A study on the relationship between long non-coding RNA H19 and high-grade glioma temozolomide resistance and their related mechanism

Transcription

1 Journal of Hainan Medical University 2017; 23(12): Journal of Hainan Medical University A study on the relationship between long non-coding RNA H19 and high-grade glioma temozolomide resistance and their related mechanism Peng-Xiang Xu, Qiang Li, Qiong-Guan Xu, Cai-Cai Zhang Department of Neurosurgery; the Second Affiliated Hospital of Hainan Medical University ARTICLE INFO Article history: Received 6 Jun 2017 Received in revised form 10 Jun 2017 Accepted 16 Jun 2017 Available online 28 Jun 2017 Keywords: Long non-coding RNAH19 High-grade glioma Temozolomide Chemotherapy resistance ABSTRACT Objective: To investigate the expression level of long chain non coding RNAH19 in advanced gliomas and its relationship with glioma cell temozolomide (TMZ) resistance, and make a preliminary study on their related mechanism. Methods: Tissue samples of normal brain tissue, early onset and recurrence of high grade gliomas were collected, and the expression of LNC H19 was detected by reverse transcription polymerase chain reaction (RT-PCR). The construction of Resistant U251 TMZ Resistant (U251-TR) Cell Lines were completed by intermittent concentration gradient increments and verified by MTT method. The changes in the expression of LncRNA H19 was detected by RT-PCR, lovirus transfection was used to construct U251-TR cell line with stable interference with LNC H19 (U251-TRsiLNC H19), and MTT assay was used to observe the changes of TMZ half-maximal inhibitory concentration (IC50). Western Blot and RT-PCR were used to detect the changes of O6- methylguanine DNA methyltransferase (MGMT) in U251, U251-TR and U251-TRsiLNC H19. Results: The results of RT-PCR showed that the expression of LNC H19 in high-grade glioma was significantly higher than that in primary glioma tissue and normal brain tissue. The IC50 value and drug resistance index of U251-TR cell line were significantly increased, the expression of LncRNA H19 in U251-TR cell line was significantly higher than that in U251 cells and the expression of MGMT were also increased. We succeeded in interfering with the expression of LNC H19 in the U251-TR cell line, and found that the IC50 value and drug resistance index of U251-TR cell line were decreased significantly and the expression of MGMT were also decreased. Conclusion: LNC H19 is highly expressed in recurrent highgrade gliomas, which may increase the level of MGMT, leading to the occurrence of glioma cell TMZ resistance. LNC H19 is a key factor in the occurrence of TMZ resistance in glioma cells. 1. Introduction Brain glioma is the most common malignant tumor in the Department of Neurosurgery, the high degree of malignancy in highgrade glioma glioma accounted for 76%, and its invasion ability was strong and rapid, the 5-year survival rate was as low as 5%. So it often needs to combine surgery, radiotherapy and chemotherapy and other comprehensive treatment in order to harvest a satisfactory short-term effect. Morzolomide (TMZ) is a chemotherapeutic agent Corresponding author: Cai-Cai Zhang, Department of Neurosurgery; the Second Affiliated Hospital of Hainan Medical University @126.com Fund Project: Hainan Provincial Natural Science Foundation, Project No : widely used in the treatment of gliomas, and its safety and efficacy have been confirmed by many clinical studies. However, with the accumulation of tumor cell resistance during chemotherapy, it wills eventually leading to chemotherapy failure and glioma recurrence. At present, the formation mechanism of metallothiazole resistance in glioma cells is not completely clear, long non-coding RNA (LncRNA) is a hot issue in recent years, which can play a biological role in the development and progression of tumor through a variety of epigenetic regulatory mechanisms. LncRNA H19 (hereinafter referred to as LNC H19) as a member of LncRNA, has been found to be closely related to the progress of a variety of malignant tumors. This study was to elucidate the role of LNC H19 in glioma cell TMZ resistance and make a preliminary exploration of the relevant mechanisms.

2 96 2. Materials and methods 2.1 Experimental materials Clinical samples 64 patients enrolled in Department of neurosurgery of our hospital from March 2014 to September 2016 were selected as clinical samples. The brain tissue of 14 patients who were hospitalized for traumatic brain injury was taken as normal control tissue samples, 35 cases of high grade glioma tissue samples and 12 cases of recurrent high grade glioma tissue samples were regarded as experimental samples. Patients with initial onset were treated by surgery, while recurrent patients were underwent surgery combined with TMZ before the second surgical treatment, and the resected tissue samples were preserved in liquid nitrogen Cell source The human glioma U251 cell line used in this experiment was purchased from Gina Bio Co, Item No: BNCC337654, and the human embryonic kidney cell 293T cell line was purchased from American ATCC Corporation, Item No: CRL Experimental apparatus The main laboratory equipment includes: ECO1.8 clean bench (US Thermo Scientific Heraguard), 3110 biochemical incubator (US Thermo Scientific), DM500 optical microscope (Germany Leica), 5424R desktop high-speed centrifuge (Germany Ai Bend ), Nanodrop 2000c ultra-micro spectrophotometer (US Thermo Scientific), porous microplate reader (American Molecular Devices), electrophoresis instrument, transfer film and GelDoc XR gel imager (US Bio-Rad), Real-time PCR instrument (US Applied Biosystems), pipette with the size of 10 μl, 100 μl and 1 ml (Germany Aiben) Experimental reagents and materials Major experimental reagents include: DMEM medium and fetal bovine serum (US Thermo Scientific Hyclone), trypsin (Sigma, USA), transfected Lipofectamine RNAiMAX Reagent (Thermo Scientific, USA), virus packaging plasmid plp1-gag/pol, PLP2- Rev and plp-vsvg (US addgene), cationic polymer polybrene (Sigma, USA), puromycin puromycin (US Thermo Scientific), RNA extraction reagent RNAiso Reagent, RNA reverse transcription kit and SYBR Green nucleic acid fluorescence Dye (Takara, Japan), non-ribozyme water (American Invitrongen), methanol, isopropanol and anhydrous ethanol (National Pharmaceutical Group Chemical Reagent Co., Ltd.), MTT cell proliferation and cytotoxicity test kit (Sigma, USA). Antibodies: O6-methyl guanine-dna methyltransferase antibody (purchased from Abcam, ab39253), mouse secondary antibody (purchased from Abcam, ab6728). TMZ was provided by Jiangsu Tianshi Li Di Yi Pharmaceutical Co., Ltd., batch number: The main experimental materials: 1.5 ml centrifuge tube (axygen company, US), 15 ml centrifuge tube and six-well plate (Wuxi NEST company, China), 10 cm Petri dish and 96-well plate (Corning Corporation, USA), disposable pipette tip with the size of 10 μl, 100 μl and 1 ml (US Axygen), RT-PCR with 96-well plate (axygen company, US), polyvinylidene fluoride (PVDF film) (Merck, Germany). 2.2 Experimental methods Cell culture U251 cells and 293T cells were cultured in DMEM medium + 10% fetal bovine serum. The culture temperature were 37 and incubated at 5% CO biochemical incubator. Passage time, 400 L trypsin digestion for 5 min, 1 ml serum containing medium to terminate digestion, 1:3 passage Using RT-PCR to detect the expression of mrna RNA collection: (1) the collection of tissue RNA: removed the tissue from the liquid nitrogen, and used a grinder to ground the tissue under the condition of low temperature without enzyme. Took about 30 mg, added 1 ml RNAiso Reagent reagent into it, then placed it on ice for 5 min after lysis and sucked the supernatant into the 1.5 ml centrifuge tube, finally, followed the instructions for subsequent extraction experiments. (2) Cell RNA collection: Collect logarithmic growth cells in 6-well plates with fusion degree of 90% or more, 400 μl trypsin digestion for 5 min, 1 ml serum containing medium, and cell suspension was added to 1.5 ml centrifuge tube, 500 g Centrifuge for 5 min, discard the supernatant; PBS wash 3 times, discard the supernatant, add 1 ml RNAiso Reagent reagent, and ice cracking for 5 min, finally, followed the instructions for subsequent extraction experiments. 50 μl of non-ribozyme was dissolved in water, and the RNA concentration was detected by Nanodrop2000 ultramicro spectrophotometer after the extraction. Take 1 g of reverse transcription and strictly operate in accordance with the reverse transcription kit instructions. After obtaining 20 μl PCR cdna products, and then diluted the nuclease water to 500 μl. 10 μl of SYBR Green nucleic acid fluorescent dye, 5 μl (10 ng) cdna and 5 μl of primer were added to RT-PCR 96-well plates. Three parallel wells were set up and the total volume was 20 μl. Quantitative analysis was performed by Applied Biosystems 9700 PCR apparatus. Reaction conditions: pre-denaturation 94 for 4 min; amplification conditions: 94 for 30 s, 60 for 1 min, total 40 cycles. GAPDH gene primer: The upstream primer sequence is TGTGGGCATCAATGGATTTGG,the downstream primer sequence is ACACCATGTATTCCGGGTCAAT, the amplification size was 116bp; LNC H19 primer: upstream primer sequence is GGCAAGAAGCGGGTCTGT, the downstream primer sequence is GCTGCTGTTCCGATGGTGT, the amplification size was 273 bp; MGMT primer: upstream primer sequence is GCACGAAATAAAGCTCCTGG, the downstream primer sequence is CAGTCCTCCGGAGTAGTTGC, the amplification size was 403 bp.

3 97 virus suspension was collected after 48 h and the suspension was The establishment of U251-TR cell lines The construction of Resistant U251 TMZ Resistant (U251-TR) Cell Lines were completed by intermittent concentration gradient increments. Gradient induction concentrations were obtained according to the method shown in Ref.[5]: 1, 2, 4 and 8 μg/ml. U251 cells were screened from the lowest concentration of 1 μg/ ml, and the TMZ-containing medium was replaced every 2-3 d. After the cells were grown for more than 1 week, the next screening concentration was used until the cells were stable at 8 μg/ml. Cell culture conditions: 37 C, 5% CO2, DMEM + 10% FBS MTT detection of drug resistance index The cells were seeded in logarithmic growth phase at / well inoculated into 96-well plates, incubated at 37 for 5 h. The cells in the logarithmic growth phase were inoculated with / holes to 96 plates, incubated at the condition of 37 and 5% CO2 for 12 h. The supernatant was discarded and mixed with different concentrations of TMZ and DMEM + 10% FBS. The total volume was 300 μl/well and the concentration of TMZ was set at 0.5, 1, 2, 4, 8, 16 and 32 μg/ml. Treated at the corresponding concentration for 48 h, the original culture solution was discarded. The MTT solution was mixed with the medium at a ratio of 1:9, and then added to the wells, incubated for 1 h in the dark, and the absorbance at 570 nm was measured by a microplate reader. The cell survival curves were plotted to calculate the half maximal inhibitory concentration (IC50) and the drug resistance index (The ratio of IC50 value and U251IC50 value of parental cells). filtered using a 0.22 μm filter. Virus infection: U251-TR cells were inoculated into 6-well plates, and the cell fusion was about 40% and added into 2 ml of DMEM medium + 10% fetal bovine serum and 1 ml of virus suspension. At the same time, 3 μl ofolybrene was added, and the cell fusion degree was close to 100% after 2 d of infection. The construction of U251-TRsiLNC H19 was completed after the cells were in good condition screened by puromycin Western Blot Detection of MGMT protein expression in cell lines The cells were harvested for logarithmic growth phase. After digestion, the cells were digested in 1 ml of medium and transferred to 1.5 ml centrifuge tube toentrifuge for 5 min, discarded the supernatant, washed for 3 times by PBS, and then discarded the supernatant. 200 μl of IP lysate was mixed with 10 μl 20 protease inhibitor and then centrifuged in the centrifuge tube for 15 min, ice cracking for 90 min, extracted the protein finally. After the protein was quantitatively analyzed by BCA method, the system with the same total protein content was added into the loading, degenerated at 100 for 5 min. With the concentration of 10% acrylamide glue, until the glue solidified sample, 80 V pressure gluing for 30 min, 120 V pressure running glue for 1 h; wet to PVDF membrane, 5% skim milk powder closed for 2 h, the primary antibody was incubated overnight at 4 and he secondary antibody was incubated at 37 for 1 h, and fluorescent liquid exposured development, the primary antibody concentration ratio of anti- 1: 1 000, the secondary antibody concentration ratio of 1: 2000, β-actin as the internal reference The establishment of U251-TR silnc H19 cell line The construction of lentivirus interference vector, the upstream sequence of complementary target sequence sirna was GCGGGUCUGUUUCUUUACUUU, the downstream sequence was AGUAAAGAAACAGACCCGCUU, The upstream sequence of the control sequence sicontrol is GCGUUCUGGUCUUUUUUUUUUUU, and the downstream sequence is AGAGAAUAAACCCGCAGACUU. The specific construction procedure is described in Ref.[6]. Virus packaging: 293T in the logarithmic growth phase was inoculated into 6-well plates, /well. After 24 h, the supernatant was discarded and PBS was used to wash 3 times carefully, and then added to 1 ml serumfree DMEM medium. PLP1-gag/pol (0.75 μg/well), PLP2-gag/pol (0.3 μg/well) and plp3-vsvg (0.45 μg/well) and the target plasmid (1.5 μg/well) were mixed with 10 μl of Lipofectamine RNA imax and diluted with 500 μl of serum-free DMEM medium for 30 min. After careful withdrawal into the corresponding wells, the DMEM medium + 10% fetal bovine serum was replaced after 6 h. The Statistical methods The statistical analysis of this experiment using SPSS 17.0 software. The data were expressed as mean ± standard deviation (x ± s), t test was used to compare the statistical differences between the two groups of measurement data; the variance was used to analyze the statistical differences between the multiple groups of metrological data. The SNK method was used for comparisons between multiple groups of data, and P<0.05 represented a statistically significant difference. 3. Results 3.1 The expression of LNC H19 in clinical samples The RT-PCR results showed that the expression of LNC H19 in normal brain tissue (0.1169±0.0195, N=14) was significantly lower than that in early stage (0.1892±0.0135, N=35) and recurrence of

4 98 high grade glioma (0.2610±0.0205, N=12). The expression of LNC and H19 in primary high-grade gliomas was significantly lower than that in recurrent high-grade gliomas (F=11.41, P<0.001): Comparison of the results: Normal brain tissue compared with the high-grade gliomas, q = 4.207, P<0.01; normal brain tissue and recurrent high-grade gliomas, q=6.744, P<0.01; early highgrade brain glial Tumor and recurrent high-grade gliomas, q=3.953, P<0.01), see Figure The changes of the expression levels of LNC H19 and MGMT inu251-tr cell line The results of RT-PCR showed that the expression of LNC H19 in U251-TR cell line was (0.080 ± 0.011), which was significantly higher than that of U251 cell (0.027 ± 0.007), the difference was statistically significant (P<0.01). The expression level of MGMT mrna in U251-TR cell line was (0.574 ± 0.109), which was significantly higher than that of U251 cells (0.313 ± 0.073), the difference was statistically significant (P<0.01). Western Blot showed that the expression level of MGMT protein in U251-TR cell line was also increased, which was consistent with the change of mrna level, see Figure 3B. mrna expression A B Normal brain tissue Primary high-grade gliomas Recurrent high-grade gliomas Figure 1. The difference of the LNC H19expression in different clinical samples. ** P< The changes of drug resistance index of U251-TR cell line The MTT results showed that the IC50 value of U251 cell line was (2.762 ± 0.213) μg/ml, which was significantly lower than that of U251-TR cell line ( ± 1.297) μg/ml, the difference was statistically significant (P<0.001); the resistance index of U251-TR cell was 3.69, see Figure 2. Figure 3.The changes of the expression levels of LNC H19 and MGMT inu251-tr cell line. Cell resistance index mrna expression 3.4 The changes of the expression levels of LNC H19 and MGMT inu251-trsilnc H19 cell line The results of RT-PCR showed that the expression of LNC H19 in U251-TRsiLNC H19 cell line was (0.031 ± 0.008), which was significantly lower than that of U251-TR cells (0.105 ± 0.013), the differences were statistically significant (P<0.01), indicating that the interference cell line was constructed successfully. There was no significant difference between the expression of U251 ( ± 0.009) and the expression of LNC H19 in U251-TRsiLNC H19 cell line (P>0.05). At the same time, the expression of MGMT mrna in U251-TR cell line also decreased significantly from (0.674 ± 0.077) to (0.357 ± 0.036), the difference was statistically significant (P<0.01), see Figure 4A. Western Blot showed that the expression level of MGMT protein in U251-TRsiLNC H19 cell line also decreased, which was consistent with the change of mrna level, see Figure 4B. mrna expression Figure 2.The comparison of IC50 value between U251-TR cell line and U251 cell line. A B Figure 4. The changes of the expression levels of LNC H19 and MGMT inu251-trsilnc H19 cell line.

5 The changes of resistance index in U251-TRsiLNC H19 cell line The results of MTT showed that the IC50 value of U251-TRsiLNC H19 cell line was (6.143 ± 0.562) μg/ml, which was significantly lower than that of U251-TR cell line IC50 value of ( ± 1.461) μg/ml, the difference was statistically significant (P<0.001), the resistance index decreased to 2.24, see Figure 5. Cell resistance index Figure 5. The comparison of IC50 value between U251-TRsiLNC H19 cell line and U251-TR cell line. 4. Discussion Generally, LNC H19 is localized on the 7F5 chromosome and is highly expressed in the embryo,and gradually decreased after birth. However, many studies have shown that LNC H19 is increasing a variety of malignancies and plays an important role in promoting cancer. Li H et al. found a high expression of LNC H19 in gastric cancer tissues, which can promote the proliferation, migration and invasion of gastric cancer cells by down regulation of calcium binding proteins (CaBP8) founded by vitro studies. Matouk et al found that LNC H19 could inhibit the expression of E-cadherin in breast cancer cells and up-regulate the expression of SLUG,then promote the expression of Epithelial-mesenchymal transition (EMT). Liang WC et al. Found that LNC H19 not only can promote the proliferation and invasion of colorectal cancer cells and the expression of vimentin and zinc finger and homologous domain transcription factors (ZEB1 and ZEB2), but also can promote the occurrence of cell EMT process, while the occurrence of EMT process and the emergence of cell chemotherapy drug resistance is closely related, so the relationship between LNC H19 and cell resistance gradually attracted people's attention. Liang WC also found that LNC H19 can modulate the expression of glutathione to make the cells resistant to cisplatin in high-grade ovarian cancer. While studied on the non-small cell lung cancer, Wang Q et al. pointed out that LNC H19 can promote cell proliferation and invasion ability, inhibit cell apoptosis and lead to cell cisplatin resistance. Si X et al. found that the increase of LNC H19 could inhibit the apoptosis of breast cancer cells and thus mediate cell resistance to paclitaxel. All of these studies suggest that LNC H19 can mediate the resistance of different malignancies to chemotherapy drugs in a variety of ways. Based on the above studies, this study was to investigate the expression characteristics of LNC H19 in clinical samples of human gliomas,and found that it is not only highly expressed in human glioma tissue, but in the the recurrence of gliomas caused by TMZ treatment failure, suggesting that LNC H19 may be closely related to the formation of TMZ chemotherapy resistance. We examined the expression level of LNC H19 in the TMZ resistant U251 cell line constructed in vitro and found that the expression level of LNC H19 was significantly higher than that of parental U251 cells. After interfering with the expression of LNC H19 in U251-TR cells, the IC50 value and drug resistance index decreased significantly, which confirmed that LNC H19 played an important role in promoting the formation of TMZ resistance in human glioma cells. It should be noted that the expression levels of LNC H19 in U251-TR silnc H19 cell lines were not significantly different from those of parental cells LNC and H19, but the resistance index was still as high as 2.24, presumably due to the formation of brain glioma TMZ resistance is regulated by many factors, LNC H19 is only one of the most important factors.therefore, the sensitivity of cell apoptosis in U251- TR cells is still at a relatively high level after the expression of LNC H19 in U251-TR cells was interfered. MGMT can repaire the DNA alkylation damage caused by TMZ and other chemotherapy drugs, which is an important cause of TMZ chemotherapy resistance in glioma cells. In this study, it was found that LNC H19 and MGMT were significantly increased in U251-TR cells, indicating that the expression of LNC H19 and MGMT may have certain correlation; after interfering with the expression of LNC H19 in U251-TR cells, MGMT decreased, which further verified that the two expressions are closely related. It was also suggested that LNC H19 could exert the biological effect of TMZ resistance by regulating the expression level of MGMT. In summary, LNC H19 plays an important role in the formation of TMS resistance in glioma cells and may play a role by regulating the expression of MGMT. In the following study, we will further confirm the interaction between LNC H19 and MGMT by chromatin immunoprecipitation (GC), and explore other possible interaction factors, such as EMT-related molecules. And to determine its effect on the proliferation and invasion of glioma cells by vivo and vitro experiments. Long-term follow-up was performed on patients with clinical glioma, and the correlation between the expression of LNC H19 and the prognosis of patients was observed to provide an experimental basis for revealing the exact biological effects of LNC H19 in human gliomas, and also provide a valuable basis for the clinical diagnosis, targeted therapy and prognosis of LNC H19 in gliomas.

6 100 References [1] Dolecek TA, Propp JM, Stroup NE. CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in Neuro-Oncology 2013; 15(2): [2] Cai Run, A study on chemoresistance of glioma cells in vitro. Southern Med Univ [3] Feng Shiyu, Zhu Weijie, Yu Xinguang. Research progress of the mechanism of lncrna in the development of glioma. Shandong Med J 2014; (18): [4] Qiu MT, Hu JW, Yin R. Long noncoding RNA: an emerging paradigm of cancer research. Tumor Biol 2013; 34(2): [5] Chen Xiao, Xu Hanjun, Guo Wei. The Biological characteristics of multidrug-resistant glioma cell line U251/TMZ. Chin J Neuromed 2014; 6(2): [6] Chen Lin, Chen Yan, Xiao Dong. The Construction and function of a lentiviral vector harboring c-myc gene under the control of Eμ-VH promoter. Shandong Med 2016; 56(21): 1-3. [7] Raveh E, Matouk IJ, Gilon M. The H19 Long non-coding RNA in cancer initiation, progression and metastasis a proposed unifying theory. Mol Cancer 2015; 14(1):184. [8] Li H, Yu B, Li J. Overexpression of lncrna H19 enhances carcinogenesis and metastasis of gastric cancer. Oncotarget 2014; 5(8): [9] Matouk IJ, Halle D, Raveh E. The role of the oncofetal H19 lncrna in tumor metastasis: orchestrating the EMT-MET decision. Oncotarget 2016; 7(4): [10] Matouk I J, Raveh E, Abulail R. Oncofetal H19 RNA promotes tumor metastasis. Biochimica Et Biophysica Acta 2014; 1843(7): [11] Liang WC, Fu WM, Wong CW. The lncrna H19 promotes epithelial to mesenchymal transition by functioning as mirna sponges in colorectal cancer. Oncotarget 2011; 6(26): [12] Du B, Shim JS. Targeting epithelial-mesenchymal transition (emt) to overcome drug resistance in cancer. Molecules 2016; 21(7): [13] Zhao Z, Zhang L, Yao Q. mir-15b regulates cisplatin resistance and metastasis by targeting PEBP4 in human lung adenocarcinoma cells. Cancer Gene Ther 2015; 22(3): [14] Li J, Wang Y, Song Y. mir-27a regulates cisplatin resistance and metastasis by targeting RKIP in human lung adenocarcinoma cells. Molecular Cancer 2014, 13(1):193. [15] Zheng ZG, Xu H, Suo SS. The essential role of h19 contributing to cisplatin resistance by regulating glutathione metabolism in high-grade serous ovarian cancer. Sci Rep 2016; 6: [16] Wang Q, Cheng N, Li X. Correlation of long non-coding RNA H19 expression with cisplatin-resistance and clinical outcome in lung adenocarcinoma. Oncotarget 2016; 8(2): [17] Si X, Zang R, Zhang E. LncRNA H19 confers chemoresistance in ERαpositive breast cancer through epigenetic silencing of the pro-apoptotic gene BIK. Oncotarget 2016; 7(49): [18] Song T, Li H, Tian Z. Disruption of NF-κB signaling by fluoxetine attenuates MGMT expression in glioma cells. Oncotargets Ther 2015; 8(5): [19] Wang Junxiang, Zhou Youxin, Wang Zhong, The expression and significance of MGMT, TopoⅡα and P-gp in grade Ⅲ-Ⅳ glioma. Shandong Med J 2011; 51(2): [20] Clark PA, Gaal JT, Strebe JK. The effects of tumor treating fields and temozolomide in MGMT expressing and non-expressing patient-derived glioblastoma cells. J Clin Neuroscience 2016; 36(1):