Survivin withdrawal by nuclear export failure as a physiological switch to commit cells to apoptosis

Transcription

1 Citation: (2010) 1, e57; doi: /ddis & 2010 Mamillan Pulishers Limited All rights reserved /10 withdrawal y nulear export failure as a physiologial swith to ommit ells to apoptosis K-S Chan 1,3, C-H Wong 1,3, Y-F Huang 1,2 and H-Y Li*,1 Apoptosis is a tightly ontrolled proess regulated y many signaling pathways; however, the mehanisms and ellular events that deide whether a ell lives or dies remain poorly understood. Here we showed that when a ell is under apoptoti stress, the prosurvival protein redistriutes from the ytoplasm to the nuleus, thus ating as a physiologial swith to ommit the ell to apoptosis. The nulear reloalization of is a result of ineffiient assemly of funtional RanGTP CRM1 export omplex due to apoptoti RanGTP gradient ollapse. Susequently, undergoes uiquitination, whih not only physially prevents its diffusion ak to the ytoplasm ut also failitates its degradation. Together, this spatial and funtional regulation of aolishes its ytoprotetive effet toward the apoptoti exeutors and thus ommits a ell to apoptosis. Our data indiate that the withdrawal of is a novel and ative physiologial regulatory mehanism that tilts the survival alane and promotes the progression of apoptosis. (2010) 1, e57; doi: /ddis ; pulished online 22 July 2010 Sujet Category: Immunity The signifiane of apoptosis is never undermined given its entral role in normal development and homeostasis of multiellular organism. Apoptosis progression relies on the interplay etween prosurvival fators and proapoptoti fators, whih ruially deides whether a ell under stress lives or dies. The family of evolutionary onserved prosurvival proteins, inhiitor of apoptosis proteins (IAPs), is essential in proteting ells from entering apoptosis y negative regulation of downstream aspases. 1 5 (16.5 kda) is the smallest memer of the IAP family ontaining a single aulovirus IAP repeat motif and it is frequently overexpressed and/or deregulated in most neoplasti tissues This makes a leading researh andidate in the development of prognostial tool and a prime target in aner therapy. 11,12 As a memer of the IAP, exhiits antiapoptoti harateristis. Elevated level of has een reported to onfer radiation resistane, whereas artifiial knokdown of sensitizes and renders ells more suseptile to irradiation-indued ell death. 13,14 is ale to inhiit the apoptoti exeutors; for example, aspases, due to its ytoplasmi loalization. It is atively and rapidly exported into the ytoplasm, as ontains a anonial nulear export signal (NES) domain. The exlusion of from the nuleus is mediated y the lassi nulear export mehanism involving the interation etween the transport reeptor hromosomal region maintenane-1 (CRM1) and Ran-guanosine 5 0 -triphosphate (RanGTP) On a different note, fored entry of modified mutants into the nuleus y different groups has een assoiated to uiquitination-mediated proteolysis y 26S proteasome Theoretially, the presene of prosurvival fators in the ell renders the ell resistant to apoptoti stimuli. Hene, it is oneivale that modulatory mehanisms are in plae to negate the effet of the prosurvival proteins and to intensify the ativation of proapoptoti proteins for the progression of apoptosis. However, the fate and funtionalities of existing prosurvival fators and proteins are inompletely eluidated during ell death. The study herein desries a novel regulatory pathway serving as a physiologial swith to mediate the removal of prevailing prosurvival protein during the onset of apoptosis y the impairment of nulear export proesses that atively ontriutes toward the eventual demise of the ell. Results Prosurvival protein is degraded during the initial stages of apoptosis. We elieved that in dying ells, the tilt in alane and the onvergene of the proapoptoti fators ould e due to the removal and/or inativation of the prosurvival fators. Thus, we sought to haraterize prosurvival proteins that might e affeted in apoptoti ells. is a suitale andidate not only eause it is highly expressed in aner ells ut also as an IAP, it is also a vital 1 Division of Moleular and Cell Biology, Shool of Biologial Sienes, College of Siene, Nanyang Tehnologial University, Singapore , Singapore *Corresponding author: H-Y Li, Division of Moleular and Cell Biology, Shool of Biologial Sienes, College of Siene, Nanyang Tehnologial University, Singapore , Singapore. Tel: þ ; Fax: þ ; hyli@ntu.edu.sg 2 Current address: Temasek Laoratories, 5A, Engineering Drive 1, No , National University of Singapore, Singapore 11741, Singapore 3 These authors ontriuted equally to this work. Keywords: apoptosis; ; RanGTP; nulear transport; uiquitination Areviations: CFP, yan fluoresene protein; CHX, ylohexamide; CRM1, hromosomal region maintenane-1; FRET, fluoresene resonane energy transfer; GFP, green fluoresent protein; RanGTP, Ran-guanosin 5 -triphosphate; IAP, inhiitor of apoptosis protein; MST1, mammalian STE20-like protein kinase 1; NES, nulear export signal; NLS, nulear loalization signal; NPC, nulear pore omplex; XIAP, X-linked Inhiitor of apoptosis protein; YFP, yellow fluoresene protein Reeived ; revised ; aepted ; Edited y RA Knight

2 frelative Fold Change 2 Nulear redistriution of promotes apoptosis modulator of apoptosis. 5,15,21 Western lot revealed a marked derease of total endogenous level in a time-dependent manner (Figure 1a and Supplementary Figure S1a) upon the indution of apoptosis (Figure 1 and Supplementary Figure S1). It is possile that the deline of endogenous ould e due to the derease of mrna transripts, or the post-translational degradation of the protein or oth. To address the likelihood of eing regulated at the transription level during apoptosis, we performed semiquantitative reverse transription-pcr. Using glyeraldehyde-3-phoshate dehydrogenase (GAPDH) as an internal ontrol, the level of mrna appeared to e relatively stale and unaffeted during apoptosis (Figure 1). Hene, this effetively rules out apoptoti downregulation of mrna transription. turnover has een shown to e modulated y the uiquitin proteasome proteolyti pathway. 20 To investigate whether is similarly sujeted to uiquitin-related degradation upon apoptosis indution, we performed staility assay as denoted y the shematis in Figure 1d. MG132 is used to lok the proteosomal ativity and ylohexamide (CHX) inhiits the synthesis of new proteins. We found that endogenous proteins are degraded at a faster rate in dying ells as ompared with ontrol ells following the resumption of proteasome ativity (Figure 1e). Moreover, graphial representation (Figure 1f) learly showed the prominent derease in the staility of endogenous during apoptosis. redistriutes into the nuleus of early apoptoti ells due to the ollapse of RanGTP gradient. As undergoes uiquitin-dependent proteolysis in the nuleus, 19 it is possile that reloation ours during the progression of apoptosis. To test out this idea, immunofluoresene staining was performed against and ma414, marker for nulear pore protein omplexes (NPCs). Indeed, we found that endogenous redistriutes from the ytoplasm into the nuleus of apoptoti ells in d a Atin hrs 17 kda 37 kda Total Lysates leaved PARP leaved ICAD hrs 89 kda 12 kda e +CHX MG132 Release hrs (17 kda) Tuulin (50 kda) Casp-3 leaved Casp-3 35 kda 17/19 kda +CHX (17 kda) Tuulin (50 kda) Atin hrs 428 p 37 kda MG132 Release + CHX MG132 Release + CHX GAPDH 396 p hrs Figure 1 Apoptoti degradation of prosurvival protein (a) Total ell lysates olleted at the stated time points after VP16 treatment and immunolotted with anti- and anti-atin (loading ontrol). () VP16 treatment-indued ell death as shown y immunolots of leaved Caspase-3, leaved PARP and leaved ICAD. () Total RNAs isolated from HeLa ells treated with or without VP16 at the indiated time points. Semiquantitative reverse transription-pcr analysis was then performed using GAPDH as internal ontrol. (d) Shemati representation of staility assay. (e) Experiments performed as shown y the shematis in (d). Endogenous level was proed at indiated time points after the resumption of the proteosome ativity. Atin as loading ontrol. (f) Quantified graphial data presented as mean±s.d. (error ar) of three independent experiments

3 Nulear redistriution of promotes apoptosis 3 a DAPI ma414 Merge DAPI ma414 Merge 36 hrs 12 hrs 6 hrs +LMB 24 hrs d Before Bleah CFP After Bleah Before Bleah YFP After Bleah High Intensity Low Intensity e Input IP :Flag WB: Crm1 110 kda WB: Flag 25 kda 12 hrs 24 hrs WB: Figure 2 RanGTP gradient ollapse indues redistriution into the nuleus during apoptosis. (a) and ma414 staining after VP16 treatment at indiated time points. Images aquired with auto-optimal exposure mode. () Quantifiation of ells with distintive loalization aross the nuleoytoplasmi ompartments. Results are presented as mean population perentage of HeLa ells having distintive loalization ±S.D. (error ar) of three independent experiments (n4300 ells). () Immunostaining of non-treated, and treated HeLa ells with LMB or VP16 against and ma414. (d) FRET analysis of the nulear RanGTP gradient y Rango iosensor (fusion protein of CFP and YFP flanking an importin inding domain). Rango undergoes FRET in the presene of RanGTP. Representative images (left) and quantified data (right) presented as mean±s.d. (error ar) of three independent experiments (n ¼ 120). *Po0.001 (Student s t-test). (e) Flag- was overexpressed, immunopreipitated with anti-flag from ells inuated with or without VP16 for 24 h. Bars, 10 mm. (right) Quantified Crm1 intensities normalized against Flag was presented as relative fold hange ±S.D. (error ar) of three independent experiments 25 kda a time-dependent manner (Figure 2a and Supplementary Figure S2a). The nulear envelope appeared to e intat throughout the ourse of experiment, thus indiating that its funtion as a physial arrier is not ompromised. NPC has een reported to e the sustrates of aspases only during late apoptosis. 22,23 To demonstrate that the reloation of is a widespread phenomenon, we quantitate the relative perentage of populations of HeLa ells having distintive loalization. Consistently, ontrol HeLa ells showed predominantly ytoplasmi (ytoplasmi4 nulear) loalization of, 4,24 whereas the indution of apoptosis triggered a signifiant inrease (Student s t-test, Po0.001) in the population showing predominantly nulear (nulear4ytoplasmi) loalization of (Figure 2 and Supplementary Figure S2). This suggests that endogenous redistriutes into the nuleus during the early stages of apoptosis. The nuleoytoplasmi shuttling aility of is oordinated y passive diffusion and also the presene of an intrinsi NES motif that direts export into the ytoplasm y CRM1. 15,16,18,21 Hene, normal irumstantial diffusion of into the nuleus would not lead to its degradation as it is atively and rapidly exported ak into the ytoplasm. Immunostaining of and ma414 performed on Leptomyin B (LMB) (potent CRM1 inhiitor) or VP16-treated HeLa ells showed analogous nulear loalization of endogenous as ompared with ontrol (Figure 2), hinting a possile error along RanGTP CRM1 axis. Given the importane of the RanGTP gradient in nuleoytoplasmi traffiking, we hypothesized that the

4 4 Nulear redistriution of promotes apoptosis nulear export pathway ould similarly e affeted when the RanGTP gradient ollapsed upon apoptosis indution. Using the aeptor photoleahing method of fluoresene resonane energy transfer (FRET), the nulear RanGTP level was measured as the relative perentage of FRET effiieny. We showed that apoptosis indution results in a signifiant redution of nulear RanGTP level in HeLa ells (Figure 2d and Supplementary Figure S3). To investigate the interation etween and CRM1 during apoptosis, Flag-tagged was overexpressed and immunopreipitated using anti-flag. Our data revealed that the interation etween CRM1 and Flag- was sustantially weaker in the presene of apoptoti stimuli (Figure 2e). This indiates that the apoptoti aumulation of nulear is driven y nulear export deregulation y the RanGTP CRM1 pathway. Re-estalishment of RanGTP gradient resues redistriution. We speulated the possiility that the export of endogenous into the ytoplasm ould resume if the RanGTP gradient reovers. In our earlier report, we have estalished the use of mammalian STE20-like protein kinase 1 (Mst1) to restore diminished nulear RanGTP level. 25 Hene, y using the same strategy, we sought to find out whether ould e exported to the ytoplasm in the presene of apoptoti stimuli after Mst1 knokdown. Western lot was performed on mok-transfeted ells and ells transfeted with Mst1 or ontrol to verify the depletion of MST1 protein level. Treatment of Mst1 ahieved B80% knokdown effiieny, ut does not affet and Ran (Figure 3a). Consistently, the depletion of MST1 restores nulear RanGTP in ells treated with VP16 (Figure 3). A lear indiation of RanGTP gradient ollapse is the misloalization of Ran from predominantly nulear to eing dispersed aross the nuleoytoplasmi ompartment. As shown in Supplementary Figure S4a and, Mst1 knokdown restores the nulear loalization of Ran in ells indued to undergo apoptosis. Immunostaining was then arried out on ells transfeted with Mst1 or ontrol, in the asene and presene of VP16. HeLa ells transfeted with Mst1 demonstrated ytoplasmi loalization of in apoptoti ells (Figure 3). This evidently indiates that restoration of the RanGTP gradient reinstates the export of into the ytoplasm of HeLa ells undergoing apoptosis. Uiquitinated are retained in the nuleus pending proteolysis when nulear export fails during early apoptosis. To verify that the export deregulated was post-translationally degraded in the nuleus, CHX was used to lok protein synthesis. As shown in Figure 4a, treatment of CHX in the asene or presene of VP16 exhiited a steady deline in endogenous level for oth the nulear and also the ytoplasmi frations. As the mrna transripts are relatively unaffeted y VP16 as previously shown (Figure 1), this data indiated that existing was atively eing degraded when the protein translation proess was inhiited. Treatment of proteosome inhiitor MG132 restored oth the VP16-treated or non-treated endogenous protein level over time, partiularly in the nulear frations (Figure 4). Western lot illustrated that while level is stailized in the ytoplasmi fration, there is a marked inrease of level in the nulear fration over time. More importantly, a Mok Mst1 Mst1 59 kda Ran Atin 24 kda 17 kda 37 kda DAPI ma414 Merge ** Mst1 Mst1 Figure 3 Restoration of RanGTP gradient reinstates export. (a) Immunolotting against Mst1,, Ran and Atin was performed on lysates olleted from mok, or Mst1 -transfeted HeLa ells. () Rango FRET analysis was performed on Mst1 or -transfeted HeLa ells, with or without VP16 treatment. Quantified data presented as mean±s.d. (error ar) of three independent experiments (n ¼ 120). **Po0.001 (Student s t-test) () HeLa ells transfeted with Mst1 or efore 24 h inuation with VP16. The ells were fixed and stained with anti- and ma414. Bar, 10 mm. Images aquired with auto-optimal exposure mode

5 Nulear redistriution of promotes apoptosis 5 a Cytoplasmi Fration Nulear Fration +CHX hrs (17kDa) Fold Change Tuulin (50kDa) GCN5 (95kDa) Cytoplasmi Fration Nulear Fration +CHX hrs (17kDa) Fold Change Tuulin (50kDa) GCN5 (95kDa) kda Input IP :My IP :My Cytoplasmi Fration Nulear Fration +MG hrs (17kDa) Fold Change Tuulin (50kDa) GCN5 (95kDa) Cytoplasmi Fration Nulear Fration +MG hrs (17kDa) Fold Change Tuulin (50kDa) GCN5 (95kDa) WB: WB: Uiquitin -My (~19kDa) Figure 4 Uiquitinated is sequestered and degraded in the nuleus upon apoptosis indution. (a) Nulearytoplasmi frations were olleted from CHX-treated ells at the indiated time points. The experiment was repeated on HeLa ells inuated with CHX and VP16 simultaneously. The samples were immunolotted against, tuulin and GCN5. () Experiment was repeated as in (a) with the exeption that CHX is replaed y MG132. () -WT-My was overexpressed and immunopreipitated with anti-my antiody from HeLa ells inuated with or without VP16 for 24 h. The immunopreipitated materials were immunolotted against and uiquitin Uiquitinated -My exposure to MG132 demonstrated a greater restoration of nulear in samples treated with VP16. This suggest that apoptosis aelerates the depletion of prosurvival fator in the nuleus. The ollapse in RanGTP gradient and hene the failed ative transport system during the progression of apoptosis ould not fully explain the redistriution of into the nuleus. Even as the ative transport proesses eases, (16.5 kda) an readily diffuse aross the nulear memrane until equilirium is reahed etween the ytoplasm and the nuleus. However, is predominantly ompartmentalized within the nuleus during apoptosis (Figure 2a and Supplementary Figure S2a). This indiates that is eing sequestered in the nuleus after the export system shuts down. Upon further inspetion, the staility assay suggested that uiquitinated in the nuleus ould lead to possile inrease in sizes due to multiple onjugations of uiquitin moleules. NPCs funtion as seletivity filters that allow moleules o40 kda to traverse aross the nulear envelope. We reasoned that after the nulear transport mahinery fails during apoptosis, uiquitinated moleules in the nuleus are prevented from diffusing out due to their inreased effetive moleular weight 440 kda. Western lot showed that apoptoti samples o-immunopreipitated greater aundane of uiquitinated proteins at various moleular weights aove 40 kda (Figure 4). Thus, apoptoti reloation of into the nuleus resulted in multiple uiquitination of that inreases its moleular weight up to B100 kda, therey preventing diffusion aross the NPC after nulear export is impeded. annot prevent apoptosis when ompartmentalized in the nuleus. During the early stages of apoptosis, reloates from the ytoplasm into the nuleus due the ollapse of RanGTP gradient, whereas oth the ProCaspase-3 and ativated leaved Caspase-3 remains in the ytoplasm (Figure 5a and ). We reasoned that the apoptoti aumulation of in the nuleus prevents it from interating with its target proteins in the ytoplasm. As suh, the ytoprotetivity of is ompromised even efore it is degraded. To study the impat of nulear aumulation on apoptosis, we performed the Caspase-3 ativity assay using the leavage of Caspase-3 sustrate (A-DEVD-AMC) as fluorogeni reporter. Instead of using total lysates to proe for Caspase-3 ativity, the ytoplasmi frations were used in line with prevalene of Caspase-3 in the ytoplasm after apoptosis indution onsistent with various reports that demonstrated that Caspase-3 only enters the nuleus during late apoptosis when the nulear envelope reaks down. As redistriutes into the nuleus during apoptosis, parallel experiments were set up involving a portion of the nulear fration eing added ak to the orresponding ytoplasmi fration efore Caspase-3

6 6 Nulear redistriution of promotes apoptosis a Tuulin GCN (16.5 kda) (50 kda) (95 kda) e Cytoplasmi Nulear f d DAPI ma414 Merge Figure 5 Apoptoti nulear ompartmentalized has aolished ytoprotetivity. (a) Nulearytoplasmi frations olleted from VP16-treated ells at the indiated time points. The samples were immunolotted against, tuulin and GCN5. () Proaspase-3 and leaved Caspase-3 are predominantly ytoplasmi in VP16-treated ells indiating early apoptosis. () depletion from HeLa ells y 24 h RNAi transfetion and immunolotted against and Atin. (d) HeLa ells were transfeted with or efore inuation with VP16 for 24 h. Cells were fixed and stained with anti- and ma414. Bar, 10 mm. (e) Caspase-3 ativity assay. Eah experiment was performed in tripliates in three independent experiments. Data presented as mean±s.d. (error ar). *Po0.001 (Student s t-test). (f) Hypothetial model depiting the role of nulear export system in regulating the ommitment of ells during the onset of apoptosis ativity readout was taken. As shown in Figure 5e, the addition of -ontaining nulear frations ak its orresponding ytoplasmi frations yielded signifiantly lower Caspase-3 ativity. To verify that the Caspase-3 inhiitory effet was due to the presene of in the nulear fration, the assay was performed on HeLa ells transfeted with. Treatment of ahieved B90% knokdown effiieny of the protein level (Figure 5 and d). The assay revealed that nulear frations depleted of had little effet on VP16-indued Caspase-3 ativity (Figure 5e). In other words, the knokdown of aolishes the suppresive effet of the supplemented nulear fration on ytoplasmi Caspase-3 ativity, thus ertifying that the onfinement of in the nuleus redues its ytoprotetivity. This data orroorated other reports that had demonstrated a link etween ell death and the nulear enforement of y NES-mutation experiments or the expression of nulear loalization signal fusion proteins. 19,21,26 In addition, transfetion of HeLa ells with GST--green fluoresent protein (GFP) showed that the mutant is retained in the ytoplasm due to its inreased size from passing through the NPC and redues the perentage of apoptoti ells in the presene of apoptoti stimuli (Supplementary Figure S5). In summary, the antiapoptoti ativity of is arogated when it is ompartmentalized in the nuleus during the progression of apoptosis. Disussion Apoptosis is a proess wherey ells have an ative role leading to their own demise (ell suiide). The survival fators funtion y upregulating the expression and/or ativity of antiapoptoti regulatory moleules and maintain the dormany of apoptoti exeutors. Upsetting this alane will trigger the ells to initiate the exeution of apoptosis. Hene, it is tempting to speulate on the role of the ell, partiularly pertaining to the fate of existing prosurvival fators and the moleular events that leads to its susequent ell death. In this study, we have reported a novel regulatory pathway mediating the ative removal of prevailing prosurvival protein

7 Nulear redistriution of promotes apoptosis 7 during the onset of apoptosis y the impairment of nulear export mahinery. is an important ifuntional protein integral as a omponent of the hromosome passenger omplex and also partiipates in the negative regulation of apoptoti events. We have disovered that the prosurvival protein is atively eing removed y the uiquitin proteasome proteolyti pathway upon the exposure to apoptoti stimuli. Moreover, redistriutes from the ytoplasm to the nuleus during the progression of apoptosis. ma414 staining indiates the preservation of the nulear envelope integrity throughout the duration of the experiment, thus implying that the funtion of the nulear memrane as a seletive physial arrier is not ompromised. For a ell under genotoxi stress, it is oneivale that the prosurvival fators will proeed and attempt to resue the ell from dying. Then again, the ell will proaly never die if the prosurvival fator ontinues to exist and funtion. Our data demonstrated that the reloation of endogenous into the nuleus of HeLa ells is a widespread phenomenon during the initial phases of apoptosis. The progressive aumulation of endogenous in the nuleus was found to e assoiated to the reakdown of the RanGTP gradient upon apoptosis indution. In addition, this apoptoti nulear reloalization of is a reurring phenomenon as oserved even in the H1299 ells (Supplementary Figure S6). As a small protein, is ale to shuttle etween nulear and ytoplasmi ompartments y passive diffusion under normal irumstanes. Nonetheless, the presene of an ative NES direts ontinuous export of into the ytoplasm y the interation with its export reeptor CRM1. Although most NES y themselves have low affinity for the inding of CRM1, 27 the involvement of RanGTP in the formation of the trimeri export omplex is neessary for effiient argo export. Further investigations revealed the redistriution of endogenous in the nuleus is a onsequene of deregulation along the RanGTP CRM1 axis. The interation etween and CRM1 was found to e signifiantly weaker during early apoptosis. This preisely fits the model of ooperative inding etween CRM1, RanGTP and the NES-argo as the asis of the funtional trimeri export omplex assemly. 28,29 The dereased nulear RanGTP level interferes the trimeri RanGTP CRM1 omplex formation and thus leads to diminished export. Conversely, the restoration of RanGTP gradient y Mst1 knokdown reinstated the ytoplasmi loalization of endogenous in apoptoti ells. Hene, we resolved the mehanism ehind the failed nulear export system during the initial phases of apoptosis. In addition, failure to atively and rapidly transport ak into the ytoplasm helps to justify its dereasing protein level in the ourse of apoptosis. The presene of in the nuleus promotes its learane y the uiquitin proteasome proteolyti pathway. This orroorates previous findings, whih olletively reported the redued staility of in the nuleus as a result of proteasomal degradation. 19,20 More importantly, this implies that the essation of nulear export ould e the regulatory mehanism for the intentional removal of prosurvival fator for ells to ommit to apoptosis. The onjugation of uiquitin to also partially explains how is retained in the nuleus even after the nulear export proesses are impeded. The small moleular weight of should theoretially permit passive diffusion ak into the ytoplasm even as the RanGTP gradient ollapsed. We showed that apoptoti reloation of into the nuleus resulted in multiple uiquitination of that effetively inreases its moleular weight up to B100 kda, therey prevents diffusion aross the NPC. has een demonstrated y numerous studies to diretly and/or indiretly (y X-linked Inhiitor of apoptosis protein or hepatitis B virus X-interating protein) interat and thus regulate the ativities of aspases. 1 4,30 During interphase, under normal irumstanes, loalizes predominantly in the ytoplasm. Therefore, it an interat and inhiit aspases that might e ativated when the ell is under stress. However, this does not mean that aspase ativity is only onfined to the ytoplasm. Although the effetor Caspase-3 is found in apoptoti nulei, this oservation is ommonly made during the later stages of apoptosis, usually after the integrity of the nulear memrane is ompromised. In reent years, a flurry of studies has assoiated the nulear to the sensitization of viale ells to apoptoti stimuli. 9,19,21 Here, we demonstrated that endogenous had limited ytoprotetivity in the nuleus as it was prevented from reahing and interating with its protein targets (suh as the aspases) in the ytoplasm during apoptosis. As desried in the results setion (Figure 5e), the addition of -ontaining nulear frations ak its orresponding ytoplasmi frations yielded signifiantly lower Caspase-3 ativity. It appears that the antiapoptoti ativity of is arogated when it is ompartmentalized in the nuleus during the progression of apoptosis. In onlusion, we have shown here that the nulear export mahinery is impaired. More importantly, our data indiate an unpreedented nulearytoplasmi transport assoiated mehanism to regulate the removal of existing prosurvival fator for ell death to our (Figure 5f). The aolished ytoprotetivity of ouple to its degradation in the nuleus ensures ative withdrawal of positive signals during the early stages of apoptosis. This regulatory mehanism serves as a physiologial deision swith, in whih the survival alane is onsequently tilted and the unrestrited, widespread ativation of proapoptoti effetor moleules will irreversily ontriutes toward apoptosis. Materials and Methods Cell ulture and transfetion. HeLa ells were otained from Amerian Type Culture Colletion and grown in Duleo s modified Eagle s medium (Gio, Invitrogen, Carlsad, CA, USA) ontaining 10% fetal ovine serum (Hylone, Themo Sientifi, Logan, UT, USA) and 1% Peniillin/Streptomyin (Gio, Invitrogen) at 371C in a humidified inuator with 5% aron dioxide. Transfetions of Rango or Flag- into HeLa ells were arried out using Lipofetamine 2000, aording to manufaturer s instrutions (Invitrogen). Immunofluoresene mirosopy. Cells seeded onto 22 mm overslips were fixed with 4% paraformaldehyde in phosphate-uffered saline (PBS) for 10 min and permeailized with 0.5% Triton X-100 (USB, Cleveland, OH, USA) in PBS for 5 min. After washing three times with PBS, ells were loked in 4% BSA (Sigma-Aldrih, St. Louis, MO, USA) for 1 h at room temperature (RT) and then inuated with primary antiody diluted in TBST (50 mm Tris, ph7.6, 150 mm NaCl, 0.1% Tween-20) plus 4% BSA. Following washes with TBST, the ells were

8 8 Nulear redistriution of promotes apoptosis inuated with appropriate seondary antiodies and inuated at RT for 1 h in the dark. Cells were then mounted onto glass slides using ProLong gold antifade reagent ontaining 4 0,6-Diamidino-2-phenylindole (Invitrogen). Images were aquired and analyzed using an Axiovert 200 M inverted mirosope (Carl Zeiss, Standort Gottingen, Vertrie, Germany) and Axiovision 4.6 software. Unless speified, all images are aquired with fixed exposures. Reagents. For VP16 treatment, 10 mg/ml VP16 (Sigma-Aldrih) in dimethyl sulfoxide (DMSO) stok was diluted in medium to a final onentration of 20 mg/ml. MG132 and CHX (oth from Sigma-Aldrih) were diluted with uffers to a final working onentration of 2 mm and 20 mg/ml, respetively. For LMB (Sigma-Aldrih) treatment, the stok solution of 5 mg/ml in 100% ethanol was diluted with uffers to a final working onentration of 5 ng/ml. Antiodies. The antiodies used were anti- rait polylonal A (R&D Systems, Minneapolis, MN, USA); anti-atin goat polylonal A (Santa Cruz Biotehnology, Santa Cruz, CA, USA); ma414 mouse monolonal A (Covane Researh Produt, Prineton, NJ, USA); anti-ran goat polylonal A (Santa Cruz Biotehnology); anti-caspase3 rait polylonal A (Cell Signaling Tehnology, Beverly, MA, USA); anti-flag M2 mouse monolonal A (Sigma-Aldrih); anti-gcn5 rait monolonal A (Cell Signaling Tehnology); anti-my rait monolonal A (Cell Signaling); anti-my mouse monolonal A (Santa Cruz Biotehnology); anti-mst1 rait polylonal A (Cell Signaling Tehnology); anti-ran goat polylonal A (Santa Cruz Biotehnology); anti-crm1 mouse monolonal A (BD Biosienes, San Jose, CA, USA); anti-a-tuulin mouse monolonal (Sigma-Aldrih); anti-leaved DFF45 (Asp224) rait polylonal (Cell Signaling Tehnology); anti-leaved PARP (Asp214) rait polylonal (Cell Signaling Tehnology); Alex Fluor 488 goat anti-rait IgG (Invitrogen); Alex Fluor 594 goat anti-rait IgG (Invitrogen); and Alex Fluor 488 goat anti-mouse IgG (Invitrogen); horseradish peroxidase-onjugated anti-mouse IgG, anti-rait IgG and anti-goat IgG (Invitrogen). Moleular loning. To reate the mammalian expression plasmids, full-length was amplified (forward primer 5 0 -TAGGGCGGATCCAGATGGGTGCCCC GACGTTGC-3 0 and reverse primer 5 0 -TAGGGCGAATTCTCAATCCATGGCAGCC AGCTG-3 0 ) using HeLa DNA lirary as template and pfu polymerase (Invitrogen). The DNA lirary was generated y reverse transription-pcr from HeLa total RNA extrats. amplions were then suloned into the pdna3-flag vetor using BamH1 and EoR1 sites or suloned into pef6/my-his C vetor using BamH1 and EoRV restrition sites. GST--GFP ontrut was generated y suloning GST- into pegfp-n3 vetor using HindIII and EoR1 sites. Time-Lapse imaging. Cells were seeded onto 60 mm dishes and transfeted with empty vetor or GST--GFP for 2 days. The transfeted ells were then treated with or without VP16 and plaed on a heat-ontrolled stage of a Zeiss Axiovert 200 M mirosope. The temperature was maintained at 371C and CO 2 levels were maintained at 5% using a CTI 3700 ontroller (Carl Zeiss). Phase ontrast and fluoresent images were reorded (AxioCam amera and Axiovision 4.6 software, Carl Zeiss) using a 20 ojetive. FRET. La-Tek Chamered over glasses (Nun, Rohester, NY, USA) were used to seed the ells. FRET was then performed on a Zeiss LSM 510 Meta onfoal mirosope equipped with Inuator S (Peon, Erah, Germany). During the experiment, the temperature and CO 2 level was maintained at 371C and 5%, respetively, y plaing the seeded ells in Inuator S on the mirosope stage. Aeptor Photoleahing method was used for FRET analysis of Rango iosensor. 31 Rango onsists of a yan fluoresene protein (CFP) and a yellow fluoresene protein (YFP) domain flanking an importin- inding domain. In rief, the iosensor will have FRET when RanGTP is present. Five onseutive images were otained at 1% of the laser intensity in CFP and YFP hannels efore and after YFP photoleahing y repeatedly sanning the designated area at 75% laser intensity. The akground CFP flutuations during FRET were determined from the unleahed ontrol ells present in the same field. FRET effiieny was alulated as E F % ¼ (I 6 I 5 ) 100/I 6, where I 5 and I 6 represent the CFP fluoresene intensity of the fifth and sixth images immediately efore and after YFP photoleahing. At least 15 ells were analyzed for eah experimental set. Results were presented as mean perentage FRET effiienies ±S.D. Preparation of ell extrats, immunolotting and immunopreipitation. For the olletion of whole ell lysates, HeLa ells were washed with PBS and lysed y M-PER (mammalian protein extration reagent; Thermo Sientifi-Piere, Rokford, IL, USA) ontaining 10% Complete EDTA-free Protease Inhiitor Coktail (Rohe, Basel, Shweiz, Switzerland) and 0.1% phosphatase oktail inhiitors 1 and 2 (Sigma-Aldrih). Nulear ytoplasmi frations were prepared using NE-PER (nulear and ytoplasmi extration) (Thermo Sientifi) aording to manufaturer s protool. 2 sample uffer (62.5 mm Tris-HCl, ph 6.8, 2% SDS, 25% glyerol, 5% 2-meraptoethanol, 0.01% romophenol lue) was added to whole ell lysates, nulear lysates and ytoplasmi lysates efore oiling the mixture for 10 min. Equal amounts of protein were resolved on SDS polyarylamide gel (PAGE) and transferred onto nitroellulose memranes (Bio-Rad Laoratories, Herules, CA, USA). Memranes were loked with 10% skim milk in TBST for 2 h at RT and proed with speifi primary antiodies diluted in loking solution at 41C overnight. Memranes were washed thrie with TBST efore inuating with horseradish peroxidase-onjugated seondary IgG antiodies (Invitrogen). After washing with TBST, immunoreative proteins were deteted y enhaned hemiluminesene (GE Healthare-BioSienes, Pisataway, NJ, USA). For immunopreipitation, HeLa ells staly transfeted with Flag- or - Wt-My and HA-U were inuated with or without VP16 for 24 h. These ells were then lysed with M-PER and the ell lysates were inuated with the relevant antiody for 1 h at room temperature. Re-Protein-G-Sepharose 4B (Invitrogen) were added to eah experimental set. The resultant mixtures were further inuated for 1 h at room temperature efore repeated washing with Wash uffer (TBS with 100 mm NaCl) to rid unound proteins. Immunopreipitated proteins were separated y SDS PAGE efore western lotting analyses. RNAi-mediated silening of Mst1 and. Stealth selet RNAi for Mst1 and (oth from Invitrogen) were used to deplete Mst1 and protein level, respetively, in HeLa ells. Mst1 silening was arried out using 10 nm of the oligo (AAUGAUAUCAGAUACAGAACCAGCC). depletion on the other hand was performed using 10 nm of the oligo (HSS141245). RNAi negative ontrol duplexes (Invitrogen) served as negative ontrol in eah experimental set. The indiated RNAi were introdued into the ells y transfetion using Lipofetamine RNAiMAX (Invitrogen). The transfeted ells were then harvested 24 h later and resuspended in 2 SDS sample uffer and oiled. Depletion was assessed y immunolotting with the relevant antiodies. Semiquantitative reverse transription-pcr. Total RNA was extrated from HeLa ells using the RNeasy kit (QIAGEN In., Valenia, CA, USA) aording to the manufaturer protool. Total RNA from non-treated and treated samples aording to the time indiated were used for the preparation of first-strand DNA y reverse transription using the MMLV-ased reverse transriptase (Stratagene, La Jolla, CA, USA). Human mrna was amplified using the forward primer 5 0 -TAGGGCGAATTCATGGGTGCCCCGGAC GTTGC-3 0 and the reverse primer 5 0 -TAGGGCGGATCCTCAATCCATGGCAGC CAGCTG-3 0 (orresponding to full-length sequene). GAPDH was also amplified as an internal ontrol. The PCR yling onditions were set to 25 rounds to prevent amplifiation eyond the exponential phase. Reation produts were analyzed on 1.0% agarose gels ontaining ethidium romide. staility assay. MG132 (Sigma-Aldrih) was used to aumulate a pool of endogenous proteins from HeLa ells treated with or without VP16. The ells were then washed three times with PBS to lift the proteasome inhiitory effets of MG132. After MG132 washoff, the produtions of new proteins were terminated y the addition of CHX (Sigma-Aldrih). SDS PAGE and western lot were performed against for analysis and quantifiation at eah indiated time points after MG132 release. Caspase-3 ativity assay and analyses. Nulearytoplasmi frations were prepared as desried aove from HeLa ells transfeted RNAi, RNAi or mok transfeted, with or without VP16 treatment. Lysates were snap-frozen and stored at 801C. Ninety-six-well mirotiter plates (Nun) were used for this assay together with the aspase-3 sustrate, fluorogeni tetrapeptide A-DEVD-AMC (Sigma-Aldrih). A quantity of 5 ng of the sustrate was inuated at 371C for 3 h in 200 ml of reation uffer (20 mm HEPES, ph 7.4, with 2 mm EDTA, 0.1% CHAPS and 5 mm DTT) and 10 ml of ytoplasmi extrats with or without 5 ml of the orresponding nulear extrats. Spetrofluorometer measured fluoresene produed y sustrate leavage with exitation and emission wavelength set at 355 and 460 nm, respetively. For eah experimental set-up, results were expressed as the mean relative perentage of aspase-3 ativity etween samples

9 Nulear redistriution of promotes apoptosis 9 ontaining only the ytoplasmi extrats and samples ontaining oth ytoplasmi and nulear extrats. For etter and more aurate omparison, the read-outs otained from ytoplasmi extrat only samples were set as the asolute value (100%), suh that the read-outs from the orresponding samples ontaining oth the ytoplasmi and nulear extrats an e normalized aordingly. Conflit of interest The authors delare no onflit of interest. Aknowledgements. We thank Dr Y Zheng for -My onstrut. This work was supported y A-STAR Biomedial Researh Counil (BMRC) Grant, Singapore (08/1/22/19/568). 1. Koayashi K, Hatano M, Otaki M, Ogasawara T, Tokuhisa T. Expression of a murine homologue of the inhiitor of apoptosis protein is related to ell proliferation. Pro Natl Aad Si USA 1999; 96: Marusawa H, Matsuzawa S, Welsh K, Zou H, Armstrong R, Tamm I et al. HBXIP funtions as a ofator of survivin in apoptosis suppression. EMBO J 2003; 22: Shin S, Sung BJ, Cho YS, Kim HJ, Ha NC, Hwang JI et al. An anti-apoptoti protein human survivin is a diret inhiitor of aspase-3 and -7. Biohemistry 2001; 40: Tamm I, Wang Y, Sausville E, Sudiero DA, Vigna N, Oltersdorf T et al. IAP-family protein survivin inhiits aspase ativity and apoptosis indued y Fas (CD95), Bax, aspases, and antianer drugs. Caner Res 1998; 58: Wheatley SP, MNeish IA. : a protein with dual roles in mitosis and apoptosis. Int Rev Cytol 2005; 247: Ferrandina G, Legge F, Martinelli E, Ranelletti FO, Zannoni GF, Lauriola L et al. expression in ovarian aner and its orrelation with linio-pathologial, surgial and apoptosis-related parameters. Br J Caner 2005; 92: Kennedy SM, O Drisoll L, Purell R, Fitz-Simons N, MDermott EW, Hill AD et al. Prognosti importane of survivin in reast aner. Br J Caner 2003; 88: Okada E, Murai Y, Matsui K, Isizawa S, Cheng C, Masuda M et al. expression in tumor ell nulei is preditive of a favorale prognosis in gastri aner patients. Caner Lett 2001; 163: Temme A, Rodriguez JA, Hendrushk S, Gunes S, Weigle B, Shakel K et al. Nulear loalization of renders HeLa tumor ells more sensitive to apoptosis y indution of p53 and Bax. Caner Lett 2007; 250: Tonini G, Vinenzi B, Santini D, Sarpa S, Vasaturo T, Malarino C et al. Nulear and ytoplasmi expression of survivin in 67 surgially reseted panreati aner patients. Br J Caner 2005; 92: Mita AC, Mita MM, Nawroki ST, Giles FJ. : key regulator of mitosis and apoptosis and novel target for aner therapeutis. Clin Caner Res 2008; 14: Stauer RH, Mann W, Knauer SK. Nulear and ytoplasmi survivin: moleular mehanism, prognosti, and therapeuti potential. Caner Res 2007; 67: Chakravarti A, Zhai GG, Zhang M, Malhotra R, Latham DE, Delaney MA et al. enhanes radiation resistane in primary human gliolastoma ells via aspaseindependent mehanisms. Onogene 2004; 23: Lu B, Mu Y, Cao C, Zeng F, Shneider S, Tan J et al. as a therapeuti target for radiation sensitization in lung aner. Caner Res 2004; 64: Knauer SK, Mann W, Stauer RH. s dual role: an export s view. Cell Cyle 2007; 6: Rodriguez JA, Span SW, Ferreira CG, Kruyt FA, Giaone G. CRM1-mediated nulear export determines the ytoplasmi loalization of the antiapoptoti protein. Exp Cell Res 2002; 275: Stauer RH, Raenhorst U, Rekik A, Engels K, Bier C, Knauer SK. Nuleoytoplasmi shuttling and the iologial ativity of mouse survivin are regulated y an ative nulear export signal. Traffi 2006; 7: Knauer SK, Kramer OH, Knosel T, Engels K, Rodel F, Kovas AF et al. Nulear export is essential for the tumor-promoting ativity of survivin. FASEB J 2007; 21: Connell CM, Colnaghi R, Wheatley SP. Nulear survivin has redued staility and is not ytoprotetive. J Biol Chem 2008; 283: Zhao J, Tenev T, Martins LM, Downward J, Lemoine NR. The uiquitin-proteasome pathway regulates survivin degradation in a ell yle-dependent manner. J Cell Si 2000; 113 (Part 23): Colnaghi R, Connell CM, Barrett RM, Wheatley SP. Separating the anti-apoptoti and mitoti roles of survivin. J Biol Chem 2006; 281: Kihlmark M, Imreh G, Hallerg E. Sequential degradation of proteins from the nulear envelope during apoptosis. J Cell Si 2001; 114 (Part 20): Walther TC, Fornerod M, Pikersgill H, Golderg M, Allen TD, Mattaj IW. The nuleoporin Nup153 is required for nulear pore asket formation, nulear pore omplex anhoring and import of a suset of nulear proteins. EMBO J 2001; 20: Mosammaparast N, Pemerton LF. Karyopherins: from nulear-transport mediators to nulear-funtion regulators. Trends Cell Biol 2004; 14: WongCH, Chan H, Ho CY, LaiSK, Chan KS, KohCGet al. Apoptoti histone modifiation inhiits nulear transport y regulating RCC1. Nat Cell Biol 2009; 11: Li F, Yang J, Ramnath N, Javle MM, Tan D. Nulear or ytoplasmi expression of survivin: what is the signifiane? Int J Caner 2005; 114: Kutay U, Guttinger S. Leuine-rih nulear-export signals: orn to e weak. Trends Cell Biol 2005; 15: Hutten S, Kehlenah RH. CRM1-mediated nulear export: to the pore and eyond. Trends Cell Biol 2007; 17: Petosa C, Shoehn G, Askjaer P, Bauer U, Moulin M, Steuerwald U et al. Arhiteture of CRM1/Exportin1 suggests how ooperativity is ahieved during formation of a nulear export omplex. Mol Cell 2004; 16: Dohi T, Okada K, Xia F, Wilford CE, Samuel T, Welsh K et al. An IAP-IAP omplex inhiits apoptosis. J Biol Chem 2004; 279: Li HY, Zheng Y. Phosphorylation of RCC1 in mitosis is essential for produing a high RanGTP onentration on hromosomes and for spindle assemly in mammalian ells. Genes Dev 2004; 18: is an open-aess journal pulished y Nature Pulishing Group. This work is liensed under the Creative Commons Attriution-Nonommerial-No Derivative Works 3.0 Unported Liense. To view a opy of this liense, visit Supplementary Information aompanies the paper on wesite (