The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge"

Transcription

1 The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

2 Previously on Cancer... hereditary predisposition Normal Cell Slightly Abnormal More Abnormal Malignant? Gene changes mutations + epigenetic change + viruses + mobile elements accelerated by Genetic Instability

3 Which genes are altered in cancer? - all sorts of different pathways and systems - Mitogenic signalling pathways e.g. Wnt signalling pathway*, Receptor tyrosine kinase pathways* Rb control of cell cycle Hedgehog pathway, Notch pathway, Hippo pathway... - Inhibitory signalling, e.g. TGF-β pathway* - Transcription control systems - transcription factors - p53 - beta-catenin, MYC and ETS families - hormone receptors ER - chromatin / histone modifiers - Cell adhesion, e.g. cadherin E in breast - telomerase - DNA repair and mitotic processes - Carbohydrate metabolism (IDH1 in gliomas and AML) - etc., etc.!

4 A weird example

5 citric acid cycle citrate A weird example isocitrate isocitrate dehydrogenases hydroxyglutarate alphaketoglutarate DNA hypermethylation? = epigenetic instability? isocitrate dehydrogenase IDH1 mutated in majority glioblastomas, occasional leukaemias,

6 What sorts of mutations alter the genes? All sorts of mutation

7 What sorts of mutations alter the genes? Sequence changes, e.g. TCGAGCTATGTGTCTCTAGGTCGGT TCGAGCTATGAGTCTCTAGGTCGGT Small-scale changes STRUCTURAL changes, e.g. Large-scale changes

8 What sorts of mutations alter the genes? - single base pair change, e.g. RAS, p53... Small-scale changes - chromosome translocation - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes

9 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes

10 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes

11 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation APC classic example, truncated in colon, first mutation in Vogelstein s model of colon cancer, - Amplification (lot of copies of gene) - Duplication - Deletion Large-scale changes

12 Deleting the APC gene in colon Wild-type APC deleted Crypt region Sansom, O.J. et al., Genes & development Crypt region has expanded

13 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift Small-scale changes - chromosome translocation...cca ATA AAT TAT AGT P I N Y S... - Amplification (lot of copies of gene) - Duplication...CCA ATA AAT TTA TAG P I N L *STOP - Deletion APC classic example, truncated in colon T truncated APC protein Large-scale changes

14 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion ->frameshift - (e.g. APC in practical) Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes

15 Duplication and amplification Gene e.g. EGFR Duplication tandem OR inverted Amplification Amplified gene

16 Chromosome translocation reciprocal translocation OR unbalanced translocation

17 Chromosome translocation translocation beginning of gene A end of gene B

18 What sorts of mutations alter the genes? How do we study these mutations?

19 How did we discover cancer genes historically before large scale sequencing Viruses: retrovirus oncogenes e.g. RAS, MYC (RAt Sarcoma, MYeloblastosis C) DNA tumour viruses p53 - Deletion Hereditary predisposition to cancer - Duplication e.g. breast cancer prediposition BRCA1, BRCA2 polyposis coli APC - Amplification (lot of copies of gene) Large-scale changes - Chromosome translocation

20 p53 is a hub for stress signalling DNA damage telomeres short aberrant growth signals ATM, ATR kinases (inhibits CDK/cyclin complexes) p21 p53 p53 p53 p53 p14 ARF DNA Viruses: e.g. HPV AdenoV RB pathway cycle arrest apoptosis

21 How do we study the alterations/mutations? sequencing Small-scale changes - Deletion - Duplication - Amplification (lot of copies of gene) Large-scale changes - Chromosome translocation

22 Passengers versus Drivers Normal Cell Slightly Abnormal More Abnormal Malignant A AB ABC ABCD Gene changes

23 Passengers versus Drivers Normal Cell Slightly Abnormal More Abnormal Malignant Random passenger mutations X Y A XY Y AB Z ABC XY X ABCD Z α γα γα β Z Gene changes random passenger mutations are difficult to distinguish from driver mutations

24 How do we study the alterations/mutations? sequencing Small-scale changes - Deletion started with cytogenetics... - Inversion - Duplication Large-scale changes - Amplification - Chromosome translocation

25 Metaphase chromosomes

26

27 Karyotype

28 Philadelphia chromosome 9:22 22:9

29 Breast Cancer Karyotype, from primary culture Pandis et al (1998) Genes Chromosomes Cancer 22, 122

30 Amplification of N-MYC Chr 12 * One copy N-MYC Hundreds of copies

31 Breast Cancer Cell Line MDA-MB-361 Joanne Davidson

32 CGH Hybridization: Search for deletions and amplifications Amplification EGFreceptor (ERBB/ HER-1) Number of copies Genome position glioblastoma Deletion P16/CDKN2A/INK4A implicated in senescence

33 Examples of mutations Tyrosine kinases and signalling downstream from them

34 Receptor Tyrosine Kinase (RTK) signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor / ERBB, HER-1 PIP2/ PI3KCA PIP3 AKT ERBB2/HER-2 PTEN tyrosine kinases

35 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor A.k.a ERBB, HER-1 Ras GTP (ac,ve) PI3KCA PIP3 AKT SOS PTEN GAP ERBB2/HER-2 Ras GDP (inac,ve)

36 POINT Mutations in RTK signalling pathways EGF EGF-Receptor RAS Grb2, SoS B-RAF RAS family: HRAS, KRAS, NRAS MAP Kinase pathway PI3KCA PIP3 AKT ERBB2/HER-2 PTEN

37 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 - Activating mutations, act like ras mutations. PIP3K AKT - In tumours that otherwise have Ras PTEN mutations e.g. 60% of melanomas, some colon cancers - Commonest mutation V600E (valine 600 -> glutamic acid),

38 BRAF V600E activation valine glutamic acid V T599 Activation segment is thought to move when Thr599 is phosphorylated, activating kinase. V600E where valine replaced by Gutamic acid doesn t need phosphorylation. Wan et al, 2004 PMID

39 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 notes: PIP3 AKT activating mutations are highlyspecific PTEN pathways mutated rather than genes

40 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA ERBB2/HER-2 - Activating mutations. - One PIP3K of the Common AKT mutations - E542K (glutamic acid 542 -> lysine) PTEN - 40% of breast cancers, several other cancers

41 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Both occasionally point mutated in lung cancers

42 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT ERBB2/HER-2 PTEN

43 POINT Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 PTEN AKT ERBB2/HER-2 RAS, RAF and PI3KCA feature in Vogelstein s model of colon cancer

44 Examples of alterations/mutations? - single base pair change - Indel = Small insert or deletion Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes

45 Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Deletions common (as well as point mutations)

46 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion -> Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes

47 Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor Activated by tandem duplication! PI3KCA PIP3K AKT ERBB2/HER-2 PTEN

48 Tandem duplications causing gene fusion of BRAF About 2 Mb BRAF KIAA1549 tandem duplication BRAF KIAA-BRAF Astrocytomas KIAA1549 BRAF fusion

49 Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor PI3KCA take home message 3: PIP3 AKT same gene can be mutated in multiple PTEN ways ERBB2/HER-2

50 Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor both fused by translocation (rarely) PI3KCA PIP3 AKT ERBB2/HER-2 PTEN

51 Mutations in RTK signalling pathways RAS Grb2, SoS B-RAF MAP Kinase pathway EGF EGF-Receptor Amplified in brain tumours PI3KCA PIP3 AKT PTEN ERBB2/HER-2 Amplified in breast

52 What sorts of mutations alter the genes? - single base pair change - Indel = Small insert or deletion -> Small-scale changes - Deletion - Inversion - Duplication - Amplification - Chromosome translocation Large-scale changes

53 The first human cancer mutation: The Philadelphia chromosome translocation

54 Philadelphia chromosome 9:22 9:22 reciprocal translocation of chronic myeloid leukaemia fuses BCR to ABL 22:9

55 BCR-ABL fusion protein Abl is a tyrosine kinase, controlled by N-terminal domain N-term ABL kinase Normal Abl BCR BCR Normal Bcr likes to form dimers Tyrosine kinases are activated by dimerisation BCR BCR ABL kinase -> Activated tyrosine kinase ABL kinase Iconic translocation; diagnostic of CML; target for drug Glivec/Gleevec

56 There are fusion genes in common epithelial cancers

57 There are fusion genes in common epithelial cancers TMPRSS2-ERG ~50% prostate cancers Chr. 21 TMPRSS2 ERG Deletion TMPRSS2- ERG fusion

58 There are fusion genes in common epithelial cancers TMPRSS2-ERG ~50% prostate cancers promoter only (intact) transcription factor TMPRSS2- ERG fusion

59 Rearrangement more often INactivates a gene A rearrangement can inactivate a gene, - by breaking it or - by gene loss

60 Don t forget epigenetics! Examples of genes silenced by DNA methylation: Gene Function Cancer MLH1 mismatch DNA repair colorectal Cadherin E cell-cell adhesion lobular breast cell membrane adherens junction Cadherin Cadherin beta-catenin beta-catenin

61 Viruses e.g. several viruses encode proteins that block p53 and Rb: Human papillomavirus(es) (HPVs) proteins E6, E7 Adenovirus E1a, E1b

62 and hot topic LINE-1 retrotransposons? We know even less, but LINE1 retrotransposons form new insertions in some tumours can interrupt genes and turn genes on so far one inactivation of APC reported watch this space!

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Karyotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl

Karyotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)

More information

oncogenes-and- tumour-suppressor-genes)

oncogenes-and- tumour-suppressor-genes) Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging

More information

Overview of the core ideas in cancer research

Overview of the core ideas in cancer research Overview of the core ideas in cancer research Paul Edwards Cancer Research UK Cambridge Institute and Department of Pathology, University of Cambridge This lecture Overview of the ideas that provide the

More information

Determination Differentiation. determinated precursor specialized cell

Determination Differentiation. determinated precursor specialized cell Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:

More information

Lecture 8 Neoplasia II. Dr. Nabila Hamdi MD, PhD

Lecture 8 Neoplasia II. Dr. Nabila Hamdi MD, PhD Lecture 8 Neoplasia II Dr. Nabila Hamdi MD, PhD ILOs Understand the definition of neoplasia. List the classification of neoplasia. Describe the general characters of benign tumors. Understand the nomenclature

More information

Emerging" hallmarks of cancer, a. Reprogramming of energy metabolism b. Evasion of the immune system, Enabling characteristics, a.

Emerging hallmarks of cancer, a. Reprogramming of energy metabolism b. Evasion of the immune system, Enabling characteristics, a. HALLMARKS OF CANCER - Together dictate the malignant phenotype. 1. Self-sufficiency in growth signals 2. Insensitivity to growth inhibitory signals 3. Evasion of cell death 4. Limitless replicative potential

More information

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage?

Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? Questions about cancer What is cancer? Cancer Gil McVean, Department of Statistics, Oxford What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? What are the steps in

More information

MOLECULAR BASIS OF ONCOGENESIS

MOLECULAR BASIS OF ONCOGENESIS MOLECULAR BASIS OF ONCOGENESIS MUDr. Jiří Vachtenheim, CSc. 1 Cell processes which result also in cell cycle effects. Differentiation. Differentiated cells are usually in the G0 phase of the cell cycle.

More information

Section D. Genes whose Mutation can lead to Initiation

Section D. Genes whose Mutation can lead to Initiation This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Cancer genetics

Cancer genetics Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Section D: The Molecular Biology of Cancer

Section D: The Molecular Biology of Cancer CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty

More information

Genomic Instability. Kent Nastiuk, PhD Dept. Cancer Genetics Roswell Park Cancer Institute. RPN-530 Oncology for Scientist-I October 18, 2016

Genomic Instability. Kent Nastiuk, PhD Dept. Cancer Genetics Roswell Park Cancer Institute. RPN-530 Oncology for Scientist-I October 18, 2016 Genomic Instability Kent Nastiuk, PhD Dept. Cancer Genetics Roswell Park Cancer Institute RPN-530 Oncology for Scientist-I October 18, 2016 Previous lecturers supplying slides/notes/inspiration Daniel

More information

Present State of Gene Diagnosis and Future Prospects

Present State of Gene Diagnosis and Future Prospects Clinical Medicine: Cancer Present State of Gene Diagnosis and Future Prospects JMAJ 45(3): 118 124, 2002 Eiichi TAHARA Chairman, Hiroshima Cancer Seminar Foundation Abstract: The entire base sequence of

More information

TUMOR-SUPPRESSOR GENES. Molecular Oncology Michael Lea

TUMOR-SUPPRESSOR GENES. Molecular Oncology Michael Lea TUMOR-SUPPRESSOR GENES Molecular Oncology 2011 Michael Lea TUMOR-SUPPRESSOR GENES - Lecture Outline 1. Summary of tumor suppressor genes 2. P53 3. Rb 4. BRCA1 and 2 5. APC and DCC 6. PTEN and PPA2 7. LKB1

More information

Prof. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2)

Prof. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2) Prof. R. V. Skibbens November 22, 2010 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality - clocks go in only one direction G1 doesn t have replication-inducing

More information

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types

More information

Multistep nature of cancer development. Cancer genes

Multistep nature of cancer development. Cancer genes Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic

More information

Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San

Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San Francisco Lung Cancer Classification Pathological Classification

More information

Genomic instability. Amin Mahpour

Genomic instability. Amin Mahpour Genomic instability Amin Mahpour 1 Some questions to ponder What is Genomic instability? What factors contribute to the genomic integrity? How we identify these aberrations? 2 PART I: MOLECULAR BIOLOGY

More information

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis

Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular

More information

Chapter 18- Oncogenes, tumor suppressors & Cancer

Chapter 18- Oncogenes, tumor suppressors & Cancer Chapter 18- Oncogenes, tumor suppressors & Cancer - Previously we have talked about cancer which is an uncontrolled cell proliferation and we have discussed about the definition of benign, malignant, metastasis

More information

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified? Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,

More information

Cell Cycle and Cancer

Cell Cycle and Cancer 142 8. Cell Cycle and Cancer NOTES CELL CYCLE G 0 state o Resting cells may re-enter the cell cycle Nondividing cells (skeletal and cardiac muscle, neurons) o Have left the cell cycle and cannot undergo

More information

Colon Cancer and Hereditary Cancer Syndromes

Colon Cancer and Hereditary Cancer Syndromes Colon Cancer and Hereditary Cancer Syndromes Gisela Keller Institute of Pathology Technische Universität München gisela.keller@lrz.tum.de Colon Cancer and Hereditary Cancer Syndromes epidemiology models

More information

Mohammed El-Khateeb. Tumor Genetics. MGL-12 July 21 st 2013 台大農藝系遺傳學 Chapter 22 slide 1

Mohammed El-Khateeb. Tumor Genetics. MGL-12 July 21 st 2013 台大農藝系遺傳學 Chapter 22 slide 1 Mohammed El-Khateeb Tumor Genetics MGL-12 July 21 st 2013 台大農藝系遺傳學 601 20000 Chapter 22 slide 1 Cellular Basis of Cancer Cancer is a collection of diseases characterized by abnormal and uncontrolled growth

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

Chapt 15: Molecular Genetics of Cell Cycle and Cancer

Chapt 15: Molecular Genetics of Cell Cycle and Cancer Chapt 15: Molecular Genetics of Cell Cycle and Cancer Student Learning Outcomes: Describe the cell cycle: steps taken by a cell to duplicate itself = cell division; Interphase (G1, S and G2), Mitosis.

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

Basic tumor nomenclature

Basic tumor nomenclature Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:

More information

CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS

CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

Chapter 16 Mutations. Practice Questions:

Chapter 16 Mutations. Practice Questions: Biology 234 J. G. Doheny Chapter 16 Mutations Practice Questions: Answer the following questions with one or two sentences. 1. List the name of one test that can be used to identify mutagens. 2. What is

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Test Name Results Units Bio. Ref. Interval. Positive

Test Name Results Units Bio. Ref. Interval. Positive LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

STRUCTURAL CHROMOSOMAL ABERRATIONS

STRUCTURAL CHROMOSOMAL ABERRATIONS STRUCTURAL CHROMOSOMAL ABERRATIONS Structural chromosomal aberrations cause structural abnormalities in chromosome structure. They alter the sequence or the kind of genes present in chromosome. These are

More information

Glioblastoma pathophysiology: or a

Glioblastoma pathophysiology: or a Glioblastoma pathophysiology: A or a? M.J. van den Bent The Brain Tumor Center at Erasmus MC Cancer Center Rotterdam, the Netherlands Pathophysiology: pathophysiology seeks to explain the physiological

More information

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.

IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically

More information

Chromosomes with two centromeres and the breakage-fusion-bridge cycle

Chromosomes with two centromeres and the breakage-fusion-bridge cycle CHROMOSOMES THAT CAUSE CANCER: Chromosomes with two centromeres and the breakage-fusion-bridge cycle Ruth MacKinnon @ruthnmackinnon http://www.theleukaemiaproject.com/ Victorian Cancer Cytogenetics Service

More information

Colon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP

Colon cancer: practical molecular diagnostics. Wade S. Samowitz, M.D. University of Utah and ARUP Colon cancer: practical molecular diagnostics Wade S. Samowitz, M.D. University of Utah and ARUP Disclosure Dr. Samowitz may receive royalties in the future related to the Ventana BRAF V600E antibody.

More information

Bihong Zhao, M.D, Ph.D Department of Pathology

Bihong Zhao, M.D, Ph.D Department of Pathology Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

Early Embryonic Development

Early Embryonic Development Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal

More information

Policy Specific Section: Medical Necessity and Investigational / Experimental. October 14, 1998 March 28, 2014

Policy Specific Section: Medical Necessity and Investigational / Experimental. October 14, 1998 March 28, 2014 Medical Policy Genetic Testing for Colorectal Cancer Type: Medical Necessity and Investigational / Experimental Policy Specific Section: Laboratory/Pathology Original Policy Date: Effective Date: October

More information

Chapter 9, Part 1: Biology of Cancer and Tumor Spread

Chapter 9, Part 1: Biology of Cancer and Tumor Spread PATHOPHYSIOLOGY Name Chapter 9, Part 1: Biology of Cancer and Tumor Spread I. Cancer Characteristics and Terminology Neoplasm new growth, involves the overgrowth of tissue to form a neoplastic mass (tumor).

More information

Colonic polyps and colon cancer. Andrew Macpherson Director of Gastroentology University of Bern

Colonic polyps and colon cancer. Andrew Macpherson Director of Gastroentology University of Bern Colonic polyps and colon cancer Andrew Macpherson Director of Gastroentology University of Bern Improtance of the problem of colon cancers - Epidemiology Lifetime risk 5% Incidence/10 5 /annum (US Detroit

More information

Chromosome Abnormalities

Chromosome Abnormalities Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present

More information

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.

BL 424 Test pts name Multiple choice have one choice each and are worth 3 points. BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the author to give readers additional information about his work. Supplement to: Croce CM. Oncogenes and cancer. N Engl J Med 2008;358:502-11.

More information

TUMOR M ARKERS MARKERS

TUMOR M ARKERS MARKERS TUMOR MARKERS M.Shekarabi IUMS Definition Many cancers are associated with the abnormal production of some molecules l which h can be measured in plasma. These molecules are known as tumor markers. A good

More information

CARCINOGENESIS: THE MOLECULAR BASIS OF CANCER

CARCINOGENESIS: THE MOLECULAR BASIS OF CANCER CARCINOGENESIS: THE MOLECULAR BASIS OF CANCER Nonlethal genetic damage lies at the heart of carcinogenesis. Mutation may be acquired by the action of environmental agents, such as chemicals, radiation,

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 1 Molecular Basis of Cancer Molecular Oncology Keisha

More information

Supplementary Material Correlation matrices on FP and FN profiles

Supplementary Material Correlation matrices on FP and FN profiles Supplementary Material Correlation matrices on FP and FN profiles The following two tables give the correlation coefficients for the FP profiles and the FN profiles of a single tagging solutions against

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

Src-INACTIVE / Src-INACTIVE

Src-INACTIVE / Src-INACTIVE Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each

More information

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng. Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

A Genetic Program for Embryonic Development

A Genetic Program for Embryonic Development Concept 18.4: A program of differential gene expression leads to the different cell types in a multicellular organism During embryonic development, a fertilized egg gives rise to many different cell types

More information

Molecular pathogenesis of lung cancer

Molecular pathogenesis of lung cancer Molecular pathogenesis of lung cancer Pr. Elisabeth Brambilla INSERM U823 Department of Pathology CHU Grenoble France Lung epithelial cells Carcinogen exposure genetic predisposition Auto- and paracrine

More information

Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas

Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Igor Astsaturov Philip Ellis Jeff Swensen Zoran Gatalica David Arguello Sandeep Reddy Wafik El-Deiry Disclaimers Dr. Igor

More information

Chromosomal Aberrations

Chromosomal Aberrations Chromosomal Aberrations Chromosomal Aberrations Abnormalities of chromosomes may be either numerical or structural and may involve one or more autosomes, sex chromosomes, or both simultaneously. Numerical

More information

Principles of Biology

Principles of Biology Principles of Biology contents 55 Cancer The Genetic Basis of Cancers Chances are that you know someone who battled cancer, because one in every two men and one in every three women will develop cancer.

More information

Molecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.

Molecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy. Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine

More information

Wikipedia Article on Epigenetics and Melanoma

Wikipedia Article on Epigenetics and Melanoma Luke Hollifield and Immaculata Ihenacho April 14, 2014 Dr. Atkinson Wikipedia Article on Epigenetics and Melanoma Introduction How and/or why does melanoma occur in people? Melanoma is a rare but aggressive

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

Test Name Results Units Bio. Ref. Interval. Positive

Test Name Results Units Bio. Ref. Interval. Positive LL - LL-ROHINI (NATIONAL REFERENCE 135091533 Age 28 Years Gender Male 1/9/2017 120000AM 1/9/2017 105415AM 4/9/2017 23858M Ref By Final LEUKEMIA DIAGNOSTIC COMREHENSIVE ROFILE, ANY 6 MARKERS t (1;19) (q23

More information

Select analysis on the next pages. Sample request and sending address see last page. Institut für Pathologie und Molekularpathologie

Select analysis on the next pages. Sample request and sending address see last page. Institut für Pathologie und Molekularpathologie Diagnostic Tumor Genome Analysis Schmelzbergstrasse 12 8091 Zürich Tel.: (+41) 044 255 3929 Fax.: (+41) 044 255 4416 Client (address, telephone number): ngs.pathologie@usz.ch www.pathologie.usz.ch Sample-Nr:

More information

Anatomic Molecular Pathology: An Emerging Field

Anatomic Molecular Pathology: An Emerging Field Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty

More information

2015 EUROPEAN CANCER CONGRESS

2015 EUROPEAN CANCER CONGRESS 2015 EUROPEAN CANCER CONGRESS 25-29 September 2015 Vienna, Austria SUMMARY The European Cancer Congress (ECC 2015) combined the 40th European Society for Medical Oncology (ESMO) congress with the 18th

More information

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar Link full download:https://getbooksolutions.com/download/test-bank-for-robbinsand-cotran-pathologic-basis-of-disease-9th-edition-by-kumar Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

Chapter 6: Cancer Pathways. Other Pathways. Cancer Pathways

Chapter 6: Cancer Pathways. Other Pathways. Cancer Pathways Chapter 6: Cancer Pathways Limited number of pathways control proliferation and differentiation Transmit signals from growth factors, hormones, cell-to-cell communications/interactions Pathways turn into

More information

An adult human has somewhere around one hundred trillion (10 14 ) cells

An adult human has somewhere around one hundred trillion (10 14 ) cells 2/22/10 Cancer genetics Inside cancer web site http://www.insidecancer.org/ National Cancer Institute http://www.cancer.gov/cancerinfo/ An adult human has somewhere around one hundred trillion (10 14 )

More information

Cell Cyc Cell Cy l c e

Cell Cyc Cell Cy l c e Mechanisms of Cell Proliferation 1 Cell Cycle G 2 S G 1 2 Multi-cellular organisms depend on cell division/proliferation; Each organism has a developmental plan that determines its behavior and properties;

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

-19. -Mousa Salah. -Shahd Alqudah. -Dr Belal

-19. -Mousa Salah. -Shahd Alqudah. -Dr Belal التزام -19 -Mousa Salah -Shahd Alqudah -Dr Belal 1 P a g e In the previous lecture we talked about the numerical chromosomal abnormalities, they are either autosomal or sex, and we said that the chromosomal

More information

Oncology for Scientists RPN 530

Oncology for Scientists RPN 530 Oncology for Scientists RPN 530 Fall 2013 Gokul Das, Ph.D. Department of Pharmacology & Therapeutics Center for Genetics & Pharmacology (CGP) Room 4-304 Tel: 845-8542 Email: gokul.das@roswellpark.org Cell,

More information

MET skipping mutation, EGFR

MET skipping mutation, EGFR New NSCLC biomarkers in clinical research: detection of MET skipping mutation, EGFR T790M, and other important biomarkers Fernando López-Ríos Laboratorio de Dianas Terapéuticas Hospital Universitario HM

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

Hereditary Gastric Cancer

Hereditary Gastric Cancer Hereditary Gastric Cancer Dr Bastiaan de Boer Consultant Pathologist Department of Anatomical Pathology PathWest Laboratory Medicine, QE II Medical Centre Clinical Associate Professor School of Pathology

More information

The Center for PERSONALIZED DIAGNOSTICS

The Center for PERSONALIZED DIAGNOSTICS The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)

More information

Molecular Diagnosis. Nucleic acid based testing in Oncology

Molecular Diagnosis. Nucleic acid based testing in Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,

More information

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities

Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

Institute of Radiation Biology. Oncogenes and tumour suppressor genes DoReMi Course 2014

Institute of Radiation Biology. Oncogenes and tumour suppressor genes DoReMi Course 2014 Institute of Radiation Biology Oncogenes and tumour suppressor genes DoReMi Course 2014 Hippocrates: Cause is systemic excess of black humor. Paracelsus challenges the humor theory. Suggests external

More information