Expressions of HIF-1α and KISS-1 in patients with liver cancer and correlation analysis

Transcription

1 European Review for Medical and Pharmacological Sciences 2017; 21: Expressions of HIF-1α and KISS-1 in patients with liver cancer and correlation analysis W.-W. SONG 1, A.-P. GUI 2, W. LI 1, H.-S. CHEN 1, J.-M. LI 1 1 Department of General Surgery, Zhongshan Hospital of Traditional Chinese Medicine, Zhongshan City, Guangdong Province, China 2 Department of Oncological Surgery, Zhongshan People s Hospital, Zhongshan City, Guangdong Province, China Weiwei Song and Anping Gui contributed equally to this work Abstract. OBJECTIVE: To study the expressions of hypoxia-inducible factor-1α (HIF-1α) and tumor metastasis suppressor gene (KISS-1) in patients with liver cancer and to analyze the correlation between HIF-1α and KISS-1 and liver cancer. PATIENTS AND METHODS: 20 normal liver tissues and 30 liver cancer tissues in our hospital were selected. The expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues were detected via immunofluorescence assay. The mr- NA expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues were detected via reverse transcription polymerase chain reaction (RT-PCR). The protein expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues were detected via Western blotting. Differences of HIF-1α and KISS-1 expressions in normal liver tissues and liver cancer tissues were analyzed using SPSS 17.0 statistical software. RESULTS: Immunofluorescence assay, RT- PCR, and Western blotting, showed that HIF-1α was highly expressed in liver cancer tissues, and its expression level was significantly higher than that in normal liver tissues. However, the expression of KISS-1 in normal liver tissues was significantly higher than that in liver cancer tissues. The results of analysis of variance showed that the differences of HIF-1α and KISS-1 expressions in normal liver tissues and liver cancer tissues were statistically significant (p<0.01). CONCLUSIONS: The abnormal expressions of HIF-1α and KISS-1 are closely related to the development and progression of liver cancer, indicating that HIF-1α and KISS-1 have important research values in liver cancer and the expressions of HIF-1α and KISS-1 can be used as the index of deterioration degree of liver cancer, providing a new clinical basis for diagnosis and treatment. Key Words: HIF-1α, KISS-1, Liver cancer. Introduction Liver cancer is one of the most common malignancies and the third leading cause of cancer mortality in the world. It is well established that the survival of patients with liver cancer is associated with the ability of cancer cells to invade surrounding tissue and vessels. So far, its pathogenesis and exact molecular mechanism are not entirely clear yet. It has been reported that liver cancer may be affected by both environmental and individual factors 1,2. Hypoxia-inducible factor-1α (HIF-1α) and tumor metastasis suppressor gene (KISS-1) are recently-discovered genes that are closely related to tumor metastasis 3,4. HIF-1α has been found to be increased in a variety of human malignancies, leading to an increased capacity for metastasis and an unfavorable prognosis 5, while KISS-1 gene has been found to be a metastasis suppressor gene in human melanoma and breast carcinoma cells without affecting tumorigenicity 6,7. However, the relationship between HIF-1α as well as KISS-1 expression and the development and progression of liver cancer, has not been well-defined. We aimed to demonstrate the expressions of HIF-1α and KISS-1 in patients with liver cancer and elucidate their relationship. Patients and Methods Tumor Tissue Collection Specimens were collected from the liver tissue paraffin blocks in Tissues were resected in the operations in our hospital, and these speci Corresponding Author: Jianming Li, MD; @qq.com

2 HIF-1α and KISS-1 value in liver cancer mens received 10% formaldehyde fixation and paraffin embedding. 30 paraffin block specimens of patients diagnosed via postoperative histopathologic examination as liver cancer receiving surgical resection in our hospital were collected, including 18 males and 12 females aged years. In addition, 20 normal liver tissue specimens provided by Liver Transplantation Center of our hospital were used as the control group, including 11 males and 9 females aged years. This study was approved by the Ethics Committee of Zhongshan Hospital of Traditional Chinese Medicine. Signed written informed consents were obtained from all participants before the study. Main Reagents Bicinchoninic acid (BCA) protein quantification kit (Beyotime, Shanghai, China); TRIzol total RNA extraction kit (Tiangen, Beijing, China); RT-PCR reverse transcription kit (Tiangen, Beijing, China); DAPI (4 6-diamidine-2-phenylindole), anti-actin (β-actin), anti-hif-1α, anti-kiss-1 monoclonal antibodies and immunofluorescence secondary antibody (Cell Signaling Technology, Danvers, MA, USA). Immunofluorescence Normal liver tissues and liver cancer tissues were fixed with 10% formaldehyde for 48 h, routinely embedded in the paraffin and finally made into 5 μm-thick sections. Paraffin sections were dewaxed via xylene, dehydrated via alcohol in gradient concentrations and repaired via antigen. Then, sections were rinsed with 0.01 M polybutylene succinate (PBS) (ph7.4) for 3 times (5 min/time), and sealed in a 10% BSA (bovine serum albumin) wet box at 37 C for 30 min. The fluorescence-labeled antibodies diluted appropriately (1:70) were dropped onto the sections, and sections were placed in a wet box overnight at 4 C. After being washed with PBS (ph7.4) for 3 times (5 min/time), the fluorescence secondary antibodies (diluted at 1:100) were dropped onto the sections in a dark place, and sections were incubated for 2 h in a wet box at 37 C. After being washed with PBS (ph7.4) for 3 times (5 min/time), sections were stained with 4,6-diamidino-2-phenylindole (DAPI) for 15 min in a dark place. Finally, sections were sealed via buffered glycerol, observed and photographed under the upright fluorescence microscope (Nikon Eclipse E 800, Tokyo, Japan). RT-PCR Analysis The appropriate number of meningioma tissues and normal brain tissues were quickly transferred to 1 ml TRIzol reagent (Thermo Scientific, Waltham, MA, USA) to make them into homogenate via full tissue grinding, and the homogenate was placed at room temperature for 5 min. After the specimen was split completely, it was centrifuged at g at 4 C for 5 min and the supernatant was carefully taken out. Chloroform was added into the supernatant, which was placed at room temperature for 5 min; next, it was centrifuged at g at 4 C for 15 min and the supernatant was carefully taken out. The same volume of isopropanol was added into the supernatant, and after it was placed at room temperature for 10 min, it was centrifuged at g at 4 C for 10 min and the precipitate was taken out. 75% ethanol was added to wash the RNA precipitate. Finally, RNas-free water was added to dissolve the precipitate completely. Then, the ratio of OD 260 /OD 280 was measured and RNA concentration was detected. Finally, the stepwise amplification was performed based on the primer sequence template shown in Table I according to the instructions and the reaction products received the RT-PCR analysis. Western Blotting Analysis The chronic pancreatitis tissues, pancreatic cancer tissues and normal pancreatic tissues were washed with ice saline. Operations were performed according to the instructions of whole protein extraction kit. Immunoprecipitation lysates (IP) including phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor were added and tissues were placed on ice for full tissue grinding. Then, the tissue homogenate was centrifuged at g at 4 C for 10 min. The supernatant was taken and centrifuged at g at 4 C for 20 min. The supernatant was taken again. The protein in supernatant was quantified according to the instructions of protein kit, and the protein specimen containing the same amount of total protein was added into each well, followed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) under 220 V constant voltage until the bromophenol blue reached the bottom of gel. Based on the molecular weight of target protein, the gel was cut and the isolated protein was transferred onto the polyvinylidene fluoride (PVDF) membrane. The protein-coated PVDF membrane was sealed with 5% skim milk powder on the shaking table at room temperature for 3 h and the primary antibody (1:1000) was 4059

3 W.-W. Song, A.-P. Gui, W. Li, H.-S. Chen, J.-M. Li Figure 1. HE staining results of normal liver tissues and liver cancer tissues ( 200). added for incubation at 4 C overnight. After the membrane was fully washed with TTBS (10 min/time, 3 times), the secondary antibody (1:2000) was added for incubation at room temperature for 1 h. After the membrane was washed with Tris-Tween-Buffer-Saline (TTBS) (10 min/time, 3 times), electrochemiluminescence (ECL) color-developing solution was dropped for color development. Statistical Analysis The experimental data were presented as mean ± standard deviation (Mean ± SD), and the experimental results received the statistical analysis using SPSS17.0 statistical software (SPSS Inc. Chicago, IL, USA). t-test was used for the comparison of means between the two groups, and Oneway ANOVA test followed by LSD (Least Significant Difference) was used for the comparison between groups. p-value was used for pairwise comparison. p<0.05 suggested that the difference was statistically significant. Results Observation of Pathological Conditions Via Hematoxylin Eosin (HE) Staining HE stained sections of normal liver tissues and liver cancer tissues were used to investigate the differences of specimens in pathology. Compared with normal liver tissues, the structure of liver cancer tissues was damaged, accompanied with fibrous connective tissue hyperplasia, severe fatty degeneration of liver cells around the central veins, different sizes of peripheral liver cells, hydropic degeneration and swelling and inflammatory cell infiltration in liver cell necrotic zone. As shown in Figure 1, normal liver tissues and liver cancer tissues were significantly different in histopathology. Detection of HIF-1α and KISS-1 Expressions in Normal Liver Tissues and Liver Cancer Tissues Via Immunofluorescence Assay As shown in Figure 2, HIF-1α was little expressed in normal pancreatic tissues, but greatly Table I. RT-PCR primer sequence of HIF-1α and KISS-1 mrna Gene name HIF-1α KISS-1 β-actin Primer sequence 5-3 GTCGGACAGCCTCACCAAACAGAGC 3-5 GTTAACTTGATCCAAAGCTCTGAG 5-3 ACCTGCCGAACTACAACTGG 3-5 TCCCTTAGCCCTACGTCCC 5-3 GAGCCGGGAAATCGTGCGT 3-5 GGAAGGAAGGCTGGAAGATG 4060

4 HIF-1α and KISS-1 value in liver cancer Figure 2. Expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues ( 200). expressed in liver cancer tissues. However, KISS- 1 was greatly expressed in normal liver tissues but little expressed in liver cancer tissues. The results revealed that HIF-1α and KISS-1 play important roles in the development and progression of liver cancer. RT-PCR Results The total RNA was extracted from the normal liver tissues and liver cancer tissues and received RT-PCR. The results showed that the expression of HIF-1α in liver cancer tissues was significantly higher than that in normal liver tissues, but the expression of KISS-1 in liver cancer tissues was significantly lower than that in normal liver tissues (Figure 3A). Protein Expressions of HIF-1α and KISS-1 in Normal Liver Tissues and Liver Cancer Tissues Results of Western blotting showed the protein expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues. As shown in Figure 3B, HIF-1α protein was highly expressed in liver cancer tissues, which was far higher than that in normal liver tissues. KISS-1 protein was highly expressed in normal liver tissues. Discussion Liver cancer is one of the most common malignant tumors in China with a very high malignancy 8. Liver cancer can be divided into the following two types: primary liver cancer and secondary liver cancer, the former of which is dominated in China, and hepatic cell carcinoma occupies the largest proportion. Liver cancer is characterized by a high morbidity and high mortality, which is a kind of malignant disease harming human health 9,10. According to data, the surgical resection is the only one effective treatment method for patients with primary liver cancer to obtain the possibility of long-term survival, but most patients with liver cancer have been in middle and advanced stage when diagnosed, significantly limiting the radical resection 11,12. It can be seen that the treatment of liver cancer is still a worldwide problem. So, searching safe and effective means of treating liver cancer is extremely urgent. Through the research 4061

5 W.-W. Song, A.-P. Gui, W. Li, H.-S. Chen, J.-M. Li Figure 3. (A) Gene expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues; compared with normal group, *p<0.05, **p<0.01 (n=3); (B): Protein expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues; compared with normal group, *p<0.05, **p<0.01 (n=3). on liver cancer in recent years, we found that searching genes closely related to liver cancer and appropriately interfering in these genes may become new ideas and directions of treatment of liver cancer. HIF-1α is a kind of key regulatory factor regulating the intracellular oxygen metabolism in the body 13. Under aerobic conditions, HIF-1α can bind to ubiquitin ligase via hydroxylation, degrading HIF-1α in the body 14. In the absence of oxygen, HIF-1α cannot be effectively hydroxylated, thus increasing its content. When the content of HIF-1α is increased, HIF-1α can be involved in the genetic transcription of a variety of malignant tumors, helping to maintain the energy metabolism of tumor cells and angiogenesis 15. Studies have shown that the inhibition of HIF-1α expression under hypoxia is a new effective way to treat tumors. In the process of rapid growth of tumor cells, the rapid proliferation of malignant tumor cells leads to intracellular hypoxia 16. HIF-1α overexpression can be found in a variety of tumors, and HIF-1α is involved in the tumor growth, infiltration and metastasis 17. KISS-1 is a kind of tumor metastasis suppressor gene that includes four exons, whose initial coding product is a hydrophilic protein with the size of 145 amino acid residues KISS-1 is expressed correspondingly in a variety of tumor tissues, and is also closely related to the tumor growth, infiltration and metastasis 21. Although there are some reports on KISS-1 in a variety of tumors, such as gastric cancer, breast cancer and kidney cancer, there are few reports on KISS-1 in liver cancer. At present, the relevant studies on KISS-1 are only at the protein expression level, but there are few studies at the gene level 22,23, especially the studies on combination of HIF-1α and KISS-1 and correlation analysis. In this study, the expressions of HIF-1α and KISS-1 in normal liver tissues and liver cancer tissues were studied to investigate the roles and significance of HIF-1α and KISS-1 in liver cancer. Conclusions We showed that HIF-1α was highly expressed in liver cancer tissues, and KISS-1 was highly expressed in normal liver tissues. Results of RT-PCR and Western blotting showed that the expressions of HIF-1α and KISS-1 in normal liver tissues had statistically significant differences compared with those in liver cancer tissues (p<0.01). This paper suggested that the study on HIF-1α and KISS-1 expressions can provide a new theoretical basis for investigating the mechanism of tumor infiltration and metastasis and provide a new direction for the diagnosis and treatment of liver cancer. Conflict of interest The authors declare no conflicts of interest. References 1) Xia XH, Xiao CJ, Shan H. Facilitation of liver cancer SMCC7721 cell aging by sirtuin 4 via inhibiting 4062

6 HIF-1α and KISS-1 value in liver cancer JAK2/STAT3 signal pathway. Eur Rev Med Pharmacol Sci 2017; 21: ) Zhai YP, Wang Y. Effect of the combination treatment of high-intensity focused ultrasound and cryocare knife in advanced liver cancer. J BUON 2017; 22: ) Lee JW, Bae SH, Jeong JW, Kim SH, Kim KW. Hypoxia-inducible factor (HIF-1) alpha: its protein stability and biological functions. Exp Mol Med 2004; 36: ) Lee JH, Miele ME, Hicks DJ, Phillips KK, Trent JM, Weissman BE, Welch DR. KiSS-1, a novel human malignant melanoma metastasis-suppressor gene. J Natl Cancer Inst 1996; 88: ) Lu X, Kang Y. Hypoxia and hypoxia-inducible factors: master regulators of metastasis. Clin Cancer Res 2010; 16: ) Liu L, Zhu XD, Wang WQ, Shen Y, Qin Y, Ren ZG, Sun HC, Tang ZY. Activation of beta-catenin by hypoxia in hepatocellular carcinoma contributes to enhanced metastatic potential and poor prognosis. Clin Cancer Res 2010; 16: ) Fattovich G, Olivari N, Pasino M, D Onofrio M, Martone E, Donato F. Long-term outcome of chronic hepatitis B in Caucasian patients: Mortality after 25 years. Gut 2008; 57: ) Di Francia R, Rinaldi L, Cillo M, Varriale E, Facchini G, D Aniello C, Marotta G, Berretta M. Antioxidant diet and genotyping as tools for the prevention of liver disease. Eur Rev Med Pharmacol Sci 2016; 20: ) Demir S, Turan I, Aliyazicioglu Y. Selective cytotoxic effect of Rhododendron luteum extract on human colon and liver cancer cells. J BUON 2016; 21: ) Sun G, Hou YB, Jia HY, Bi XH, Yu L, Chen DJ. MiR- 370 promotes cell death of liver cancer cells by Akt/FoxO3a signalling pathway. Eur Rev Med Pharmacol Sci 2016; 20: ) Lin CL, Kao JH. Risk stratification for hepatitis B virus related hepatocellular carcinoma. J Gastroenterol Hepatol 2013; 28: ) Bangoura G, Liu ZS, Qian Q, Jiang CQ, Yang GF, Jing S. Prognostic significance of HIF-2alpha/ EPAS1 expression in hepatocellular carcinoma. World J Gastroenterol 2007; 13: ) Rankin EB, Giaccia AJ. The role of hypoxia-inducible factors in tumorigenesis. Cell Death Differ 2008; 15: ) Patel SA, Simon MC. Biology of hypoxia-inducible factor-2alpha in development and disease. Cell Death Differ 2008; 15: ) Chen N, Chen X, Huang R, Zeng H, Gong J, Meng W, Lu Y, Zhao F, Wang L, Zhou Q. BCL-xL is a target gene regulated by hypoxia-inducible factor-1{alpha}. J Biol Chem 2009; 284: ) Greijer AE, van der Wall E. The role of hypoxia inducible factor 1 (HIF-1) in hypoxia induced apoptosis. J Clin Pathol 2004; 57: ) Zhang H, Bosch-Marce M, Shimoda LA, Tan YS, Baek JH, Wesley JB, Gonzalez FJ, Semenza GL. Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to hypoxia. J Biol Chem 2008; 283: ) Sanchez-Carbayo M, Capodieci P, Cordon-Cardo C. Tumor suppressor role of KiSS-1 in bladder cancer: loss of KiSS-1 expression is associated with bladder cancer progression and clinical outcome. Am J Pathol 2003; 162: ) Shirasaki F, Takata M, Hatta N, Takehara K. Loss of expression of the metastasis suppressor gene KiSS1 during melanoma progression and its association with LOH of chromosome 6q16.3-q23. Cancer Res 2001; 61: ) Ringel MD, Hardy E, Bernet VJ, Burch HB, Schuppert F, Burman KD, Saji M. Metastin receptor is overexpressed in papillary thyroid cancer and activates MAP kinase in thyroid cancer cells. J Clin Endocrinol Metab 2002; 87: ) Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi K, Terao Y, Kumano S, Takatsu Y, Masuda Y, Ishibashi Y, Watanabe T, Asada M, Yamada T, Suenaga M, Kitada C, Usuki S, Kurokawa T, Onda H, Nishimura O, Fujino M. Metastasis suppressor gene KiSS- 1 encodes peptide ligand of a G-protein-coupled receptor. Nature 2001; 411: ) Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E, Brezillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G, Parmentier M. The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 2001; 276: ) Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Calamari A, Szekeres PG, Sarau HM, Chambers JK, Murdock P, Steplewski K, Shabon U, Miller JE, Middleton SE, Darker JG, Larminie CG, Wilson S, Bergsma DJ, Emson P, Faull R, Philpott KL, Harrison DC. AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem 2001; 276: