Finding genes. Genes and language, Part V: Dan Dediu. Dan Dediu

Transcription

1 Genes and language, Part V: Finding genes DGFS Summer School 2013 Berlin 26th 30th of August, 2013 Language and Genetics Max Planck Institute for Psycholinguistics Nijmegen The Netherlands 1

2 Grand overview Parts V, VI, VII & VIII Heritability, linkage & association studies, sequencing Examples of genes Evolution, gene-culture co-evolution, innateness Relationships genes languages, genetic biases, dispersals Outlook & future directions Suggested (1-2 papers/part) & supplementary readings Points for discussion ~60 mins lecture + ~30 mins discussion (interspersed) Grand Danoverview Dediu 12

3 Overview Part V Basic concepts I (phenotype, genotype...) Heritability Basic concepts II (locus, LD...) Linkage studies Association studies Sequencing (exome, whole genome) Overview 13

4 Basic concepts I Phenotype observable/measurable properties height eye color hard palate shape rate of speech vocabulary size brain activation grammaticality judgments.. Basic Danconcepts Dediu I 14

5 Basic concepts I Phenotype variation normal extreme/pathological Frequency Height Basic Danconcepts Dediu I 15

6 Basic concepts I Phenotype variation normal extreme/pathological Frequency measurement Height Basic Danconcepts Dediu I 16

7 Basic concepts I Phenotype variation theoretically interesting reliable test-retest valid construct normal extreme/pathological measurement content criterion Basic Danconcepts Dediu I 17

8 Basic concepts I Phenotype variation theoretically interesting reliable test-retest valid construct normal extreme/pathological measurement psychometrics content criterion Basic Danconcepts Dediu I 18

9 Basic concepts I Phenotype variation theoretically interesting reliable test-retest valid construct normal extreme/pathological measurement psychometrics content criterion Basic Danconcepts Dediu I quick cheap 19

10 Basic concepts I Genotype abstract way gene genetic locus alleles/variants Basic Danconcepts Dediu I 1

11 Basic concepts I Genotype abstract way gene genetic locus alleles/variants biallelic loci (A/a) Basic Danconcepts Dediu I 1

12 Basic concepts I Genotype abstract way gene genetic locus alleles/variants biallelic loci (A/a) CNVs Basic Danconcepts Dediu I 1

13 Basic concepts I Genotype abstract way gene genetic locus alleles/variants biallelic loci (A/a) CNVs, SNPs Basic Danconcepts Dediu I 1

14 Basic concepts I Environment variation Basic Danconcepts Dediu I schooling nutrition healthcare early multilingualism. 1

15 Basic concepts I What are the relationships between: Basic Danconcepts Dediu I phenotype (P) genetic background (G) environment (E) 1

16 Basic concepts I Notions of statistics (statistical) population sample & inference? Parameters (e.g., population mean μ) Basic Danconcepts Dediu I Inference (confidence) Estimates (e.g., sample mean x) 1

17 Basic concepts I Notions of statistics (statistical) population sample & inference mean (μ) and variation (σ) Frequency Height Basic Danconcepts Dediu I 1

18 Basic concepts I Notions of statistics (statistical) population sample & inference mean (μ) and variation (σ) Frequency Height Basic Danconcepts Dediu I 1

19 Basic concepts I Notions of statistics (statistical) population sample & inference mean (μ) and variation (σ) Frequency Frequency Height Weight Basic Danconcepts Dediu I 1

20 Basic concepts I Notions of statistics (statistical) population sample & inference mean (μ) and variation (σ) Frequency Frequency Height Weight Basic Danconcepts Dediu I 12

21 Basic concepts I Notions of statistics (statistical) population sample & inference mean (μ) and variation (σ) correlation r (covariation cov) = v 0. 5 o c r= cov height, weight r height, weight = σ height σ weight regression line Basic Danconcepts Dediu I 12

22 Partitioning the phenotype P = G + E Assuming independence between G and E: P =G E P = G E phenotypic variation differences in environment genetic variation Basic Danconcepts Dediu I 12

23 Partitioning the genotype G is composed of several (independent) effects: Additive: the effects of the alleles simply sum up Dominance: interaction b/w alleles at the same locus Epistatic: interaction b/w alleles at different loci G=A +D+I Basic Danconcepts Dediu I 12

24 Partitioning the environment E is not monolithic Common partitioning: Shared/common environment to a group: e.g., linguistic input, nutrition,... Unique (non-shared) environment specific to an individual: e.g., personal accidents, illness, friends,... E =C e Basic Danconcepts Dediu I 12

25 Additivity Consider two genes acting on height (hgta & hgtb ) hgta has alleles A and a, hgtb has alleles B and b The independent effects of each allele separately are: A adds 1cm, a adds 0cm, B adds 3cm, b subtracts 1cm Additivity (the effects sum up): mother Genotype AABB AaBb aabb Basic Danconcepts Dediu I AABB +8cm Cumulative effect (cm) = = = -2 offspring? AABb +4cm? AABB +8cm father + AaBb +3cm? AaBB +7cm? AaBb +3cm 12

26 Dominance Let's focus on hgta The independent effects of each allele separately are: A adds 1cm, a adds 0cm If A is dominant over a (a is recessive) A hides a (heterozygote Aa = homozygote AA) homozygote aa AA +1cm Genotype AA Aa aa + Cumulative effect (cm) ? AA +1cm manifest recessive Basic Danconcepts Dediu I hidden recessive Aa +1cm Aa +1cm? aa 0cm +? AA +1cm Aa +1cm? Aa +1cm 12

27 Mendel's First Law (Law of Segregation) A diploid individual produces haploid gametes Random allocation of the two alleles: / AA A / aa A a / Aa a A Diploid parental genotype Possible haploid gametes a Punnett square: parental gametes all possible offspring genotypes Parental gametes A a A AA Aa a Aa aa Genotype ratios: AA:Aa:aa = 1:2:1 Phenotype ratios: additive: (AA):(Aa):(aa) = 1:2:1 dominant: (AA & Aa):(aa) = 3:1 Basic Danconcepts Dediu I 12

28 Dominance: examples Many cases of dominant/recessive alleles Mendel's pea color: yellow dominant over green Many genetic disorders: Huntington's disease (d), cystic fibrosis (r), developmental verbal dyspraxia (d), some forms of deafness (r) Recessive autosomal deafness in Bengkala, Bali Winata et al. (1995); Firedman et al. (1995); Liang et al. (1998) Genealogy of the KE family showing affected and unaffected members, Vargha-Khadem et al. (2005) Basic Danconcepts Dediu I 12

29 Epistasis Epistasis: hot and very complex (and confused) topic Modifier genes (e.g., transcription factors: FOXP2) The independent effects of each allele separately are: A adds 1cm, a adds 0cm, B adds 3cm, b subtracts 1cm hgta is an enhancer of hgtb: say each allele A doubles the effect of each allele of hgtb: Genotype Cumulative effect (cm) hgta is a repressor of hgtb: allele A fully hides hgtb (and is dominant over a): Genotype Cumulative effect (cm) AABB 1+1+(2+2)x(3+3) = +26 AABB 1+1+0x(3+3) = +2 AaBb 1+0+2x(3-1) = +5 AaBb 1+0+0x(3-1) = +1 aabb = -2 aabb = Basic Danconcepts Dediu I -2 12

30 Non-independence of genes and environment P=G+E ignores two possible relationships G E: Genotype-Environment Correlation ( G E): Passive: e.g., genes for linguistic ability in children tend to be in a better linguistic environment because parents also have these genes Active: students genetically inclined towards languages choose linguistics courses Evocative: children genetically good at languages evoke from others (parents, teachers) more language learning opportunities Genotype Environment Interaction (G E ): The effects of G depend on E: MAOAlow child abuse, breastfeed IQ, PKU, language Basic Danconcepts Dediu I 13

31 Non-independence of genes and environment P=G+E ignores two possible relationships G E: Genotype-Environment Correlation ( G E): Passive: e.g., genes for linguistic ability in children tend to be in a better linguistic environment because parents also have these genes Active: students genetically inclined towards languages choose linguistics courses Evocative: children genetically good at languages evoke from others (parents, teachers) more language learning opportunities Genotype Environment Interaction (G E ): The effects of G depend on E: MAOAlow child abuse, breastfeed IQ, PKU, language 2 P 2 G 2 E P =G E G E = 2 G E Basic Danconcepts Dediu I 2 G E 13

32 Heritability = proportion of phenotypic variation due to genotypic variation 2 H = = 2 2 σ 2G 2 σp 2 P =G E P = G E H2 (broad sense heritability) h2 (narrow sense heritability) G=A D I G = A D I Heritability h 2= 2 σa σ 2P 13

33 Heritability = proportion of phenotypic variation due to genotypic variation 2 H = = σ 2G 2 σp 0 (genetic variation has no effect) 1 (all phenotypic variation is genetic) Heritability 13

34 Heritability Caveats in interpretation: Uniform traits Essential (fixed) genes Constant vs variable environment Specific to population & environment Changes with age high heritability innateness/ genetic determinism Heritability 13

35 Heritability Estimation: Twin studies Heritability vs. h2 =2(r M Z r D Z ) 13

36 Heritability Estimation: Twin studies Heritability vs. h2 =2(r M Z r D Z ) 13

37 Heritability Estimation: Twin studies Heritability vs. h2 =2(r M Z r D Z ) 13

38 Heritability Estimation: Twin studies Heritability vs. h2 =2(r M Z r D Z )= =2( )=2 0.30= =

39 Heritability Estimation: Twin studies Adoption studies Heritability h2 =2(r M Z r D Z ) vs. vs. and 13

40 Heritability Estimation: Twin studies Adoption studies h2 =2(r M Z r D Z ) vs. vs. and Non-related samples (genome-wide complex trait analysis; GCTA) Heritability 14

41 Heritability Moderate high heritabilities for: - almost all aspects of speech and language - normal and pathological Examples: - dyslexia ( ), SLI (0.5), stuttering (0.7) - (I)SLA (0.7), conversational language (0.7), formal language (0.5), vocabulary size (0.7), phonology & articulation (0.7) Heritability 14

42 Heritability Moderate high heritabilities for: - almost all aspects of speech and language - normal and pathological Examples: - dyslexia ( ), SLI (0.5), stuttering (0.7) - (I)SLA (0.7), conversational language (0.7), formal language (0.5), vocabulary size (0.7), phonology & articulation (0.7) Genetic correlations: Specialist genes Language Generalist genes Maths Heritability 14

43 Mendel's Second Law and Gametic Disequilibrium Mendel's 2nd Law/Law of Inheritance/Law of Independent Assortment different genes assort independently into gametes / AA BB / Aa bb... A B A B A B A B A b A B a b a B 1/4 1/4 1/4 1/4 1/4 1/4 1/4 1/4 Diploid parental genotype Possible haploid gametes Probability of gamete Gametic disequilibrium: not all gametes are equally frequent Epistatic selection: combinations of alleles (HLA) Population admixture: pooling them not ok Linkage disequilibrium Basic Danconcepts Dediu II 14

44 Linkage disequilibrium Genome: discrete linear molecules (chromosomes + mtdna) From father From mother Basic Danconcepts Dediu II 14

45 Linkage disequilibrium Genome: discrete linear molecules (chromosomes + mtdna) Basic Danconcepts Dediu II 14

46 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes): Peas plant Basic Danconcepts Dediu II 14

47 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes) non-independent loci linkage + crossing over recombinants Basic Danconcepts Dediu II 14

48 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes) non-independent loci linkage + crossing over Basic Danconcepts Dediu II recombination probability ~ physical distance 1 centimorgan (cm) = 1% recombinants/generation non-uniform, hot and cold spots 14

49 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes) non-independent loci linkage + crossing over LD map: Gene structure SNPs (landmarks) Basic Danconcepts Dediu II 14

50 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes) non-independent loci linkage + crossing over LD map: Measuring LD: Deviation of observed associations of alleles across loci from random Haplotype = combination of alleles at different loci that tend to be co-transmitted Loci A (A, a) and B (B, b) observed haplotype freqs. pab, pab, pab & pab r 2 and D': 0 = independence 1 = complete linkage Basic Danconcepts Dediu II 15

51 Linkage disequilibrium Genome: discrete linear molecules independent loci (genes) non-independent loci linkage + crossing over Basic Danconcepts Dediu II LD map: 15

52 Linkage studies Large pedigrees segregating the phenotype The KE family Linkage studies 15

53 Linkage studies Large set (genome-wide) of landmarks Linkage studies 15

54 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

55 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

56 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

57 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

58 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

59 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 15

60 Linkage studies Large set (genome-wide) of landmarks Alleles..... Loci Linkage studies 16

61 Linkage studies Large set (genome-wide) of landmarks Alleles... SPCH1.. D7S513 Linkage studies D7S530 D7S χ2(1)=0.015, p=0.90 Loci D7S527 χ2(1)=16.2, p<10-5 χ2(1)=16.2, p<10-5 χ2(1)=0.88, p=

62 Linkage studies Large set (genome-wide) of landmarks In practice: LOD score (Logarithm of Odds) > 3 LOD plot for reading, Bates et al., 2007 Linkage studies 16

63 Linkage studies Large set (genome-wide) of landmarks In practice: LOD score (Logarithm of Odds) > 3 Specialized software (MERLIN, GENEHUNTER) Relatively low resolution complementary techniques here, a case (CS) unrelated to KE Linkage studies with same phenotype chromosomal abnormality affecting the SPCH1 interval on chromosome 7 more precisely FOXP2 16

64 Linkage studies Pros: Good for rare mutations of large effect & penetrance Relatively cheap (few markers genotyped) Not very good for multiple genes with small effect Needs large pedigrees recruitment Relatively low resolution Cons: Linkage studies 16

65 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Association studies 16

66 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Association with BMI in 249,796 individuals Association with height in 13,665 individuals Association studies 16

67 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi SNPi+1 SNPi+2 SNPi+3 LD Association studies 16

68 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi C SNPi+1 SNPi+2 SNPi+3 LD Association studies 16

69 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi C SNPi+1 C SNPi+2 SNPi+3 LD Association studies 16

70 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi C SNPi+1 C SNPi+2C SNPi+3 LD Association studies 17

71 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi C SNP C i+1 C SNPi+2C SNPi+3 LD Association studies 17

72 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association Position on DNA SNPi C SNP C i+1 C SNP C i+2c SNPi+3 LD Association studies 17

73 Association studies Large unrelated samples variation in the phenotype of interest Correlation between each marker and differences in phenotype Causal locus (hidden, unobserved) markers (observed): Strength of association ? Position on DNA SNPi C SNP C i+1 C SNP C i+2c SNPi+3 LD Association studies 17

74 Association studies Pros: Good for common mutations of small effect Relatively good resolution No special requirements for sampling Many markers needed expensive Multiple testing correction (p < ) Cons: Association studies 17

75 Association studies Pros: Good for common mutations of small effect Relatively good resolution No special requirements for sampling Many markers needed expensive Multiple testing correction (p < ) Huge sample sizes (1,000+) tiny effect sizes Cons: Association studies 17

76 Association studies Pros: Good for common mutations of small effect Relatively good resolution No special requirements for sampling Many markers needed expensive Multiple testing correction (p < ) Huge sample sizes (1,000+) tiny effect sizes Population stratification Cons: Association studies 17

77 Association studies Pros: Good for common mutations of small effect Relatively good resolution No special requirements for sampling Many markers needed expensive Multiple testing correction (p < ) Huge sample sizes (1,000+) tiny effect sizes Population stratification Cons: Association studies 17

78 Association studies GWAS: genome-wide, huge number of SNPs Candidate gene/snp: limited tests, a priori hypothesis Whole gene/pathway analysis Association studies 17

79 Transmission Disequilibrium Test (TDT) Simultaneously test for association & linkage Trios: affected child + two parents overtransmitted Pros: Relatively simple family structure easy recruiting Not affected by population structure Requires both association and linkage Does not use all information from families Cons: Transmission Disequilibrium Test 17

80 Exome & genome sequencing Sequencing full message instead of (dense) landmarks Landmarks (SNPs)?T? C? A? G? (SNP) genotyping sequencing ACTCAGGATTACGATAACTTAGCGCAAAATCGGCATGT Sequencing 18

81 Exome & genome sequencing Sequencing full message instead of (dense) landmarks Whole genome Exome sequencing ACTCAGGATTACGATAACTTAGCGCAAAATCGGCATGT Sequencing 18

82 The need for Replication Even with multiple testing correction false positives Replication 18

83 The need for Replication Even with multiple testing correction false positives The winner's curse too big effect sizes in underpowered initial discovery studies larger samples for replication Replication 18

84 The need for Replication Even with multiple testing correction false positives The winner's curse too big effect sizes in underpowered initial discovery studies larger samples for replication Many initial discoveries are not replicated, or replicated with different direction/causative allele, or replication is not perfect ( phenotype, sample...) Replication is key for scientific validity Replication 18

85 Conclusions Just at the beginning Extremely fast methodological advances Varied methodology, multiple complementary approaches More work: (endo-)phenotyping (language scholars!) large samples (association) pedigrees (linkage) Thanks to: Sarah Graham, Sonja Vernes, Simon Fisher Funding: Netherlands Organisation for Scientific Research ( Conclusions ) Vidi grant

86 Suggested reading General books: Jones, Steve (2000). The language of the genes. London: Flamingo. Ridley, M. (2004). Nature via nurture: genes, experience and what makes us human. London: Harper Perennial. Introductions to genetics: Snustad, D. P., & Simmons, M. J. (2010). Principles of genetics. John Wiley & Sons, Inc. Krebs, J. E., Kilpatrick, S. T., & Goldstein, E. S. (2013). Lewin s Genes XI. Jones and Bartlett Publishers, Inc. Suggested readings 18

87 Suggested reading Heritability: Visscher, P. M., Hill, W. G., & Wray, N. R. (2008). Heritability in the genomics eraconcepts and misconceptions. Nat Rev Genet 9: doi: /nrg2322 Charney, E. (2012). Behavior genetics and postgenomics. Behavioral and Brain Sciences 35: doi: /s x Stromswold, K. (2001). The Heritability of Language: A Review and Metaanalysis of Twin, Adoption, and Linkage Studies. Language 77: Linkage: Dawn Teare, M., & Barrett, J. H. (2005). Genetic linkage studies. The Lancet 366: doi: /s (05) Association: Hirschhorn, J. N., & Daly, M. J. (2005). Genome-wide association studies for common diseases and complex traits. Nature Reviews Genetics 6: doi: /nrg1521 Balding, D. J. (2006). A tutorial on statistical methods for population association studies. Nature Reviews Genetics 7: doi: /nrg1916 Sequencing: Deriziotis, P., & Fisher, S. E. (2013). Neurogenomics of speech and language disorders: the road ahead. Genome biology 14:204. doi: /gb O Roak, B. J., Deriziotis, P., Lee, C., Vives, L., Schwartz, J. J., Girirajan, S., Eichler, E. E. (2011). Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations. Nature genetics 43: doi: /ng.835 Replication: Ioannidis, J. P. A. (2005). Why most published research findings are false. PLoS Med 2:e124. doi: /journal.pmed Chanock, S. J., Manolio, T., Boehnke, M., Boerwinkle, E., Hunter, D. J., Thomas, G., Collins, F. S. (2007). Replicating genotypephenotype associations. Nature 447: doi: /447655a Suggested readings 18