Shing Faculty of Medicine, University

More information

Effect of 24 Week Intensification with a CCR5-Antagonist on the Decay of the HIV-1 Latent Reservoir

Effect of 24 Week Intensification with a CCR5-Antagonist on the Decay of the HIV-1 Latent Reservoir Effect of 24 Week Intensification with a CCR5-Antagonist on the Decay of the HIV-1 Latent Reservoir Laura Díaz 1, Carolina Gutiérrez 2, Carmen Page 2, Raquel Lorente 1, Beatriz Hernández-Novoa 2, Alejandro

More information

Session. Viral Hepatitis B & D: Clinical. Saturday April 25, Cihan Yurdaydin, MD

Session. Viral Hepatitis B & D: Clinical. Saturday April 25, Cihan Yurdaydin, MD Session Viral Hepatitis B & D: Clinical Saturday April 25, 2015 Cihan Yurdaydin, MD 1 2 Optimizing the prenylation inhibitor lonafarnib using ritonavir boosting in patients with chronic delta hepatitis

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Immunology The innate and adaptive immune systems

Immunology The innate and adaptive immune systems Immunology The innate and adaptive immune systems The immune system is the collection of cells, tissues and molecules that protects the body from numerous pathogenic microbes and toxins in our environment.

More information

CELL MEDIATED IMMUNITY IN VIRUS INFECTIONS

CELL MEDIATED IMMUNITY IN VIRUS INFECTIONS 13 CELL MEDIATED IMMUNITY IN VIRUS INFECTIONS Nobel Lecture, December 8, 1996 by PETER c. DOHERTY St.Jude Children's Research Hospital, Memphis, Tennessee 38104, USA INTRODUCTION Many key concepts concerning

More information

Immunity and Infection. Chapter 17

Immunity and Infection. Chapter 17 Immunity and Infection Chapter 17 The Chain of Infection Transmitted through a chain of infection (six links) Pathogen: Disease causing microorganism Reservoir: Natural environment of the pathogen Portal

More information

The Biotechnology Education Company. AIDS Kit I: Simulation of HIV-1 Detection by ELISA. Store entire experiment in the refrigerator.

The Biotechnology Education Company. AIDS Kit I: Simulation of HIV-1 Detection by ELISA. Store entire experiment in the refrigerator. The Biotechnology Education Company AIDS Kit I: Simulation of HIV-1 Detection by ELISA Store entire experiment in the refrigerator. EXPERIMENT OBJECTIVE: EDVO-Kit 271 The objective of the experiment is

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL Supplementary Material The Open AIDS Journal, 2012, Volume 6 i SUPPLEMENTARY MATERIAL Immune Reconstitution During the First Year of Antiretroviral Therapy of HIV-1-Infected Adults in Rural Burkina Faso

More information

Hands-on Activity Viral DNA Integration. Educator Materials

Hands-on Activity Viral DNA Integration. Educator Materials OVERVIEW This activity is part of a series of activities and demonstrations focusing on various aspects of the human immunodeficiency virus (HIV) life cycle. HIV is a retrovirus. Retroviruses are distinguished

More information

Viruses. Objectives At the end of this sub section students should be able to:

Viruses. Objectives At the end of this sub section students should be able to: Name: 3.5 Responses to Stimuli Objectives At the end of this sub section students should be able to: 3.5.4 Viruses 1. Explain the problem of defining what a virus is - living or non-living? 2. show you

More information

UNIT 6: PHYSIOLOGY Chapter 31: Immune System and Disease

UNIT 6: PHYSIOLOGY Chapter 31: Immune System and Disease CORNELL NOTES Directions: You must create a minimum of 5 questions in this column per page (average). Use these to study your notes and prepare for tests and quizzes. Notes will be stamped after each assigned

More information

CDC website:

CDC website: Hepatitis B virus CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_b/slide_1.htm Relevance Key Features es of Hepatitis t B Virus 250 million people infected worldwide. In areas of

More information

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System 24.1 Multiple-Choice Questions 1) The body's innate defenses against infection include A) several nonspecific

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

MODULE ONE" TB Basic Science" Treatment Action Group TB/HIV Advocacy Toolkit

MODULE ONE TB Basic Science Treatment Action Group TB/HIV Advocacy Toolkit MODULE ONE" TB Basic Science" Treatment Action Group TB/HIV Advocacy Toolkit Topics to be covered What is Tuberculosis? TB bacteria and what is unique about it. How is TB different from HIV? How is TB

More information

Chapter 1. Chapter 1 Concepts. MCMP422 Immunology and Biologics Immunology is important personally and professionally!

Chapter 1. Chapter 1 Concepts. MCMP422 Immunology and Biologics Immunology is important personally and professionally! MCMP422 Immunology and Biologics Immunology is important personally and professionally! Learn the language - use the glossary and index RNR - Reading, Note taking, Reviewing All materials in Chapters 1-3

More information

An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs. Debrah Boeras Emory University October 14, 2008

An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs. Debrah Boeras Emory University October 14, 2008 An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs Debrah Boeras Emory University October 14, 2008 Background A majority of HIV-1 infections occur through heterosexual exposure

More information

Quantification of HBV, HCV genotype and HIV subtype panels

Quantification of HBV, HCV genotype and HIV subtype panels Quantification of HBV, HCV genotype and HIV subtype panels Harry van Drimmelen 1,2, Wim Quint 2, Nico Lelie 3 and the international NAT study group 1. Biologicals Quality Control, 2. DDL Diagnostic Laboratory,

More information

Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta )

Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta ) Alla ricerca del virus nascosto (quando il virus dell epatitie B si occulta ) Giovanni Raimondo Epatologia Clinica e Biomolecolare Policlinico Universitario di Messina UI/ml pg/ml HBsAg HBeAg + anti-hbe

More information

CALIBRATION OF ANALYTICAL STANDARDS FOR HBV-DNA, HCV-RNA AND HIV-1 RNA IN GENOME COPIES BY A REFERENCE METHOD

CALIBRATION OF ANALYTICAL STANDARDS FOR HBV-DNA, HCV-RNA AND HIV-1 RNA IN GENOME COPIES BY A REFERENCE METHOD CALIBRATION OF ANALYTICAL STANDARDS FOR HBV-DNA, HCV-RNA AND HIV-1 RNA IN GENOME COPIES BY A REFERENCE METHOD AAJ van Drimmelen, E.R. Bax and W.G.V. Quint, BioQControl (BQC), Delft Diagnostic Laboratories

More information

Chapter 35 Active Reading Guide The Immune System

Chapter 35 Active Reading Guide The Immune System Name: AP Biology Mr. Croft Chapter 35 Active Reading Guide The Immune System Section 1 Phagocytosis plays an important role in the immune systems of both invertebrates and vertebrates. Review the process

More information

Measuring the latent reservoir in vivo

Measuring the latent reservoir in vivo Series Editor: Robert F. Siliciano Measuring the latent reservoir in vivo Marta Massanella 1 and Douglas D. Richman 1,2 1 UCSD, La Jolla, California, USA. 2 VA San Diego Healthcare System, La Jolla, California,

More information

Mayo Clinic HIV ecurriculum Series Essentials of HIV Medicine Module 2 HIV Virology

Mayo Clinic HIV ecurriculum Series Essentials of HIV Medicine Module 2 HIV Virology Mayo Clinic HIV ecurriculum Series Essentials of HIV Medicine Module 2 HIV Virology Eric M. Poeschla, MD Professor of Medicine College of Medicine Consultant, Division of Infectious Diseases Mayo Clinic

More information