SUPPLEMENTARY INFORMATION
|
|
|
- Alexandrina Foster
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION INTEGRATIVE mirna AND GENE EXPRESSION PROFILING ANALYSIS OF HUMAN QUIESCENT HEPATIC STELLATE CELLS Mar Coll 1*, Adil El Taghdouini 2*, Luis Perea 1, Inge Mannaerts 2, Maria Vila-Casadesús 3, Delia Blaya 1, Daniel Rodrigo-Torres 1, Silvia Affò 1, Oriol Morales-Ibanez 1, Isabel Graupera, Juan José Lozano 3, Mustapha Najimi 4, Etienne Sokal 4, Joeri Lambrecht 2, Pere Ginès 1,3,5, Leo A. van Grunsven 2* and Pau Sancho-Bru 1,3*. *equal contribution 1 Institut d Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain. 2 Liver Cell Biology Lab, Faculty of Medicine and Pharmacy, Vrije Universiteit Brussel (VUB), Brussels, Belgium. 3 Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Barcelona, Spain. 4 Laboratory of Pediatric Hepatology and Cell Therapy, Institute of Experimental & Clinical Research, Université Catholique de Louvain, Brussels, Belgium. 5 Liver Unit, Hospital Clínic, Faculty of Medicine, University of Barcelona, Barcelona, Spain.
2 Supplementary Table 1.Clinical characteristics of cadaveric liver donors liver ID isolated cells age gender ischemia time Cause of brain death L4 qhsc and LSEC 12 years female 16h30 Drowned L8 qhsc and LSEC 1 days male 4h40 L10 qhsc and LSEC 7 months female 5h20 L11 qhsc and LSEC 7 days male 4h25 Sudden death of unknown cause Sudden death of unknown cause Sudden death of unknown cause F3 Hepatocytes 17 years male 9h Trauma F23 Hepatocytes 16 years female <10h Trauma
3 Supplementary Table 2.Characteristics of patients with cirrhosis and alcoholic hepatitis Validation Cohort (n=15) Characteristics Median (25-75 IQR) Age (y) 54 (49-60) Male n (%) 87 Alcohol intake (g/day) 100 (90-200) Laboratory and hemodynamic parameters Hemoglobin (g/dl) 11.8 ( ) Leukocyte count x10 9 /L 7.64 (4.3-11) Platelet count x10 9 /L 124 (84-208) AST ( U/L) 127 ( ) ALT (U/L) 58 (14-67) Serum albumin (g/dl) 29 ( ) Serum creatinine (mg/dl) 0.9 ( ) Serum bilirubin (mg/dl) 10 ( ) International normalized ratio 1.4 ( ) HVPG (mmhg) 17 (10-22) Alcoholic hepatitis severity MELD score 21 (11-24) ABIC score 7.9 ( ) Maddrey score 68.3 ( ) IQR, interquartile range; AST, aspartate aminotransferase level; ALT, alanine aminotransferase level; HVPG, hepatic venous pressure gradient; MELD, model for end-stage liver disease; ABIC, age-bilirubin-inr-creatinine score.
4 Supplementary Table 3.List of primers used for gene expression analysis Gene Name Forward sequence Reverse sequence GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC ALBUMIN TGGCACAATGAAGTGGGTAA CTGAGCAAAGGCAATCAACA PDGFRβ CCCTTATCATCCTCATCATGC CCTTCCATCGGATCTCGTAA CD32b AGTGCCCAGCATGGGCAGC TGTCTCTTTCTGATGGCAAT F4/80 GCCAGTTTGCACAGTTATAGTGA GACTTCGGCATTAACACTGGA ACTA2 CTGTTCCAGCCATCCTTCAT TCATGATGCTGTTGTAGGTGG COL1A1 GACACAGAGGTTTCAGTGG CACCCTTAGCACCAACAG LOX CACAGTTGTCATCAACATTACC CTGACCTTTAGGATATAGTTTCCAG SPARCL1 GGATTCAACTTCAATTTTTCTGC AGAAGGTTGGTTGGATTACTTGA ATP1B2 GAGGACGCACCAGTTTATGG AACATGGCGGTGAGGAAC BTG2 AGCGAGCAGAGGCTTAAGGT CGGTAGGACACCTCATAGGG SPRY1 GTGTGTTGGAAATCCACG GT AAAGAAGGCTGCTGGATCAC PLAU TCACCACAACGACATTGCCTT TGATCTCACAGCTTGTGCCAAA COL5A1 CACAACTTGCCTGATGGAATAACA GCAGGGTACAGCTGCTTGGT mirna primer sequence hsa-mir-192 CTGACCTATGAATTGACAGCC mmu-mir-192 CTGACCTATGAATTGACAGCC hsa-mir-139-5p TCTACAGTGCACGTGTCTCCAGT hsa-mir-139-3p TGGAGACGCGGCCCTGTTGGAGT hsa-mir-485-5p hsa-mir-142-3p AAGACGGGAGGAAAGAAGGGAG TGTAGTGTTTCCTACTTTATGGA hsa-mir-375 TTTGTTCGTTCGGCTCGCGTGA hsa-mir-100 AACCCGTAGATCCGAACTTGTG hsa-mir-125b-1* ACGGGTTAGGCTCTTGGGAGCT hsa-mir-132 TAACAGTCTACAGCCATGGTCG hsa-mir-21 UAGCUUAUCAGACUGAUGUUGA
5 Supplementary Table 4.Up-regulated mirnas in human culture-activated compared to quiescent HSCs. mirna FC (Q vs. A) P value Target genes mir , CPNE5, BTG2, SPARCL1, PPAP2A, ABCG2 mir-99a 74, CPNE5, BTG2 mir-130b 11,38 6, ITGB4, ENTPD1 mir-625 7,93 0,0003 C7 mir-29a 68,21 0,0003 none mir ,30 0,0003 none mir-28 6,39 0,0003 none mir-365 8,56 0,0005 ST8SIA6, NR4A2, RASD1 mir-576-3p 15,96 0,0006 none mir-106b 6,52 0,0006 ST8SIA6 mir ,64 0,0006 TESC, ENTPD1 mir-22 30,56 0,0006 C7 mir-19b 4,58 0,0006 ITM2A mir ,59 0,0007 none mir-125b 22,62 0,0007 none mir-24 9,89 0,0007 none mir-222* 134,47 0,0008 COL9A3 mir ,83 0,0009 none mir-374 7,52 0,0009 none mir-517b 47,23 0,0010 LTBP4 mir-10b 10,13 0,0010 TESC, ITM2A mir-34a* 42,93 0,0010 CCL19, SPP1 mir-27b 26,92 0,0011 SPARCL1 mir-130a 10,49 0,0011 none mir-376a 28,77 0,0011 PPAP2A mir-27a 34,84 0,0012 CCL19, SPARCL1 mir-589 9,28 0,0012 none mir-193a-3p 237,84 0,0013 none mir ,97 0,0014 COL9A3 mir-34c 15,94 0,0014 none
6 Supplementary Table 5.Differentially expressed genes found targeted by a high number of deregulated mirnas mrnas FC.mRNA (Q vs. A) mirnas ENTPD1 5,62 mir-130b, mir-143, mir-23a, mir-27b*, mir-335*, mir-337-5p, mir-539, mir-654-3p, mir-708, mir-758 SPARCL1 55,47 mir-100, mir-140-3p, mir-152, mir-154*, mir-199a-3p, mir-19b-1*, mir-27a, mir-27b, mir-301b, mir-655 VCAM1 13,98 mir-132, mir-181a, mir-22*, mir-340, mir-376c, mir-424, mir-487a, mir-671-3p, mir-935 ST8SIA6 14,01 let-7i*, mir-106b, mir-184, mir-31, mir-31*, mir-365, mir-616, mir-98 MTHFD1L -9,43 mir-126*, mir-142-5p, mir-200a, mir-429, mir-522, mir-605, mir-638 PFKP -16,73 mir-139-3p, mir-139-5p, mir-142-5p, mir-372, mir-523, mir-548b-5p, mir-628-5p ACOT7-4,97 mir-139-3p, mir-200a, mir-200b, mir-302c*, mir-375, mir-429 COL9A3 4,08 let-7b*, mir-210, mir-222*, mir-31*, mir-597, mir-598 DCBLD1-4,11 mir-126, mir-139-3p, mir-302c*, mir-342-5p, mir-363, mir-885-5p ITM2A 10,63 let-7a*, let-7b*, let-7i*, mir-10b, mir-19a, mir-19b LOX -67,33 mir-126*, mir-200a, mir-200b, mir-429, mir-548b-5p, mir-628-5p PPAP2A 2,86 let-7g, mir-100, mir-181a-2*, mir-18b, mir-376a, mir-503 BTG2 23,21 mir-100, mir-18b, mir-21, mir-31, mir-99a CCL19 5,52 mir-27a, mir-339-5p, mir-345, mir-34a*, mir-671-3p DOCK7-8,94 mir-126*, mir-135a, mir-142-5p, mir-223, mir-522 FAP -26,34 mir-126, mir-135a, mir-200a, mir-375, mir-429 SPP1 21,36 mir-130b*, mir-181a, mir-34a*, mir-376c, mir-424 TESC 4,79 mir-10a, mir-10b, mir-143, mir-339-5p, mir-532-3p WNK4-7,06 mir-135a, mir-142-3p, mir-202, mir-342-5p, mir-639
7 FIGURE LEGENDS Supplementary Figure 1: Integrative analysis pipeline: (A) Differential microrna and mrna expression analysis. Heatmaps represent the 50 most significant mirnas and mrnas together with the volcano plots of the differential expressed mirnas and mrnas. Red and black dots represent significant (FDR<0.05) and non-significant differential expressed genes/mirnas, respectively (B) Correlation and intersection with Microcosm Database. The table shows the basic statistics for correlations between mirna and target genes. Only those mirna-mrna pairs with Pearson Correlation Coefficient < 0 and FDR<0.05 were considered and used for the intersection with Microcosm Database (8.7% of all potential correlations). Among all mirna-target pairs predicted by MicroCosm (8463) only 9.16% present a negative and significant correlation and were considered for further analysis. Supplementary Figure 2: In vitro modulation of mirna expression in human HSCs (LX2). Reduction of mir-21 and mir-100 expression and up-regulation of mir- 192 in LX2 cells was achieved by transfecting mir-21 antagomir (50nM), mir-100 antagomir (50nM) or mir-192 mimic (50nM), respectively (n=2) or control mimic/inhibitor. All expressions are relative to the solvent (blank).
8 Supplementary figure 1 A. Differential expression analysis B. Correlation and intersection with Microcosm Database Number % Differentially expressed mirnas 259 Differentially expressed mrnas 1071 Number of total correlations Total negative correlations ,81 Total negative correlations, p<0, ,43 Total negative correlations, FDR<0, ,70 Total targets predicted in MicroCosm Total negative correlated targets ,44 Total negative correlated targets, p<0, ,43 Total negative correlated targets, FDR<0, ,16
9 Supplementary Figure 2 A. mir-21 inhibition mir-100 inhibition mir-21 relative expression Blank Control mir-21 inhibitor mir-100 relative expression Blank Control mir-100 inhibitor B. mir-192 over-expression mir-192 relative expression Blank CTRL MIMIC mir-192 mimic
Emricasan (IDN-6556) administered orally for 28 days lowers portal pressure in patients with compensated cirrhosis and severe portal hypertension
Emricasan (IDN-6556) administered orally for 28 days lowers portal pressure in patients with compensated cirrhosis and severe portal hypertension Guadalupe Garcia-Tsao, Michael Fuchs, Mitchell Shiffman,
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
DISCLOSURES. This activity is jointly provided by Northwest Portland Area Indian Health Board and Cardea
DISCLOSURES This activity is jointly provided by Northwest Portland Area Indian Health Board and Cardea Cardea Services is approved as a provider of continuing nursing education by Montana Nurses Association,
ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2012;10:65 71 ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT Acute Kidney Injury Is an Early Predictor of Mortality for Patients With Alcoholic Hepatitis
Supplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Hepatitis C Virus and Liver Transplantation
Hepatitis C Virus and Liver Transplantation Marina Berenguer Editor Hepatitis C Virus and Liver Transplantation 2123 Editor Marina Berenguer, MD Department of Hepatology and Liver Transplantation La Fe
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
Forward-looking Statements
Forward-looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained in this presentation, including statements regarding
Cirrhosis and Portal Hypertension Gastroenterology Teaching Project American Gastroenterological Association
CIRRHOSIS AND PORTAL HYPERTENSION Cirrhosis and Portal Hypertension Gastroenterology Teaching Project American Gastroenterological Association WHAT IS CIRRHOSIS? What is Cirrhosis? DEFINITION OF CIRRHOSIS
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
NIH Public Access Author Manuscript Gastroenterology. Author manuscript; available in PMC 2015 May 01.
NIH Public Access Author Manuscript Published in final edited form as: Gastroenterology. 2014 May ; 146(5): 1231 1239.e6. doi:10.1053/j.gastro.2014.01.018. A Histologic Scoring System for Prognosis of
Hepatitis C Virus and Liver Transplantation
Hepatitis C Virus and Liver Transplantation Marina Berenguer Editor Hepatitis C Virus and Liver Transplantation 2123 Editor Marina Berenguer, MD Department of Hepatology and Liver Transplantation La Fe
Approved regimens for cirrhotic patients
5th Workshop on HCV THERAPY ADVANCES New antivirals in clinical practice Approved regimens for cirrhotic patients Amsterdam, 4-5 december 2015 Disease burden in Spain 400000 350000 300000 F0 Peak cirrhosis
Renalase: A Novel Inflamatory Marker Post Living Donor Liver Transplantation
Med. J. Cairo Univ., Vol. 86, No. 5, September: 2741-2745, 2018 www.medicaljournalofcairouniversity.net Renalase: A Novel Inflamatory Marker Post Living Donor Liver Transplantation AHMED M. ABDUL GHANI,
Primary biliary cirrhosis (PBC) is a progressive cholestatic
AUTOIMMUNE, CHOLESTATIC AND BILIARY DISEASE Incidence, Risk Factors, and Survival of Hepatocellular Carcinoma in Primary Biliary Cirrhosis: Comparative Analysis from Two Centers Anna Cavazza, 1 Llorenç
MS/MS analysis of plasma from AD patients and healthy volunteers (n=8 healthy volunteers
Figure S. PGFα, - and -HETE are elevated in of patients with Acute Decompensation (AD) when compared with healthy volunteers. (a-g) Lipidomic LC/ESI- MS/MS analysis of from AD patients and healthy volunteers
Glecaprevir-Pibrentasvir in Cirrhotic Genotype 1, 2, 4, 5, and 6 EXPEDITION-1
Phase 3 Treatment-Naïve and Treatment-Experienced Glecaprevir-Pibrentasvir in Cirrhotic Genotype 1, 2, 4, 5, and 6 EXPEDITION-1 EXPEDITION-1: Study Features EXPEDITION-1 Trial Design: Open-label, single-arm,
Liver transplantation: Hepatocellular carcinoma
Liver transplantation: Hepatocellular carcinoma Alejandro Forner BCLC Group. Liver Unit. Hospital Clínic. University of Barcelona 18 de marzo 2015 3r Curso Práctico de Transplante de Órganos Sólidos Barcelona
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
Incidence, Prevalence, and Clinical Significance of Abnormal Hematologic Indices in Compensated Cirrhosis
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2009;xx:xxx 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
SOLAR-1 (Cohorts A and B)
Phase 2 Treatment Naïve and Treatment Experienced Ledipasvir-Sofosbuvir + RBV in HCV GT 1,4 and Advanced Liver Disease SOLAR-1 (Cohorts A and B) Charlton M, al. Gastroenterology. 2015; [Epub ahead of print]
microrna PCR System (Exiqon), following the manufacturer s instructions. In brief, 10ng of
SUPPLEMENTAL MATERIALS AND METHODS Quantitative RT-PCR Quantitative RT-PCR analysis was performed using the Universal mircury LNA TM microrna PCR System (Exiqon), following the manufacturer s instructions.
Accepted Manuscript. Letter to the Editor. Reply to: A cut-off serum creatinine value of 1.5 mg/dl for AKI - To be or not to be
Accepted Manuscript Letter to the Editor Reply to: A cut-off serum creatinine value of 1.5 mg/dl for AKI - To be or not to be Claudia Fagundes, Rogelio Barreto, Ezequiel Rodríguez, Isabel Graupera, Esteban
A Day-4 Lille Model Predicts Response to Corticosteroids and Mortality in Severe Alcoholic Hepatitis
306 ORIGINAL CONTRIBUTIONS see related editorial on page x A Day-4 Lille Model Predicts Response to Corticosteroids and Mortality in Severe Alcoholic Hepatitis Mauricio Garcia-Saenz-de-Sicilia, MD 1, 9,
SITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
Supplementary Material
Supplementary Material Identification of mir-187 and mir-182 as biomarkers for early diagnosis and prognosis in prostate cancer patients treated with radical prostatectomy Irene Casanova-Salas 1, José
Hepatitis C: How sick can we treat? Robert S. Brown, Jr., MD, MPH Vice Chair, Transitions of Care Interim Chief, Division of
Hepatitis C: How sick can we treat? Robert S. Brown, Jr., MD, MPH Vice Chair, Transitions of Care Interim Chief, Division of Gastroenterology & Hepatology www.livermd.org HCV in advanced disease In principle
SOLAR-1 (Cohorts A and B)
Phase 2 Treatment Naïve and Treatment Experienced Ledipasvir-Sofosbuvir + RBV in HCV GT 1,4 and Advanced Liver Disease SOLAR-1 (Cohorts A and B) Charlton M, al. Gastroenterology. 2015; 149:649-59. Ledipasvir-Sofosbuvir
Serum YKL-40 as a marker of liver fibrosis in patients with non-alcoholic fatty
Supplementary Information Serum YKL- as a marker of liver fibrosis in patients with non-alcoholic fatty liver disease Erina Kumagai 1,,#, Yohei Mano 1,#, Sachiyo Yoshio 1, Hirotaka Shoji 1, Masaya Sugiyama
T he model for end-stage liver disease (MELD) score is the
1283 LIVER DISEASE MELD score and serum sodium in the prediction of survival of patients with cirrhosis awaiting liver transplantation Maria-Carlota Londoño, Andrés Cárdenas, Mónica Guevara, Llorenç Quintó,
Who to Treat? Consider biopsy Treat. > 2 ULN Treat Treat Treat Treat CIRRHOTIC PATIENTS Compensated Treat HBV DNA detectable treat
Who to Treat? Parameter AASLD US Algorithm EASL APASL HBV DNA CRITERIA HBeAg+ >, IU/mL > 2, IU/mL > 2, IU/mL >, IU/mL HBeAg- > 2, IU/mL > 2, IU/mL > 2, IU/mL > 2, IU/mL ALT CRITERIA PNALT 1-2 ULN Monitor
Mechanisms of Portal Hypertension: Bench to Bedside
REVIEW Mechanisms of Portal Hypertension: Bench to Bedside Jordi Gracia-Sancho, Ph.D.,* and Wim Laleman, M.D., Ph.D. PATHOPHYSIOLOGY OF PORTAL HYPERTENSION Portal hypertension (PH) is the most frequent
ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2009;7:689 695 ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT Incidence, Prevalence, and Clinical Significance of Abnormal Hematologic Indices in Compensated
Hepatology for the Nonhepatologist
Hepatology for the Nonhepatologist Kenneth E. Sherman, MD, PhD Gould Professor of Medicine Director, Division of Digestive Diseases University of Cincinnati College of Medicine Cincinnati, Ohio Learning
Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
Intron A Hepatitis C. Intron A (interferon alfa-2b) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.05 Subject: Intron A Hepatitis C Page: 1 of 5 Last Review Date: November 30, 2018 Intron A Hepatitis
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Patients must have met all of the following inclusion criteria to be eligible for participation in this study.
Supplementary Appendix S1: Detailed inclusion/exclusion criteria Patients must have met all of the following inclusion criteria to be eligible for participation in this study. Inclusion Criteria 1) Willing
The Artificial Intelligence Clinician learns optimal treatment strategies for sepsis in intensive care
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41591-018-0213-5 In the format provided by the authors and unedited. The Artificial Intelligence Clinician learns optimal treatment strategies
EDUCATION PRACTICE. Management of Refractory Ascites. Clinical Scenario. The Problem
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2005;3:1187 1191 EDUCATION PRACTICE Management of Refractory Ascites ANDRÉS CÁRDENAS and PERE GINÈS Liver Unit, Institute of Digestive Diseases, Hospital Clínic,
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Epidemiology, causes, evolution and outcome in a single center cohort of 1116 critically ill patients with hypoxic hepatitis
https://doi.org/10.1186/s13613-018-0356-z RESEARCH Open Access Epidemiology, causes, evolution and outcome in a single center cohort of 1116 critically ill patients with hypoxic hepatitis Astrid Van den
Contraindications. Indications. Complications. Currently TIPS is considered second or third line therapy for:
Contraindications Absolute Relative Primary prevention variceal bleeding HCC if centrally located Active congestive heart failure Obstruction all hepatic veins Thomas D. Boyer, M.D. University of Arizona
Complications of portal hypertension (PH) are
LIVER FAILURE/CIRRHOSIS/PORTAL HYPERTENSION The Prognostic Value of Hepatic Venous Pressure Gradient in Patients With Cirrhosis Is Highly Dependent on the Accuracy of the Technique Gilberto Silva-Junior,
Prognostic Importance of the Cause of Renal Failure in Patients With Cirrhosis
GASTROENTEROLOGY 2011;140:488 496 Prognostic Importance of the Cause of Renal Failure in Patients With Cirrhosis MARTA MARTÍN LLAHÍ,*,, MÓNICA GUEVARA,*,, ALDO TORRE,*,, CLAUDIA FAGUNDES,*,, TEA RESTUCCIA,*,,
Cirrosis, una enfermedad vascular
VI Curso para Residentes AEEH 10 Noviembre 2017 Cirrosis, una enfermedad vascular Jordi Gracia- Sancho, PhD Liver Vascular Biology Research Group Barcelona Hepatic Hemodynamic Lab IDIBAPS jordi.gracia@idibaps.org
Ammonia level at admission predicts in-hospital mortality for patients with alcoholic hepatitis
Gastroenterology Report, 5(3), 2017, 232 236 doi: 10.1093/gastro/gow010 Advance Access Publication Date: 1 May 2016 Original article ORIGINAL ARTICLE Ammonia level at admission predicts in-hospital mortality
ACG Clinical Guideline: Evaluation of Abnormal Liver Chemistries
ACG Clinical Guideline: Evaluation of Abnormal Liver Chemistries Ashwani K. Singal, MD, MS, FACG 1, Ramon Bataller, MD, PhD, FACG 2, Joseph Ahn, MD, MS, FACG (GRADE Methodologist) 3, Patrick S. Kamath,
CIRROSI E IPERTENSIONE PORTALE NELLA DONNA
Cagliari, 16 settembre 2017 CIRROSI E IPERTENSIONE PORTALE NELLA DONNA Vincenza Calvaruso, MD, PhD Ricercatore di Gastroenterologia Gastroenterologia & Epatologia, Di.Bi.M.I.S. Università degli Studi di
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
Alcoholic Hepatitis: Management Options
Alcoholic Hepatitis: Management Options Paul J. Thuluvath, MD. FRCP Institute of Digestive Health & Liver Diseases, Mercy Medical Center, Baltimore Professor of Surgery & Medicine, Georgetown University,
Hepatitis C: Management of Previous Non-responders with First Line Protease Inhibitors
Hepatitis C: Management of Previous Non-responders with First Line Protease Inhibitors Fred Poordad, MD The Texas Liver Institute Clinical Professor of Medicine University of Texas Health Science Center
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
The Heart in Concert: Do Other Organs Matter? The Liver
The Heart in Concert: Do Other Organs Matter? The Liver Pascal de Groote CHRU Lille France DECLARATION OF CONFLICT OF INTEREST I have no conflict of interest with this presentation Impact of liver disease
Alcoholic Hepatitis: Routine Screening for Early Recognition and Management. Juan Guerrero, MD
Alcoholic Hepatitis: Routine Screening for Early Recognition and Management Juan Guerrero, MD Global Problem 1% of GNP of medium/high income countries Additional societal costs Disproportionately affects
Andrew Civitello MD, FACC
Timing the Transition from Short Term to Long Term Mechanical Circulatory Support Andrew Civitello MD, FACC Medical Director, Heart Transplant Program Director, Fellowship Co-Director, Baylor St. Luke's
Acute Liver Failure. Neil Shah, MD UNC School of Medicine High-Impact Hepatology Saturday, Dec 8 th, 2018
Acute Liver Failure Neil Shah, MD UNC School of Medicine High-Impact Hepatology Saturday, Dec 8 th, 2018 Disclosures None Outline Overview of ALF Management of ALF Diagnosis of ALF Treatments and Support
DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
DIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
Supplementary Information
Supplementary Information Metabolomics reveals trichloroacetate as a major contributor to trichloroethylene-induced metabolic alterations in mouse urine and serum Zhong-Ze Fang, Kristopher W Krausz, Naoki
Title: The Baveno VI criteria for predicting esophageal varices: validation in real life practice
Title: The Baveno VI criteria for predicting esophageal varices: validation in real life practice Authors: Mafalda Sousa, Sónia Fernandes, Luísa Proença, Ana Paula Silva, Sónia Leite, Joana Silva, Ana
Forward-looking Statements
NASDAQ:CNAT Forward-looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained in this presentation, including statements
4/30/2015. Interactive Case-Based Presentations and Audience Discussion. Debika Bhattacharya, MD, MSc. Learning Objectives
4/3/215 Interactive Case-Based Presentations and Audience Discussion Debika Bhattacharya, MD, MSc Assistant Clinical Professor University of California Los Angeles Los Angeles, California Formatted:4-27-215
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
Th17 and Th17/Treg ratio at early HIV infection associate with protective HIV-specific CD8 + T-cell responses and disease progression
Th17 and Th17/Treg ratio at early HIV infection associate with protective HIV-specific CD8 T-cell responses and disease progression Juliana Falivene 1, Yanina Ghiglione 1, Natalia Laufer 1,3, María Eugenia
Tomasz Z. Jodlowski, Pharm.D., BCPS (AQ-ID), AAHIVP Clinical Pharmacy Specialist, Infectious Diseases VA North Texas HCS
Tomasz Z. Jodlowski, Pharm.D., BCPS (AQ-ID), AAHIVP Clinical Pharmacy Specialist, Infectious Diseases VA North Texas HCS Tomasz.Jodlowski@va.gov 1) Upon completion of this presentation, learners should
Patients with Cirrhosis: Managing the HCV Peri-Transplant Patient
Patients with Cirrhosis: Managing the HCV Peri-Transplant Patient Fred Poordad, MD Professor of Medicine University of Texas Health Science Center VP, Academic and Clinical Affairs The Texas Liver Institute
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Sojan George Kunnathuparambil, Kattoor Ramakrishnan Vinayakumar, Mahesh R. Varma, Rony Thomas, Premaletha Narayanan, Srijaya Sreesh
Original article Annals of Gastroenterology (2013) 26, 1-5 Bilirubin, aspartate aminotransferase and platelet count score: a novel score for differentiating patients with chronic hepatitis B with acute
Treating now vs. post transplant
Resistance with treatment failure Treating now vs. post transplant Pros (for treating pre transplant) If SVR efficacy means Better quality of life Removal from waiting list No post transplant recurrence
Interpreting Liver Function Tests
PSH Clinical Guidelines Statement 2017 Interpreting Liver Function Tests Dr. Asad A Chaudhry Consultant Hepatologist, Chaudhry Hospital, Gujranwala, Pakistan. Liver function tests (LFTs) generally refer
Hepatocytes produce. Proteins Clotting factors Hormones. Bile Flow
R.J.Bailey MD Hepatocytes produce Proteins Clotting factors Hormones Bile Flow Trouble.. for the liver! Trouble for the Liver Liver Gall Bladder Common Alcohol Hep C Fatty Liver Cancer Drugs Viruses Uncommon
Supplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative.
Supplementary Information for: Predictors of chronic kidney disease in type 1 diabetes: a longitudinal study from the AMD Annals initiative. Authors: Pamela Piscitelli 1, Francesca Viazzi 2 ; Paola Fioretto
VIRAL HEPATITIS. Definitions. Acute Liver Disease (Hepatitis A &E, Alcoholic hepatitis, DILI and ALF) Acute Viral Hepatitis Symptoms
Acute Liver Disease (Hepatitis A &E, Alcoholic hepatitis, DILI and ALF) Definitions AST and ALT Markers of hepatocellular injury Ryan M. Ford, MD Assistant Professor of Medicine Director of Viral Hepatitis
SUPPLEMENTARY DATA. Supplementary Table S1. Clinical characteristics of the study subjects.*
Supplementary Table S1. Clinical characteristics of the study subjects.* T2D ND n (F/M) 66 (21/45) 25 (7/18) Age (years) 61.8 ± 6.9 49.4 ± 7.3 # Body weight (kg) 95 ± 16 105 ± 13 # Body mass index (kg.
Nomograms to Predict the Disease-free Survival and Overall Survival after Radiofrequency Ablation for Hepatocellular Carcinoma
doi: 10.2169/internalmedicine.9064-17 Intern Med Advance Publication http://internmed.jp ORIGINAL ARTICLE Nomograms to Predict the Disease-free Survival and Overall Survival after Radiofrequency Ablation
ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT. A Sustained Virologic Response Reduces Risk of All-Cause Mortality in Patients With Hepatitis C
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2011;9:509 516 ORIGINAL ARTICLES LIVER, PANCREAS, AND BILIARY TRACT A Sustained Virologic Response Reduces Risk of All-Cause Mortality in Patients With Hepatitis
Liver cirrhosis leads to poorer survival in patients with end-stage renal disease
ORIGINAL ARTICLE Korean J Intern Med 2016;31:730-738 Liver cirrhosis leads to poorer survival in patients with end-stage renal disease Ae Jin Kim, Hye Jin Lim, Han Ro, Ji Yong Jung, Hyun Hee Lee, Wookyung
Alcoholic liver disease (ALD) is a major cause of. Human and Experimental Evidence Supporting a Role for Osteopontin in Alcoholic Hepatitis
Human and Experimental Evidence Supporting a Role for Osteopontin in Alcoholic Hepatitis Oriol Morales-Ibanez, 1 Marlene Domınguez, 1 Sung H. Ki, 2 Miguel Marcos, 3 Javier F. Chaves, 4 Eric Nguyen-Khac,
Vascular Liver Disease
Vascular Liver Disease wwwwwwwwwwwwwwwwwww Laurie D. DeLeve Guadalupe Garcia-Tsao Editors Vascular Liver Disease Mechanisms and Management Editors Laurie D. DeLeve Division of Gastrointestinal and Liver
Phase 2 placebo-controlled withdrawal study of the ASBT inhibitor maralixibat in children with Alagille syndrome 48-week efficacy analysis
Phase 2 placebo-controlled withdrawal study of the ASBT inhibitor maralixibat in children with Alagille syndrome 48-week efficacy analysis ICONIC Study Emmanuel Gonzales, Ekkehard Sturm, Michael Stormon,
Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
ROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
SURVEYOR-II Part 2 Study Design
HIGH SVR RATES WITH + CO-ADMINISTERED FOR 8 WEEKS IN NON-CIRRHOTIC PATIENTS WITH HCV GENOTYPE 3 INFECTION A.J. Muir, S. Strasser, S. Wang, S. Shafran, M. Bonacini, P. Kwo, D. Wyles, E. Gane, S.S. Lovell,
SEQUENCING OF HCC TREATMENT. Dr. Amit G. Singal Medical Director, UT Southwestern Medical Center, USA
SEQUENCING OF HCC TREATMENT Dr. Amit G. Singal Medical Director, UT Southwestern Medical Center, USA February 2018 DISCLAIMER Please note: The views expressed within this presentation are the personal
Stick or twist management options in hepatitis C
Stick or twist management options in hepatitis C Dr. Chris Durojaiye & Dr. Matthijs Backx SpR Microbiology and Infectious Diseases University Hospital of Wales, Cardiff Patient history 63 year old female
Alanine Amino Transferase (ALT) Among Blood Donors Visiting King Abdulaziz Medical City Blood Donor Center
Alanine Amino Transferase (ALT) Among Blood Donors Visiting King Abdulaziz Medical City Blood Donor Center Salem Alshimemeri 1, Mohammed Alshareef 1, Mohammed Sambas 1, Abdulrahman Alshareef 1, Waleed
Paul Martin, MD, FACG. University of Miami. 30,000 deaths from cirrhosis per annum, alcohol implicated in 48%
Paul Martin, MD, FACG University of Miami 30,000 deaths from cirrhosis per annum, alcohol implicated in 48% Second commonest indication for liver transplant NIAA 2007 Page 1 of 26 Risk Factors Medical
Protein & Enzyme Lab (BBT 314)
Protein & Enzyme Lab (BBT 314) Experiment 3 A: Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Bioanalyzer Background: Alanine aminotransferase (glutamate pyruvate transaminase)
Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic. hepatitis B infection
Supplemental Materials Regulation of T cell proliferation by JMJD6 and PDGF-BB during chronic hepatitis B infection Cai-Feng Chen 1#, Xia Feng 2#, Hui-Yu Liao 2#, Wen-Jing Jin 1, Jian Zhang 3, Yu Wang
Circulating MicroRNAs as Biomarkers of Colorectal Cancer: Results From a Genome-Wide Profiling and Validation Study
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2013;11:681 688 Circulating MicroRNAs as Biomarkers of Colorectal Cancer: Results From a Genome-Wide Profiling and Validation Study MARÍA DOLORES GIRÁLDEZ,* JUAN
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
ALT and aspartate aminotransferase (AST) levels were measured using the α-ketoglutarate reaction (Roche,
Supplemental Methods Analytical determinations ALT and aspartate aminotransferase (AST) levels were measured using the α-ketoglutarate reaction (Roche, Basel, Switzerland). Glucose, triglyceride, total
Beta-blockers in cirrhosis: Cons
Beta-blockers in cirrhosis: Cons Eric Trépo MD, PhD Dept. of Gastroenterology. Hepatopancreatology and Digestive Oncology. C.U.B. Hôpital Erasme. Université Libre de Bruxelles. Bruxelles. Belgium Laboratory