increment in the genome to calculate the statistic of read count. Three billions according to the reference

Transcription

1 SUPPLEMENTAL METHODS Genome-wide Window Determination As described in our previous study 1, we use adjustable sliding windows with increment in the genome to calculate the statistic of read count. Three billions 5 reads 50 bp in length were simulated by MAQ according to the reference sequence (hg19) and re-mapped to the reference genome by SOAP with a parameter allowing only two mismatches (-v ). Only uniquely mapped reads were used for further analysis. The window sizes were adjusted to have the same expected read count (i.e., 50,000 reads for sliding windows with 5,000 read increments (50 Kb-5 Kb) and 5,000 reads for non-overlapping windows). GC-correction and Population-based Normalization Two-step corrections are described in our previous study 1. Briefly, either for sliding windows with increment or non-overlapping windows, 1) GC-correction: GC percentage of each mapped read was calculated as the GC percentage of DNA template of that mapped read (i.e., median insert-size: 00bp for non size-selected library), and GC percentage of each window was defined as the median value of all the mapped reads in that particular window (Supp. Fig. S). Afterwards, all the windows were grouped by their GC content value, i.e., separated by 0.001%, and for any particular group or GC content, the median coverage was set as its coverage value. The GC-correction value of each group was set as the ratio of its coverage and the experimental sample s coverage (median value genome-wide) and it was used to correct the original coverage of each window with this particular GC content. ) Population-based normalization: the average coverage value of each window, which had undergone self GC-correction in each sample from the control group, was set as the baseline of this population. Therefore, the coverage of each window in the 1

2 experimental sample would be normalized by this baseline Genome-wide Standard Derivation Evaluation We used the YH lymphocyte cell line for estimation of the effect from systematic errors (i.e., sequencing) and to optimize the methodology for CNV calling. First, we sequenced the YH cell line with two independent size-selected libraries (~500 bp insert-size) 1 and obtained ~70 million raw read pairs (paired-end, PE) for each library. Assuming that FASTQ 1 represents the data from single-end sequencing (SE), we used each FASTQ file 1 as single-end reads for further analysis. In addition, random selection of reads/ read pairs from an original data (FASTQ file) can present the randomness of selection of DNA template for amplification during sequencing 5. For the data of these YH libraries, new data either in PE or SE with different read depth were generated by randomly selected reads/ read pairs. Genome-Wide Standard Deviation (GWSD, Supp. Fig. S1a) of the windows copy-ratios (excluding the windows located in the chromosomes identified to have numerical disorder) was calculated for the data after GC-correction and population-based normalization described above. Smaller GWSD is observed with single-end data in each read depth and the GWSD of 15 million single-end reads is nearly equal to the GWSD of 60 million paired-end reads (~0.07). After considering the mapped results, the reason that paired-end data has larger GWSD is from only selecting read pairs mapped within expected insert sizes and expected orientation. In this case, single-end data with our approach seem to be more appropriate for CNV analysis. Random Selection of Reads The paired-end *.FASTQ files of each sample were used as input data. For each read, a digit was randomly generated ranging from 1 to Ø (the number of raw reads). Any

3 particular read would be taken out as new data if its digit was no larger than q (the expected number of reads) 5. Putative CNVs in Genome-wide Screens Since the Genome-Wide Standard Deviation (GWSD) of YH with ~15 million single-end reads is about 0.07 for sliding windows with adjusted 50 Kb size and 5 Kb increments, we genome-wide screen the putative duplication (coverage ratio is 1.10 for continuing 10 sliding windows) or deletions (coverage ratio is 0.9 for continuing 10 sliding windows) for the next step analysis of CNV identification. Increment Ratio of Coverage The equation of Increment-rate of Coverage (IRC i ) is shown below: 11 IRC i = Δ increment Copy ratio +1= i+9 C n n=i 10 i n=i 9 10 i n=i 9 C n 10 C n i+9 i i+9 C n n=i i i C n C n n=i 9 n=i 9 C n C n n=i +1= n=i 9 +1= (1) C is the coverage of a particular window i. In general, for any particular window, its IRC (IRC i ) is calculated as the coverage difference divided by its coverage. The coverage of flanking windows (i.e., nine windows) was taken into account in order to reduce the sequencing bias (i.e., GC content). It should be noted that each value of the increment ratio would be plus 1 because sometimes the increment ratio would be negative. Circular Peak-Trough Screen of Increment Ratio for Precise Boundary of Copy-number Changed Region Identification Comparing with the sliding window, the GWSD of the same sample with a non-overlapping window would be much larger 0.07 for YH with sliding window

4 (50 Kb-5 Kb) and 0. for YH with non-overlapping window (5 Kb), respectively, when the number of raw reads were only 15 million. In some cases, if there is a small duplication, which may be due to sequencing bias/noise, happening within a deletion (vice versa, Supp. Fig. S), we would only identify a portion of this copy number gain if we only consider the smallest-largest IRC of the non-overlapping windows (Supp. Fig. S). Therefore, we take the second or third smallest/ largest IRC into account by simultaneously considering the average copy ratio (i.e., <0.9 for a loss and >1.1 for a gain) of the putative region identified. This Circular Peak-Trough Screen of Increment Ratio approach was demonstrated to be more precise in detection of CNV boundaries, by comparing the CMA results in the validation group. CNV Simulation and Detection with YH Lymphocyte Cell Line In order to evaluate the detection power of our approach, we randomly simulated 60 CNVs (at least two in each chromosome, Supp. Table S1) of a size no larger than 1 Mb. Afterwards, we combined the two YH libraries as one dataset (only used FASTQ 1 as single-end data) and generated new data by increasing or decreasing the number of mapped reads in terms of the start-stop locations of each simulated CNV. In an effort to reduce bias, i.e., true CNVs harbored by YH, we simulated 0 sets of YH, each of which has ~60 million reads, as a control baseline. After comparing the results generated with different sequencing strategies, the False Positive Rate (FPR) and False Negative Rate (FNR) trend to 0% when the read depth increases to 15 million reads (Supp. Fig. S1b). Furthermore, the average Absolute Distance (AD) from the putative breakpoint to simulated breakpoint is only about 5 Kb (an adjustable non-overlapping window size) for either sequencing strategy in our results (Supp. Table S).

5 Mosaic aneuploidy and CNV detection A constitutional numerical disorder is diagnosed by a z-score 6, and the mosaic level of a mosaic aneuploidy or CNV is denoted by the following equation: R observed = P R + (1 P ) R normal normal normal case = P normal + (1 P normal )R CNV () R normal P normal indicates the proportion of cells with copies of the DNA fragments, while P case refers to the proportion of cells with that CNV. Suppose the majority of the subjects from the normal population have two copies of a certain DNA fragment (homologous chromosomes). In this method, we used the average coverage of the 100 samples from normal population (1000 Genomes Project) as the control base line. In theory, for the coverage of an experimental case dividing by the control base line (similar to array-cgh method), the copy number/ ratio of a constitutional CNV, named R CNV, would be considered based on the following assumptions: 1) biallelic deletion (both of the copies of that DNA fragment are lost) is equal to 0; ) one copy lost (1 copied remains) is equal to 0.5; ) one copy gained ( copies exist) is equal to 1.5; ) two copies gained ( copies identified, triplication) is equal to and 5) more than two copies gained is equal to.5 or larger. The equation () is written as: P mosaic =1 P normal =1 R observed 1 = 1 R observed () 1 R CNV 1 R CNV For instance, in case the observed copy Ratio (R observed ) is 0.75, indicating that the proportion of cells with that CNV (P mosaic ) would be in about 50% level because the expected Ratio (R CNV ) for a deletion is 0.5. As GWSD after step-correction of the YH cell line is 0.07, the detectable percentage of numerical or copy-number change should be larger than 10%. Evaluation of the precision of the boundaries of CNV region identified 5

6 Because there was less DNA left for the methodology validation samples, we performed extremely low-coverage paired-end sequencing for fourteen samples, and screened chimeric paired-end reads spanning the breakpoints to narrow down the breakpoint region into only several base-pairs with our reported method 5 (Supp. Fig. Sa, Supp. Table S). As some CNV events are known to be mediated by transposable elements 7, only 0% of CNVs (1/7) were found with paired-end reads supported in these 1 samples (Supp. Table S). Five were not reported by CMA because of the insufficient coverage of the CMA probe design. In subject 1DNJ0, there is a copy-number gain located in 8p.p.( )x of 55.9 Kb indicated by chimeric read pairs. Using our Increment-ratio of Coverage algorithm, we only reported a copy-number gain at 8p.( )x since the partial 0. Kb proximal duplication was normalized by the baseline (Supp. Fig. Sb). For CMA result, only a duplication is reported at 8p.( )x, because there is an absence of probes in the region proximal to this duplication. Except of this breakpoint detection, the average value of Absolute Distance (AD) of the putative boundary, which is identified by our read-depth method, is estimated to be within 5.7 Kb (an adjusted non-overlapping window size) from the precise breakpoint. For CMA, the average AD is 1.7Kb, which is much larger than our method s AD. 6

7 SUPPLEMENTAL FIGURES Supp. Fig. S1. Genome-Wide Standard Deviation distribution of YH and simulated CNVs detected with different Read-Depths. (a) Genome-wide standard deviation (GWSD) of YH libraries namly YH1 and YH, respectively with either single-end sequencing or paired-end sequencing with different read depths. All data were GC corrected and population-based normalized as progress mentioned in PSCC 1. The dotted lines in gray revealing a saturated interval of GWSD for paired-end data are determined by GWSD of YH with 15 0 million single-end reads. (b) False Positive rate (FP) and False Negative rate (FN) evaluation of simulated CNVs detection with different read depth for single-end data. 7

8 Supp. Fig. S. The Quality Control of the experimental samples after -step correction. Distribution copy-ratio (coverage) of sliding windows with the corresponding GC content, excluding the windows located in the chromosomes of numerical disorders, are shown before (a, c) and after (b, d) -step correction. The distribution of the copy-ratio from a sample passing QC (a) shows that the Genome-wide Standard Derivation of the windows copy-ratios after -step correction is less than 0.15 (b), while the distribution of a sample failing in QC (c) reflects the large (> 0.15) Genome-wide Standard Derivation (d). 10 8

9 Supp. Fig. S. Circular Peak-Trough Screen of Increment Ratio. A distribution is shown of the copy-ratio of a sample with the adjusted non-overlapping window (5 kb) in black and the distribution of increment-ratio of each non-overlapping window. A digit shown under a dotted line in sky blue indicates the increment-ratio of that particular window. The average copy-ratio of the non-overlapping window of the CNV segment inferred by the smallest increment-ratio or the second smallest increment-ratio is shown by green or dark blue line, respectively.. 9 9

10 Supp. Fig. S. Evaluation of the preciseness of region identification. (a) A diagram of precise breakpoint determination by using the paired-end reads spanning the putative breakpoints. Each line in red reveals a paired-end read spanning the breakpoints and the lines in black show the region within which the precise breakpoint would locate. (b) Paired-end reads spanning the breakpoints indicate a gain of ~00 Kb (original distribution of copy-ratio shown in red) at 8p.p. in subject 1DNJ0. However, the size of this CNV reported by our approach is only 61.9 Kb (normalized distribution of copy-ratio shown in blue) since a polymorphic region within this duplication is normalized by the population control

11 Supp. Fig. S5. Distribution of probes in CMA: (a) Distribution of probes in cyto1 SNP array in sample 1ZS1191, (b) and (c) distributions of CNV probes in fetal chip v1 in sample 1S001876, indicating there are probes lacking within these regions for detection of copy-number changes. The sequencing result revealed a gain of 18.7Kb at 7q6. ( )x in sample 1ZS1191. In sample 1S001876, there is a 0.Kb deletion located at q6.1( )x1 and a deletion of 95.Kb located at 7p.( )x1. 11

12 5 Supp. Fig. S6. Validation of CNVs not reported by CMA via MLPA: (a) Copy-number gain at 8p.p.( )x in sample 1ZS1191, (c) Copy-number gain at q( )x in sample 1ZS10508, (b) and (d) demonstrate increased dosage in those regions of these two samples. 6 1

13 5 6 Supp. Fig. S7. Validation of mosaic aneuploidy and pcnv: (a) Mosaic trisomy (~0%) in case 1S10685, (b) Mosaic trisomy 5 (~0%) in case 15S000057, (c) Copy-number loss at q11.1( )x1 in case 1B000710, (d) in case 1B0015, two losses at 8p.1p.( )x1 and 8p.1( )x1, and a gain at 8q.q.( )x

14 5 6 7 Supp. Fig. S8. Size distribution of CNVs classified as VOUS and benign. Histogram shows the size distributions of VOUS (in red) and benign (in green) of copy-number loss (a) and gain (b) in 59 samples. The p value for a two-sample Kolmogorov-Smirnov test for size distributions between the VOUS and benign groups is 0.001, which is smaller than 0.05, indicating a highly significant different between these groups. 1

15 SUPPLEMENTAL TABLES Supp. Table S1. Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- NGS CMA Sample Clinical indication cation* type 1 11DNA01H K001D115 VOUS 1p6.( )x1 - AF Interrupted aortic arch (type B 11DNA015H K00A18 11DNA186H K00 11DNA187H K00 VOUS q.( )x1 - VOUS 6p.1( )x - bcnv 15q11.1q11.( )x - pcnv q11.1( )x1 q11.1( )x1 susp), VSD, Hypertelorism, Exophthalmos, micrognathia, IUGR pcnv q9( )x1 q90( )x1 Blood q9 microdeletion syndrome VOUS Xq( )x - CVS previous child/preg with chr abn: Hypothyroidism, severe mental retardation VOUS q6.1( )x1 - CVS positive Down screening risk: 1/; Paternal: 6, X, t(y;18)(q11.;p11.) VOUS q.1( )x - VOUS 7p1.1( )x - VOUS 15q1.( )x1 - pcnv 18p11.( )x1 18p11.( )x1 pcnv Yq11.1q1( )x Yq11.1q11.( )x 5 IMS1S0001 VOUS 5p1.( )x 5p1.( )x AF positive Down screening risk: 1/87; 6 IMS1S000 pcnv Xp.p.( )x1 Xp.p.( ) x1 *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively adv mat age AF US: IUGR; previous family abnormal pregnancy 15

16 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID 7 11DNA188H K DNA190H K DNA191H K007 Classifi- Sample NGS CMA cation* type Clinical indication bcnv p11( )x - CVS adv mat age; positive Down bcnv 10q6.( )x - screening risk: 1/; small NB, pcnv 11q.q5( )x 11q.q5( micrognathia, DV reverse, SUA, )x cerebellar hypoplasia, left VOUS 1q.q.( )x1 - diaphragmatic relaxation, not pcnv q11.1q11.1( )x q11.1q11.1( typical but 18T is susp 5)x pcnv q.q5.( )x1 q.q5.( )x1 lpcnv 7p1.p.( )x 7p1.p.( )x pcnv q.q1.( )x1 q.q1.( )x1 pcnv 10q1.q1.( )x1 10q1.q1.( )x1 CVS positive Down screening risk: 1/; US: small NB, micrognathia, lowset ear, cleft lip/palate, SUA, cord cysts (placental side), cord knot, wide posterior fossa Placenta adv mat age; Skeletal dysplasia, short extremities, Fibula broken, Humerus curved, Rib deformity, Flat face 10 IMS1S0008 pcnv 5p1.1p15.( )x1 5p1.1p15.( )x1 AF US: CHD; adv mat age; karyotyping abnormal: 6,XX,5p- 11 IMS1S0005 bcnv 16q.( )x1 16q.( )x1 Blood MR, cerebral palsy, epilepsia, facial anomalies, small and short penis 1 IMS1S0007 VOUS p5.( )x p5.( )x Blood Facial anomalies, fifth finger bcnv 16p11.1( )x 16p11.( )x *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively bending, hypospadia, small and short penis 16

17 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID 1 11DNA19H K008 Classifi- Sample NGS CMA cation* type Clinical indication VOUS 9q.( )x 9q.( )x CVS previous child/ pregnancy with chr VOUS 16q.1( )x1 - abn: 17p- (death month); positive pcnv 17p1.p1.( )x1 17p1.p1.( )x1 Down screening risk:1:5; US:General edema, small NB, stomach not visible, exomphalos containing bowel only, Tachycardia, dangling CPI 1 11DNA19H VOUS 8p.p.( )x - Placenta US: IUFD(1w5d) K009 bcnv 10q6.( )x DNJ005 lbcnv p5.( )x1 p5.( )x1 Blood maternal karyotyping abnormal bcnv p11.( )x - VOUS 8q.( )x1 8q.( )x1 pcnv 11q.q5( ) x 16 1DNJ006 pcnv q.1q9( )x 11q.q5( )x VOUS 5q1.1( )x1 5q1.1( )x1 VOUS 18p11.1( )x1 - q.1q9( )x AF Familial Chr. Defect: Mat 6, XX, t(;1)(q1;p1), previous two pregnancies with cyst of cord and stillbirth, respectively; karyotyping abnormal: 6,XX,-1,+der(1)t(;1)(q1;p1 )mat 17 1DNJ007 bcnv Xp.1( )x Xp.1( )x AF holoprosencephaly, facial deformity (cyclopia,beak nose) *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 17

18 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 18 1DNJ008 VOUS 15q11.( )x 15q11.1q11.( )x AF IUGR (intrauterine growth retardation), Fetal cerebral ventriculomegaly 19 1DNJ01 bcnv 9p( )x1 9p( )x1 AF US: severe IUGR, CHD, facial lbcnv 16q11.( )x - anomalies (Low-set ears, a small VOUS 0q1.q1.( ) x 0q1.q1.( )x jaw) 0 1DNJ01 bcnv q9( )x1 q9( )x1 AF positive Down screening risk: 1/55 bcnv 7p1.1( )x1 7p1.1( )x1 pcnv 9p1.1p.( )x 9p1.1p.( )x lbcnv 1q11.( )x1 1q11.( )x1 VOUS 15q11.( )x - 1 1DNJ016 pcnv 8p1.p.( )x 8p1.p.( )x AF positive Down screening risk: VOUS 9p( )x1-1/117; adv mat age; karyotyping VOUS 15q6.( )x1 15q6.( )x abnormal: 6,XY,15p+ 1DNJ017 bcnv 5p1.1( )x - AF adv mat age VOUS 16q.( )x 16q.( )x pcnv 18p11.1p11.( )x 18p11.1p11.( )x 1DNJ05 pcnv 15q11.q1.1( )x 15q11.q1.1( )x1 Blood MR, dwarf, corpulent, enorchia 1 VOUS Yp11.( )x - *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 18

19 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 1DNJ00 pcnv 15q11.1q1.1( )x1 15q11.1q1( )x1 AF IUGR 5 1DNJ0 bcnv 8p.( )x 8p.( )x AF US: CHD (Hypoplastic right heart, pcnv 0p1.1p1.( )x1 0p1.1p1.( )x 1 PAS) 6 1DNJ07 pcnv p15.1p16.( )x1 p15.1p16.( )x1 AF positive Down screening risk: lbcnv 17q1.1( )x - 1/0; IUGR bcnv Xq1.1( )x - 7 1DNJ08 pcnv q1.1q.1( )x1 q1.1q.1( )x 1 Blood intellectual disability, developmental language disorder VOUS 1q1.( )x - 8 1DNJ00 bcnv q1( )x q1( )x AF US: CHD(VSD), diaphragmatocele pcnv 1p1.1p1.( )x 1p1.1p1.( )x pcnv 1q11q1.1( )x 1q11q1.1( )x bcnv 18q1.1( )x - 9 1DNJ01 bcnv 1p1.( )x - Blood DD, hypotonia, facial anomalies pcnv 5q.q.1( )x 1 5q.q.1( ) x1 bcnv 7q11.( )x1 7q11.( )x1 lbcnv 8p1( )x - 0 1DNJ0 pcnv 15q11.1q1.1( )x 15q11.1q1.1( )x Blood intellectual disability, developmental language disorder bcnv 1p11.( )x - *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 19

20 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 1 1DNJ05 VOUS 1p6.1( )x 1p6.1( )x AF US: CHD (Ventricular Septal VOUS 10q6.( )x 10q6.( )x Defect) pcnv 1q( )x 1q( )x pcnv 18p11.1p11.( )x 18p11.1p11.( )x1 1 1DNJ05 VOUS 11p15.5( )x - AF US: Fetal jugular Lymphatic pcnv 18p11.1p11.( )x 18p11.1p11.( )x1 hydrocele 1 pcnv 18q1.q( )x 18q1.q( )x1 1 1DNJ056 pcnv 5p15.( )x1 5p15.( )x1 AF US: CHD pcnv 8p.1p.( )x 8p.1p.( )x pcnv 8p1p.1( )x 8p1p.1( )x 1DNJ057 bcnv 8q1.( )x1 8q1.( )x1 AF Familial Defect: previous pregnancy VOUS 18p11.p11.1( )x 18p11.( )x with multiple anomalies 5 1DNJ06 pcnv 11q.1q5( ) 11q.1q5( )x1 AF US: CHD x1 pcnv 15q6.( )x 15q6.( )x VOUS 17p11.( )x - VOUS 0p1.1( )x1-6 IMS1S0009 bcnv 10q1.1( )x1 10q1.1( )x1 Blood MR, blepharoptosis; karyotyping lbcnv 15q6.( )x 15q6.( )x abnormal: 6,XY,15p+ pcnv q11.1( )x1 q11.1( )x1 7 1ZS605 VOUS 9p1.( )x1 - AF Ventricular has strong echo. *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 0

21 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 8 1DNJ06 pcnv p16.( )x1 p16.( )x1 AF US: Fetal third ventricle posterior lpcnv 7p.1p.( )x 7p.1p.( )x cystic lesions, CHD (myocardial bcnv 18q1.( )x 18q1.( )x hypertrophy, a small amount of fluid collection in the pericardial cavity,vsd), Bilateral renal agenesis, strephenopodia, hypamnion 9 1DNJ067 pcnv* 18p11.q.1( )x 18p11.q.1( )x AF US: IUGR, CHD (VSD), SUA, pcnv 1q11.q1.( )x1 1q11.q1.( )x 1 Bilateral choroid plexus cysts. 0 1DNJ068 pcnv VOUS q7.1q7.( )x 1 q6.1( )x q7.1q7.( ) x1 - Blood Developmental retardation, intellectual disability, slight facial anomalies VOUS 5q.( )x 5q.( )x 1 1DNJ069 VOUS 7q1.1( )x1 7q1.1( )x1 AF positive Down screening risk pcnv 9p1.1p.( )x 9p1.1p.( )x VOUS 9q1.11q1.1( )x 9q1.11q1.1( ) x 1ZS008 bcnv q8.( )x1 q8.( )x1 AF US: obstruction of duodenum 1DNJ075 pcnv 1q5.1q1.( )x 1q5.1q1.( ) Blood maternal karyotyping abnormal 1 x1 VOUS 9p.( )x 9p.( )x1 lbcnv 9p.( )x - bcnv 15q11.( )x - *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 1

22 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 1ZS01 lbcnv p11.( )x1 p11.( )x1 AF polyhydramnios VOUS 7q11.1( )x 7q11.1( )x VOUS 8q.1( )x 8q.1( )x VOUS 8q.1( )x - bcnv 10q6.( )x 10q6.( )x VOUS 11q.1( )x1 - VOUS 1q1.( )x1-5 1ZS0519 bcnv Yq11.q11.( )x Yq11.( )x AF adv mat age 6 1ZS07100 bcnv 5q5.( )x 5q5.( )x AF positive Down screening risk: bcnv 19p1.( )x - 1/70 7 1ZS0710 lbcnv 16p1.1( )x 16p1.1( )x AF Fetal brain cavity effusion 8 IMS1S0010 pcnv 6q7( )x1 6q7( )x1 AF US: fetal cerebral VOUS 10q6.( )x 10q6.( )x ventriculomegaly; previous pregnancy with hydrocephalus 9 IMS1S pcnv 15q.q6.( )x 15q.q6.( ) x AF positive Down screening risk; karyotyping abnormal: 50 A pcnv 1q.q.( )x1 1q.q.( ) x1 VOUS 15q11.( )x - 51 A10018 pcnv q6.q7.( )x q6.q7.( ) x *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively Placenta 6,XY,15p+ Holoprosencephaly, Migration disorder? TOP, Autopsy CVS De novo fetal 6, XY, q+

23 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 5 1ZS081 VOUS q.( )x1 - AF positive Down screening risk: 1/0 bcnv 5q5.( )x 5q5.( )x VOUS 10p1.1( )x 10p1.1( )x lbcnv 15q1.( )x 15q1.( )x bcnv 1p11.( )x - bcnv - 1p1.1( )x1 5 1ZS10508 VOUS q( )x - Blood Previous pregnancy with stillbirth VOUS 11p11.1( )x - indicated as 10q11. 1.Mx 5 1ZS1066 bcnv 10q.( )x 10q.( )x AF positive Down screening risk: 1/00 bcnv 10q6.( )x 10q6.( )x bcnv 1p1.1( )x - bcnv 16p1.( )x1 16p1.( )x1 55 1ZS1191 bcnv 7q6.1( )x - Blood DiGeorge syndrome, CHD, father VOUS 7q6.( )x - with translocation in q bcnv 8p.p.( )x ZS155 bcnv 7q6.1( )x - AF positive Down screening risk: 1/150 VOUS 10q6.( )x 10q6.( )x 57 1ZS6080 lbcnv 8p1.( )x 8p1.( )x Blood Autism bcnv 11q1.( )x - bcnv 18p11.1( )x 18p11.1( )x *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively

24 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 58 1ZS6106 VOUS 11p11.1( )x 11p11.1( )x AF Inversion of chromosome 9 bcnv 11q11( )x - (hyperbilirubinemia, impetigo found bcnv 11q.( )x1 11q.( )x1 at birth) 59 1ZS6500 lbcnv 7q1.11( )x 7q1.11( )x AF positive Down screening risk: 1/180 VOUS 7q11.( )x1 - lbcnv q11.1( )x q11.1( )x 60 1P10108 VOUS p.1( )x p.1( )x Blood Previous livebirths, both of them VOUS p.1( )x1 p.1( )x1 deceased after fever bcnv 15q1.( )x1 - VOUS 15q1.( )x 15q1.( )x 61 1P10100 lbcnv 18q1.q1.1( )x 18q1.q1.1( )x Blood CHD; positive Down screening risk:1/60 VOUS Xq7.( )x1 Xq7.( )x1 bcnv - q1( )x bcnv - p1.( )x 6 1P10101 bcnv 1p1.( )x 1p1.( )x AF NT.7; positive Down screening VOUS 5q1.( )x1 5q1.( )x1 risk: 1/0 VOUS 6p.1( )x 6p.1( )x VOUS q11.( )x q11.( )x lbcnv q11.( )x - bcnv Xq6.( )x - *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively

25 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 6 1P1010 VOUS 7q11.1( )x1 - AF positive Down screening risk: 1/10 VOUS 9p1.( )x1 9p1.( )x1 bcnv - 7q11.1q11.1( )x 6 1P1010 bcnv q1( )x1 q1( )x1 AF NT.9MM bilateral fetal choroid VOUS q5.( )x - plexus cysts. 65 1P10105 bcnv 1q.( )x 1q.( )x AF positive Down screening risk: 1/75 pcnv 17p1( )x 17p1( )x VOUS - 6p1.( )x1 66 A bcnv 1q1.1( )x - CVS positive Down screening risk: 1/9; bcnv q1.1( )x - Familial Chr. Defect: pcnv 5p1.p15.( )x1 5p1.p15.( )x1 6,XX,t(5.18)(p1.1;q1.)mat; TR, lpcnv 18q1.q( )x 18q1.q( )x VSD, Prev. child; Partial trisomy 5 67 IMS1S0010 VOUS 0p1.1( )x1 - VOUS 1p.1( )x1 1p.1( )x1 AF Familial Chr. Defect: Mat balanced translocation, previous livebirth with autism bcnv 1q1.( )x 1q1.( )x pcnv 1q1q( )x 1q1q( )x VOUS q11.( )x q11.( )x bcnv q1.( )x1 q1.( )x1 68 1ZS Blood epilepsy, encephalodysplasia, inversion found in chromosome 9 *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 5

26 Supp. Table S1 (continued). Comparison of CNVs detected by our approach and CMA in validation group of 71 samples No. Sample ID Classifi- Sample NGS CMA cation* type Clinical indication 69 HK1C010 lbcnv p16.( )x p16.( )x AF US: fetal anomalies, bilateral bcnv 5p15.( )x1~ 5p15.( )x1~ cerebral ventriculomegaly bcnv 7q11.1( )x 7q11.1( )x bcnv 9p( )x1 - pcnv 1p11.1p1.( )x~ 1p11.1p1.( )x~ bcnv Xq11.1( )x - 70 HK1C067 lbcnv 7p1.( )x - CVS US: increased NT 5.9mm, reverse bcnv 15q11.( )x1~ 15q11.( )1~ DV, absent nasal bone VOUS 16p1.( )x 16p1.( )x VOUS 17p1.(1-1669)x1 17p1.( )x1 VOUS 17p1.( )x 17p1.( )x lpcnv 17p1.( )x~ 17p1.( )x~ lbcnv 17q1.1( )x - 71 HK1C0669 pcnv lbcnv 1q5.q( )x ~ q.1q.( ) 1q5.q( )x~ - CVS US: multiple anomalies,.7mm right neck cyst, likely pre-axial polydactyl of left hand, abnormal pcnv x q.q5.( ) x1~ q.q5.( )x 1~ right thumb possibly polydactyl, small left cardiac ventricle only one flow can be seen, single umbilical VOUS 17q5.( )x 17q5.( )x artery *lpcnv and lbcnv refer to likely pathogenic CNV and likely benign CNV, respectively 6

27 5 Supp. Table S Simulated CNV identified by our approach Simulated CNVs Our approach # Chr. Start End Length Length Copy-ratio (kb) (kb) Copy-ratio AD* *AD (Kb) refers to the average value of absolute distance between the putative breakpoint and the simulated breakpoint for each CNV #These results are detected with 15 million reads for single-end sequencing 7

28 5 Supp. Table S (continued) Simulated CNV identified by our approach Simulated CNVs our approach # Chr. Start End Length Length Copy-ratio (kb) (kb) Copy-ratio AD* X Y Y *AD (Kb) refers to the average value of absolute distance between the putative breakpoint and the simulated breakpoint for each CNV #These results are detection with 15 million reads for single-end sequencing 8

29 5 6 Supp. Table S. Evaluation of regions isolation by our approach with chimeric read pairs supported by paired- end sequencing. Start of CNV End of CNV Sample ID Chr. Precise NGS Array Precise NGS Array breakpoint# Location AD* Location^ AD* breakpoint# Location AD* Location^ AD* 1DNJ016 9$ NA NA NA NA 1DNJ DNJ01 8$ NA NA NA NA 1DNJ DNJ DNJ068 $ NA NA NA NA 1DNJ DNJ DNJ DNJ DNJ00 18$ NA NA NA NA 1DNJ06 0$ NA NA NA NA 1DNJ IMS1S * AD (Kb) refers to the absolute distance between the putative breakpoint and the predicted breakpoint for the start or end of each CNV # These results were given by our previous method (Dong et al., 01), the reported breakpoint is located within the region of ~500bp (an average insert size) to the real breakpoint. $ These results are not reported by CMA ^ The inner boundaries of each CNV provided by CMA were used for comparison 9

30 Supp. Table S MLPA primers for validation. Length Sample ID Band Left/ Right Primer Oligo region 1 1ZS10508 q CTGCAGAGCTAGGCAAGCCTCAGTTCAGACTT GGCTGCTCAGGAACAGTGTGACCTTGGCAAA 1 1ZS1191 7q6. AAGAAGTTTCCAGATGCTGCTGCTGCTGCTGC TCAGAGGACCACACTGGCAACCACTGCTCTA 115 1ZS1191 8p. CAAAATCAGCAGCAGCAGCATGAGCTTCAGATG CACG GGACTGTTGAAAGGAATCGCCGAAGCCCTCGTA TT 0

31 Supp. Table S5. Numerical disorders detected in the clinical group of 59 samples passing QC. Sample ID Aneuploidy Group Sample ID Aneuploidy Group 1S Abortus 1S Abortus 1S , X Abortus 1S Abortus 1S Abortus 1S1111 5, X Abortus 1S Abortus 1S1167 5, X Abortus 1S Abortus 1S1167 MOSAIC +15 Abortus 1S MOSAIC +7 Abortus 15S Abortus 1S , X Abortus 15S Abortus 1S00171* +16 Abortus 15S Abortus 1S Abortus 15S ,+10 Abortus 1S Abortus 15S Abortus 1S001870* 7, XXY Abortus 15S MOSAIC +5 Abortus 1S Abortus 15S , X Abortus 1S Abortus 15S MOSAIC + Abortus 1S ,+15 Abortus 15S Abortus 1S , X Abortus 15S , XXY Abortus 1S Abortus 15S , X Abortus 1S Abortus 15S Abortus 1S00651 MOSAIC +16 Abortus 15S Abortus 1S Abortus 15S Abortus 1S0065 5, X Abortus 15S Abortus 1S Abortus 15S , X Abortus 1S00697 MOSAIC + Abortus 15S , XXY Abortus 1S Abortus 15S Abortus 1S Abortus 15S Abortus 1S Abortus 15S Abortus 1S Abortus 15S , X Abortus 1S Abortus 15S Abortus 1S Abortus 15S Abortus 1S Abortus 15S , X, +1 Abortus 1S , X Abortus 15S ,+16 Abortus 1S Abortus 15S Abortus 1S Abortus 15S Abortus 1S Abortus 15S Abortus 1S , X Abortus 15S6107 MOSAIC +16 Abortus 1S10000* MOSAIC + Abortus 15S Abortus 1S1057* +1 Abortus 15S61 5, X Abortus *Confirmed by CMA 1

32 Supp. Table S5. (continued) Numerical disorders detected in the clinical group of 59 samples passing QC. Sample ID Aneuploidy Group Sample ID Aneuploidy Group 1S1057 6, X, +16 Abortus 15S6060 7, XXY Abortus 1S10685 MOSAIC + Abortus 15S Abortus 1S10689 MOSAIC +11 Abortus 15S Abortus 1S Abortus 15S6011 7, XXX Abortus 1S ,+9 Abortus 15S Abortus 1S Abortus 15S601 + Abortus 1S , X Abortus 15S Abortus 1S Abortus 15S Abortus 1B Postnatal 1S , XXY Prenatal 1B Postnatal 1S , X Prenatal 1B Postnatal 1S Prenatal 15B Postnatal 1S Prenatal 15B Postnatal 1S Prenatal 15B Postnatal 1S Prenatal 1B Postnatal 1S Prenatal 1S , X Prenatal 1S Prenatal 1S Prenatal 15B61116 MOSAIC -1 Prenatal 1S001876* +18 Prenatal 15S Prenatal 1S , X Prenatal 15S Prenatal 1S , X Prenatal 15S Prenatal 1S , X Prenatal 1S , XXX Stillbirth 1S Prenatal 1S0001 5, X Stillbirth 1S Prenatal 1S Stillbirth 1S Prenatal *Confirmed by CMA

33 Supp. Table S6. Pathogenic CNVs detected in early abortus No. Sample ID Classification pcnv 1 1S Pathogenic# 11p11.p15.5( )x1 Pathogenic# 11q1.1q5( )x 1S0061 Pathogenic 8pp.( )x1 1S00651 Pathogenic 5q1.( )x1 1S08918 Pathogenic* 1q.1q.( )x Pathogenic* 1q.q( )x 5 1S10571 Pathogenic 1q1.1q1.( )x1 6 15S00018 Pathogenic 1qq( )x1 7 15S00008 Pathogenic 1p6.( )x1 8 15S00009 Likely pathogenic q11.1( )x 9 15S0007 Pathogenic q1.q5.( )x1 Pathogenic 6q.1q7( )x 10 15S Pathogenic 15q5.q6.( )x S Pathogenic q.q5.( )x1 1 15S600 Pathogenic 5q1.( )x1 *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh)

34 Supp. Table S7. Pathogenic CNVs detected in stillbirth ID Sample ID Classification pcnv Clinical indication 1 15S6587 Pathogenic 9p.p.( )x1 embryo damage; Pathogenic 9q.q.( )x abnormal organs 1S Pathogenic q11.1( )x1 oligohydramnios; two miscarriages

35 Supp. Table S8. Pathogenic CNVs detected in prenatal group No. Sample ID Classification pcnv Clinical indication 1 1S0517 Pathogenic 7q11.( )x1 cleft lip and palate found in w+ 1B Pathogenic p16.1p16.( Multi-anomalies 06)x Likely pathogenic p15.1p16.1( )x 1S Pathogenic 17p11.( )x1 no equal size of kidneys; previous male live birth with unclosed arterial duct and pregnancy hypertension 1S0067 Pathogenic p16.p.( )x1 fetal holoprosencephaly 5 1S006 Pathogenic# Xp11.( gastroschisis, cleft lip, 790)x1 syndactylia, ectodactyle; the first fetus was diagnosed with gastroschisis and inevitable abortion for the second fetus 6 1S00671 Likely 15q1.q1.( Ultrasound abnormality Pathogenic 18619)x1 7 1S00657 Pathogenic 0p1( )x Cystic hygroma; induced abortion 8 1S00675 Pathogenic 1q1.( skull deformity; 5)x1 abnormality found in lung and kidney 9 1S0069 Likely 7q6.( meningocele pathogenic 95)x1 10 1S07505 Pathogenic Xp1.1( pulmonary artery blood 7)x1 testing with single peak value *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) ^Confirmed by conventional karyotyping 5

36 Supp. Table S8 (continued). Pathogenic CNVs detected in prenatal group No. Sample ID Classification pcnv Clinical indication 11 1S Pathogenic 16p11.p1.1( Multiple abnormality; 90817)x1 dysontogenesis found in fetal both kidneys; paracele effusion in both sides; previous prenancy with miscarriage 1 1S Pathogenic* q.q5.( multiple abnormality; )x deroncus Pathogenic* 7q.q6.( )x1 1 1S Pathogenic 5p1.1p15.( seroperitoneum; large 561)x1 cardio-thoracic proportion 1 1S Pathogenic^ 8p.1p.( cyst in choroid plexus in 89)x1 both sides; strong flare Likely 8p11.1p.1(115- found in left ventricle; pathogenic^ 76015)x karyotyping from AF: 6, XN, add(8)(p.1) 15 1S1110 Pathogenic 15q11.q1.(5967- fetal edema 0975)x Pathogenic Yq11.q11.( )x 16 1S11676 Pathogenic^ Xp.1p.( external vagina )x1 abnormality; maternal karyotyping abnormality: 6, X, del(x)(p) 17 15S00000 Pathogenic q.( )x1 no nasal bone; translocation of kidney; cyst found in right ureter and right kidney 18 15S Pathogenic^ 15q11.1q11.( Ultrasound abnormality R 6016)x 19 15S65866 likely Pathogenic 8q.( )x1 fetal exencephalia *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) ^Confirmed by conventional karyotyping 6

37 Supp. Table S9. Pathogenic CNVs detected in postnatal samples No. Sample ID Classification pcnv Clinical indication 1 1B009 Pathogenic 1q.1q.( hypertelorism 00576)x1 1B05 Pathogenic$ q.1q.( atelencephalia; previous )x1 history of early spontaneous abortion 1U0551 Pathogenic# 5p1.p15.( Cri du Chat Syndrome 167)x1 Likely pathogenic# 1p1.1p1.( )x 1B Pathogenic q6.1( )x1 crinosity; small palpebral fissure 5 1B00076 Pathogenic 15q6.q6.( )x1 dwarfish?? 6 1B Pathogenic# q11.1( Low set ear;torticollisk 9)x1 intellectual disability; poor memory 7 1B Pathogenic 9p1p.( Likely p ter deletion 9)x syndrome Pathogenic 9p11.p1( )x 8 1B00109 Pathogenic 5q1.1( )x1 developmental retardation 9 1B Pathogenic 10q6.1q6.(115 hypertelorism; dull )x1 expression; undescended testicle; orticollis in left side; small size of frontal lobe in both side; motor development delay 10 1B0015 Pathogenic# 8p.1p.( )x1 hypospadias; short upper lip and tongue Pathogenic# 8p.1( )x1 Pathogenic# 8q.q.( )x *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) $De novo, confirmed by parental DNAs 7

38 Supp. Table S9 (continued). Pathogenic CNVs detected in postnatal samples No. Sample ID Classification pcnv Clinical indication 11 1B00189 Pathogenic p1( ) developmental retardation x1 1 1B Pathogenic Xq1.q6.( primary amenorrhea 09)x Pathogenic Xq6.q8( )x1 1 1B00198 Pathogenic q8( recurrent miscarriage 7)x1 1 1B0050 Pathogenic 8p.1p.( )x1 developmental retardation 15 1B00 Pathogenic Xp.1( twisted lip, unsteady 5)x1 walking, irritability 16 1B0005 Pathogenic 15q11.q1.1( )x1 newborn defect 17 1B007 Pathogenic q1.q1.( kayrotyping abnormal: )x 6,XY,der(6)t(6;)(p5;q1 1.)pat; congenital heart disease, abnormal genitals, pre-term, hypertelorism 18 1B0081 Likely Xq1.1q1.( motor and language pathogenic 6666)x1 developmental retardation, short limbs, maternal first pregnancy miscarriage with pregnancy hypertension 19 1B00715 Pathogenic 7q11.( motor and language 58)x1 developmental retardation, microcephalus 0 1B0075 Pathogenic p15.1p16.( )x1 hearing loss, atrial septal defect, eye choroid defect, rachischisis, polycystic kidney, corpus callosum developmental delay from MRI 1 1B00758 Pathogenic p.p.1( congenital dislocation of 99995)x1 thigh bone, intellectual disability, abnormal gum *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) $De novo, confirmed by parental DNAs 8

39 Supp. Table S9 (continued). Pathogenic CNVs detected in postnatal samples No. Sample ID Classification pcnv Clinical indication 1B00788 Pathogenic 9q.( intellectual disability; 709)x torticollis; amputated palm Pathogenic q1.1q1.( )x1 1B00090 Pathogenic 15q11.q1.1(61- obesity and strabismus; 86709)x1 karyotyping abnormal: a deletion in chromosome 15 1B Pathogenic 17p11.( lower lip protrusion, 56)x1 anisodont, intellectual disability 5 1B05965 Pathogenic 9q.( torticollis, amputated palm, 051)x intellectual disability, Pathogenic q1.1q1.(8870 cannot communicate, )x1 hydronephrosis slightly in both side, sister sample 1B B Pathogenic 17p1.( )x1 macrogyria and epilepsy 7 1B Pathogenic 6q1( frontal bossing, thoracia 0)x1 dysplasia, myasthenia, positive cortex thumb 8 1B Pathogenic q.1( frontal bossing, 07)x1 hypertelorism, hypospadias 9 1B Pathogenic 10q6.1q6.( Polydactyly, intellectual )x1 disability Pathogenic 19q1.q1.( )x 0 1B Pathogenic 7q.q6.1( karyotyping abnormality: )x1 deletion in 7q 1 1B07189 Pathogenic$ p1.1p1.( intellectual disability, 96988)x1 bending elbow joint in right side *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) $De novo, confirmed by parental DNAs 9

40 Supp. Table S9 (continued). Pathogenic CNVs detected in postnatal samples No. Sample ID Classification pcnv Clinical indication 1B07188 Likely q1.1q1.( developmental retardation; pathogenic 687)x1 karyotyping: ring Pathogenic q.( )x1 chromosome Pathogenic q.q5.( )x1 1B07181 Pathogenic 16p11.( )x1 intellectual disability 1B07187 Pathogenic 11p11.1p1( intellectual disability, 7650)x previous boy with Likely pathogenic 15q1( )x1 intellectual disability 5 1B07188 Pathogenic 6q.1( intellectual disability; 98)x1 encephalatrophy diagnosed by MRI 6 1B Pathogenic 11q.q5( karyotyping abnormal: 89605)x1 inv(9) 7 1B Pathogenic 17p11.( developmental retardation 9)x1 8 1B1000 Pathogenic q7.1q7.( )x1 low bridge of nose, patent foramen ovale, myasthenia 9 1B1167 Pathogenic 6p.( )x1 ASD (atrial septal defect), external genital tract defect, limbs defect 0 15B Pathogenic q1.q( )x hypertelorism 1 15B Pathogenic 7q11.( narrow aortic valve; 58)x1 arteriostenosis in right side; likely Williams syndrome 15B Pathogenic 6q.1q5.( face abnomality 5981)x Pathogenic 17q1( )x *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) $De novo, confirmed by parental DNAs 0

41 Supp. Table S9 (continued). Pathogenic CNVs detected in postnatal samples No. Sample ID Classification pcnv Clinical indication 15B Pathogenic q1.q( )x face abnormality 15B Pathogenic 7q11.( congenital heart disease, 89)x1 parental consanguineous marriage 5 15B Pathogenic 8p.1p.( intellectual disability, 7)x1 developmental delay, Pathogenic 8p11.p.1( )x hypertelorism 6 15B Pathogenic 1q.q.( )x1 rare cry and scream, small lower jaw 7 15B6108 Likely 7q5( short face, external ear pathogenic )x1 defects 8 15B619 Pathogenic 7q11.( Williams syndrome 89)x1 9 BD Pathogenic 15q11.q1.1(8089- full term but low birth 85000)x1 weight, infectious, cephalhematoma, paralysis found in brachial plexus in the right hand side, born at term also appears even smaller, low and weak cry *Validated by cyto-1 (SNP array) #Validated by fetal chip (acgh) $De novo, confirmed by parental DNAs 1

42 Supp. Table S10. Likely unbalanced translocations detected in four routine case series Event Sample ID Sample Type pcnv 1 15S00018 Early abortus 1qq( )x1 5qq5.( )x 15S0007 Early abortus q1.q5.( )x1 6q.1q7( )x 15S6587 Stillbirth 9p.p.( )x1 9q.q.( )x 1S Prenatal q.q5.( )x 7q.q6.( )x1 5 1B0015 Postnatal 8p.1p.( )x1 8p.1( )x1 8q.q.( )x 6 1B00788 Postnatal 9q.( )x q1.1q1.( )x1 7 1B05965 Postnatal 9q.( )x q1.1q1.( )x1 8 1B Postnatal 10q6.1q6.( )x1 19q1.q1.( )x 9 1U0551 Postnatal 5p1.p15.( )x1 1p1.1p1.( )x

43 SUPPLEMENTAL REFERENCE 1. Li X, Chen S, Xie W, et al. PSCC: sensitive and reliable population-scale copy number variation detection method based on low coverage sequencing. PLoS One. 01;9(1):e Li H, Ruan J, Durbin R. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 008;18(11): Li R, Yu C, Li Y, et al. SOAP: an improved ultrafast tool for short read alignment. Bioinformatics. 009;5(15): Wang J, Wang W, Li R, et al. The diploid genome sequence of an Asian individual. Nature. 008;56(718): Dong Z, Jiang L, Yang C, et al. A robust approach for blind detection of balanced chromosomal rearrangements with whole-genome low-coverage sequencing. Hum Mutat. 01;5(5): Xie W, Tan Y, Li X, et al. Rapid detection of aneuploidies on a benchtop sequencing platform. Prenat Diagn. 01;(): Reilly MT, Faulkner GJ, Dubnau J, Ponomarev I, Gage FH. The role of transposable elements in health and diseases of the central nervous system. J Neurosci. 01;(5):