Angiogenesis and Anti-Angiogenesis in Hematological Malignancies

Size: px
Start display at page:

Download "Angiogenesis and Anti-Angiogenesis in Hematological Malignancies"

Transcription

1

2 Angiogenesis and Anti-Angiogenesis in Hematological Malignancies

3 Domenico Ribatti Angiogenesis and Anti-Angiogenesis in Hematological Malignancies 1 3

4 Domenico Ribatti Department of Basic Medical Sciences Neurosciences and Sensory Organs University of Bari Medical School Bari Italy ISBN ISBN (ebook) DOI / Springer Dordrecht Heidelberg New York London Library of Congress Control Number: Springer Science+Business Media Dordrecht 2014 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher s location, in its current version, and permission for use must always be obtained from Springer. Permissions for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution under the respective Copyright Law. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. While the advice and information in this book are believed to be true and accurate at the date of publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper Springer is part of Springer Science+Business Media (

5 Acknowledgments This work was supported by European Union Seventh Framework Programme (FPT7/ ) under grant agreement n to DR. v

6 Contents 1 Introduction Angiogenesis Tumor Angiogenesis Angiogenesis in Multiple Myeloma General Features of Multiple Myeloma Angiogenesis in Multiple Myeloma Angiogenic Cytokines and Multiple Myeloma Progression Signaling Pathways Invasive Ability of Plasma Cells Multiple Myeloma Endothelial Cells The Role of Macrophages and Mast Cells The Role of Endothelial Precursor Cells and of Hematopoietic Stem and Progenitor Cells Prognostic Value of Angiogenesis in Multiple Myeloma Angiogenesis in Lymphomas General Features of Lymphomas In Vitro and Vivo Experimental Models Angiogenesis in Normal Lymph Nodes and in Benign Lymphadenopathies Angiogenesis in Non-Hodgkin Lymphomas The Role of Myelo-Monocytic Cells and Circulating Endothelial Cells The Role of Macrophages and Mast Cells Genetically Modified Lymphoma Endothelial Cells Angiogenesis in Leukemia General Features of Leukemias Angiogenesis in Acute Lymphocytic Leukemia Angiogenesis in Chronic Lymphocytic Leukemia vii

7 viii Contents 4.4 Angiogenesis in Acute and Chronic Myeloid Leukemia and Myelodysplastic Syndrome Role of Matrix Metalloproteinases and Mast Cells Anti-angiogenesis Introduction Endostatin Thalidomide Thalidomide in the Treatment of Multiple Myeloma and Waldenstrom s Macroglobulinemia Thalidomide in the Treatment of Leukemia, Lymphoma and Myelodysplastic Syndrome Side Effects Thalidomide Analogues Combination Therapy VEGF Neutralizing Antibodies Receptor Tyrosine Kinase Inhibitors Receptor Tyrosine Kinase Inhibitors in the Treatment of Multiple Myleoma Receptor Tyrosine kinase Inhibitors in the Treatment of Leukemia Bortezomib Zoledronic Acid Interleukins Chemotherapeutics Histone Deacetylase Inhibitors and Vascular Disrupting Agents Concluding Remarks References Index

8 List of Abbreviations ALL AML Ang AQP4 ATL ATP CAM CBC CECs CLL CML DLBCL DVT ECM ECOG EGFR EMEA EPC ERKs ETS FACS FDA FGF-2 FKHR FL G-CSF GF GFAP GIST GM-CSF HDAC HGF/SF acute lymphoblastic leukemia acute myeloid leukemia angiopoietin aquaporin-4 adult T cell leukemia adenosine triphosphate chorioallantoic membrane complete blood count circulating endothelial cells chronic lymphocytic leukemia chronic myeloid leukemia diffuse large B-cell lymphomas deep vein thrombosis extracellular matrix Eastern Cooperative Oncology Group Epidermal growth factor receptor European Agency for the Evaluation of Medicinal Products endothelial precursor cell extracellular-signal regulated kinases expressed sequence tags fluorescent activating cell sorter Food and Drug Administration fibroblast growth factor-2 forkhead transcription factor follicular lymphoma granulocyte-colony stimulating factor growth fraction glial fibrillary acid protein gastrointestinal stromal tumor granulocyte macrophage-colony stimulating factor histone deacetylase Hepatocyte growth factor/scatter factor ix

9 x List of Abbreviations HIF hypoxia-inducible factor HL Hodgkin lymphomas HOX homeobox HUVEC human umbilical vein endothelial cell ICAM-1 Intercellular Adhesion Molecule 1 IFN interferon IGF-1 insulin-like growth factor-1 IGH immunoglobulin heavy chain IgVhH immunoglobulin variable gene segments IKK I kappa B kinase IL interleukin IMIDs immunmodulatory drugs I-TAC interferon inducible T-cell alpha chemoattractant JAK Janus kinase LFA-1 lymphocyte function associated antigen-1 LI labeling index MALT mucosa associated lymphoid tissue MAPK mitogen-activated protein kinase MCL mantle cell lymphoma MCP-1 monocyte chemotactic protein-1 MDS myelodysplastic syndrome MEK mitogen-induced extracellular kinase MGUS monoclonal gammopathy of undetermined significance MiRNA micro RNA MM multiple myeloma MMP matrix metalloproteinase MVD microvascular density NF-kB nuclear factor kappa B NGF nerve growth factor NHL non Hodgkin lymphomas NOS nitric oxide synthase NSCLC non-small-cell lung cancer PCNSL primary central nervous system lymphoma PDGF platelet derived growth factor PDGFR platelet-derived growth factor receptor PECAM platelet endothelial cell adhesion molecule PI3K phosphatidylinositol-3 kinase PKC protein kinase C PTCL peripheral T cell lymphoma RTK receptor tyrosine kinase RT-PCR reverse transcriptase- polymerase chain reaction SCF stem cell factor SCID severe combined immunodeficiency SDF-1α stromal cell derived factor 1 alpha SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electrophoresis

10 List of Abbreviations xi SelCiDs SLL STAT TGF-β TIMP TNF-α upa VCAM-1 VDAs VE VEGF VEGFR VLA-4 WHO selected cytokine inhibitory drugs small lymphocytic leukemia signal transducers and activator of transcription transforming growth factor-β tissue inhibitor of matrix metalloproteinase tumor necrosis factor alpha urokinase plasminogen activator vascular cell adhesion molecule-1 vascular disrupting agents vascular endothelial vascular endothelial growth factor vascular endothelial growth factor receptor very late antigen-4 World Health Organization

11 Chapter 1 Introduction 1.1 Angiogenesis Angiogenesis (new vessel formation) occurs during embryo development and in postnatal life, cyclically in the female genital system and in wound repair. In these situations, it is limited in time and the result of an equilibrium between the activator and the inhibitor systems that together keep the microcirculation in a quiescent state, with very low proliferation and turnover of the endothelial cells. The quiescent endothelium rests on a specialized form of the extracellular matrix (ECM)-the basement membrane-whose main constituents are laminin and type IV collagen (Ingber and Folkman 1989). Irrespective of the nature of the inducing stimulus, angiogenesis develops through five steps: (a) Basement membrane degradation by the proteolytic enzymes (metalloproteinases, collagenases, heparinase and plasminogen activators secreted by the endothelial cells, resulting in the formation of tiny sprouts which penetrate into the perivascular connective tissue; (b) Migration toward the stimulus of endothelial cells at the sprout tip; (c) Proliferation of the endothelial cells below the sprout; (d) Canalization, branching and formation of vascular loops, then of a functioning circulatory network; (e) Perivascular apposition of pericytes, and neosynthesis of basement membrane constituents by both the endothelial cells and the pericytes. Endothelial cell proliferation and migration coincide with limited laminin deposition, whereas cell differentiation and lumen formation coincide with further laminin deposition and type IV collagen deposition. New microvessels grow by at least three mechanisms: (a) New sprouts bud from preexisting vessels; (b) Circulating endothelial progenitor cells participate in new vessel formation; (c) Endothelial cells in preexisting vessels bridge the lumen to form new vessels by intussusception. This latter postulated that the capillary network increases its complexity and vascular surface by insertion of a multitude of transcapillary pillars, a process called intussusception (Djonov et al. 2000). All three mechanisms depend upon loosening of preexisting endothelial cells from their junctions with each other which are maintained by proteins such as vascular endothelial (VE)-cadherin and platelet-endothelial cell adhesion molecule D. Ribatti, Angiogenesis and Anti-Angiogenesis in Hematological Malignancies, DOI / _1, Springer Science+Business Media Dordrecht

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY. Gerhard Bauer Joseph S. Anderson. Gene Therapy for HIV From Inception to a Possible Cure

SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY. Gerhard Bauer Joseph S. Anderson. Gene Therapy for HIV From Inception to a Possible Cure SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY Gerhard Bauer Joseph S. Anderson Gene Therapy for HIV From Inception to a Possible Cure 123 SpringerBriefs in Biochemistry and Molecular Biology For

More information

Mark W.J. Strachan Brian M. Frier. Insulin Therapy. A Pocket Guide

Mark W.J. Strachan Brian M. Frier. Insulin Therapy. A Pocket Guide Insulin Therapy Mark W.J. Strachan Brian M. Frier Insulin Therapy A Pocket Guide Mark W.J. Strachan, MD, FRCP (Ed) Metabolic Unit Western General Hospital Edinburgh United Kingdom Brian M. Frier, MD,

More information

SpringerBriefs in Cancer Research

SpringerBriefs in Cancer Research SpringerBriefs in Cancer Research For further volumes: http://www.springer.com/series/10786 Natalia Aptsiauri Angel Miguel Garcia-Lora Teresa Cabrera MHC Class I Antigens In Malignant Cells Immune Escape

More information

Progress in Social Psychiatry in Japan

Progress in Social Psychiatry in Japan Progress in Social Psychiatry in Japan Yoshibumi Nakane Progress in Social Psychiatry in Japan An Approach to Psychiatric Epidemiology Yoshibumi Nakane Department of Neuropsychiatry Nagasaki University

More information

Differential Diagnosis of Movement Disorders in Clinical Practice

Differential Diagnosis of Movement Disorders in Clinical Practice Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Peter Hedera Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Parkinson's Clinic

More information

Congenital Hip Disease in Adults

Congenital Hip Disease in Adults Congenital Hip Disease in Adults George Hartofilakidis George C. Babis Kalliopi Lampropoulou-Adamidou Congenital Hip Disease in Adults George Hartofilakidis, MD, FACS Orthopaedic Department Medical School

More information

Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov. Breast Ultrasound

Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov. Breast Ultrasound Breast Ultrasound Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov Breast Ultrasound Alexander N. Sencha Department of Ultrasound Diagnostics Yaroslavl Railway Clinic Yaroslavl

More information

Neurobiological Bases of Abnormal Aggression and Violent Behaviour

Neurobiological Bases of Abnormal Aggression and Violent Behaviour Neurobiological Bases of Abnormal Aggression and Violent Behaviour . József Haller Neurobiological Bases of Abnormal Aggression and Violent Behaviour József Haller Department of Behavioral Neurobiology

More information

White Coat Hypertension

White Coat Hypertension White Coat Hypertension Giuseppe Mancia Guido Grassi Gianfranco Parati Alberto Zanchetti White Coat Hypertension An Unresolved Diagnostic and Therapeutic Problem Giuseppe Mancia Emeritus Professor University

More information

Evidence-Based Forensic Dentistry

Evidence-Based Forensic Dentistry Evidence-Based Forensic Dentistry Balwant Rai Jasdeep Kaur Evidence-Based Forensic Dentistry Authors Balwant Rai Earth and Life Sciences Vrije Universiteit Amsterdam and ILEWG Amsterdam The Netherlands

More information

Diseases of the Spinal Cord

Diseases of the Spinal Cord Diseases of the Spinal Cord Elke Hattingen Stefan Weidauer Matthias Setzer Johannes C. Klein Frank Vrionis Editors Diseases of the Spinal Cord Novel Imaging, Diagnosis and Treatment Editors Elke Hattingen

More information

John Papadopoulos David R. Schwartz Consulting Editor. Pocket Guide to Critical Care Pharmacotherapy Second Edition

John Papadopoulos David R. Schwartz Consulting Editor. Pocket Guide to Critical Care Pharmacotherapy Second Edition John Papadopoulos David R. Schwartz Consulting Editor Pocket Guide to Critical Care Pharmacotherapy Second Edition 123 Pocket Guide to Critical Care Pharmacotherapy John Papadopoulos Author David R. Schwartz

More information

Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication

Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Huang-Ge Zhang Editor Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication 2123 Editor Huang-Ge Zhang University of Louisville

More information

Radiation Therapy for Skin Cancer

Radiation Therapy for Skin Cancer Radiation Therapy for Skin Cancer Armand B. Cognetta Jr. William M. Mendenhall Editors Radiation Therapy for Skin Cancer Editors Armand B. Cognetta Jr. Dermatology Associates of Tallahassee Chief, Division

More information

Progressive Multiple Sclerosis

Progressive Multiple Sclerosis Progressive Multiple Sclerosis Alastair Wilkins Editor Progressive Multiple Sclerosis Editor Alastair Wilkins, M.A., M.B., B.Chir, Ph.D., FRCP Department of Neurology Frenchay Hospital Bristol UK ISBN

More information

Morphological Aspects of Inner Ear Disease

Morphological Aspects of Inner Ear Disease Morphological Aspects of Inner Ear Disease Yasuya Nomura Morphological Aspects of Inner Ear Disease Yasuya Nomura President The Society for Promotion of International Oto-Rhino-Laryngology Tokyo, Japan

More information

Musculoskeletal Health in Women

Musculoskeletal Health in Women Musculoskeletal Health in Women Elinor Mody Elizabeth Matzkin Editors Musculoskeletal Health in Women Editors Elinor Mody, MD Department of Rheumatology Gretchen and Edward Fish Center for Women s Health

More information

Atlas of Lymph Node Anatomy

Atlas of Lymph Node Anatomy Atlas of Lymph Node Anatomy Mukesh G. Harisinghani Editor Atlas of Lymph Node Anatomy This publication was developed through an unrestricted educational grant from Siemens. Editor Mukesh G. Harisinghani

More information

Human Motivation and Interpersonal Relationships

Human Motivation and Interpersonal Relationships Human Motivation and Interpersonal Relationships Netta Weinstein Editor Human Motivation and Interpersonal Relationships Theory, Research, and Applications Editor Netta Weinstein Department of Psychology

More information

Radiology Illustrated

Radiology Illustrated Radiology Illustrated For further volumes: http://www.springer.com/series/11755 In-One Kim Editor Radiology Illustrated: Pediatric Radiology Editor In-One Kim, M.D. Department of Radiology Seoul National

More information

Advancing Responsible Adolescent Development

Advancing Responsible Adolescent Development Advancing Responsible Adolescent Development Series Editor Roger J.R. Levesque For additional volumes: http://www.springer.com/series/7284 wwwwwwwwww Anna-Karin Andershed Editor Girls at Risk Swedish Longitudinal

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

Respiratory Medicine Series Editor: Sharon I.S. Rounds. Marc A. Judson Editor. Pulmonary Sarcoidosis A Guide for the Practicing Clinician

Respiratory Medicine Series Editor: Sharon I.S. Rounds. Marc A. Judson Editor. Pulmonary Sarcoidosis A Guide for the Practicing Clinician Respiratory Medicine Series Editor: Sharon I.S. Rounds Marc A. Judson Editor Pulmonary Sarcoidosis A Guide for the Practicing Clinician Respiratory Medicine Series Editor: Sharon I.S. Rounds For further

More information

Tadaaki Kirita Ken Omura Editors. Oral Cancer. Diagnosis and Therapy

Tadaaki Kirita Ken Omura Editors. Oral Cancer. Diagnosis and Therapy Oral Cancer Tadaaki Kirita Ken Omura Editors Oral Cancer Diagnosis and Therapy Editors Tadaaki Kirita Department of Oral and Maxillofacial Surgery Nara Medical University Nara, Japan Ken Omura Oral Cancer

More information

The Olfactory System

The Olfactory System The Olfactory System Editor The Olfactory System From Odor Molecules to Motivational Behaviors Editor Department of Physiology The University of Tokyo Tokyo, Japan ISBN 978-4-431-54375-6 ISBN 978-4-431-54376-3

More information

Recurrent Erosion Syndrome and Epithelial Edema

Recurrent Erosion Syndrome and Epithelial Edema Recurrent Erosion Syndrome and Epithelial Edema Helena M. Tabery Recurrent Erosion Syndrome and Epithelial Edema In Vivo Morphology in the Human Cornea Helena M. Tabery, MD Malmö Sweden helena.tabery@telia.com

More information

Imaging of Urinary Tract Diverticula

Imaging of Urinary Tract Diverticula Imaging of Urinary Tract Diverticula Vladimir M. Builov Imaging of Urinary Tract Diverticula Vladimir M. Builov Department of X-Ray and MRI RailWay Clinical Hospital Yaroslavl Russia ISBN 978-3-319-05382-0

More information

Cerebral Blood Flow, Metabolism, and Head Trauma

Cerebral Blood Flow, Metabolism, and Head Trauma Cerebral Blood Flow, Metabolism, and Head Trauma Christian W. Kreipke Editors Jose A. Rafols Cerebral Blood Flow, Metabolism, and Head Trauma The Pathotrajectory of Traumatic Brain Injury Editors Christian

More information

Urinary Tract Infection

Urinary Tract Infection Urinary Tract Infection Abhay Rané Ranan Dasgupta Editors Urinary Tract Infection Clinical Perspectives on Urinary Tract Infection Editors Abhay Rané, MS, FRCS, FRCS (Urol) Department of Urology Surrey

More information

Morbid Obesity in Adolescents

Morbid Obesity in Adolescents Morbid Obesity in Adolescents ThiS is a FM Blank Page Kurt Widhalm Gerhard Prager Editors Morbid Obesity in Adolescents Conservative Treatment and Surgical Approaches Editors Kurt Widhalm Department of

More information

CLINICAL GASTROENTEROLOGY

CLINICAL GASTROENTEROLOGY CLINICAL GASTROENTEROLOGY Series Editor George Y. Wu University of Connecticut Health Center, Farmington, CT, USA For further volumes: http://www.springer.com/series/7672 Elizabeth J. Carey Keith D. Lindor

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Applications. in Oncology

Applications. in Oncology Kewal K. Jain Applications of Biotechnology in Oncology Applications of Biotechnology in Oncology Applications of Biotechnology in Oncology Kewal K. Jain, MD, FRACS, FFPM Jain PharmaBiotech, Basel, Switzerland

More information

Local Flaps in Facial Reconstruction

Local Flaps in Facial Reconstruction Local Flaps in Facial Reconstruction Velupillai Ilankovan Madan Ethunandan Tian Ee Seah Local Flaps in Facial Reconstruction A Defect Based Approach Velupillai Ilankovan Poole Hospital NHS Foundation

More information

Deep Brain Stimulation for Neurological Disorders

Deep Brain Stimulation for Neurological Disorders Deep Brain Stimulation for Neurological Disorders Toru I t a k u ra Editor Deep Brain Stimulation for Neurological Disorders Theoretical Background and Clinical Application Editor Toru Itakura, MD, PhD

More information

Minimally Invasive Gynecological Surgery

Minimally Invasive Gynecological Surgery Minimally Invasive Gynecological Surgery O l av Is t re Editor Minimally Invasive Gynecological Surgery Editor Olav Istre, MD, PhD Fredriksberg Denmark ISBN 978-3-662-44058-2 ISBN 978-3-662-44059-9 (ebook)

More information

Thomas Reinhard Frank Larkin Editors. Corneal Disease. Recent Developments in Diagnosis and Therapy

Thomas Reinhard Frank Larkin Editors. Corneal Disease. Recent Developments in Diagnosis and Therapy Corneal Disease Thomas Reinhard Frank Larkin Editors Corneal Disease Recent Developments in Diagnosis and Therapy Editors Prof. Dr. med. Thomas Reinhard University Eye Hospital Freiburg Germany Dr. Frank

More information

Radiation Therapy for Head and Neck Cancers

Radiation Therapy for Head and Neck Cancers Radiation Therapy for Head and Neck Cancers Murat Beyzadeoglu Gokhan Ozyigit Ugur Selek Editors Radiation Therapy for Head and Neck Cancers A Case-Based Review Editors Murat Beyzadeoglu, MD Professor

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

End of Life Care in Neurological Disease

End of Life Care in Neurological Disease End of Life Care in Neurological Disease David Oliver Editor End of Life Care in Neurological Disease Editor David Oliver BSc FRCP FRCGP Wisdom Hospice Rochester Kent UK ISBN 978-0-85729-681-8 ISBN 978-0-85729-682-5

More information

Angiogenesis Modulations in Health and Disease

Angiogenesis Modulations in Health and Disease Angiogenesis Modulations in Health and Disease Shaker A. Mousa Paul J. Davis Editors Angiogenesis Modulations in Health and Disease Practical Applications of Pro- and Anti-angiogenesis Targets Editors

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Gynecologic Oncology

Gynecologic Oncology Gynecologic Oncology Ramez N. Eskander Robert E. Bristow Editors Gynecologic Oncology A Pocketbook Editors Ramez N. Eskander, M.D. Assistant Professor Division of Gynecologic Oncology Department of Obstetrics

More information

The Cleveland Clinic Manual of Dynamic Endocrine Testing

The Cleveland Clinic Manual of Dynamic Endocrine Testing The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin A. Laurence Kennedy Manjula K. Gupta Amir H. Hamrahian The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin Department of Endocrinology,

More information

Indirect Questioning in Sample Surveys

Indirect Questioning in Sample Surveys Indirect Questioning in Sample Surveys Arijit Chaudhuri Tasos C. Christofides Indirect Questioning in Sample Surveys 123 Arijit Chaudhuri Applied Statistics Unit Indian Statistical Institute Kolkata,

More information

Medication-Related Osteonecrosis of the Jaws

Medication-Related Osteonecrosis of the Jaws Medication-Related Osteonecrosis of the Jaws Sve n O t to Editor Medication-Related Osteonecrosis of the Jaws Bisphosphonates, Denosumab, and New Agents Editor Sven Otto, MD, DMD, FEBOMFS Department of

More information

Health-Related Quality of Life in Cardiovascular Patients

Health-Related Quality of Life in Cardiovascular Patients Health-Related Quality of Life in Cardiovascular Patients Kalina Kawecka-Jaszcz Marek Klocek Beata Tobiasz-Adamczyk Christopher J. Bulpitt Editors Health-Related Quality of Life in Cardiovascular Patients

More information

Mitochondria as Targets for Phytochemicals in Cancer Prevention and Therapy

Mitochondria as Targets for Phytochemicals in Cancer Prevention and Therapy Mitochondria as Targets for Phytochemicals in Cancer Prevention and Therapy Dhyan Chandra Editor Mitochondria as Targets for Phytochemicals in Cancer Prevention and Therapy 1 3 Editor Dhyan Chandra, Associate

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Imaging of Alimentary Tract Perforation

Imaging of Alimentary Tract Perforation Imaging of Alimentary Tract Perforation Luigia Romano Antonio Pinto Editors Imaging of Alimentary Tract Perforation Editors Luigia Romano Department of Radiology A. Cardarelli Hospital Naples Italy Antonio

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

Sine Syndromes in Rheumatology

Sine Syndromes in Rheumatology Sine Syndromes in Rheumatology Jozef Rovenský Manfred Herold Martina Vašáková Editors Sine Syndromes in Rheumatology Editors Jozef Rovenský National Institute of Rheumatic Diseases Piešťany Slovakia Institute

More information

Neural-Immune Interactions in Brain Function and Alcohol Related Disorders

Neural-Immune Interactions in Brain Function and Alcohol Related Disorders Neural-Immune Interactions in Brain Function and Alcohol Related Disorders Changhai Cui Lindsey Grandison Antonio Noronha Editors Neural-Immune Interactions in Brain Function and Alcohol Related Disorders

More information

In Clinical Practice

In Clinical Practice In Clinical Practice Taking a practical approach to clinical medicine, this series of smaller reference books is designed for the trainee physician, primary care physician, nurse practitioner and other

More information

Medical and Surgical Complications of Sickle Cell Anemia

Medical and Surgical Complications of Sickle Cell Anemia Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Department of Surgery Dar A lalafia Medical Company Qatif

More information

Radiation Therapy for Extranodal Lymphomas

Radiation Therapy for Extranodal Lymphomas Radiation Therapy for Extranodal Lymphomas Keisuke Sasai Masahiko Oguchi Editors Radiation Therapy for Extranodal Lymphomas Editors Keisuke Sasai Department of Radiation Oncology Juntendo University Faculty

More information

The Cardiac Lymphatic System

The Cardiac Lymphatic System The Cardiac Lymphatic System Ganga Karunamuni Editor The Cardiac Lymphatic System An Overview Editor Ganga Karunamuni Department of Pediatrics Case Western Reserve University Cleveland, OH, USA ISBN 978-1-4614-6773-1

More information

Atlas of Peripheral Nerve Ultrasound

Atlas of Peripheral Nerve Ultrasound Atlas of Peripheral Nerve Ultrasound Siegfried Peer Hannes Gruber Editors Atlas of Peripheral Nerve Ultrasound With Anatomic and MRI Correlation Editors Siegfried Peer CTI GesmbH Klostergasse 4 Innsbruck

More information

Wound Management in Urgent Care

Wound Management in Urgent Care Wound Management in Urgent Care Brittany Busse Wound Management in Urgent Care Brittany Busse, MD Med 7 Urgent Care Folsom, CA, USA ISBN 978-3-319-27426-3 DOI 10.1007/978-3-319-27428-7 ISBN 978-3-319-27428-7

More information

Fundamentals of Cancer Prevention

Fundamentals of Cancer Prevention Fundamentals of Cancer Prevention David Alberts Lisa M. Hess Editors Fundamentals of Cancer Prevention Third Edition Editors David Alberts College of Medicine Arizona Cancer Center University of Arizona

More information

Esthetic and Functional Management of Diastema

Esthetic and Functional Management of Diastema Esthetic and Functional Management of Diastema Ugur Erdemir Esra Yildiz Editors Esthetic and Functional Management of Diastema A Multidisciplinary Approach Editors Ugur Erdemir Faculty of Dentistry University

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Therapeutic rtms in Neurology

Therapeutic rtms in Neurology Therapeutic rtms in Neurology Thomas Platz Editor Therapeutic rtms in Neurology Principles, Evidence, and Practice Recommendations Editor Thomas Platz BDH-Klinik Greifswald Ernst-Moritz-Arndt Universität

More information

Planning and Care for Children and Adolescents with Dental Enamel Defects

Planning and Care for Children and Adolescents with Dental Enamel Defects Planning and Care for Children and Adolescents with Dental Enamel Defects Etiology, Research and Contemporary Management Bernadette K. Drummond Nicola Kilpatrick Editors 123 Planning and Care for Children

More information

Practical Case Studies in Hypertension Management. Series editor Giuliano Tocci Rome, Italy

Practical Case Studies in Hypertension Management. Series editor Giuliano Tocci Rome, Italy Practical Case Studies in Hypertension Management Series editor Giuliano Tocci Rome, Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat

More information

Desmond P. Kidd. Neuro-Ophthalmology. Illustrated Case Studies

Desmond P. Kidd. Neuro-Ophthalmology. Illustrated Case Studies Neuro-Ophthalmology Desmond P. Kidd Neuro-Ophthalmology Illustrated Case Studies Desmond P. Kidd Department of Clinical Neurosciences Royal Free Hospital London UK ISBN 978-1-4471-2409-2 DOI 10.1007/978-1-4471-2410-8

More information

SPRINGER HANDBOOK OF AUDITORY RESEARCH

SPRINGER HANDBOOK OF AUDITORY RESEARCH SPRINGER HANDBOOK OF AUDITORY RESEARCH Series Editors: Richard R. Fay and Arthur N. Popper Sunil Puria Richard R. Fay Arthur N. Popper Editors The Middle Ear Science, Otosurgery, and Technology Springer

More information

Inflammation and Lung Cancer

Inflammation and Lung Cancer Inflammation and Lung Cancer Steven M. Dubinett Editor Inflammation and Lung Cancer 1 3 Editor Steven M. Dubinett David Geffen School of Medicine at UCLA Los Angeles California USA ISBN 978-1-4939-2723-4

More information

Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis

Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis ii Colloquium Digital Library of Life Sciences This e-book is an original work

More information

Counseling and Action

Counseling and Action Counseling and Action Richard A. Young José F. Domene Ladislav Valach Editors Counseling and Action Toward Life-Enhancing Work, Relationships, and Identity 1 3 Editors Richard A. Young Department of Educational

More information

Handbook of Dermatologic Surgery

Handbook of Dermatologic Surgery Handbook of Dermatologic Surgery Handbook of Dermatologic Surgery Elizabeth Hale, M.D. New York University of School of Medicine New York, NY, USA Julie Karen, M.D. New York University of School of Medicine

More information

Medical Management of the Pregnant Patient

Medical Management of the Pregnant Patient Medical Management of the Pregnant Patient Karen Rosene-Montella Editor Medical Management of the Pregnant Patient A Clinician s Handbook Editor Karen Rosene-Montella, MD SVP Women s Services and Clinical

More information

Evidence Based Treatments for Trauma- Related Psychological Disorders

Evidence Based Treatments for Trauma- Related Psychological Disorders Evidence Based Treatments for Trauma- Related Psychological Disorders Ulrich Schnyder Marylène Cloitre Editors Evidence Based Treatments for Trauma-Related Psychological Disorders A Practical Guide for

More information

Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus

Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus Helena M. Tabery Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus In Vivo Morphology in the Human Cornea

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Louise Grech Alan Lau Editors. Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis. From Hospital to Community

Louise Grech Alan Lau Editors. Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis. From Hospital to Community Louise Grech Alan Lau Editors Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis From Hospital to Community Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Louise Grech

More information

Handbook for Venous Thromboembolism

Handbook for Venous Thromboembolism Handbook for Venous Thromboembolism Gregory Piazza Benjamin Hohlfelder Samuel Z. Goldhaber Handbook for Venous Thromboembolism Gregory Piazza Cardiovascular Division Harvard Medical School Brigham and

More information

Iatrogenic Effects of Orthodontic Treatment

Iatrogenic Effects of Orthodontic Treatment Iatrogenic Effects of Orthodontic Treatment Roberto Justus Iatrogenic Effects of Orthodontic Treatment Decision-Making in Prevention, Diagnosis, and Treatment Roberto Justus Department of Orthodontics

More information

Autism and the Brain

Autism and the Brain Autism and the Brain Tatyana B. Glezerman Autism and the Brain Neurophenomenological Interpretation Tatyana B. Glezerman Independent Practitioner New York, NY, USA ISBN 978-1-4614-4111-3 ISBN 978-1-4614-4112-0

More information

Current Therapy and Surgery for Urogenital Tuberculosis

Current Therapy and Surgery for Urogenital Tuberculosis Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Research TB Institute Novosibirsk Medical University

More information

Office-Based Gynecologic Surgical Procedures

Office-Based Gynecologic Surgical Procedures Office-Based Gynecologic Surgical Procedures Jonathan D. Emery Marie Fidela R. Paraiso Editors Office-Based Gynecologic Surgical Procedures Editors Jonathan D. Emery, M.D. Department of Obstetrics and

More information

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest DECLARATION OF CONFLICT OF INTEREST No conflicts of interest University Heart Centre Tübingen Angiogenic actions of platelets Meinrad Gawaz, MD, FESC Tübingen, Germany ESC 2011 Paris GPIb GPIb GPVI TxA2

More information

Cancer Treatment and Research

Cancer Treatment and Research Cancer Treatment and Research Volume 155 Series Editor Steven T. Rosen For further volumes: http://www.springer.com/series/5808 Boris Pasche Editor Cancer Genetics 123 Editor Boris Pasche, MD, PhD, FACP

More information

Sami Shousha Editor. Breast Pathology. Problematic Issues

Sami Shousha Editor. Breast Pathology. Problematic Issues Breast Pathology Editor Breast Pathology Problematic Issues Editor Charing Cross Hospital Imperial College Healthcare NHS Trust & Imperial College London United Kingdom ISBN 978-3-319-28653-2 ISBN 978-3-319-28655-6

More information

The Mediterranean Diet

The Mediterranean Diet The Mediterranean Diet wwwwwwwwwwwwww Eric Zacharias, M.D. The Mediterranean Diet A Clinician s Guide for Patient Care Eric Zacharias, M.D. Chairman, Department of Medicine, Boulder Medical Center Assistant

More information

Editor Journal of Allergy and Therapy

Editor Journal of Allergy and Therapy Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the

More information

Benign Breast Diseases

Benign Breast Diseases Catherine N. Chinyama Benign Breast Diseases Radiology Pathology Risk Assessment Second Edition 123 Benign Breast Diseases Catherine N. Chinyama Benign Breast Diseases Radiology - Pathology - Risk Assessment

More information

Reconstructive Oral and Maxillofacial Surgery

Reconstructive Oral and Maxillofacial Surgery Reconstructive Oral and Maxillofacial Surgery Carlos Navarro Vila Editor Reconstructive Oral and Maxillofacial Surgery Editor Carlos Navarro Vila Hospital General Universitario Gregorio Marañón Madrid

More information

Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs

Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Department of Anatomy Xuzhou Medical College Xuzhou Jiangsu

More information

Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders

Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders Janusz K. Rybakowski Alessandro Serretti Editors Genetic Influences on Response to Drug Treatment for Major Psychiatric

More information

Pulmonary Manifestations of Rheumatic Disease

Pulmonary Manifestations of Rheumatic Disease Pulmonary Manifestations of Rheumatic Disease Paul F. Dellaripa Aryeh Fischer Kevin R. Flaherty Editors Pulmonary Manifestations of Rheumatic Disease A Comprehensive Guide With 64 Figures, 26 in Color

More information

SpringerBriefs in Applied Sciences and Technology

SpringerBriefs in Applied Sciences and Technology SpringerBriefs in Applied Sciences and Technology Computational Intelligence Series Editor Janusz Kacprzyk, Systems Research Institute, Polish Academy of Sciences, Warsaw, Poland SpringerBriefs in Computational

More information

Practical Case Studies in Hypertension Management. Series editor: Giuliano Tocci Rome Italy

Practical Case Studies in Hypertension Management. Series editor: Giuliano Tocci Rome Italy Practical Case Studies in Hypertension Management Series editor: Giuliano Tocci Rome Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat

More information

Measures of Positive Psychology

Measures of Positive Psychology Measures of Positive Psychology Kamlesh Singh Mohita Junnarkar Jasleen Kaur Measures of Positive Psychology Development and Validation 123 Kamlesh Singh Department of Humanities and Social Sciences Indian

More information

SpringerBriefs in Psychology. Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle

SpringerBriefs in Psychology. Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle SpringerBriefs in Psychology Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle Epidemiological studies show that the prevalence of mental disorders is extremely high across the globe

More information

Pediatric Endodontics

Pediatric Endodontics Pediatric Endodontics Anna B. Fuks Benjamin Peretz Editors Pediatric Endodontics Current Concepts in Pulp Therapy for Primary and Young Permanent Teeth Editors Anna B. Fuks Department of Pediatric Dentistry

More information

Intraductal Papillary Mucinous Neoplasm of the Pancreas. Masao Tanaka Editor

Intraductal Papillary Mucinous Neoplasm of the Pancreas. Masao Tanaka Editor Intraductal Papillary Mucinous Neoplasm of the Pancreas Masao Tanaka Editor Intraductal Papillary Mucinous Neoplasm of the Pancreas Masao Tanaka Editor Intraductal Papillary Mucinous Neoplasm of the Pancreas

More information

Birkh auser Advances in Infectious Diseases

Birkh auser Advances in Infectious Diseases Birkh auser Advances in Infectious Diseases Series Editors Axel Schmidt, University Witten/Herdecke, Faculty of Medicine, Alfred-Herrhausen-Str. 50, 58448 Witten, Germany Olaf Weber, Rheinische Friedrich-Wilhelms-University,

More information