Supplemental Information
|
|
|
- Myron Stafford
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total cholesterol (TC), total triglyceride (TG), aspartate aminotransferase (AST), alanine aminotransferase (ALT), high density lipoprotein (HDL) and low density lipoprotein (LDL) were obtained from Huili Biotechnology Co., Ltd. (Changchun, China). Additionally, detection kits of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), alkaline phosphatase (ALP) and malonaldehyde (MDA) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Moreover, enzyme-linked immuno sorbent assay kits of apoprotein A1 (Apo-A1), apoprotein B (Apo-B), fatty acid synthetase (FAS), tumor necrosis factor-α (TNF-α), interleukin 1 (IL- 1) and interleukin 6 (IL-6) were also purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Histopathological observation A portion of each liver tissue (cut into several portions) and abdominal fat pad were preserved into 4% paraformaldehyde solution, and then embedded in paraffin. The paraffin blocks were sliced into 4-6 μm sections, and stained with hematoxylin-eosin (H & E) for the fat pad and hepatic tissue. Sections of liver were also stained with Oil Red O before histopathological evaluation. Finally, the samples were analyzed by observing the morphological changes with an Olympus light microscope 1. Western blot analysis Liver tissue of 100 mg was homogenized in 1mL lysis buffer (200 mm of ph 6.8 Tris- HCl, 0.32 M SDS, 125 ng/ml bromophenol blue, 15.6% glycerinum, 21% Tris-Base, 6.25% β-mercaptoethanol). After 10 min, the centrifugation was performed at rad/min for 10 min and the supernatant was collected. Protein concentration of lysate was determined with a commercial kit (BestBio, Shanghai, China). Equal amounts of lysate proteins were heated at 95ºC for 5 min with one-fourth volume of 5 loading buffer. Then, electrophoresis was performed by SDS-PAGE for 30 min at 80 V in the first stage, and 60 min at 120 V in the 2nd stage, and the separated proteins was electro-blotted to
2 PVDF membranes. The nonspecific binding sites were blocked with 5% defatted milk in TBST (Tris 100mM, NaCl 166mM, 0.5% Tween 20) for 2h, and the transferred membrane was incubated at 4ºC for 12h with primary anti-cdp antibody (1:1000, Proteintech Group, Inc., Chicago, USA), followed by incubation at room temperature for 1h with horseradish peroxidase conjugated goat anti-rabbit secondary antibody (1:5000, Proteintech Group, Inc., Chicago, USA). The immunoreactive bands were detected using a Chemiluminescence Imaging Systems (Ultra-Violet Products, USA). References 1 D. Ren, Y. Zhao, Y. Nie, N. Yang, and X. Yang, Hypoglycemic and hepatoprotective effects of polysaccharides from Artemisia sphaerocephala Krasch seeds, Int. J. Biol. Macromol., 2014, 69, A B Supplemental Figure 1 The partial ion chromatograms (m/z = 368) of epicatechin (IS, internal standard) and serum, urine and feces samples without IS (A). The GC-MS chromatograms of epicatechin (IS) and genistein derivatives for standard compounds, and serum, urine and feces samples of HF-fed mice (B). Although epicatechin was found in many food, its typical ion peak (m/z = 368) was no found in serum, urine and feces samples in this study (Supplemental Figure 1A). Thus, epicatechin as internal standard was applied for determination of genistein in serum, urine
3 and feces samples in current research. Supplemental Figure 2 GC MS chromatograms of EFA and FFA obtained from mice serum and standard substance (St.) at selected ion monitoring (SIM) model. Peaks: (1) C8:0, (2) C10:0, (3) C11:0, (4) C12:0, (5) C13:0, (6) C14:1, (7) C14:0, (8) C15:1, (9) C15:0, (10) C16:1, (11) C16:0, (12) C17:1, (13) C17:0, (14) γ-c18:3, (15) C18:2, (16) C18:1, (17) C18:1t, (18) C18:0, (19) C20:4, (20) C20:5, (21) C20:3, (22) C20:2, (23) C18:3, (24) C20:0, (25) C21:0, (26) C22:6, (27) C22:2, (28) C22:1, (29) C22:0, (30) C23:0, (31) C24:1, (32) C24:0.
4 Supplemental Figure 3 GC MS chromatograms of EFA and FFA obtained from mice liver and standard substance (St.) at selected ion monitoring (SIM) model. Peaks: (1) C8:0, (2) C10:0, (3) C11:0, (4) C12:0, (5) C13:0, (6) C14:1, (7) C14:0, (8) C15:1, (9) C15:0, (10) C16:1, (11) C16:0, (12) C17:1, (13) C17:0, (14) γ-c18:3, (15) C18:2, (16) C18:1, (17) C18:1t, (18) C18:0, (19) C20:4, (20) C20:5, (21) C20:3, (22) C20:2, (23) C18:3, (24) C20:0, (25) C21:0, (26) C22:6, (27) C22:2, (28) C22:1, (29) C22:0, (30) C23:0, (31) C24:1, (32) C24:0.
5 Serum EFA Serum FFA Liver EFA Liver FFA Supplemental Figure 4 Column plots of VIP value with jack-knifed confidence intervals for multivariate statistical analysis of serum fatty acid.
6 A B C D Supplemental Figure 5 Z-score plots of serum EFA (A) and FFA (B), and hepatic EFA (C) and FFA (D), respectively. The blue *, ** and *** means the statistical significance (p < 0.05, 0.01 and 0.001, respectively) between the normal group and model group by Wilcoxon Mann-Whitney Test. A B Supplemental Figure 6 Potential biomarkers about fatty acid metabolism in HF-diet fed mice: C20:4 (A) and C22:6 (B) in FFA of mice liver. a,b Values having different superscripts are significantly different (p < 0.05).
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
Protocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
Cornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
Protocol for Western Blo
Protocol for Western Blo ng SDS-PAGE separa on 1. Make appropriate percentage of separa on gel according to the MW of target proteins. Related recommenda ons and rou ne recipes of separa on/stacking gels
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
The Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
Choline Assay Kit (Fluorometric)
Product Manual Choline Assay Kit (Fluorometric) Catalog Number MET- 5042 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Choline is a water soluble amine that is an essential
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
APPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation.
APPENDIX 1 Preparation of reagents 1.1. Preparation of dosing solution Nonylphenol 15 mg of Nonylphenol was dissolved in olive oil (10 ml) and used as stock solution. The stock solution was serially diluted
Supplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows
FULL PAPER Biochemistry Reduction in Serum Lecithin:Cholesterol Acyltransferase Activity Prior to the Occurrence of Ketosis and Milk Fever in Cows Hisami NAKAGAWA-UETA 1) and Norio KATOH 2) * 1) Ishikawa
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the
P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium
Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin
Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
![2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein](/thumbs/86/94743397.jpg "2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein")
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
The study on the Antioxidation of EM-X in Liver of Rat in vivo
The study on the Antioxidation of EM-X in Liver of Rat in vivo Cao Jun a), Cong Huifang b), Sun Ziaojun c), Ke Bin d) a) Department of Biochemistry, Qiqihar Medical College, P.R. Chin, 161042 b) Second
Supplementary Information
Supplementary Information Metabolomics reveals trichloroacetate as a major contributor to trichloroethylene-induced metabolic alterations in mouse urine and serum Zhong-Ze Fang, Kristopher W Krausz, Naoki
Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
OxiSelect Malondialdehyde (MDA) Immunoblot Kit
Product Manual OxiSelect Malondialdehyde (MDA) Immunoblot Kit Catalog Number STA- 331 10 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipid peroxidation is a well-defined
Kynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)
Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC
Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT
BCH 447. Triglyceride Determination in Serum
BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Anti-obesity effects of yellow catfish protein hydrolysate on mice fed a 45% kcal high-fat diet
784 Anti-obesity effects of yellow catfish protein hydrolysate on mice fed a 45% kcal high-fat diet MI-RYUNG KIM 1*, JOO-WAN KIM 2*, JEONG BEEN PARK 1, YONG-KI HONG 3, SAE KWANG KU 4 and JAE-SUK CHOI 1
Supplementary Material
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2018 Supplementary Material 1 Supplemental Figures Supplemental Figure S1. Mechanical properties
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase
Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE
Free Fatty Acid Assay Kit (Fluorometric)
Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid
The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids
The Application of UPLC/MS E for the Analysis of Bile Acids in Biological Fluids Elizabeth J. Want, 1 Muireann Coen, Perrine Masson, Hector C. Keun, Jake T.M. Pearce, Michael D. Reily, Donald Robertson,
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
Anti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
LNA-mediated silencing of microrna-122 in African green monkeys
LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured
Mammalian Tissue Protein Extraction Reagent
Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
DIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Supplementary Information A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Kynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based. Metabolomics and Serum Amino Acid Profiles in Obese Women from a
Supporting information for Effects of Histidine Supplementation on Global Serum and Urine 1 H NMR-based Metabolomics and Serum Amino Acid Profiles in Obese Women from a Randomized Controlled Study Shanshan
The hepatoprotective activity of olive oil and Nigella sativa oil against CCl 4 induced hepatotoxicity in male rats
Al-Seeni et al. BMC Complementary and Alternative Medicine (2016) 16:438 DOI 10.1186/s12906-016-1422-4 RESEARCH ARTICLE Open Access The hepatoprotective activity of olive oil and Nigella sativa oil against
Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Juxtapid. Juxtapid (lomitapide) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)
APPENDIX 1 ETHICAL CLEARANCE
APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
Amelioration of nonalcoholic fatty liver disease by hepatic stimulator substance via preservation of carnitine palmitoyl transferase-1 activity
Am J Physiol Cell Physiol 309: C215 C227, 2015. First published June 24, 2015; doi:10.1152/ajpcell.00133.2014. Amelioration of nonalcoholic fatty liver disease by hepatic stimulator substance via preservation
Supplementary Information. Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a
Supplementary Information Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a High-throughput Targeted Metabolomics Approach Nanyang Yu, Si Wei, *, Meiying Li, Jingping
www.academicjournals.com OPEN ACCESS Asian Journal of Animal and Veterinary Advances ISSN 1683-9919 DOI: 10.3923/ajava.2017.61.70 Research Article Flaxseed Oil Alleviates Toxic Effects of Subacute Exposure
Supplementary Material for
Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei
Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
Sipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
Original Article The protective effects of Masson pine pollen aqueous extract on CCl 4. -induced oxidative damage of human hepatic cells
Int J Clin Exp Med 2015;8(10):17773-17780 www.ijcem.com /ISSN:1940-5901/IJCEM0013347 Original Article The protective effects of Masson pine pollen aqueous extract on -induced oxidative damage of human
Supplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
Protein & Enzyme Lab (BBT 314)
Protein & Enzyme Lab (BBT 314) Experiment 3 A: Determination of the enzyme ALT or SGPT activity in serum by enzymatic method using Bioanalyzer Background: Alanine aminotransferase (glutamate pyruvate transaminase)
Activation of Chemical Biological Defense Mechanisms and Remission of Vital Oxidative Injury by Low Dose Radiation
Activation of Chemical Biological Defense Mechanisms and Remission of Vital Oxidative Injury by Low Dose Radiation K.Yamaoka 1, T.Nomura 2 and S.Kojima 3 1 Okayama University Medical School, Okayama 700-8558,
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
Anti-obesity and fatty liver-preventing activities of Lonicera caerulea in high-fat diet-fed mice
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE Anti-obesity and fatty liver-preventing activities of Lonicera caerulea in high-fat diet-fed mice JOO WAN KIM 1*, YOU SUK LEE 2*, DU JIN SEOL 1, IL JE CHO 3,
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
BIOO RESEARCH PRODUCTS. Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #:
BIOO RESEARCH PRODUCTS Aspartate Transaminase (AST) Color Endpoint Assay Kit Manual Catalog #: 5605-01 BIOO Scientific 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure
Supporting information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting information Experimental Section Synthesis and modification of SBA-15. In a typical
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
HT Glutathione Assay Kit
Instructions For Research Use Only. Not For Use In Diagnostic Procedures HT Glutathione Assay Kit Colorimetric assay for total, reduced and oxidized glutathione. Sufficient reagents for tests. Table of
African Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp (2012)
African Journal of Pharmaceutical Research & Development Vol. 4 No.1 pp.16-19 (2012) Effects of Antimalarial Herbal Mixture (Abc 123) on the Liver of Rats *Iliya HA, Wannang NN, Andrew MM, Ibrahim H Department
Total Cholesterol Assay Kit (Fluorometric)
Product Manual Total Cholesterol Assay Kit (Fluorometric) Catalog Number STA- 390 192 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol that is
Supporting information
Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction
Low toxicity and accumulation of zinc oxide nanoparticles in mice
Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2016 Low toxicity and accumulation of zinc oxide nanoparticles in mice after 270-day consecutive
ab E3 Ligase Auto- Ubiquitilylation Assay Kit
ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma
Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma H.B. Liu, Y. Zhu, Q.C. Yang, Y. Shen, X.J. Zhang and H. Chen Department of Pathology First People s Hospital
Total Phosphatidic Acid Assay Kit
Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor
Supporting information. Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers
Supporting information Precise Photodynamic Therapy of Cancer via Subcellular Dynamic Tracing of Dual-loaded Upconversion Nanophotosensitizers Yulei Chang 1, Xiaodan Li 1,3, Li zhang 1,3, Lu Xia 1, Xiaomin