1999 Oxford University Press Human Molecular Genetics, 1999, Vol. 8, No
|
|
- Hollie Fields
- 6 years ago
- Views:
Transcription
1 1999 Oxford University Press Human Molecular Genetics, 1999, Vol. 8, No Association analysis using refined microsatellite markers localizes a susceptibility locus for psoriasis vulgaris within a 111 kb segment telomeric to the HLA-C gene Akira Oka, Gen Tamiya, Maiko Tomizawa, Masao Ota 2, Yoshihiko Katsuyama 3, SatoshiMakino,TakashiShiina,MaiYoshitome 4, Mariko Iizuka 1,YukiSasao 1, Kenichi Iwashita 1,YoKawakubo 1, Junichi Sugai 1,AkiraOzawa 1, Muneo Ohkido 1, Minoru Kimura, Seiamak Bahram 5 and Hidetoshi Inoko + Department of Genetic Information, Division of Molecular Life Science and 1 Department of Dermatology, Tokai University School of Medicine, Bohseidai, Isehara, Kanagawa , Japan, 2 Department of Legal Medicine and 3 Department of Pharmacy, Shinshu University School of Medicine, Asahi, Matsumoto , Japan, 4 Department of Biology, Kitasato University, School of Science, Kitasato, Sagamihara, Kanagawa , Japan and 5 Centre de Recherche d Immunologie et d Hematologie, 4 rue Kirschleger, Strasbourg Cedex, France Received June 3, 1999; Revised and Accepted August 30, 1999 DDBJ/EMBL/GenBank accession nos AB and AB AB The HLA-Cw6 antigen has been associated with psoriasis vulgaris despite racial and ethnic differences. However, it remains unclear whether it is the HLA-Cw6 antigen itself or a closely linked, hitherto unidentified, locus that predisposes to the disease. Here, in order to map the susceptibility locus for psoriasis vulgaris precisely within the HLA class I region, 11 polymorphic microsatellite markers distributed throughout a 1060 kb segment surrounding the HLA-C locus were subjected to association analysis in Japanese psoriasis vulgaris patients. Statistical analyses of the distribution and deviation from Hardy Weinberg equilibrium of the allelic frequency at each microsatellite locus revealed that the pathogenic gene for psoriasis vulgaris is located within a reduced interval of 111 kb spanning kb telomeric of the HLA-C gene. In addition to three known genes, POU5F1, TCF19 and S, this 111 kb fragment contains four new, expressed genes identified in the course of our genomic sequencing of the entire HLA class I region. Therefore, these seven genes are the potential candidates for susceptibility to psoriasis vulgaris. INTRODUCTION Psoriasis vulgaris (MIM ) is a common skin disorder characterized by inflammatory cell infiltration and hyperproliferation of epidermal cells. The familial nature of this disease, which affects almost 2% of Caucasian populations, has long been recognized. However, in the Japanese population, a lower incidence (0.1%) has been observed, with most psoriasis vulgaris cases being sporadic. These facts define psoriasis vulgaris as a multifactorial disease, triggered by the involvement of some environmental factors in individuals with a particular genetic background. In fact, recent genome-wide linkage studies have identified several susceptibility loci on chromosomes 6p21.3 [human leucocyte antigen (HLA)], 17q25, 4q and many others (1 4). Among them, the HLA locus is believed to be one of the major genetic factors predisposing to disease. It is well known that psoriasis vulgaris is associated with several serologically defined HLA class I antigens such as HLA-B13, -B17, -B39, -B57, -Cw6 and -Cw7. This has been verified throughout the world, within many different populations, including Caucasians and Japanese (5 9). Among these alleles, the single most consistent and significant association is that of HLA-Cw6. However, this association is not as strong as that between HLA- B27 and ankylosing spondylitis (MIM ), where up to 100% of patients carry the allele which most probably is the bona fide causative element (10). Indeed, only 10% (Japanese) to 45% (Caucasians) of patients with psoriasis vulgaris carry the HLA- Cw6 allele (6,11). Therefore, the possibility clearly exists that the HLA-C gene itself is not the primary locus responsible for psoriasis vulgaris and that other gene(s) located nearby harbor the true pathogenic mutation/allele, in strong linkage disequilibrium with HLA-Cw6. In this respect, fine mapping of this putative susceptibility locus using high resolution genetic markers around the HLA-C gene is clearly needed. We recently have accomplished sequence analysis of the entire 1.8 Mb HLA class I region from MICB (major histocompatibility complex class I chain-related gene B) to HLA-F and have identified >40 new genes within this segment (12 14). Concentrating + To whom correspondence should be addressed. Tel: ; Fax: ; hinoko@is.icc.u-tokai.ac.jp
2 2166 Human Molecular Genetics, 1999, Vol. 8, No. 12 Figure 1. P-values obtained by the association test and the exact test of Hardy Weinberg proportion with the locations of microsatellite markers used for gene mapping of psoriasis vulgaris. a Gene map showing the location of each gene in the HLA class I region from IkBL to HLA-L. Black and white boxes represent the HLA-class I genes and non-hla genes, respectively. Arrows indicate the orientations of genes. b Statistical analysis by the case control association test and the exact test of Hardy Weinberg proportion. The curve is drawn as smoothly fitted on the basis of a two-point moving average in each test. Open circles with solid line, Pc-values obtained by Fisher s exact test in the case control association test; open squares with dashed line, P-values obtained in the patients by the exact test in terms of deviation from Hardy Weinberg proportions (the probability test); closed squares with bold solid line, P-values obtained in the patients by the exact test in terms of heterozygote deficiency against the null hypothesis of Hardy Weinberg equilibrium. c Locations of microsatellite markers with the distance (kb) from the HLA-C locus to each microsatellite in parentheses. on our target fragment, a total of 11 novel highly polymorphic microsatellite markers located at regular intervals in the region surrounding HLA-C were selected for high resolution mapping of the putative major histocompatibility complex (MHC)-linked psoriasis gene. RESULTS During the course of our large-scale genomic sequencing, 758 microsatellite loci ranging from di- to penta-nucleotide repeats were identified within the 1.8 Mb HLA class I region, which extends from the centromeric MICB gene to the telomeric HLA-F gene (12 15) and hence includes the HLA-B and -C genes. Among these microsatellites, 70 were characterized for their polymorphism content in the Japanese population. Of these, 38 were found to be highly informative with a PIC (polymorphism content) value of 0.66 and an average of 8.9 alleles (15,16). Here, we have selected 11 microsatellites which were densely distributed at a resolution of one microsatellite per ~100 kb around the HLA-C locus (C1_2_A, 232 kb centromeric; C1_4_1, 91 kb centromeric; C1_2_5, 19kbcentromeric; C1_4_3, 29kbtelomeric;C1_3_1, 31kbtelomeric; C1_2_6, 89kbtelomeric; C1_3_2, 143 kb telomeric; C2_4_4, 200kbtelomeric;C4_2_12, 457 kb telomeric; C4_2_25, 618 kb telomeric; and C3_2_11, 831 kb telomeric) (Fig. 1). A total of 76 Japanese patients with psoriasis vulgaris were enrolled for association analysis using these microsatellites. In the patients, the phenotype frequency of HLA-Cw6 (8/76 patients, 10.5%) was significantly increased, with a Pc-value of 0.02 (odds ratio = 15.88). As shown in Table 1, alleles showing statistically significant differences from the Pc-value of <0.05 in the patient group were found at four microsatellite loci: alleles 303 (χ 2 =12.62,Pc = ) of C1_2_6; 357 (χ 2 = 7.91, Pc =0.034)ofC1_3_2; 255, 259 (χ 2 =9.53, Pc =0.012 and χ 2 = 11.58, Pc = , respectively) of C2_4_4; and 223 (χ 2 =7.59,Pc = 0.036) of C4_2_12. Alleles in each microsatellite marker were named on the basis of the amplified fragment size length. The most significant
3 Human Molecular Genetics, 1999, Vol. 8, No Table 1. Statistically significant alleles associated with psoriasis vulgaris Loci Distance from HLA-C a No. of alleles Allele Odds ratio CI of odds ratio χ 2 P-value b Pc-value c C1_2_A 232 kb (c) C1_4_1 91 kb (c) C1_2_5 19 kb (c) C1_4_3 29 kb (t) C1_3_1 31 kb (t) C1_2_6 89 kb (t) C1_3_2 143 kb (t) C2_4_4 200 kb (t) C2_4_ C4_2_ kb (t) C4_2_ kb (t) C3_2_ kb (t) a (c), centromeric of the HLA-C gene; (t), telomeric of the HLA-C gene. b Determined by Fisher s exact test. c Corrected by multiplying by the number of microsatellite alleles observed in each locus. Pc-values of <0.05 accepted as statistically significant are underlined. Table 2. Exact test of the Hardy Weinberg proportion of microsatellites Loci HW a SE Hetero. b SE Ex. hetero. c Ob. hetero. d C1_2_A C1_4_ C1_2_ C1_4_ C1_3_ C1_2_ C1_3_ C2_4_ C4_2_ C4_2_ C3_2_ The exact P-value was estimated by the simulations based on the Markov chain method with the following parameters: dememorization number = 1000; no. of batches = 400; iteration per batch = When the number of alleles was <5, the exact P-value was calculated by the complete enumeration method. P-values of <0.1 accepted as statistically significant are underlined. SE, standard error. a Deviation from Hardy Weinberg proportions (probability test). b Heterozygote deficiency against the null hypothesis of Hardy Weinberg equilibrium. c Expected heterozygote frequency in the patient population. d Observed heterozygote frequency in the patient population. association was obtained for the 303 allele of the C1_2_6 locus. All four microsatellites in the segment from the loci C1_2_6 to C4_2_12 exhibited statistically significant differences in their allele frequencies between the patients and controls (Table 1 and Fig. 1). The exact test of Hardy Weinberg proportion was also carried out for these 11 microsatellite markers by the Markov chain method (17) in terms of deviation from Hardy Weinberg proportions (the probability test) and heterozygote deficiency against the null hypothesis of Hardy Weinberg equilibrium (18,19). All of the 11 markers tested followed, as expected, Hardy Weinberg equilibrium in the healthy controls (P > 0.25). In contrast, five loci deviated significantly from Hardy Weinberg equilibrium in the patients (P <0.1:C1_2_5, C1_3_1, C1_2_6, C1_3_2 and C2_4_4). Furthermore, five loci showed a significant decrease in heterozygotes (P < 0.1: C1_4_3, C1_3_1, C1_3_2, C2_4_4 and C4_2_12), as listed in Table 2. On the other hand, heterozygote excess was not observed at any markers. It must be noted that the three microsatellite loci (C1_3_1, C1_3_2 and C2_4_4) in the segment from C1_3_1 to C2_4_4 displayed significant P-values in both probability and heterozygote deficiency tests (Table 2 and Fig. 1). In particular, C1_3_2 and C2_4_4 reached highly significant P-values for both of these tests.
4 2168 Human Molecular Genetics, 1999, Vol. 8, No. 12 DISCUSSION On completion of our genomic sequence determination of the entire 1.8 Mb HLA class I region, a total of 38 highly informative microsatellite repeats were selected for high resolution mapping. Combined with the seven previously known polymorphic genes and microsatellites [MICB, MICA, HLA-B, HLA-C, HLA-A, MIB (20) and D6S265 (21)], a total of 45 informative genetic markers, i.e. one every 41.1 kb, are defined within the HLA class I region. These high density polymorphic markers are expected to provide useful and precise information for haplotype and mapping analyses of HLA class I-associated diseases such as psoriasis vulgaris, Behçet s disease (MIM ), acute anterior uveitis and ulcerative colitis (MIM ). In this study, to determine the definite position of the causative gene for psoriasis vulgaris within the HLA class I region, association analyses were conducted using 11 of these 38 repeats. Four of these microsatellites (C1_2_6, C1_3_2, C2_4_4 and C4_2_12) in the segment from C1_2_6 to C4_2_12 displayed statistically significant differentiation between the patients and controls (Table 1 and Fig. 1). Further, the Hardy Weinberg equilibrium analyses in the patient group suggested that the three microsatellite loci (C1_3_1, C1_3_2 and C2_4_4) in the segment from C1_3_1 to C2_4_4 displayed significant deviation from Hardy Weinberg equilibrium in both the probability and heterozygote deficiency tests (Table 2 and Fig. 1). In particular, C1_3_2 and C2_4_4 reached highly significant P-values for both tests. Although the mode of inheritance of psoriasis is unclear, the lower than expected frequency of heterozygotes at these five microsatellite loci in the patients (Table 1) may suggest a recessive HLA trait for this disease, although the genetic penetrance is not high. Collectively, it can be concluded that the 111 kb segment from C1_2_6 (89kbtelomericofHLA-C)toC2_4_4 (200 kb telomeric of HLA-C) is the common area critical for psoriasis vulgaris at a >95% confidence level, as assessed by both statistical methods for allelic distribution and deviation from Hardy Weinberg equilibrium (Fig. 1). It must be emphasized that these two independent statistical methods, of which the former deals with the data of patients and controls and the latter only with the data of patients, revealed an almost identical critical segment for psoriasis vulgaris. This result is consistent with previous mapping data showing that the susceptibility gene for psoriasis vulgaris resides on the telomeric side of the HLA-C gene, based on the transmission/ disequilibrium test (TDT) and parametric linkage analysis using the HLA class I (HLA-A, -B and -C) and class II (HLA- DRB1 and -DQB1) alleles in the patients (22). Investigation of recombinant haplotypes in the HLA region revealed the presence of the five frozen blocks in which recombination rarely occurs, thus maintaining stable ancestral HLA haplotypes (23). Among them, the β-block spans ~500 kb from the HLA-B-associated transcript 1 (BAT1)genetotheS gene. The telomeric boundary of this β-block, whereahotspotfor genetic recombination is supposed to operate, is in the region of the C2_4_4 locus and so may also define the telomeric end of the critical region for psoriasis vulgaris. Within this defined critical region for psoriasis vulgaris, we have so far identified three known genes, POU5F1 (OTF3; octamer transcription factor 3) (24,25), TCF19 (SC1; cell growth-regulated gene) (25,26) and S (corneodesmosin gene) (27 30), two new, completely expressed sequence tagmatched expressed genes as well as two putative genes detected by RT PCR (using keratinocyte mrna). The S gene encodes a kda protein, corneodesmosin, which is expressed in differentiating epidermal keratinocytes. Given this, it is an obvious candidate for psoriasis vulgaris. However, our previous genetic analysis of polymorphic nucleotide positions 619 (Ser/Phe), 1240 (Gly/Val) and 1243 (Ser/Leu) failed to delineate any significant associations with the Japanese psoriasis vulgaris patients (28). This is in contrast to a reported notable disease association with Leu (allele 2) at position 1243 in Caucasian patients (29,30). Although the reason for this discrepancy remains unclear at present, there are three possible explanations. First, the number of patients enrolled in our study (28) was not sufficient (n = 63) to obtain statistical significance, as compared with those in Tazi et al. (n = 235) (29) and Allen et al. (n = 152) (30). Second, there is an unknown disease-causing allele or mutation in the S gene itself or in a nearby gene, which in turn is in linkage disequilibrium with allele 2 at position 1243 in Caucasian populations, but not in the Japanese population. Third, the pathogenic gene (or allele) is not identical in Japanese and Caucasian patients, which may indeed result in the observed differential clinical manifestations between two populations, e.g. the age of disease onset, the familial clustering, the incidence, the frequency of HLA-Cw6-carrying patients, etc. POU5F1 and TCF19 are two further other genes within the critical area. POU5F1 is expressed in totipotent and pluripotent stem cells of the pregastrulation embryo and plays a role in early development (23). The TCF19 gene is ubiquitously expressed in the G 1 S phases of the cell cycle as a cell growth regulatory factor. Based on these broadly based functions, neither POU5F1 nor TCF19 appear to be obvious candidates for the putative MHClinked psoriasis vulgaris gene, although this needs to be ruled out formally. One of the four new genes in the 111 kb critical region for psoriasis vulgaris is expressed in most of the tissues examined, including keratinocytes, and encodes a plectin-like protein with α-helical coiled-coil rod domains. Plectin has been proposed to provide mechanical strength to cells and tissues by acting as a cross-linking element of the cytoskeleton (31). Furthermore, it is of particular interest that the plectin gene is responsible for the development of epidermolysis bullosa simplex (32). The other three new genes have no homology to any known sequences in the DNA databases, although it is noteworthy that all of them are expressed specifically in keratinocytes and skin tissues. Thus, in addition to the S gene, these four new genes are also strong candidates for psoriasis vulgaris in terms of their expression pattern and/or predicted function. In this respect, it is of great importance to investigate disease-associated polymorphism(s)/mutation(s) within all these loci in several ethnically diverse patient and control populations. MATERIALS AND METHODS Patients A total of 76 unrelated Japanese patients with psoriasis vulgaris and 132 healthy controls were investigated in this
5 Human Molecular Genetics, 1999, Vol. 8, No Table 3. Microsatellite markers used in the association study Microsatellite Localization Repeat unit PCR primers C1_2_A Tel. (0 kb)/micb (CA) 23 CA: AATAGCCATGAGAAGCTATGTGGGGGAG Cen. (89 kb)/mica TG: CTACCTCCTTGCCAAACTTGCTGTTTGTG C1_4_1 Tel. (40 kb)/mica (CAAA) 6 CAAA: CGAGAACAACTGGCAGGACTG Cen. (6 kb)/hla-b TTTG: GACAGTCCTCATTAGCGCTGAGG C1_2_5 Tel. (62 kb)/hla-b (CA) 4 AA(CA) 20 CA: CAGTAGTAAGCCAGAAGCTATTAC Cen. (19 kb)/hla-c TG: AAGTCAAGCATATCTGCCATTTGG C1_4_3 Tel. (26 kb)/hla-c (GGAA) 18 GGAA: TAGAAAACGCAATCTCGGCC Cen. (71 kb)/otf3 TTCC: CTGGATTAACCTGGAGACTC C1_3_1 Tel. (27 kb)/hla-c (TTG) 8 TTG: CAGTGACAAGCACCTGGCAC Cen. (69 kb)/otf3 CAA: GCCAGATGTGGTGGCATGC C1_2_6 Tel. (85 kb)/hla-c (TA) 17 TA: TGTTCAGACCTCTTCCTGCC Cen. (11 kb)/otf3 AT: GACTAGCTCTTGACTACTTG C1_3_2 Tel. (37 kb)/otf3 (TAA) 16 TAA: TAGGGATGGTCCCAAACGTG Cen. (7 kb)/s TTA: CCCGTGCAGGACTGATCTCC C2_4_4 Tel (80 kb)/s (GAAA) 6 AAAA(GAAA) 3 GAAA: GGCTTGACTTGAAACTCAGAGACC TTTC: TTATCTACTTATAGTCTATCACGG C4_2_12 Tel. (75 kb)/ddr (CA) 13 CA: GAGCCACGGAGAGTCTCCCTTTATC Cen. (89 kb)/tubb TG: TCCAGGAACTGTGAGTAGTAAGAAC C4_2_25 Tel. (69 kb)/tubb (TG) 16 TG: TCTTCTGTGCAAGCAATGCACTGTAC Cen. (47 kb)/hsgt260 CA: ATGTTACTTTTAGAAGATAACACTC C3_2_11 Tel. (50 kb)/hla-e (GA) 22 TA(GA) 8 GA: AGATGGCATTTGGAGAGTGCAG Cen. (21 kb)/micc TC: TCCTTACAGCAGAGATATGTGG Marker order from centromere to telomere is C1_2_A, C1_4_1, C1_2_5, C1_4_3, C1_3_1, C1_2_6, C1_3_2, C2_4_4, C4_2_12, C4_2_25 and C3_2_11 (Fig. 1). Repeat units are determined from our sequencing data (14). All markers were established by Tamiya et al. (15,16). Tel., telomeric; Cen., centromeric. study. All patients were hospitalized for diagnosis and treatment at the Department of Dermatology, Tokai University School of Medicine (Kanagawa, Japan). The patient group consisted of 51 males and 25 females with mean age of onset of 33.9 years (SD = 15.3). Informed consent was obtained from all the healthy donors and patients by explaining the details of this study prior to collection of peripheral blood. Genotyping for microsatellite alleles To determine the number of repeat units of the microsatellite loci exhibiting polymorphisms, unilateral primers were synthesized by labeling at the 5 end with the fluorescent reagent, 6-FAM, HEX or TET (PE Biosystems, Foster City, CA). PCR primers used for amplification of 11 microsatellites (C1_2_A, C1_4_1, C1_2_5, C1_4_3, C1_3_1, C1_2_6, C1_3_2, C2_4_4, C4_2_12, C4_2_25 and C3_2_11) are shown in Table 3. The PCR reaction mixture contained 50 ng of genomic DNA, 2 µl of dntp (2.5 mm each), 2 µl of10 buffer (100 mm Tris HCl, ph 8.3, 500 mm KCl, 15 mm MgCl 2 ) and 20 pmol of forward and reverse primers as well as 0.5 U of Takara recombinant Taq polymerase (Takara Shuzo, Kyoto, Japan) in a total volume of 20 µl. After initial denaturation for 5 min at 96 C, amplification was carried out in an automated thermal cycler (Takara Shuzo) for 30 cycles consisting of 1 min at 96 C, 30 s at 55 C and 45 s at 72 C, with a final extension of 4 min at 72 C. The amplified products were denatured for 5 min at 100 C, mixed with formamidecontaining stop buffer, applied with a size standard marker of GS500 Tamra (PE Biosystems) to each lane and run on a 4% polyacrylamide denaturing sequencing gel containing 8 M urea in an automated DNA sequencer. Fragment sizes were determined automatically using the GeneScan software (PE Biosystems). Statistical analysis Allele frequencies were estimated by direct counting. The significance of the distribution of alleles between the patients and the controls was tested by the χ 2 method with the continuity correction and Fisher s exact probability test (P-value test). The P-value was corrected by multiplying by the number of microsatellite alleles observed in each locus (Pc). A level of Pc < 0.05 was accepted as statistically significant. The odds ratio of the risk of psoriasis vulgaris was calculated from the 2 2 contingency table. The exact P-value test of the Hardy Weinberg proportion for multiple alleles was simulated by the Markov chain method within the Genepop software package (15 17). The Markov chain method has the advantage of giving a complete enumeration for testing the Hardy Weinberg proportion in cases where the number of alleles as well as sample size are small. When the number of alleles was <5, the exact P-value was calculated by the complete enumeration method. A level of P < 0.1 was accepted as statistically significant for the Hardy Weinberg equilibrium test.
6 2170 Human Molecular Genetics, 1999, Vol. 8, No. 12 ACKNOWLEDGEMENTS We would like to thank Naruse Taeko and Yumiko Matsuzawa for HLA genotyping, and Takako Sakuma and Setsuko Harada for secretarial assistance. We also wish to acknowledge the many helpful suggestions by Koji Watanabe and Masaaki Yamazaki at Fujiya Co. Ltd. This work was supported by a grant from the Japan Science and Technology Corp., an arm of the Japan Science and Technology Agency. S.B. and H.I. are grateful to a French Japanese collaborative grant awarded jointly by INSERM and JSPS. REFERENCES 1. Tomfohrde, J., Silverman, A., Barnes, R., Fernandez-Vina, M.A., Young, M., Lory, D., Morris, L., Wuepper, K.D., Stastny, P., Menter, A. and Bowcock, A. (1994) Gene for familial psoriasis susceptibility mapped to the distal end of human chromosome 17q. Science, 20, Matthews, D., Fry, L., Powles, A., Weber, J., McCarthy, M., Fisher, E., Davies, K. and Williamson, R. (1996) Evidence that a locus for familial psoriasis maps to chromosome 4q. Nature Genet., 14, Nair, R.P., Henseler, T., Jenisch, S., Stuart, P., Bichakjian, C.K., Lenk, W., Westphal, E., Guo, S.W., Christophers, E., Voorhees, J.J. and Elder, J.T. (1997) Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan. Hum. Mol. Genet., 6, Trembath, R.C., Clough, R.L., Rosbotham, J.L., Jones, A.B., Camp, R.D., Frodsham, A., Browne, J., Barber, R., Terwilliger, J., Lathrop, G.M. and Barker, J.N. (1997) Identification of a major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by a two stage genome-wide search in psoriasis. Hum. Mol. Genet., 6, Brenner, W., Gschnait, F. and Mayr, W.R. (1978) HLA B13, B17, B37 and Cw6 in psoriasis vulgaris: association with the age of onset. Arch. Dermatol. Res., 28, Tiilikainen, A., Lassus, A., Karvonen, J., Vartiainen, P. and Julin, M. (1980) Psoriasis and HLA-Cw6. Br. J. Dermatol., 102, Ozawa, A., Ohkido, M. and Tsuji, K. (1981) Some recent advances in HLA and skin diseases. J. Am. Acad. Dermatol., 4, Cao, K., Song, F.J., Li, H.G., Xu, S.Y., Liu, Z.H., Su, X.H. and Wang, F.X. (1993) Association between HLA antigens and families with psoriasis vulgaris. Chin. Med. J., 106, Schmitt-Egenolf, M., Eiermann, T.H., Boehncke, W.H., Stander, M. and Sterry, W. (1996) Familial juvenile onset psoriasis is associated with the human leukocyte antigen (HLA) class I side of the extended haplotype Cw6-B57-DRB1*0701-DQA1*0201-DQB1*0303: a population- and family-based study. J. Invest. Dermatol., 106, Moller, E. and Olhagen, B. (1975) Studies on the major histocompatibility system inpatients with ankylosing spondylitis. Tissue Antigens, 6, Asahina, A., Akazaki, S., Nakagawa, H., Kuwata, S., Tokunaga, K., Ishibashi, Y. and Juji, T. (1991) Specific nucleotide sequence of HLA-C is strongly associated with psoriasis vulgaris. J. Invest. Dermatol., 97, Mizuki, N., Ando, H., Kimura. M., Ohno. S., Miyata, S., Yamazaki, M., Tashiro, H., Watanabe, K., Ono, A., Taguchi, S., Sugawara, C., Fukuzumi, Y., Okumura, K., Goto, K., Ishihara, M., Nakamura, S., Yonemoto, J., Kikuti, Y.Y., Shiina, T., Chen, L., Ando, A., Ikemura, T. and Inoko, H. (1997) Nucleotide sequence analysis of the HLA class I region spanning the 237-kb segment around the HLA-B and -C genes. Genomics, 42, Shiina, T., Tamiya, G., Oka, A., Yamagata, T., Yamagata, N., Kikkawa, E., Goto, K., Mizuki, N., Watanabe, K., Fukuzumi, Y., Taguchi, S., Sugawara, C., Ono, A., Chen, L., Yamazaki, M., Tashiro, H., Ando, A., Ikemura, T., Kimura, M. and Inoko, H. (1998) Nucleotide sequencing analysis of the 146-kilobase segment around the IkBL and MICA genes at the centromeric end of the HLA class I region. Genomics, 47, Shiina, T., Tamiya, G., Oka, A., Takishima, N. and Inoko, H. (1999) Genome sequencing analysis of the 1.8 Mb entire human MHC class I region. Immunol. Rev., 167, Tamiya, G., Ota, M., Katsuyama, Y., Shiina, T., Oka, A., Makino, S., Kimura, M. and Inoko, H. (1998) Twenty-six new polymorphic microsatellite markers around the HLA-B, -C and -E loci in the human MHC class I region. Tissue Antigens, 51, Tamiya, G., Shiina, T., Oka, A., Ota, M., Kastuyama, Y., Tomizawa, M., Yoshitome, M., Ohtsuka, M., Kimura, M. and Inoko, H. (1999) New microsatellite markers in the human MHC class I region. Tissue Antigens, in press. 17. Guo, S.W. and Thompson, E.A. (1992) Performing the exact test of Hardy Weinberg proportion for multiple alleles. Biometrics, 48, Raymond, M. and Rousset, F. (1995) Genepop (version 1.2): population genetics software for exact tests and ecumenicism. J. Hered., 86, Rousset, F. and Raymond, M. (1995) Testing heterozygote excess and deficiency. Genetics, 140, Grimaldi, M.C., Clayton, J., Pontarotti, P., Cambon-Thomsen, A. and Crouau-Roy, B. (1996) New highly polymorphic microsatellite marker in linkage disequilibrium with HLA-B. Hum. Immunol., 51, Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G. and Lathrop, M. (1992) A second-generation linkage map of the human genome. Nature, 29, Jenisch, S., Henseler, T., Nair, R.P., Guo, S.W., Westphal, E., Stuart, P., Kronke, M., Voorhees, J.J., Christophers, E. and Elder, J.T. (1998) Linkage analysis of human leukocyte antigen (HLA) markers in familial psoriasis: strong disequilibrium effects provide evidence for a major determinant in the HLA-B/-C region. Am.J.Hum.Genet., 63, Marshall, B., Leelayuwat, C., Degli-Esposti, M.A., Pinelli, M., Abraham, L.J. and Dawkins, R.L. (1993) New major histocompatibility complex genes. Hum. Immunol., 38, Takeda, J., Seino, S. and Bell, G.I. (1991) Human Oct3 gene family: cdna sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucleic Acids Res., 20, Krishnan, B.R., Jamry, I. and Chaplin, D.D. (1995) Feature mapping of the HLA class I region: localization of the POU5F1 and TCF19 genes. Genomics, 30, Ku, D.H., Chang, C.D., Koniecki, J., Cannizzaro, L.A., Boghosian-Sell, L., Alder, H. and Baserga, R. (1991) A new growth-regulated complementary DNA with the sequence of a putative trans-activating factor. Cell Growth Differ., 2, Zhou, Y. and Chaplin, D.D. (1993) Identification in the HLA class I region of a gene expressed late in keratinocyte differentiation. Proc. Natl Acad. Sci. USA, 90, Ishihara, M., Yamagata, N., Ohno, S., Naruse, T., Ando, A., Kawata, H., Ozawa, A., Ohkido, M., Mizuki, N., Shiina, T., Ando, H. and Inoko, H. (1996) Genetic polymorphisms in the keratin-like S gene within the human major histocompatibility complex and association analysis on the susceptibility to psoriasis vulgaris. Tissue Antigens, 48, Tazi Ahnini, R., Camp, N.J., Cork, M.J., Mee, J.B., Keohane, S.G., Duff, G.W. and di Giovine, F.S. (1999) Novel genetic association between the corneodesmosin (MHC S) gene and susceptibility to psoriasis. Hum. Mol. Genet., 8, Allen, M.H., Veal, C., Faassen, A., Powis, S.H., Vaughan, R.W., Trembath, R.C. and Barker, J.N. (1999) A non-hla gene within the MHC in psoriasis. Lancet, 353, Liu, C.G., Maercker, C., Castanon, M.J., Hauptmann, R. and Wiche, G. (1996) Human plectin: organization of the gene, sequence analysis, and chromosome localization (8q24). Proc. Natl Acad. Sci. USA, 30, Pulkkinen, L., Smith, F.J., Shimizu, H., Murata, S., Yaoita, H., Hachisuka, H., Nishikawa, T., McLean, W.H. and Uitto, J. (1996) Homozygous deletion mutations in the plectin gene (PLEC1) in patients with epidermolysis bullosa simplex associated with late-onset muscular dystrophy. Hum. Mol. Genet., 5,
Behçet s disease (BD) is a refractory systemic inflammatory
Localization of the Pathogenic Gene of Behçet s Disease by Microsatellite Analysis of Three Different Populations Nobuhisa Mizuki, 1,2 Masao Ota, 3 Kazuro Yabuki, 1,2 Yoshihiko Katsuyama, 3 Hitoshi Ando,
More informationThe Region of 150 kb Telometic to HLA-C Is Associated with Psoriasis in the Jewish Population
The Region of 150 kb Telometic to HLA-C Is Associated with Psoriasis in the Jewish Population Jesús Martínez-Borra, Chaim Brautbar,w Segundo González,z Claes D. Enk,y Antonio López-Vázquez, and Carlos
More informationCorneodesmosin Expression in Psoriasis Vulgaris Differs from Normal Skin and Other Inflammatory Skin Disorders
0023-6837/01/8107-969$03.00/0 LABORATORY INVESTIGATION Vol. 81, No. 7, p. 969, 2001 Copyright 2001 by The United States and Canadian Academy of Pathology, Inc. Printed in U.S.A. Corneodesmosin Expression
More informationBehçet s disease (BD) is a chronic inflammatory disorder
Association of MICA Gene and HLA-B*5101 with Behçet s Disease in Greece Kazuro Yabuki, 1,2 Nobuhisa Mizuki, 1,2 Masao Ota, 3 Yoshihiko Katsuyama, 3 Gerasimos Palimeris, 4 Caterina Stavropoulos, 5 Yvonni
More informationAssociation of -619C/T polymorphism in CDSN gene and psoriasis risk: a meta-analysis
Association of -619C/T polymorphism in CDSN gene and psoriasis risk: a meta-analysis Y. Wu 1 *, B. Wang 1 *, J.L. Liu 2, X.H. Gao 1, H.D. Chen 1 and Y.H. Li 1 1 Department of Dermatology, The First Affiliated
More informationDiversity and Frequencies of HLA Class I and Class II Genes of an East African Population
Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and
More information1997 Oxford University Press Human Molecular Genetics, 1997, Vol. 6, No
1997 Oxford University Press Human Molecular Genetics, 1997, Vol. 6, No. 5 813 820 Identification of a major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by a two
More informationEvidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan
1997 Oxford University Press Human Molecular Genetics, 1997, Vol. 6, No. 8 1349 1356 Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide
More informationASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală
ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES Summary Irina Durbală CELL AND MOLECULAR BIOLOGY DEPARTMENT FACULTY OF MEDICINE, OVIDIUS UNIVERSITY CONSTANŢA Class II
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationHLA-C, DRB1 and DQB1 alleles involved in genetic predisposition to psoriasis vulgaris in the Slovak population
Folia Microbiol (2013) 58:319 324 DOI 10.1007/s12223-012-0213-7 HLA-C, DRB1 and DQB1 alleles involved in genetic predisposition to psoriasis vulgaris in the Slovak population Ivana Shawkatová & Juraj Javor
More informationA meta analysis of the association between Behçet's disease and MICA A6
BIOMEDICAL REPORTS 4: 741-745, 2016 A meta analysis of the association between Behçet's disease and MICA A6 FEIRAN WEI 1, YU ZHANG 1 and WEI LI 2 1 Clinical Medical College, Yangzhou University, Yangzhou,
More informationDetermination of HLA-A, -C, -B, -DRB1 allele and haplotype frequency in Japanese population based on family study
Tissue Antigens ISSN 0001-2815 Determination of HLA-A, -C, -B, -DRB1 allele and haplotype frequency in Japanese population based on family study N. Ikeda 1,H.Kojima 1,M.Nishikawa 1, K. Hayashi 1, T. Futagami
More informationPsoriasis susceptibility locus in chromosome region 3q21 identified in patients from southwest Sweden
European Journal of Human Genetics (1999) 7, 783 790 1999 Stockton Press All rights reserved 1018 4813/99 $15.00 t http://www.stockton-press.co.uk/ejhg ARTICLE Psoriasis susceptibility locus in chromosome
More informationC D Veal, R L Clough, R C Barber, S Mason, D Tillman, B Ferry, A B Jones, M Ameen, N Balendran, S H Powis, A D Burden, J N W N Barker,
J Med Genet ;8:7 7 Original articles Division of Medical Genetics, Departments of Medicine and Genetics, University of Leicester, Adrian Building, Leicester LE 7RH, UK CDVeal R L Clough R C Barber S Mason
More informationMyoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
More informationAllele and Haplotype Frequencies of Human Leukocyte Antigen-A, -B, -C, -DRB1, and -DQB1 From Sequence- Based DNA Typing Data in Koreans
Original Article Diagnostic Immunology Ann Lab Med 2015;35:429-435 http://dx.doi.org/10.3343/alm.2015.35.4.429 ISSN 2234-3806 eissn 2234-3814 Allele and Haplotype Frequencies of Human Leukocyte Antigen-A,
More informationHeterozygosity. Unit 178/ AT D6S2655 GDB: / CA D6S2656 GDB:
Supplement to Nair et al., Localization of Psoriasis Susceptibility Locus PSORS1 to a 60 Kilobase Interval Telomeric to HLA-C. Page 1 of 6 Reference allele for new s were determined using the Research
More informationFONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
More informationLack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims
Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,
More informationResearch Article The Region Centromeric to HLA-C Is a Key Region for Understanding the Phenotypic Variability of Psoriatic Arthritis
ISRN Dermatology, Article ID 570178, 5 pages http://dx.doi.org/10.1155/2014/570178 Research Article The Region Centromeric to HLA-C Is a Key Region for Understanding the Phenotypic Variability of Psoriatic
More informationAssociation of MICA Polymorphism with HLA-B51 and Disease Severity in Korean Patients with Behcet's Disease
J Korean Med Sci 2002; 17: 366-70 ISSN 1011-8934 Copyright The Korean Academy of Medical Sciences Association of MICA Polymorphism with HLA-B51 and Disease Severity in Korean Patients with Behcet's Disease,
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationHuman leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
More informationIndian Journal of Nephrology Indian J Nephrol 2001;11: 88-97
88 Indian Journal of Nephrology Indian J Nephrol 2001;11: 88-97 ARTICLE HLA gene and haplotype frequency in renal transplant recipients and donors of Uttar Pradesh (North India) S Agrawal, AK Singh, RK
More informationImmunogenetics in SARS: a casecontrol
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES MHL Ng 吳香玲 SH Cheng 鄭淑恆 KM Lau 劉建盟 GM Leung 梁卓偉 US Khoo 邱瑋璇 BCW Zee 徐仲鍈 JJY Sung 沈祖堯 Key Messages 1. Human leukocyte antigen (HLA) genotypes from 102
More informationThe Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationPsoriasis is a chronic in ammatory skin disease. All major. Genetic Analysis of PSORS1 Distinguishes Guttate Psoriasis and Palmoplantar Pustulosis
ORIGINAL ARTICLE See related Commentary on pages vii and xvii Genetic Analysis of PSORS1 Distinguishes Guttate Psoriasis and Palmoplantar Pustulosis Kati Asumalahti, n1 Mahreen Ameen,w 1 Sari Suomela,z
More informationTitle: Lack of association of Toll-like receptor 9 gene polymorphism with
Title: Lack of association of Toll-like receptor 9 gene polymorphism with Behçet s disease in Japanese patients Short title:tlr9 gene polymorphism in Japanese patients with Behçet s disease Authors: Akiko
More informationHLA-DR2 and IKBL+738(C) in Dutch Ulcerative Colitis Patients
HLA-DR2 and IKBL+738(C) in Dutch Ulcerative Colitis Patients Boukje de Vries Student from the VUmc Amsterdam The Netherlands September 2002 January 2003 Supervisors: EG de la Concha, AS Peña, L Fernandez
More informationLack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population
Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu
More informationANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE.
ANALYSIS OF IL17 AND IL17RA POLYMORPHISMS IN SPANISH PSORIASIS PATIENTS: ASSOCIATION WITH RISK FOR DISEASE. Batalla A, Coto E*, González-Lara L, González- Fernández D, Maldonado-Seral C, García-García
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationAssociation between atopic dermatitis-related single nucleotide polymorphisms rs and psoriasis vulgaris in a southern Chinese cohort
Association between atopic dermatitis-related single nucleotide polymorphisms rs4722404 and psoriasis vulgaris in a southern Chinese cohort G. Shi 1 *, C.M. Cheng 2 *, T.T. Wang 1 *, S.J. Li 1, Y.M. Fan
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationCompleting the CIBMTR Confirmation of HLA Typing Form (Form 2005)
Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1
More informationGenome-wide association studies for human narcolepsy and other complex diseases
ETHZ-JST Joint WS Sept. 15-16, 2008 Genome-wide association studies for human narcolepsy and other complex diseases Katsushi Tokunaga Department of Human Genetics Graduate School of Medicine The University
More informationOriginal Article. C18orf1 located on chromosome 18p11.2 may confer susceptibility to schizophrenia
J Med Dent Sci 2003; 50: 225 229 Original Article C18orf1 located on chromosome 18p11.2 may confer susceptibility to schizophrenia Mika Kikuchi 1,2, Kazuo Yamada 1, Tomoko Toyota 1,2 and Takeo Yoshikawa
More informationThe major histocompatibility complex (MHC) is a group of genes that governs tumor and tissue transplantation between individuals of a species.
Immunology Dr. John J. Haddad Chapter 7 Major Histocompatibility Complex The major histocompatibility complex (MHC) is a group of genes that governs tumor and tissue transplantation between individuals
More informationTCR-p-MHC 10/28/2013. Disclosures. Rheumatoid Arthritis, Psoriatic Arthritis and Autoimmunity: good genes, elegant mechanisms, bad results
Rheumatoid Arthritis, Psoriatic Arthritis and Autoimmunity: good genes, elegant mechanisms, bad results The meaning and significance of HLA associations Disclosures No relevant commercial relationships
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationDocumentation of Changes to EFI Standards: v 5.6.1
Modified Standard B - PERSONNEL QUALIFICATIONS B1.000 The laboratory must employ one or more individuals who meet the qualifications and fulfil the responsibilities of the Director/Co-Director, Technical
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationGenetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder)
Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder) September 14, 2012 Chun Xu M.D, M.Sc, Ph.D. Assistant professor Texas Tech University Health Sciences Center Paul
More informationthe HLA complex Hanna Mustaniemi,
the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important
More informationIntroduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder
Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits
More informationPolymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women
www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha
More informationHLA Complex Genetics & Biology
HLA Complex Genetics & Biology M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info Mount Sinai Medical Center
More information25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex
Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationChapter 4 INSIG2 Polymorphism and BMI in Indian Population
Chapter 4 INSIG2 Polymorphism and BMI in Indian Population 4.1 INTRODUCTION Diseases like cardiovascular disorders (CVD) are emerging as major causes of death in India (Ghaffar A et. al., 2004). Various
More informationHLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute
HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationMICA association with presumed ocular histoplasmosis syndrome (POHS)
Received 29 April 2003 Accepted 28 August 2003 Published 2 September 2003 MICA association with presumed ocular histoplasmosis syndrome (POHS) Judith Reinders, 1 Erik H. Rozemuller, 1 Jenny V. Ongkosuwito,
More informationGenomewide Scan in German Families Reveals Evidence for a Novel Psoriasis-Susceptibility Locus on Chromosome 19p13
Am. J. Hum. Genet. 67:1020 1024, 2000 Report Genomewide Scan in German Families Reveals Evidence for a Novel Psoriasis-Susceptibility Locus on Chromosome 19p13 Young-Ae Lee, 1,2 Franz Rüschendorf, 1,4
More informationattomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!
attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95
More informationMODULE NO.14: Y-Chromosome Testing
SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:
More informationDEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS
DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific
More informationAssociation between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population
Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population G.B. Su, X.L. Guo, X.C. Liu, Q.T. Cui and C.Y. Zhou Department of Cardiothoracic
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationAldehyde Dehydrogenase-2 Genotype Detection in Fingernails among Non-alcoholic Northeastern Thai Population and Derived Gene Frequency
ScienceAsia 28 (2002) : 99-103 Aldehyde Dehydrogenase-2 Genotype Detection in Fingernails among Non-alcoholic Northeastern Thai Population and Derived Gene Frequency Paiboon Mongconthawornchai a, *, Somsong
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationVisualizing Human Leukocyte Antigen Class II Risk Haplotypes in Human Systemic Lupus Erythematosus
Am. J. Hum. Genet. 71:543 553, 2002 Visualizing Human Leukocyte Antigen Class II Risk Haplotypes in Human Systemic Lupus Erythematosus Robert R. Graham, 1 Ward A. Ortmann, 1 Carl D. Langefeld, 2 Damini
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationHistocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director
Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow
More informationA study on the relationship between TCTA tetranucleotide polymorphism of the HPRT gene and primary hyperuricemia
A study on the relationship between TCTA tetranucleotide polymorphism of the HPRT gene and primary hyperuricemia Y.S. Zhu 1,2, S.G. Wei 1, R.F. Sun 1, J.L. Feng 1, W.J. Kuang 1, J.H. Lai 1 and S.B. Li
More informationPsoriasis (OMIM#177900) is a chronic in ammatory
ORIGINAL ARTICLE See related Editorial on page v Psoriasis Susceptibility Locus on 18p Revealed by Genome Scan in Finnish Families Not Associated with PSORS1 Kati Asumalahti, Tarja Laitinen, PÌivi Lahermo,w
More informationWho gets EIMs? Dr Tim Orchard St Mary s Hospital & Imperial College London
Who gets EIMs? Dr Tim Orchard St Mary s Hospital & Imperial College London Background Extraintestinal manifestations of IBD are well recognised. They include:- Arthritis - peripheral and axial Eye complications
More informationHandling Immunogenetic Data Managing and Validating HLA Data
Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationHLA-DQA1 and DQB1 Genotyping in Individuals with Family History of Gastritis
ADVANCES IN BIORESEARCH, Vol. 2 [1] June 2011: 40-46 Society of Education, India http://www.soeagra.com/abr.htm ISSN 0976-4585 RESEARCH ARTICLE HLA-DQA1 and DQB1 Genotyping in with Family Nibras S. Al-Ammar
More informationHuman leukocyte antigen (HLA) system
Is HLA a determinant of prognosis or therapeutic response to cytokines, IFN and anti-ctla4 blocking antibodies in melanoma? Helen Gogas, M.D. Ass. Professor in Medical Oncology 1st Department of Medicine,
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationIVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois
FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation
More informationLack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis
Lack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis Y. Liu, X.L. Song, G.L. Zhang, A.M. Peng, P.F. Fu, P. Li, M. Tan, X. Li, M. Li and C.H. Wang Department of Respiratory
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationHLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis
Disease Markers 26 (2009) 93 96 93 DOI 10.3233/DMA-2009-0619 IOS Press HLA haplotype A33-B58-Cw10 may modulate radiographic development of bamboo spine in Taiwanese patients with primary ankylosing spondylitis
More informationAncestral and recombinant 16-locus HLA haplotypes in the Hutterites
Immunogenetics (1999) 49: 491 497 Q Springer-Verlag 1999 ORIGINAL PAPER Lowell R. Weitkamp 7 Carole Ober Ancestral and recombinant 16-locus HLA haplotypes in the Hutterites Received: 1 May 1998 / Revised:
More informationdoi: /s
doi: 10.1007/s10528-008-9185-3 Lack of association of the HbE variant with protection from cerebral malaria in Thailand Izumi Naka 1, Jun Ohashi 1, Pornlada Nuchnoi 2, Hathairad Hananantachai 2, Sornchai
More informationInfluence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population
Influence of the c.1517g>c genetic variant in the XRCC1 gene on pancreatic cancer susceptibility in a Chinese population Z.M. Zhao*, C.G. Li*, M.G. Hu, Y.X. Gao and R. Liu Department of Surgical Oncology,
More informationIL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
More informationAssociation between the CYP11B2 gene 344T>C polymorphism and coronary artery disease: a meta-analysis
Association between the CYP11B2 gene 344T>C polymorphism and coronary artery disease: a meta-analysis Y. Liu, H.L. Liu, W. Han, S.J. Yu and J. Zhang Department of Cardiology, The General Hospital of the
More informationGenetics of B27-associated diseases 1
Ann. rheum. Dis. (1979), 38, Supplement p. 135 Genetics of B27-associated diseases 1 J. C. WOODROW From the Department of Medicine, University of Liverpool, Liverpool The genetic analysis of those conditions
More informationMRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
More informationDistribution of HLA Antigens Class I and II in Iraqi Arab population
Distribution of HLA s Class I and II in Iraqi Arab population *Ahmed A.A. Al-Hassan, MSc, Immunology ; **Sana a Al-Naseri, MD, ph.d, immunopathology *** Batool H. Al-Ghurabi, ph.d, Immunology **** Mohammed
More information1" 7I'?? 1" : t"i"i"itf
Cell, Vol. 80, 1-5, January 13, 1995, Copyright 1995 by Cell Press Genes for SMA: Multum In Parvo Minireview Benjamin Lewin Cell In this issue of Ceil, we take the unusual step of publishing two articles
More informationPolymorphic Variations in 5 HT2A, 5 HTT and DISC 1 in first episode schizophrenia patients
PolymorphicVariationsin5 HT2A,5 HTTandDISC1infirst episodeschizophreniapatients L.MedinaGonzález,DepartmentofClinicalChemistry,RamónyCajalHospital,Madrid. PhD.MJArranz,SectionofClinicalNeuropharmacologyattheInstituteofPsychiatry,
More informationHLA localization of the genes predisposing to
Brief Genetics Report Non Class II HLA Gene Associated With Type 1 Diabetes Maps to the 240-kb Region Near HLA-B Sergei Nejentsev, Zsofia Gombos, Antti-Pekka Laine, Riitta Veijola, Mikael Knip, Olli Simell,
More informationHLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.
www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationAssociation between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
More informationUse of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing of Patients with Narcolepsy
Original Article Woo HI, et al. Diagnostic Immunology Ann Lab Med 2012;32:57-65 ISSN 2234-3806 eissn 2234-3814 Use of PCR with Sequence-specific Primers for High-Resolution Human Leukocyte Antigen Typing
More information