World Journal of Gastroenterology

Transcription

1 ISSN (print) ISSN (online) World Journal of Gastroenterology World J Gastroenterol 2013 October 28; 19(40):

2 Editorial Board The World Journal of Gastroenterology Editorial Board consists of 1352 members, representing a team of worldwide experts in gastroenterology and hepatology. They are from 64 countries, including Albania (1), Argentina (8), Australia (33), Austria (15), Belgium (14), Brazil (13), Brunei Darussalam (1), Bulgaria (2), Canada (21), Chile (3), China (82), Colombia (1), Croatia (2), Cuba (1), Czech (6), Denmark (9), Ecuador (1), Egypt (4), Estonia (2), Finland (8), France (29), Germany (87), Greece (22), Hungary (11), India (32), Indonesia (2), Iran (10), Ireland (6), Israel (13), Italy (124), Japan (140), Jordan (2), Kuwait (1), Lebanon (4), Lithuania (2), Malaysia (1), Mexico (11), Morocco (1), Moldova (1), Netherlands (32), New Zealand (2), Norway (13), Pakistan (2), Poland (11), Portugal (6), Romania (4), Russia (1), Saudi Arabia (3), Serbia (3), Singapore (11), Slovenia (1), South Africa (3), South Korea (46), Spain (43), Sri Lanka (1), Sweden (17), Switzerland (12), Thailand (1), Trinidad and Tobago (1), Turkey (30), United Arab Emirates (2), United Kingdom (95), United States (285), and Uruguay (1). HONORARY EDITORS-IN-CHIEF James L Boyer, New Haven Ke-Ji Chen, Beijing Martin H Floch, New Haven Bo-Rong Pan, Xi'an Eamonn M Quigley, Cork Rafiq A Sheikh, Sacramento Nicholas J Talley, Rochester EDITORS-IN-CHIEF Ferruccio Bonino, Pisa Myung-Hwan Kim, Seoul Kjell Öberg, Uppsala Matt Rutter, Stockton-on-Tees Andrzej S Tarnawski, Long Beach STRATEGY ASSOCIATE EDITORS-IN-CHIEF You-Yong Lu, Beijing Peter Draganov, Florida Hugh J Freeman, Vancouver Maria Concepción Gutiérrez-Ruiz, Mexico Kazuhiro Hanazaki, Kochi Akio Inui, Kagoshima Kalpesh Jani, Baroda Javier San Martin, Punta del Este Natalia A Osna, Omaha Wei Tang, Tokyo Alan BR Thomson, Edmonton Harry Hua-Xiang Xia, Livingston John M Luk, Hong Kong Hiroshi Shimada, Yokohama GUEST EDITORIAL BOARD MEMBERS Jiunn-Jong Wu, Tainan Cheng-Shyong Wu, Chia-Yi Ta-Sen Yeh, Taoyuan Tsung-Hui Hu, Kaohsiung Chuah Seng-Kee, Kaohsiung I-Rue Lai, Taipei Jin-Town Wang, Taipei Ming-Shiang Wu, Taipei Teng-Yu Lee, Taichung Yang-Yuan Chen, Changhua Po-Shiuan Hsieh, Taipei Chao-Hung Hung, Kaohsiung Hon-Yi Shi, Kaohsiung Hui-kang Liu, Taipei Jen-Hwey Chiu, Taipei Chih-Chi Wang, Kaohsiung Wan-Long Chuang, Kaohsiung Wen-Hsin Huang, Taichung Hsu-Heng Yen, Changhua Ching Chung Lin, Taipei Chien-Jen Chen, Taipei Jaw-Ching Wu, Taipei Ming-Chih Hou, Taipei Kevin Cheng-Wen Hsiao, Taipei Chiun Hsu, Taipei Yu-Jen Chen, Taipei Chen Hsiu-Hsi Chen, Taipei Liang-Shun Wang, Taipei hun-fa Yang, Taichung Min-Hsiung Pan, Kaohsiung Chun- Hung Lin, Taipei Ming-Whei Yu, Taipei Chuen Hsueh, Taoyuan Hsiu-Po Wang, Taipei Lein-Ray Mo, Tainan Ming-Lung Yu, Kaohsiung MEMBERS OF THE EDITORIAL BOARD Albania Bashkim Resuli, Tirana Argentina Julio H Carri, Córdoba Bernabe Matias Quesada, Buenos Aires Bernardo Frider, Buenos Aires Maria Ines Vaccaro, Buenos Aires Eduardo de Santibañes, Buenos Aires Adriana M Torres, Rosario Carlos J Pirola, Buenos Aires Silvia Sookoian, Buenos Aires Australia Finlay A Macrae, Victoria David Ian Watson, Bedford Park Jacob George, Sydney Leon Anton Adams, Nedlands Minoti V Apte, Liverpool Andrew V Biankin, Sydney Filip Braet, Sydney Guy D Eslick, Sydney Michael A Fink, Melbourne Mark D Gorrell, Sydney Michael Horowitz, Adelaide John E Kellow, Sydney Daniel Markovich, Brisbane I March 7, 2013

3 Phillip S Oates, Perth Ross C Smith, Sydney Kevin J Spring, Brisbane Philip G Dinning, Koagarah Christopher Christophi, Melbourne Cuong D Tran, North Adelaide Shan Rajendra, Tasmania Rajvinder Singh, Adelaide William Kemp, Melbourne Phil Sutton, Melbourne Richard Anderson, Victoria Vance Matthews, Melbourne Alexander G Heriot, Melbourne Debbie Trinder, Fremantle Ian C Lawrance, Perth Adrian G Cummins, Adelaide John K Olynyk, Fremantle Alex Boussioutas, Melbourne Emilia Prakoso, Sydney Robert JL Fraser, Daw Park Austria Wolfgang Mikulits, Vienna Alfred Gangl, Vienna Dietmar Öfner, Salzburg Georg Roth, Vienna Herwig R Cerwenka, Graz Ashraf Dahaba, Graz Markus Raderer, Vienna Alexander M Hirschl, Wien Thomas Wild, Kapellerfeld Peter Ferenci, Vienna Valentin Fuhrmann, Vienna Kurt Lenz, Linz Markus Peck-Radosavljevic, Vienna Michael Trauner, Vienna Stefan Riss, Vienna Belgium Rudi Beyaert, Gent Inge I Depoortere, Leuven Olivier Detry, Liège Benedicte Y De Winter, Antwerp Etienne M Sokal, Brussels Marc Peeters, De Pintelaan Eddie Wisse, Keerbergen Jean-Yves L Reginster, Liège Mark De Ridder, Brussel Freddy Penninckx, Leuven Kristin Verbeke, Leuven Lukas Van Oudenhove, Leuven Leo van Grunsven, Brussels Philip Meuleman, Ghent Brazil Heitor Rosa, Goiania Roberto J Carvalho-Filho, Sao Paulo Damiao Carlos Moraes Santos, Rio de Janeiro Marcelo Lima Ribeiro, Braganca Paulista Eduardo Garcia Vilela, Belo Horizonte Jaime Natan Eisig, São Paulo Andre Castro Lyra, Salvador José Liberato Ferreira Caboclo, Brazil Yukie Sato-Kuwabara, São Paulo Raquel Rocha, Salvador Paolo R Salvalaggio, Sao Paulo Ana Cristina Simões e Silva, Belo Horizonte Joao Batista Teixeira Rocha, Santa Maria Brunei Darussalam Vui Heng Chong, Bandar Seri Begawan Bulgaria Zahariy Krastev, Sofia Mihaela Petrova, Sofia Canada Eldon Shaffer, Calgary Nathalie Perreault, Sherbrooke Philip H Gordon, Montreal Ram Prakash Galwa, Ottawa Baljinder Singh Salh, Vancouver Claudia Zwingmann, Montreal Alain Bitton, Montreal Pingchang Yang, Hamilton Michael F Byrne,Vancouver Andrew L Mason, Alberta John K Marshall, Hamilton Ontario Kostas Pantopoulos, Montreal Waliul Khan, Ontario Eric M Yoshida, Vancouver Geoffrey C Nguyen, Toronto Devendra K Amre, Montreal Tedros Bezabeh, Winnipeg Wangxue Chen, Ottawa Qiang Liu, Saskatoon Chile De Aretxabala Xabier, Santiago Marcelo A Beltran, La Serena Silvana Zanlungo, Santiago China Chi-Hin Cho, Hong Kong Chun-Qing Zhang, Jinan Ren Xiang Tan, Nanjing Fei Li, Beijing Hui-Jie Bian, Xi'an Xiao-Peng Zhang, Beijing Xing-Hua Lu, Beijing Fu-Sheng Wang, Beijing An-Gang Yang, Xi an Xiao-Ping Chen, Wuhan Zong-Jie Cui, Beijing Ming-Liang He, Hong Kong Yuk-Tong Lee, Hong Kong Qin Su, Beijing Jian-Zhong Zhang, Beijing Paul Kwong-Hang Tam, Hong Kong Wen-Rong Xu, Zhenjiang Chun-Yi Hao, Beijing San-Jun Cai, Shanghai Simon Law, Hong Kong Yuk Him Tam, Hong Kong De-Liang Fu, Shanghai Eric WC Tse, Hong Kong Justin CY Wu, Hong Kong Nathalie Wong, Hong Kong Jing Yuan Fang, Shanghai Yi-Min Mao, Shanghai Wei-Cheng You, Beijing Xiang-Dong Wang, Shanghai Xuan Zhang, Beijing Zhao-Shen Li, Shanghai Guang-Wen Cao, Shanghai En-min Li, Shantou Yu-Yuan Li, Guangzhou Fook Hong Ng, Hong Kong Hsiang-Fu Kung, Hong Kong Wai Lun Law, Hong Kong Eric CH Lai, Hong Kong Jun Yu, Hong Kong Ze-Guang Han, Shanghai Bian zhao-xiang, Hong Kong Wei-Dong Tong, Chongqing Colombia Germán Campuzano-Maya, Medellín Croatia Tamara Cacev, Zagreb Marko Duvnjak, Zagreb Cuba Damian C Rodriguez, Havana Czech Milan Jirsa, Praha Pavel Trunečka, Prague Jan Bures, Hradec Kralove Marcela Kopacova, Hradec Kralove Ondrej Slaby, Brno Radan Bruha, Prague Denmark Asbjørn M Drewes, Aalborg Leif Percival Andersen, Copenhagen Jan Mollenhauer, Odense C Morten Frisch, Copenhagen S Jorgen Rask-Madsen, Skodsborg Morten Hylander Møller, Holte Søren Rafaelsen, Vejle Vibeke Andersen, Aabenraa Ole Haagen Nielsen, Herlev Ecuador Fernando E Sempértegui, Quito Egypt Zeinab Nabil Ahmed Said, Cairo Hussein M Atta, El-Minia Asmaa Gaber Abdou, Shebein Elkom II March 7, 2013

4 Maha Maher Shehata, Mansoura Estonia Riina Salupere, Tartu Tamara Vorobjova, Tartu Finland Saila Kauhanen, Turku Pauli Antero Puolakkainen, Turku Minna Nyström, Helsinki Juhani Sand, Tampere Jukka-Pekka Mecklin, Jyvaskyla Lea Veijola, Helsinki Kaija-Leena Kolho, Helsinki Thomas Kietzmann, Oulu France Boris Guiu, Dijon Baumert F Thomas, Strasbourg Alain L Servin, Châtenay-Malabry Patrick Marcellin, Paris Jean-Jacques Tuech, Rouen Francoise L Fabiani, Angers Jean-Luc Faucheron, Grenoble Philippe Lehours, Bordeaux Stephane Supiot, Nantes Lionel Bueno, Toulouse Flavio Maina, Marseille Paul Hofman, Nice Abdel-Majid Khatib, Paris Annie Schmid-Alliana, Nice cedex 3 Frank Zerbib, Bordeaux Cedex Rene Gerolami Santandera, Marseille Sabine Colnot, Paris Catherine Daniel, Lille Cedex Thabut Dominique, Paris Laurent Huwart, Paris Alain Braillon, Amiens Bruno Bonaz, Grenoble Evelyne Schvoerer, Strasbourg M Coeffier, Rouen Mathias Chamaillard, Lille Hang Nguyen, Clermont-Ferrand Veronique Vitton, Marseille Alexis Desmoulière, Limoges Juan Iovanna, Marseille Germany Hans L Tillmann, Leipzig Stefan Kubicka, Hannover Elke Cario, Essen Hans Scherubl, Berlin Harald F Teutsch, Ulm Peter Konturek, Erlangen Thilo Hackert, Heidelberg Jurgen M Stein, Frankfurt Andrej Khandoga, Munich Karsten Schulmann, Bochum Jutta Elisabeth Lüttges, Riegelsberg Wolfgang Hagmann, Heidelberg Hubert Blum, Freiburg Thomas Bock, Berlin Christa Buechler, Regensburg Christoph F Dietrich, Bad Mergentheim Ulrich R Fölsch, Kiel Nikolaus Gassler, Aachen Markus Gerhard, Munich Dieter Glebe, Giessen Klaus R Herrlinger, Stuttgart Eberhard Hildt, Berlin Joerg C Hoffmann, Ludwigshafen Joachim Labenz, Siegen Peter Malfertheiner, Magdeburg Sabine Mihm, Göttingen Markus Reiser, Bochum Steffen Rickes, Magdeburg Andreas G Schreyer, Regensburg Henning Schulze-Bergkamen, Heidelberg Ulrike S Stein, Berlin Wolfgang R Stremmel, Heidelberg Fritz von Weizsäcker, Berlin Stefan Wirth, Wuppertal Dean Bogoevski, Hamburg Bruno Christ, Halle/Saale Peter N Meier, Hannover Stephan Johannes Ott, Kiel Arndt Vogel, Hannover Dirk Haller, Freising Jens Standop, Bonn Jonas Mudter, Erlangen Jürgen Büning, Lübeck Matthias Ocker, Erlangen Joerg Trojan, Frankfurt Christian Trautwein, Aachen Jorg Kleeff, Munich Christian Rust, Munich Claus Hellerbrand, Regensburg Elke Roeb, Giessen Erwin Biecker, Siegburg Ingmar Königsrainer, Tübingen Jürgen Borlak, Hannover Axel M Gressner, Aachen Oliver Mann, Hamburg Marty Zdichavsky, Tübingen Christoph Reichel, Bad Brückenau Nils Habbe, Marburg Thomas Wex, Magdeburg Frank Ulrich Weiss, Greifswald Manfred V Singer, Mannheim Martin K Schilling, Homburg Philip D Hard, Giessen Michael Linnebacher, Rostock Ralph Graeser, Freiburg Rene Schmidt, Freiburg Robert Obermaier, Freiburg Sebastian Mueller, Heidelberg Andrea Hille, Goettingen Klaus Mönkemüller, Bottrop Elfriede Bollschweiler, Köln Siegfried Wagner, Deggendorf Dieter Schilling, Mannheim Joerg F Schlaak, Essen Michael Keese, Frankfurt Robert Grützmann, Dresden Ali Canbay, Essen Dirk Domagk, Muenster Jens Hoeppner, Freiburg Frank Tacke, Aachen Patrick Michl, Marburg Alfred A Königsrainer, Tübingen Kilian Weigand, Heidelberg Mohamed Hassan, Duesseldorf Gustav Paumgartner, Munich Philipe N Khalil, Munich Martin Storr, Munich Greece Andreas Larentzakis, Athens Tsianos Epameinondas, Ioannina Elias A Kouroumalis, Heraklion Helen Christopoulou-Aletra, Thessaloniki George Papatheodoridis, Athens Ioannis Kanellos, Thessaloniki Michael Koutsilieris, Athens T Choli-Papadopoulou, Thessaloniki Emanuel K Manesis, Athens Evangelos Tsiambas, Ag Paraskevi Attiki Konstantinos Mimidis, Alexandroupolis Spilios Manolakopoulos, Athens Spiros Sgouros, Athens Ioannis E Koutroubakis, Heraklion Stefanos Karagiannis, Athens Spiros Ladas, Athens Elena Vezali, Athens Dina G Tiniakos, Athens Ekaterini Chatzaki, Alexandroupolis Dimitrios Roukos, Ioannina George Sgourakis, Athens Maroulio Talieri, Athens Hungary Peter L Lakatos, Budapest Yvette Mándi, Szeged Ferenc Sipos, Budapest György M Buzás, Budapest László Czakó, Szeged Peter Hegyi, Szeged Zoltan Rakonczay, Szeged Gyula Farkas, Szeged Zsuzsa Szondy, Debrecen Gabor Veres, Budapest Zsuzsa Schaff, Budapest India Philip Abraham, Mumbai Sri P Misra, Allahabad Ramesh Roop Rai, Jaipur Nageshwar D Reddy, Hyderabad Rakesh Kumar Tandon, New Delhi Jai Dev Wig, Chandigarh Uday C Ghoshal, Lucknow Pramod Kumar Garg, New Delhi Barjesh Chander Sharma, New Delhi Gopal Nath, Varanasi Bhupendra Kumar Jain, Delhi Devinder Kumar Dhawan, Chandigarh Ashok Kumar, Lucknow Benjamin Perakath, Tamil Nadu Debidas Ghosh, Midnpore Pankaj Garg, Panchkula Samiran Nundy, New Delhi Virendra Singh, Chandigarh Bikash Medhi, Chandigarh Radha K Dhiman, Chandigarh Vandana Panda, Mumbai Vineet Ahuja, New Delhi SV Rana, Chandigarh III March 7, 2013

5 Deepak N Amarapurkar, Mumbai Abhijit Chowdhury, Kolkata Jasbir Singh, Kurukshetra B Mittal, Lucknow Sundeep Singh Saluja, New Delhi Pradyumna Kumar Mishra, Mumbai Runu Chakravarty, Kolkata Nagarajan Perumal, New Delhi Indonesia David handojo Muljono, Jakarta Andi Utama, Tangerang Iran Seyed-Moayed Alavian, Tehran Reza Malekzadeh, Tehran Peyman Adibi, Isfahan Alireza Mani, Tehran Seyed Mohsen Dehghani, Shiraz Mohammad Abdollahi, Tehran Majid Assadi, Bushehr Arezoo Aghakhani, Tehran Marjan Mohammadi, Tehran Fariborz Mansour-Ghanaei, Rasht Ireland Ross McManus, Dublin Billy Bourke, Dublin Catherine Greene, Dublin Ted Dinan, Cork Marion Rowland, Dublin Israel Abraham R Eliakim, Haifa Simon Bar-Meir, Tel Hashomer Ami D Sperber, Beer-Sheva Boris Kirshtein, Beer Sheva Mark Pines, Bet Dagan Menachem Moshkowitz, Tel-Aviv Ron Shaoul, Haifa Shmuel Odes, Beer Sheva Sigal Fishman, Tel Aviv Alexander Becker, Afula Assy Nimer, Safed Eli Magen, Ashdod Amir Shlomai, Tel-Aviv Italy Mauro Bortolotti, Bologna Gianlorenzo Dionigi, Varese Fiorucci Stefano, Perugia Roberto Berni Canani, Naples Ballarin Roberto, Modena Bruno Annibale, Roma Vincenzo Stanghellini, Bologna Giovanni B Gaeta, Napoli Claudio Bassi, Verona Mauro Bernardi, Bologna Giuseppe Chiarioni, Valeggio Michele Cicala, Rome Dario Conte, Milano Francesco Costa, Pisa Giovanni D De Palma, Naples Giammarco Fava, Ancona Francesco Feo, Sassari Edoardo G Giannini, Genoa Fabio Grizzi, Milan Salvatore Gruttadauria, Palermo Pietro Invernizzi, Milan Ezio Laconi, Cagliari Giuseppe Montalto, Palermo Giovanni Musso, Torino Gerardo Nardone, Napoli Valerio Nobili, Rome Raffaele Pezzilli, Bologna Alberto Piperno, Monza Anna C Piscaglia, Roma Piero Portincasa, Bari Giovanni Tarantino, Naples Cesare Tosetti, Porretta Terme Alessandra Ferlini, Ferrara Alessandro Ferrero, Torino Donato F Altomare, Bari Giovanni Milito, Rome Giuseppe Sica, Rome Guglielmo Borgia, Naples Giovanni Latella, L'Aquila Salvatore Auricchio, Naples Alberto Biondi, Rome Alberto Tommasini, Trieste Antonio Basoli, Roma Giuliana Decorti, Trieste Marco Silano, Roma Michele Reni, Milan Pierpaolo Sileri, Rome Achille Iolascon, Naples Alessandro Granito, Bologna Angelo A Izzo, Naples Giuseppe Currò, Messina Pier Mannuccio Mannucci, Milano Marco Vivarelli, Bologna Massimo Levrero, Rome Massimo Rugge, Padova Paolo Angeli, Padova Silvio Danese, Milano Antonello Trecca, Rome Antonio Gasbarrini, Rome Cesare Ruffolo, Treviso Massimo Falconi, Verona Fausto Catena, Bologna Francesco Manguso, Napoli Giancarlo Mansueto, Verona Luca Morelli, Trento Marco Scarpa, Padova Mario M D'Elios, Florence Francesco Luzza, Catanzaro Franco Roviello, Siena Guido Torzilli, Rozzano Milano Luca Frulloni, Verona Lucia Malaguarnera, Catania Lucia Ricci Vitiani, Rome Mara Massimi, L'Aquila Mario Pescatori, Rome Mario Rizzetto, Torino Mirko D Onofrio, Verona Nadia Peparini, Rome Paola De Nardi, Milan Paolo Aurello, Rome Piero Amodio, Padova Riccardo Nascimbeni, Brescia Vincenzo Villanacci, Brescia Vittorio Ricci, Pavia Silvia Fargion, Milan Luigi Bonavina, Milano Oliviero Riggio, Rome Fabio Pace, Milano Gabrio Bassotti, Perugia Giulio Marchesini, Bologna Roberto de Franchis, Milano Giovanni Monteleone, Rome C armelo Scarpignato, Parma Luca VC Valenti, Milan Urgesi Riccardo, Rome Marcello Persico, Naples Antonio Moschetta, Bari Luigi Muratori, Bologna Angelo Zullo, Roma Vito Annese, Florence Simone Lanini, Rome Alessandro Grasso, Savona Giovanni Targher, Verona Domenico Girelli, Verona Alessandro Cucchetti, Bologna Fabio Marra, Florence Michele Milella, Rome Francesco Franceschi, Rome Giuseppina De Petro, Brescia Salvatore Leonardi, Catania Cristiano Simone, Santa Maria Imbaro Bernardino Rampone, Salerno Francesco Crea, Pisa Walter Fries, Messina Antonio Craxì, Palermo Gerardo Rosati, Potenza Mario Guslandi, Milano Gianluigi Giannelli, Bari Paola Loria, Modena Paolo Sorrentino, Avellino Armando Santoro, Rozzano Gabriele Grassi, Trieste Antonio Orlacchio, Rome Japan Tsuneo Kitamura, Chiba Katsutoshi Yoshizato, Higashihiroshima Masahiro Arai, Tokyo Shinji Tanaka, Hiroshima Keiji Hirata, Kitakyushu Yoshio Shirai, Niigata Susumu Ohmada, Maebashi Kenichi Ikejima, Tokyo Masatoshi Kudo, Osaka Yoshiaki Murakami, Hiroshima Masahiro Tajika, Nagoya Kentaro Yoshika, Toyoake Kyoichi Adachi, Izumo Yasushi Adachi, Sapporo Takafumi Ando, Nagoya Akira Andoh, Otsu Hitoshi Asakura, Tokyo Mitsuhiro Fujishiro, Tokyo Toru Hiyama, Higashihiroshima Yutaka Inagaki, Kanagawa Hiromi Ishibashi, Nagasaki Shunji Ishihara, Izumo Toru Ishikawa, Niigata Yoshiaki Iwasaki, Okayama Terumi Kamisawa, Tokyo IV March 7, 2013

6 Norihiro Kokudo, Tokyo Shin Maeda, Tokyo Yasushi Matsuzaki, Ibaraki Kenji Miki, Tokyo Hiroto Miwa, Hyogo Yoshiharu Motoo, Kanazawa Kunihiko Murase, Tusima Atsushi Nakajima, Yokohama Yuji Naito, Hisato Nakajima, Tokyo Hiroki Nakamura, Yamaguchi Shotaro Nakamura, Fukuoka Mikio Nishioka, Niihama Hirohide Ohnishi, Akita Kazuichi Okazaki, Osaka Morikazu Onji, Ehime Satoshi Osawa, Hamamatsu Hidetsugu Saito, Tokyo Yutaka Saito, Tokyo Yasushi Sano, Kobe Tomohiko Shimatani, Kure Yukihiro Shimizu, Toyama Shinji Shimoda, Fukuoka Masayuki Sho, Nara Hidekazu Suzuki, Tokyo Shinji Togo, Yokohama Satoshi Yamagiwa, Niigata Takayuki Yamamoto, Yokkaichi Hiroshi Yoshida, Tokyo Norimasa Yoshida, Kyoto Akihito Nagahara, Tokyo Hiroaki Takeuchi, Kochi Keiji Ogura, Tokyo Kotaro Miyake, Tokushima Mitsunori Yamakawa, Yamagata Naoaki Sakata, Sendai Naoya Kato, Tokyo Satoshi Mamori, Hyogo Shogo Kikuchi, Aichi Shoichiro Sumi, Kyoto Susumu Ikehara, Osaka Taketo Yamaguchi, Chiba Tokihiko Sawada, Tochigi Tomoharu Yoshizumi, Fukuoka Toshiyuki Ishiwata, Tokyo Yasuhiro Fujino, Akashi Yasuhiro Koga, Isehara city Yoshihisa Takahashi, Tokyo Yoshitaka Takuma, Okayama Yutaka Yata, Maebashi-city Itaru Endo, Yokohama Kazuo Chijiiwa, Miyazaki Kouhei Fukushima, Sendai Masahiro Iizuka, Akita Mitsuyoshi Urashima, Tokyo Munechika Enjoji, Fukuoka Takashi Kojima, Sapporo Takumi Kawaguchi, Kurume Yoshiyuki Ueno, Sendai Yuichiro Eguchi, Saga Akihiro Tamori, Osaka Atsushi Masamune, Sendai Atsushi Tanaka, Tokyo Hitoshi Tsuda, Tokyo Takashi Kobayashi, Tokyo Akimasa Nakao, Nagogya Hiroyuki Uehara, Osaka Masahito Uemura, Kashihara Satoshi Tanno, Sapporo Toshinari Takamura, Kanazawa Yohei Kida, Kainan Masanori Hatakeyama, Tokyo Satoru Kakizaki, Gunma Shuhei Nishiguchi, Hyogo Yuichi Yoshida, Osaka Manabu Morimoto, Japan Mototsugu Kato, Sapporo Naoki Ishii, Tokyo Noriko Nakajima, Tokyo Nobuhiro Ohkohchi, Tsukuba Takanori Kanai, Tokyo Kenichi Goda, Tokyo Mitsugi Shimoda, Mibu Zenichi Morise, Nagoya Hitoshi Yoshiji, Kashihara Takahiro Nakazawa, Nagoya Utaroh Motosugi, Yamanashi Nobuyuki Matsuhashi, Tokyo Yasuhiro Kodera, Nagoya Takayoshi Ito, Tokyo Yasuhito Tanaka, Nagoya Haruhiko Sugimura, Hamamatsu Hiroki Yamaue, Wakayama Masao Ichinose, Wakayama Takaaki Arigami, Kagoshima Nobuhiro Zaima, Nara Naoki Tanaka, Matsumoto Satoru Motoyama, Akita Tomoyuki Shibata, Toyoake Tatsuya Ide, Kurume Tsutomu Fujii, Nagoya Osamu Kanauchi, Toky Atsushi Irisawa, Aizuwakamatsu Hikaru Nagahara, Tokyo Keiji Hanada, Onomichi Keiichi Mitsuyama, Fukuoka Shin Maeda, Yokohama Takuya Watanabe, Niigata Toshihiro Mitaka, Sapporo Yoshiki Murakami, Kyoto Tadashi Shimoyama, Hirosaki Jordan Ismail Matalka, Irbid Khaled Jadallah, Irbid Islam Khan, Safat Kuwait Lebanon Bassam N Abboud, Beirut Rami Moucari, Beirut Ala I Sharara, Beirut Rita Slim, Beirut Lithuania Giedrius Barauskas, Kaunas Limas Kupcinskas, Kaunas Malaysia Andrew Seng Boon Chua, Ipoh Mexico Saúl Villa-Trevio, Mexico Omar Vergara-Fernandez, Mexico Diego Garcia-Compean, Monterrey Arturo Panduro, Jalisco Miguel Angel Mercado, Distrito Federal Richard A Awad, Mexico Aldo Torre Delgadillo, Mexico Paulino Martínez Hernández Magro, Celaya Carlos A Aguilar-Salinas, Mexico Jesus K Yamamoto-Furusho, Mexico Morocco Samir Ahboucha, Khouribga Moldova Igor Mishin, Kishinev Netherlands Ulrich Beuers, Amsterdam Albert Frederik Pull ter Gunne, Tilburg Jantine van Baal, Heidelberglaan Wendy Wilhelmina Johanna de Leng, Utrecht Gerrit A Meijer, Amsterdam Lee Bouwman, Leiden J Bart A Crusius, Amsterdam Frank Hoentjen, Haarlem Servaas Morré, Amsterdam Chris JJ Mulder, Amsterdam Paul E Sijens, Groningen Karel van Erpecum, Utrecht BW Marcel Spanier, Arnhem Misha Luyer, Sittard Pieter JF de Jonge, Rotterdam Robert Christiaan Verdonk, Groningen John Plukker, Groningen Maarten Tushuizen, Amsterdam Wouter de Herder, Rotterdam Erwin G Zoetendal, Wageningen Robert J de Knegt, Rotterdam Albert J Bredenoord, Nieuwegein Annemarie de Vries, Rotterdam Astrid van der Velde, Ede Lodewijk AA Brosens, Utrecht James CH Hardwick, Leiden Loes van Keimpema, Nijmegen WJ de Jonge, Amsterdam Zuzana Zelinkova, Rotterdam LN van Steenbergen, Eindhoven Frank G Schaap, Amsterdam Jeroen Maljaars, Leiden New Zealand Andrew S Day, Christchurch Max S Petrov, Auckland Norway Espen Melum, Oslo V March 7, 2013

7 Trine Olsen, Tromsø Eyvind J Paulssen, Tromsø Rasmus Goll, Tromsø Asle W Medhus, Oslo Jon Arne Søreide, Stavanger Kjetil Soreide, Stavanger Reidar Fossmark, Trondheim Trond Peder Flaten, Trondheim Olav Dalgard, Oslo Ole Høie, Arendal Magdy El-Salhy, Bergen Jørgen Valeur, Oslo Pakistan Shahab Abid, Karachi Syed MW Jafri, Karachi Poland Beata Jolanta Jablońska, Katowice Halina Cichoż-Lach, Lublin Tomasz Brzozowski, Cracow Hanna Gregorek, Warsaw Marek Hartleb, Katowice Stanislaw J Konturek, Krakow Andrzej Dabrowski, Bialystok Jan Kulig, Kraków Julian Swierczynski, Gdansk Marek Bebenek, Wroclaw Dariusz M Lebensztejn, Bialystok Portugal Ricardo Marcos, Porto Guida Portela-Gomes, Estoril Ana Isabel Lopes, Lisboa Codex Raquel Almeida, Porto Rui Tato Marinho, Lisbon Ceu Figueiredo, Porto Romania Dan L Dumitrascu, Cluj Adrian Saftoiu, Craiova Andrada Seicean, Cluj-Napoca Anca Trifan, Iasi Russia Vasiliy I Reshetnyak, Moscow Saudi Arabia Ibrahim A Al Mofleh, Riyadh Abdul-Wahed Meshikhes, Qatif Faisal Sanai, Riyadh Serbia Tamara M Alempijevic, Belgrade Dusan M Jovanovic, Sremska Kamenica Zoran Krivokapic, Belgrade Singapore Brian Kim Poh Goh, Singapore Khek-Yu Ho, Singapore Fock Kwong Ming, Singapore Francis Seow-Choen, Singapore Kok Sun Ho, Singapore Kong Weng Eu, Singapore Madhav Bhatia, Singapore London Lucien Ooi, Singapore Wei Ning Chen, Singapore Richie Soong, Singapore Kok Ann Gwee, Singapore Slovenia Matjaz Homan, Ljubljana South Africa Rosemary Joyce Burnett, Pretoria Michael Kew, Cape Town Roland Ndip, Alice South Korea Byung Chul Yoo, Seoul Jae J Kim, Seoul Jin-Hong Kim, Suwon Marie Yeo, Suwon Jeong Min Lee, Seoul Eun-Yi Moon, Seoul Joong-Won Park, Goyang Hoon Jai Chun, Seoul Myung-Gyu Choi, Seoul Sang Kil Lee, Seoul Sang Yeoup Lee, Gyeongsangnam-do Won Ho Kim, Seoul Dae-Yeul Yu, Daejeon Donghee Kim, Seoul Sang Geon Kim, Seoul Sun Pyo Hong, Geonggi-do Sung-Gil Chi, Seoul Yeun-Jun Chung, Seoul Ki-Baik Hahm, Incheon Ji Kon Ryu, Seoul Kyu Taek Lee, Seoul Yong Chan Lee, Seoul Seong Gyu Hwang, Seongnam Seung Woon Paik, Seoul Sung Kim, Seoul Hong Joo Kim, Seoul Hyoung-Chul Oh, Seoul Nayoung Kim, Seongnam-si Sang Hoon Ahn, Seoul Seon Hahn Kim, Seoul Si Young Song, Seoul Young-Hwa Chung, Seoul Hyo-Cheol Kim, Seoul Kwang Jae Lee, Swon Sang Min Park, Seoul Young Chul Kim, Seoul Do Hyun Park, Seoul Dae Won Jun, Seoul Dong Wan Seo, Seoul Soon-Sun Hong, Incheon Hoguen Kim, Seoul Ho-Young Song, Seoul Joo-Ho Lee, Seoul Jung Eun Lee, Seoul Jong H Moon, Bucheon Spain Eva Vaquero, Barcelona Andres Cardenas, Barcelona Laureano Fernández-Cruz, Barcelona Antoni Farré, Spain Maria-Angeles Aller, Madrid Raul J Andrade, Málaga Fernando Azpiroz, Barcelona Josep M Bordas, Barcelona Antoni Castells, Barcelona Vicente Felipo, Valencia Isabel Fabregat, Barcelona Angel Lanas, Zaragoza Juan-Ramón Larrubia, Guadalajara María IT López, Jaén Jesús M Prieto, Pamplona Mireia Miquel, Sabadell Ramon Bataller, Barcelona Fernando J Corrales, Pamplona Julio Mayol, Madrid Matias A Avila, Pamplona Juan Macías, Seville Juan Carlos Laguna Egea, Barcelona Juli Busquets, Barcelona Belén Beltrán, Valencia José Manuel Martin-Villa, Madrid Lisardo Boscá, Madrid Luis Grande, Barcelona Pedro Lorenzo Majano Rodriguez, Madrid Adolfo Benages, Valencia Domínguez-Muñoz JE, Santiago de Compostela Gloria González Aseguinolaza, Navarra Javier Martin, Granada Luis Bujanda, San Sebastián Matilde Bustos, Pamplona Luis Aparisi, Valencia José Julián calvo Andrés, Salamanca Benito Velayos, Valladolid Javier Gonzalez-Gallego, León Ruben Ciria, Córdoba Francisco Rodriguez-Frias, Barcelona Manuel Romero-Gómez, Sevilla Albert Parés, Barcelona Joan Roselló-Catafau, Barcelona Sri Lanka Arjuna De Silva, Kelaniya Sweden Stefan G Pierzynowski, Lund Hanns-Ulrich Marschall, Stockholm Lars A Pahlman, Uppsala Helena Nordenstedt, Stockholm Bobby Tingstedt, Lund Evangelos Kalaitzakis, Gothenburg Lars Erik Agréus, Huddinge Annika Lindblom, Stockholm VI March 7, 2013

8 Roland Andersson, Lund Zongli Zheng, Stockholm Mauro D'Amato, Huddinge Greger Lindberg, Stockholm Pär Erik Myrelid, Linköping Sara Lindén, Göteborg Sara Regnér, Malmö Åke Nilsson, Lund Switzerland Jean L Frossard, Geneva Andreas Geier, Zürich Bruno Stieger, Zürich Pascal Gervaz, Geneva Paul M Schneider, Zurich Felix Stickel, Berne Fabrizio Montecucco, Geneva Inti Zlobec, Basel Michelangelo Foti, Geneva Pascal Bucher, Geneva Andrea De Gottardi, Berne Christian Toso, Geneva Thailand Weekitt Kittisupamongkol, Bangkok Trinidad and Tobago Shivananda Nayak, Mount Hope Turkey Tarkan Karakan, Ankara Yusuf Bayraktar, Ankara Ahmet Tekin, Mersin Aydin Karabacakoglu, Konya Osman C Ozdogan, Istanbul Özlem Yilmaz, Izmir Bülent Salman, Ankara Can GONEN, Kutahya Cuneyt Kayaalp, Malatya Ekmel Tezel, Ankara Eren Ersoy, Ankara Hayrullah Derici, Balıkesir Mehmet Refik Mas, Etlik-Ankara Sinan Akay, Tekirdag A Mithat Bozdayi, Ankara Metin Basaranoglu, Istanbul Mesut Tez, Ankara Orhan Sezgin, Mersin Mukaddes Esrefoglu, Malatya Ilker Tasci, Ankara Kemal Kismet, Ankara Selin Kapan, Istanbul Seyfettin Köklü, Ankara Murat Sayan, Kocaeli Sabahattin Kaymakoglu, Istanbul Yucel Ustundag, Zonguldak Can Gonen, Istanbul Yusuf Yilmaz, Istanbul Müge Tecder-Ünal, Ankara İlhami Yüksel, Ankara United Arab Emirates Fikri M Abu-Zidan, Al-Ain Sherif M Karam, Al-Ain United Kingdom Anastasios Koulaouzidis, Edinburgh Sylvia LF Pender, Southampton Hong-Xiang Liu, Cambridge William Dickey, Londonderry Simon D Taylor-Robinson, London James Neuberger, Birmingham Frank I Tovey, London Kevin Robertson, Glasgow Chew Thean Soon, Manchester Geoffrey Burnstock, London Vamsi R Velchuru, United Kingdom Simon Afford, Birmingham Navneet K Ahluwalia, Stockport Lesley A Anderson, Belfast Anthony TR Axon, Leeds Jim D Bell, London Alastair D Burt, Newcastle Tatjana Crnogorac-Jurcevic, London Daniel R Gaya, Edinburgh William Greenhalf, Liverpool Indra N Guha, Southampton Stefan G Hübscher, Birmingham Robin Hughes, London Pali Hungin, Stockton Janusz AZ Jankowski, Oxford Peter Karayiannis, London Patricia F Lalor, Birmingham Giorgina Mieli-Vergani, London D Mark Pritchard, Liverpool Marco Senzolo, Padova Roger Williams, London M H Ahmed, Southampton Christos Paraskeva, Bristol Emad M El-Omar, Aberdeen A M El-Tawil, Birmingham Anne McCune, Bristol Charles B Ferguson, Belfast Chin Wee Ang, Liverpool Clement W Imrie, Glasgow Dileep N Lobo, Nottingham Graham MacKay, Glasgow Guy Fairbairn Nash, Poole Ian Lindsey, Oxford Jason CB Goh, Birmingham Jeremy FL Cobbold, London Julian RF Walters, London Jamie Murphy, London John Beynon, Swansea John B Schofield, Kent Anil George, London Aravind Suppiah, East Yorkshire Basil Ammori, Salford Catherine Walter, Cheltenham Chris Briggs, Sheffield Jeff Butterworth, Shrewsbury Nawfal Hussein, Nottingham Patrick O'Dwyer, Glasgow Rob Glynne-Jones, Northwood Sharad Karandikar, Venkatesh Shanmugam, Derby Yeng S Ang, Wigan Alberto Quaglia, London Andrew Fowell, Southampton Gianpiero Gravante, Leicester Piers Gatenby, London Kondragunta Rajendra Prasad, Leeds Sunil Dolwani, Cardiff Andrew McCulloch Veitch, Wolverhampton Brian Green, Belfast Noriko Suzuki, Middlesex Richard Parker, North Staffordshire Shahid A Khan, London Akhilesh B Reddy, Cambridge Jean E Crabtree, Leeds John S Leeds, Sheffield Paul Sharp, London Sumita Verma, Brighton Thamara Perera, Birmingham Donald Campbell McMillan, Glasgow Kathleen B Bamford, London Helen Coleman, Belfast Eyad Elkord, Manchester Mohammad Ilyas, Nottingham Simon R Carding, Norwich Ian Chau, Sutton Claudio Nicoletti, Norwich Hendrik-Tobias Arkenau, London Muhammad Imran Aslam, Leicester Giuseppe Orlando, Oxford John S Leeds, Aberdeen S Madhusudan, Nottingham Amin Ibrahim Amin, Dunfermline David C Hay,Edinburgh Alan Burns, London United States Tauseef Ali, Oklahoma City George Y Wu, Farmington Josef E Fischer, Boston Thomas Clancy, Boston John Morton, Stanford Luca Stocchi, Cleveland Kevin Michael Reavis, Orange Shiu-Ming Kuo, Buffalo Gary R Lichtenstein, Philadelphia Natalie J Torok, Sacramento Scott A Waldman, Philadelphia Georgios Papachristou, Pittsburgh Carla W Brady, Durham Robert CG Martin, Louisville Eugene P Ceppa, Durham Shashi Bala, Worcester Imran Hassan, Springfield Klaus Thaler, Columbia Andreas M Kaiser, Los Angeles Shawn D Safford, Norfolk Massimo Raimondo, Jacksonville Kazuaki Takabe, Richmond VA Stephen M Kavic, Baltimore T Clark Gamblin, Pittsburgh BS Anand, Houston Ananthanarayanan M, New York Anthony J Bauer, Pittsburgh Edmund J Bini, New York Xian-Ming Chen, Omaha Ramsey Chi-man Cheung, Palo Alto Parimal Chowdhury, Arkansas Mark J Czaja, New York VII March 7, 2013

9 Conor P Delaney, Cleveland Sharon DeMorrow, Temple Bijan Eghtesad, Cleveland Alessandro Fichera, Chicago Glenn T Furuta, Aurora Jean-Francois Geschwind, Baltimore Shannon S Glaser, Temple Ajay Goel, Dallas James H Grendell, New York Anna S Gukovskaya, Los Angeles Jamal A Ibdah, Columbia Atif Iqbal, Omaha Hajime Isomoto, Rochester Hartmut Jaeschke, Kansas Leonard R Johnson, Memphis Rashmi Kaul, Tulsa Ali Keshavarzian, Chicago Miran Kim, Providence Burton I Korelitz, New York Richard A Kozarek, Seattle Alyssa M Krasinskas, Pittsburgh Ming Li, New Orleans Zhiping Li, Baltimore Chen Liu, Gainesville Michael R Lucey, Madison James D Luketich, Pittsburgh Patrick M Lynch, Houston Willis C Maddrey, Dallas Mercedes Susan Mandell, Aurora Wendy M Mars, Pittsburgh Laura E Matarese, Pittsburgh Lynne V McFarland, Washington Stephan Menne, New York Didier Merlin, Atlanta George Michalopoulos, Pittsburgh James M Millis, Chicago Pramod K Mistry, New Haven Emiko Mizoguchi, Boston Peter L Moses, Burlington Masaki Nagaya, Boston Robert D Odze, Boston Stephen JD O Keefe, Pittsburgh Zhiheng Pei, New York Raymund R Razonable, Minnesota Basil Rigas, New York Richard A Rippe, Chapel Hill Philip Rosenthal, San Francisco Stuart Sherman, Indianapolis Christina Surawicz, Seattle Wing-Kin Syn, Durham Yvette Taché, Los Angeles K-M Tchou-Wong, New York George Triadafilopoulos, Stanford Chung-Jyi Tsai, Lexington Andrew Ukleja, Florida Arnold Wald, Wisconsin Irving Waxman, Chicago Steven D Wexner, Weston Jackie Wood, Ohio Jian Wu, Sacramento Zobair M Younossi, Virginia Liqing Yu, Winston-Salem Ruben Zamora, Pittsburgh Michael E Zenilman, New York Michael A Zimmerman, Colorado Beat Schnüriger, California Clifford S Cho, Madison R Mark Ghobrial, Texas Anthony T Yeung, Philadelphia Chang Kim, West Lafayette Balamurugan N Appakalai, Minneapolis Aejaz Nasir, Tampa Ashkan Farhadi, Irvine Kevin E Behrns, Gainesville Joseph J Cullen, Iowa City David J McGee, Shreveport Anthony J Demetris, Pittsburgh Dimitrios V Avgerinos, New York Dong-Hui Li, Houston Eric S Hungness, Chicago Giuseppe Orlando, Winston Salem Hai-Yong Han, Phoenix Huanbiao Mo, Denton Jong Park, Tampa Justin MM Cates, Nashville Charles P Heise, Madison Craig D Logsdon, Houston Ece A Mutlu, Chicago Jessica A Davila, Houston Rabih M Salloum, Rochester Amir Maqbul Khan, Marshall Bruce E Sands, Boston Chakshu Gupta, Saint Joseph Ricardo Alberto Cruciani, New York Mariana D Dabeva, Bronx Edward L Bradley III, Sarasota Martín E Fernández-Zapico, Rochester Henry J Binder, New Haven John R Grider, Richmond Ronnie Fass, Tucson Dinesh Vyas, Washington Wael El-Rifai, Nashville Craig J McClain, Louisville Christopher Mantyh, Durham Daniel S Straus, Riverside David A Brenner, San Diego Eileen F Grady, San Francisco Ekihiro Seki, La Jolla Fang Yan, Nashville Fritz Francois, New York Giamila Fantuzzi, Chicago Guang-Yin Xu, Galveston Jianyuan Chai, Long Beach JingXuan Kang, Charlestown Le Shen, Chicago Lin Zhang, Pittsburgh Mitchell L Shiffman, Richmond Douglas K Rex, Indianapolis Bo Shen, Cleveland Edward J Ciaccio, New York Jean S Wang, Saint Louis Bao-Ting Zhu, Kansas Tamir Miloh, Phoenix Eric R Kallwitz, Chicago Yujin Hoshida, Cambridge C Chris Yun, Atlanta Alan C Moss, Boston Oliver Grundmann, Gainesville Linda A Feagins, Dallas Chanjuan Shi, Nashville Xiaonan Han, Cincinnati William R Brugge, Boston Richard W McCallum, El Paso Lisa Ganley-Leal, Boston Lin-Feng Chen, Urbana Elaine Y Lin, New York Julian Abrams, New York Arun Swaminath, New York Huiping Zhou, Richmond Korkut Uygun, Boston Anupam Bishayee, Signal Hill C Bart Rountree, Hershey Avinash Kambadakone, Boston Courtney W Houchen, Oklahoma Joshua R Friedman, Philadelphia Justin H Nguyen, Jackonville Sophoclis Alexopoulos, Los Angeles Suryakanth R Gurudu, Scottsdale Wei Jia, Kannapolis Yoon-Young Jang, Baltimore Ourania M Andrisani, West Lafayette Roderick M Quiros, Bethlehem Timothy R Koch, Washington Adam S Cheifetz, Boston Lifang Hou, Chicago Thiru vengadam Muniraj, Pittsburgh Dhiraj Yadav, Pittsburgh Ying Gao, Rockville John F Gibbs, Buffalo Aaron Vinik, Norfolk Charles Thomas, Oregon Robert Jensen, Bethesda John W Wiley, Ann Arbor Jonathan Strosberg, Tampa Randeep Singh Kashyap, New York Kaye M Reid Lombardo, Rochester Lygia Stewart, San Francisco Martin D Zielinski, Rochester Matthew James Schuchert, Pittsburgh Michelle Lai, Boston Million Mulugeta, Los Angeles Patricia Sylla, Boston Pete Muscarella, Columbus Raul J Rosenthal, Weston Robert V Rege, Dallas Roberto Bergamaschi, New York Ronald S Chamberlain, Livingston Alexander S Rosemurgy, Tampa Run Yu, Los Angeles Samuel B Ho, San Diego Sami R Achem, Florida Sandeep Mukherjee, Omaha Santhi Swaroop Vege, Rochester Scott Steele, Fort Lewis Steven Hochwald, Gainesville Udayakumar Navaneethan, Cincinnati Radha Krishna Yellapu, New York Rupjyoti Talukdar, Rochester Shi-Ying Cai, New Haven Thérèse Tuohy, Salt Lake City Tor C Savidge, Galveston William R Parker, Durham Xiaofa Qin, Newark Zhang-Xu Liu, Los Angeles Adeel A Butt, Pittsburgh Dean Y Kim, Detroit Denesh Chitkara, East Brunswick Mohamad A Eloubeidi, Alabama JiPing Wang, Boston Oscar Joe Hines, Los Angeles Jon C Gould, Madison Kirk Ludwig, Wisconsin Mansour A Parsi, Cleveland VIII March 7, 2013

10 Perry Shen, Winston-Salem Piero Marco Fisichella, Maywood Marco Giuseppe Patti, Chicago Michael Leitman, New York Parviz M Pour, Omaha Florencia Georgina Que, Rochester Richard Hu, Los Angeles Robert E Schoen, Pittsburgh Valentina Medici, Sacramento Wojciech Blonski, Philadelphia Yuan-Ping Han, Los Angeles Grigoriy E Gurvits, New York Robert C Moesinger, Ogden Mark Bloomston, Columbus Bronislaw L Slomiany, Newark Laurie DeLeve, Los Angeles Michel M Murr, Tampa John Marshall, Columbia Wilfred M Weinstein, Los Angeles Jonathan D Kaunitz, Los Angeles Josh Korzenik, Boston Kareem M Abu-Elmagd, Pittsburgh Michael L Schilsky, New Haven John David Christein, Birmingham Mark A Zern, Sacramento Ana J Coito, Los Angeles Golo Ahlenstiel, Bethesda Smruti R Mohanty, Chicago Victor E Reyes, Galveston CS Pitchumoni, New Brunswick Yoshio Yamaoka, Houston Sukru H Emre, New Haven Branko Stefanovic, Tallahassee Jack R Wands, Providence Wen Xie, Pittsburgh Robert Todd Striker, Madison Shivendra Shukla, Columbia Laura E Nagy, Cleveland Fei Chen, Morgantown Kusum K Kharbanda, Omaha Pal Pacher, Rockville Pietro Valdastri, Nashville IX March 7, 2013

11 S Contents Weekly Volume 19 Number 40 October 28, 2013 EDITORIAL 6703 Hepatitis C, stigma and cure Marinho RT, Barreira DP FIELD OF VISION 6710 Clostridium difficile infection in the community: Are proton pump inhibitors to blame? Freedberg DE, Abrams JA TOPIC HIGHLIGHT 6714 Hepatitis C and pregnancy Floreani A 6721 Impact of exome sequencing in inflammatory bowel disease Cardinale CJ, Kelsen JR, Baldassano RN, Hakonarson H 6730 Virus entry mediated by hepatitis B virus envelope proteins Taylor JM REVIEW 6735 Pathogenesis of hepatic steatosis: The link between hypercortisolism and non-alcoholic fatty liver disease Tarantino G, Finelli C 6744 Surveillance for hepatocellular carcinoma in chronic liver disease: Evidence and controversies van Meer S, de Man RA, Siersema PD, van Erpecum KJ 6757 Role of stem cells in repair of liver injury: Experimental and clinical benefit of transferred stem cells on liver failure Esrefoglu M 6774 Risk of ileal pouch neoplasms in patients with familial adenomatous polyposis Tajika M, Niwa Y, Bhatia V, Tanaka T, Ishihara M, Yamao K 6784 Clinical applications of next-generation sequencing in colorectal cancers Kim TM, Lee SH, Chung YJ 6794 Gut-lung crosstalk in pulmonary involvement with inflammatory bowel diseases Wang H, Liu JS, Peng SH, Deng XY, Zhu DM, Javidiparsijani S, Wang GR, Li DQ, Li LX, Wang YC, Luo JM October 28, 2013 Volume 19 Issue 40

12 Contents World Journal of Gastroenterology Volume 19 Number 40 October 28, 2013 MINIREVIEWS 6805 Ligation of intersphincteric fistula tract: What is the evidence in a review? Vergara-Fernandez O, Espino-Urbina LA ORIGINAL ARTICLE 6814 Curcumin cytotoxicity is enhanced by PTEN disruption in colorectal cancer cells Chen L, Li WF, Wang HX, Zhao HN, Tang JJ, Wu CJ, Lu LT, Liao WQ, Lu XC BRIEF ARTICLE 6825 Acute arterial mesenteric ischemia and reperfusion: Macroscopic and MRI findings, preliminary report Saba L, Berritto D, Iacobellis F, Scaglione M, Castaldo S, Cozzolino S, Mazzei MA, Di Mizio V, Grassi R 6834 Risk factors for hepatocellular carcinoma in patients with drug-resistant chronic hepatitis B Jun CH, Hong HJ, Chung MW, Park SY, Cho SB, Park CH, Joo YE, Kim HS, Choi SK, Rew JS 6842 Differential diagnosis of left-sided abdominal pain: Primary epiploic appendagitis vs colonic diverticulitis Hwang JA, Kim SM, Song HJ, Lee YM, Moon KM, Moon CG, Koo HS, Song KH, Kim YS, Lee TH, Huh KC, Choi YW, Kang YW, Chung WS 6849 Antiviral therapy delays esophageal variceal bleeding in hepatitis B virus-related cirrhosis Li CZ, Cheng LF, Li QS, Wang ZQ, Yan JH 6857 Trans-umbilical endoscopic cholecystectomy with a water-jet hybrid-knife: A pilot animal study Jiang SJ, Shi H, Swar G, Wang HX, Liu XJ, Wang YG 6863 Estrogen improves the hyperdynamic circulation and hyporeactivity of mesenteric arteries by alleviating oxidative stress in partial portal vein ligated rats Zhang B, Zhang CG, Zhou QB, Chen W, Wu ZY 6869 Transarterial embolization for massive gastrointestinal hemorrhage following abdominal surgery Zhou CG, Shi HB, Liu S, Yang ZQ, Zhao LB, Xia JG, Zhou WZ, Li LS 6876 Overexpression of nuclear β-catenin in rectal adenocarcinoma is associated with radioresistance Wang L, Zhang XM, Li Z, Liu XJ, Chai J, Zhang GY, Cheng YF II October 28, 2013 Volume 19 Issue 40

13 Contents World Journal of Gastroenterology Volume 19 Number 40 October 28, Expression and significance of cyclooxygenase-2 mrna in benign and malignant ascites Lu J, Li XF, Kong LX, Ma L, Liao SH, Jiang CY 6888 Relationship between interleukin-6 polymorphism and susceptibility to chronic hepatitis B virus infection Zhao XM, Gao YF, Zhou Q, Pan FM, Li X 6894 Abnormal DNA-PKcs and Ku 70/80 expression may promote malignant pathological processes in gastric carcinoma Li W, Xie C, Yang Z, Chen J, Lu NH META-ANALYSIS 6902 Diabetes mellitus carries a risk of gastric cancer: A meta-analysis Shimoyama S 6911 Effects of probiotics on nonalcoholic fatty liver disease: A meta-analysis Ma YY, Li L, Yu CH, Shen Z, Chen LH, Li YM 6919 Restrictive vs liberal transfusion for upper gastrointestinal bleeding: A meta-analysis of randomized controlled trials Wang J, Bao YX, Bai M, Zhang YG, Xu WD, Qi XS CASE REPORT 6928 Angiotensin-Ⅱ inhibitor (olmesartan)-induced collagenous sprue with resolution following discontinuation of drug Nielsen JA, Steephen A, Lewin M 6931 Resolution of an esophageal leak and posterior gastric wall necrosis with esophageal self-expandable metal stents Almadi MA, Aljebreen AM, Bamihriz F 6934 Adjuvant surgery for advanced extrahepatic cholangiocarcinoma Oshiro Y, Takahashi K, Sasaki R, Kondo T, Sakashita S, Ohkohchi N 6939 Isolated gastric variceal bleeding caused by splenic lymphoma-associated splenic vein occlusion Chen BC, Wang HH, Lin YC, Shih YL, Chang WK, Hsieh TY 6943 Laparoscopic treatment of an upper gastrointestinal obstruction due to Bouveret s syndrome Yang D, Wang Z, Duan ZJ, Jin S III October 28, 2013 Volume 19 Issue 40

14 Contents World Journal of Gastroenterology Volume 19 Number 40 October 28, 2013 APPENDIX I-VI Instructions to authors ABOUT COVER Editorial Board Member of World Journal of Gastroenterology, Rui Tato Marinho, MD, PhD, Department of Gastroenterology and Hepatology, Hospital Santa Maria, Medical School of Lisbon, Av. Prof. Egas Moniz, , Lisboa, Portugal AIMS AND SCOPE World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1352 experts in gastroenterology and hepatology from 64 countries. The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. INDEXING/ABSTRACTING World Journal of Gastroenterology is now indexed in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Journal Citation Reports, Gastroenterology and Hepatology, 2012 Impact Factor: (34/74); Total Cites: (6/74); Current Articles: 944 (1/74); and Eigenfactor Score: (6/74). FLYLEAF I-IX Editorial Board EDITORS FOR THIS ISSUE Responsible Assistant Editor: Xin-Xin Che Responsible Electronic Editor: Dan-Ni Zhang Proofing Editor-in-Chief: Lian-Sheng Ma Responsible Science Editor: Ling-Ling Wen Proofing Editorial Office Director: Xiu-Xia Song NAME OF JOURNAL World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) LAUNCH DATE October 1, 1995 FREQUENCY Weekly EDITORS-IN-CHIEF Ferruccio Bonino, MD, PhD, Professor of Gastroenterology, Director of Liver and Digestive Disease Division, Department of Internal Medicine, University of Pisa, Director of General Medicine 2 Unit University Hospital of Pisa, Via Roma 67, Pisa, Italy Myung-Hwan Kim, MD, PhD, Professor, Head, Department of Gastroenterology, Director, Center for Biliary Diseases, University of Ulsan College of Medicine, Asan Medical Center, Pungnap- 2dong, Songpa-gu, Seoul , South Korea Kjell Öberg, MD, PhD, Professor, Department of Endocrine Oncology, Uppsala University Hospital, SE Uppsala, Sweden Matt D Rutter, MBBS, MD, FRCP, Consultant Gastroenterologist, Senior Lecturer, Director, Tees Bowel Cancer Screening Centre, University Hospital of North Tees, Durham University, Stockton-on-Tees, Cleveland TS19 8PE, United Kingdom Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States EDITORIAL OFFICE Jin-Lei Wang, Director Xiu-Xia Song, Vice Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: wjg@wjgnet.com PUBLISHER Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: bpgoffice@wjgnet.com PUBLICATION DATE October 28, 2013 COPYRIGHT 2013 Baishideng. Articles published by this Open- Access journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. SPECIAL STATEMENT All articles published in this journal represent the viewpoints of the authors except where indicated otherwise. INSTRUCTIONS TO AUTHORS Full instructions are available online at wjgnet.com/ /g_info_ htm ONLINE SUBMISSION IV October 28, 2013 Volume 19 Issue 40

15 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. EDITORIAL Hepatitis C, stigma and cure Rui Tato Marinho, David Pires Barreira Rui Tato Marinho, David Pires Barreira, Department of Gastroenterology and Hepatology Hospital Santa Maria, Medical School of Lisbon, Lisboa, Portugal Author contributions: Both of authors gave substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data, drafting the article or revising it critically for important intellectual content, and final approval of the version to be published. Correspondence to: Rui Tato Marinho, MD, PhD, Department of Gastroenterology and Hepatology, Hospital Santa Maria, Medical School of Lisbon, Av. Prof. Egas Moniz, Lisboa, Portugal. rui.marinho@mail.telepac.pt Fax: Received: July 28, 2013 Revised: August 14, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 Abstract The infection with hepatitis C virus (HCV) is one of the most important global chronic viral infections worldwide. It is estimated to affect around 3% of the world population, about million people. Great part of the infections are asymptomatic, the patient can be a chronic carrier for decades without knowing it. The most severe consequences of the chronic infection are liver cirrhosis and hepatocellular carcinoma, which appears in 20%-40% of the patients, leading to hepatic failure and death. The HCV was discovered 25 years ago in 1989, is a RNA virus and classified by the World Health Organization as an oncogenic one. Hepatocellular carcinoma is one of the most important cancers, the fifth worldwide in terms of mortality. It has been increasing in the Ocidental world, mainly due to chronic hepatitis C. Hepatitis C is not only a liver disease and a cause of cirrhosis, but also a mental, psychological, familiar, and social disease. The stigma that the infected person sometimes carries is tremendous having multiple consequences. The main cause is lack of adequate information, even in the health professionals setting. But, besides the drama of being infected, health professionals, family, society and the infected patients, must be aware of the chance of real cure and total and definitive elimination of the virus. The treatment for hepatitis C has begun in the last 80 s with a percentage of cure of 6%. Step by step the efficacy of the therapy for hepatitis C is rapidly increasing and nowadays with the very new medications, the so called Direct Antiviral Agents-DAAs of new generation, is around 80%-90% Baishideng. All rights reserved. Key words: Hepatitis C; Chronic; Therapy; Hepatocellular carcinoma; Hepatic cirrhosis; Interferon-alpha; Ribavirin; Social stigma; Depression Core tip: Around 3% of the world population, about million people are infected with hepatitis C virus. The chronic consequences of the infection are liver cirrhosis and hepatocellular carcinoma, which appears in 20%-40% of the patients. Hepatitis C is not only a liver disease but also a mental, psychological, familiar, and social disease. The stigma that the infected person sometimes carries is tremendous. But, besides the drama of being infected, health professionals, family, society and infected patients, must be aware of the chance of real cure and definitive elimination of the virus. Step by step, the efficacy of the therapy for hepatitis C is rapidly increasing and with the new medications, the Direct Antiviral Agents-DAAs, is around 80%-90%. Marinho RT, Barreira DP. Hepatitis C, stigma and cure. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: HEPATITIS C AND CURE Step by step increasing the efficacy Hepatitis C is one of the most important global chronic infection worldwide: it is estimated to affect October 28, 2013 Volume 19 Issue 40

16 Marinho RT et al. Hepatitis C, stigma and cure million people, while chronic hepatitis B and human immunodeficiency virus (HIV) infection affects respectively 350 million and 34 million. There is no vaccine for hepatitis C. Hepatitis B is easily preventable by vaccination. Another characteristic of hepatitis C virus (HCV) infection is the high risk of evolution to chronicity, more than 50% which can be around 80% in same series [1]. Another characteristic is the absence of symptoms for decades before the phase of decompensation of liver cirrhosis and the appearance of hepatocellular carcinoma. The most severe chronic consequences of the infection are liver cirrhosis and hepatocellular carcinoma, leading to hepatic failure and death, which can appear in 20%-40% of the patients [2]. In effect, cirrhosis is the end-stage of every chronic liver disease. Its natural history is characterized by an asymptomatic phase, called compensated followed after several years or decades by a decompensated phase. The patient, in the decompensated phase has a median of survival of 2 years [3]. This phase can be characterized by a rapid clinical evolution with all the complications of a cirrhotic liver with portal hypertension: ascites, sepsis (the majority from spontaneous bacterial peritonitis), varices bleeding, jaundice, mental alterations (encephalopathy), renal failure (hepatorenal syndrome), caquexia [4,5]. Liver cirrhosis is one of the most oncogenic situations in medical terms. The development of hepatocellular carcinoma (HCC) is a real fact, occurring in 1%-4% each year and is becoming in some centers the most frequent complication of HCV cirrhosis [6]. The quality of life in the decompensated phase can be very poor with frequent hospitalizations and readmissions [7]. At this stage only liver transplantation is really effective for median or long term survival. But if the virus is still active, the reinfection is almost universal [8]. But, besides the drama of being infected, health professionals, family, society and infected patients, must be aware of the chance of real cure and total and definitive elimination of the virus [9]. The HCV was discovered 25 years ago in 1989, is a RNA virus and classified by the World Health Organization as an oncogenic one [10]. The discover of the virus has open the way to a diagnosis test (anti-hcv) and several studies of molecular biology, virology and pharmacology [11]. The treatments for hepatitis C has begun in the last 80 s with a percentage of cure of 6% [12]. Step by step the efficacy of the therapy for hepatitis C is rapidly increasing and nowadays with the very new medications, the oral Direct Antiviral Agents-DAAs, is around 80%-90% [13]. The therapy of hepatitis C is an example of the capacity of modern medicine to translate the basic research to the clinical setting (Figure 1). Several types of medications have been used in to treat hepatitis C throughout these 25 years of success: first, human interferon (INF, three times weekly, 6% of efficacy), in 1995 Ribavirin has appeared to be used in combination with INF (34%-42% of efficacy), in 2001 Pegylated INF once weekly with Percentage IFN SC 3Xw 24w Landmarks of efficacy of treatments in chronic hepatitis C, genotype 1 PEG-IFN 1Xw + RBV 24-48w + Boceprevir or Telaprevir PEG-IFN SC 1Xw + RBV 48w IFN SC 3Xw + RBV 48w Oral (DAA's) 12w t /yr Figure 1 Percentage of cure of hepatitis C genotype 1. IFN: Interferon; RBV: Ribavirine; PEG: Peginterferon; DAA: Direct antiviral agents. ribavirin (45% of cure for genotype 1 and 70%-80% for genotype 3) [14]. In 2011 another step with the combination of Peginterferon and Ribavirin with two Protease inhibitors, region 3/4 (Boceprevir [15] and Telaprevir [16] ), the triple therapy, leading to cure in 70%-80% of cases. Several clinical trials are in rapid development worldwide with the new DAA s (Direct Acting Antiviral Agents) interacting with several of vital components of the virus (NS 3/4, NS5A, NS5B Polymerase, etc.). In effect a new generation medications is rapidly approaching, like Sofosbuvir [13], Daclastavir, Asunaprevir [17], ABT-450 [18], Faldaprevir, Simeprevir, Deleobuvir, some of them only using oral agents, for a period of 12 wk, with a few negligible side effects, having a chance of viral eradication of 80%-90%. In fact, in a quarter of a century, the percentage of cure has increased from 6% to 90% of cure. From three injections a week during 48 wk to some pills a day during 12 wk! Another important development that has positively affected the quality of life of patients, allowing access to treatment and possible cure is the Transitory Elastography (Fibroscan ). Is an ultrasonographic device with very good acuity in the diagnosis of liver fibrosis, mainly when there is liver cirrhosis. The number of liver biopsies has decreased [19] in some centers around 90%. The efficacy of the therapy is assessed by on important finding, i.e., the viral load: RNA HCV (by a sensitive test) must be negative 24 wk after stopping therapy. If this happens, more than 99% of patients will never be positive again. Cure of hepatitis C It is the only global chronic viral infection that is possible to cure. The other ones are hepatitis B and HIV infecting respectively 350 and 34 million people worldwide but with no chance of cure in chronic cases. In the beginning of this story of success, the medical community was afraid of the word cure. But now it is well known this word can be used with property but with some restrictions. In effect is a virological cure for 6704 October 28, 2013 Volume 19 Issue 40

17 Marinho RT et al. Hepatitis C, stigma and cure Table 1 Benefits of cure of hepatitis C Benefits of cure of hepatitis 1 Negative HCV RNA (viral load) for life, in more than 99% of cases 2 Negative HCV RNA in the liver 3 HCV RNA negativation in PBMC 4 No detection of the genotype 5 Sometimes, a few year later, the anti-hcv test can became negative, the so called seroreversion 6 Normalization of aminotransferases (AST, ALT) and GGT 7 Changing of ultrasound findings (contours can became regular, reduce of diameter of portal vein in case of portal hypertension) 8 Disappearance of the lymphnodes near the liver (helium) 9 Decrease of the values for Elastography (Fibroscan ) 10 Reducing the risk of progression to cirrhosis 11 Reversion of cirrhosis in some cases 12 Disappearance of oesophageal varices 13 Reducing the risk of progression to liver cancer 14 Reduced risk of decompensated liver disease (ascites, jaundice, rupture of oesophageal varices, encephalopathy) 15 Reducing to zero the risk of recurrence after liver transplantation (if necessary) 16 Improved quality of life (asthenia, fatigue, general well-being) 17 Reducing of the psychological impact (anxiety/depression) 18 Disappearance of the risk of sexual transmission 19 Disappearance of the risk of perinatal transmission 20 Decrease in the insurance premium 21 Cure of associated conditions (porphyria cutanea tarda, polyneuropathy, urticaria, cryoglobulinemia, splenic lymphoma) 22 Reducing personal, family and social stigma 23 The treatment is proved cost-effective 24 Benefit to public health 25 Reduced risk of death from liver disease 26 Neurocognitive improvement 27 Cure of hepatitis C Benefits of virological response (HCV RNA negative 24 wk after finishing therapy). HCV: Hepatitis C virus; PBMC: Peripheral Blood Mononuclear Cells; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; GGT: Gamma-glutamyl transferase. life. It is proved that virus is not detected on liver cells or mononuclear blood cells. Nor there is an occult disease as is the case for chronic hepatitis B (HBV DNA negative or with low levels, having HBsAg negative and a risk of relapse in case of immunosuppression). Albeit is a definitive one, we must be cautious in patients having liver cirrhosis, because the chance of development of hepatocellular carcinoma is strongly reduced, but still remains. It is one of the reasons to treat patients with mild or moderate fibrosis, in order to reduce the chance, while in a stage of a less severe disease, of evolution to cirrhosis and hepatocellular carcinoma. Liver cirrhosis, per se, is a disease having a risk of 1%-4% per year of evolution to hepatocellular carcinoma. The benefits of cure are tremendous. Hepatitis C should be considered a global disease. As for the definition of Health of World Health Organization, ( Health is a state of complete physical, mental and social wellbeing and not merely the absence of disease or infirmity ) chronic hepatitis C is a physical, mental and social disease, affecting globally the individual, the couple, the family, and the society as a whole. There are some myths about hepatitis C: almost always lethal, more severe than acquired immunodeficiency syndrome (AIDS), very contagious disease, not curable, the adverse events of therapy are huge and very severe, etc. But the benefits of cure, in global terms considering the physical, mental and social aspects are several (Table 1). Mental health and quality of life in hepatitis C Besides the natural history of this disease, the personal impacts of a diagnosis of hepatitis C infection and its treatment strongly affect the patients quality of life [20-22]. Mental health problems frequently occur in chronic infection with HCV and during the antiviral treatment. These individuals frequently present neuropsychiatric symptoms like fatigue, anxiety, depression and cognitive disorders [23,24]. Regarding neuropsychiatric symptoms, one can identify two distinctive patterns in its relation with HCV infection. On one hand, individuals with chronic hepatitis C have higher prevalence of psychiatric disorders, including depression [25]. On the other hand, individuals with psychiatric records present higher HCV infection rates than the average population [26]. A combined therapeutics using Pegylated IFN is commonly used in these patients and proves to be a fundamental and consensual intervention for a favourable change in the natural history of the disease [27,28]. However, this treatment is associated with a high number of adverse reactions like: irritability, insomnia, fatigue and loss of appetite. Apart from these, neuropsychiatric symptoms (especially depression, and sometimes with suicidal ideation) are among the most common secondary effects in therapeutics with IFN, being one of the main causes why patients interrupt their treatment [24,29,30]. It is noteworthy that, up to a certain extent, psychopathologic symptoms (depression, cognitive disorders) may be associated to HCV infection, even without an INF treatment, and may be related to direct HCV neurotoxicity [29-32]. A large number of patients undergoing treatment for VHC infection should be referred for psychiatric evaluation and, if necessary, should received treatment for depression and other neuropsychiatric symptoms. Recognition of depression and other neuropsychiatric symptoms is important, and could improve adherence to VHC treatment. This symptomatology negatively affects the individual s perceived quality of life, its general functioning, work capacities, less participation in life and medical care, increase mobility and mortality, decrease overall well-being and quality of life [27,33]. Furthermore, therapeutic used in HCV treatment is associated to impairment in all of these dimensions [34]. Thus, considering the impact in patients mental health, before and during the treatment, an interdisciplinary approach should be followed and encouraged when dealing with HCV infected patients [24]. Stigma and hepatitis C Diagnosis with hepatitis C was reported to have pro October 28, 2013 Volume 19 Issue 40

18 Marinho RT et al. Hepatitis C, stigma and cure found impacts on social functioning. Perceived stigma associated with HCV infection leads to high levels of anxiety and exaggerated fear of transmission, and it can be a major cause of social isolation and reduced intimacy in relationships [35]. Epidemiological studies suggest that more than 90% of transmission in developed countries takes place through the sharing of non-sterilized needles and syringes in the intravenous drug-using population [36]. Because the vast majority of people with hepatitis C have a history of intravenous drug use, they are frequently blamed for acquiring the disease, and viewed as irresponsible, accountable and unworthy [37]. Furthermore, as a blood-borne disease, hepatitis C is strongly associated with HIV. This association exists due to the fact that intravenous drug abuse is a significant risk factor for contracting both diseases and this can be a stigmatizing factor for this patients [38] Stigma can be defined as attitudes expressed by a dominant group, which views a collection of others as socially unacceptable. The notion of stigma denoting shameful relations and deviations from what is considered normal has a long history within infections disease, in particular HIV [39], and more recently in hepatitis C infection. These norms, behaviours and beliefs surrounding hepatitis C infection can lead to alienation from family and friends, as well as to discrimination (perceived or real) in health services and workplaces [40]. Stigma can affect self-esteem and quality of life. It can also impede the success of diagnosis and treatment, leading to continuing risk of disease transmission. It is a social phenomenon that influences the course of illness and marginalizes patients [41]. Since stigmatization affects not only the individual but also the whole course of the disease, health care workers are not immune to stereotypes and judgements that might influence the course of the treatment of HCV patients. Changing this behaviour will help prevent patients isolation, withdrawal of treatment and it will increase the search for medical help [42]. Hepatitis C should have a global approach in its treatment. It requires broad-based educational efforts in order to increase the understanding of this disease, still connected to several pejorative stereotypes [42]. These efforts should include patients and their family, health care providers and the society as a whole. Further knowledge of hepatitis C stigma is central to assisting patients in selfmanaging their illness, and it is important to reduce the disease burden. Several benefits of cure hepatitis C The goal of therapy is to eradicate HCV infection. The endpoint of therapy is sustained virological response (SVR). Once obtained, SVR usually equates to cure of infection in more than 99% of patients [43]. If the test for assessing viral load is negative 24 wk after finishing therapy, we can talk of cure. With the new treatments, the oral DAAs, the assessment of sustained viral response can be shortened to 12 wk after ending the treatment. HCV RNA detection and quantification should be made by a sensitive assay (lower limit of detection of 50 IU/mL or less), ideally a real-time PCR assay. If the patient has already cirrhosis, the risk of develop hepatocellular carcinoma still persist for some years and deserves an abdominal ultrasound every six mouths. When the SVR is obtained the global benefit is as it follows: if there is no another reason for AST, ALT or GGT elevation, namely alcohol consumption or obesity, they became persistently normal. At virological level, the HCV RNA is no longer detected in the liver [44] or even in the Peripheral Blood Mononuclear Cells (PBMC) by sensitive tests [45]. The genotype becomes and remains negative, because there is no virus for detection. One of the things that can cause some confusion is the fact that the anti-hcv (a marker of past infection) generally remains positive. The index can decrease slowly and the anti-hcv can became negative, several years after, as it happens in the context of acute hepatitis C [46]. On the Hepatic Elastography (Fibroscan ) the values generally decrease along some months [47]. At the abdominal ultrasound the findings can change: the liver contours can become regular, the diameter of portal vein reduces in case of presence of portal hypertension. The disappearance of the lymph nodes in the hepatic hilum can be a finding [48]. There are some studies showing thatdimensions of these lymph nodes are related with the levels of viral replication [49]. Regarding liver disease the risk of progression to cirrhosis decreases. In some cases it occurs a reversion of cirrhosis [50]. In fact this is no longer an irreversible situation as was thought some years ago; the disappearance of oesophageal varices is also fact [51]. On the other side, there is a decrease of risk of evolution for more severe stages of liver disease like the progression hepatocellular carcinoma [52] and risk of the decompensated liver disease (ascites, jaundice, rupture of oesophageal varices, encephalopathy, jaundice, etc.) [53]. In the case that a liver transplantation would be necessary the risk of reactivation is no longer present. More than 95% of cases of patients transplanted for cirrhosis associated with HCV will have again HCV RNA positive and 50% will develop severe forms of liver disease a few years after transplant [54]. Because of that, to treat patients with cirrhosis or intense fibrosis must be done as soon as possible. There is an improvement of quality of life [55] (asthenia, fatigue, general well-being, etc.) assessed by adequate tests and more important on the mental level there is a reduction of the psychological impact (anxiety and/or depression). In strong relation to cure, the risk of sexual [56] and perinatal transmission [57] disappear. These are very important advantages of SVR in the treatment of hepatitis C. We must not forget, that hepatitis C, besides a liver 6706 October 28, 2013 Volume 19 Issue 40

19 Marinho RT et al. Hepatitis C, stigma and cure disease is also an infectious and transmissible disease. We can consider the cure as belonging to the patient himself but also to his family, his couple, etc. Is also a familiar disease. There are some patients who don t tell the family or to the couple afraid of the consequences of the bad new. If patients insist with Insurance Companies they must decrease the insurance premium because there is less risk of clinical evolution. There are reports of the control and even disappearance of some associated conditions like porphyria cutanea tarda [58], polyneuropathy [59], urticaria [60], cryoglobulinemia [61], splenic lymphoma [62,63]. Depending on the countries and the burden of the infection, the treatment was proved to be cost-effective [64]. Reducingof personal, psychological, family and social stigma is a huge benefit for all. Stigma is a fact that must be considered in the setting of HCV therapy and also when considering the real burden of the disease. CONCLUSION Considering the global approach we can consider that to cure HCV chronic infection is a real benefit to public health mainly by reducing the risk of complications and dying because of liver disease. Having access to the most modern therapies, the disease is almost a curable disease and the efficacy of treatment markedly increases the survival of patients infected. Chronic hepatitis C is a silent epidemic, a global disease with a strong stigma, but with high chance of definitive cure [65]. REFERENCES 1 Loomba R, Rivera MM, McBurney R, Park Y, Haynes- Williams V, Rehermann B, Alter HJ, Herrine SK, Liang TJ, Hoofnagle JH, Heller T. The natural history of acute hepatitis C: clinical presentation, laboratory findings and treatment outcomes. Aliment Pharmacol Ther 2011; 33: [PMID: DOI: /j x] 2 Sangiovanni A, Prati GM, Fasani P, Ronchi G, Romeo R, Manini M, Del Ninno E, Morabito A, Colombo M. The natural history of compensated cirrhosis due to hepatitis C virus: A 17-year cohort study of 214 patients. Hepatology 2006; 43: [PMID: DOI: /hep.21176] 3 D Amico G, Garcia-Tsao G, Pagliaro L. Natural history and prognostic indicators of survival in cirrhosis: a systematic review of 118 studies. J Hepatol 2006; 44: [PMID: DOI: /j.jhep ] 4 Planas R, Ballesté B, Alvarez MA, Rivera M, Montoliu S, Galeras JA, Santos J, Coll S, Morillas RM, Solà R. Natural history of decompensated hepatitis C virus-related cirrhosis. A study of 200 patients. J Hepatol 2004; 40: [PMID: DOI: /j.jhep ] 5 Benvegnù L, Gios M, Boccato S, Alberti A. Natural history of compensated viral cirrhosis: a prospective study on the incidence and hierarchy of major complications. Gut 2004; 53: [PMID: ] 6 Bolondi L, Sofia S, Siringo S, Gaiani S, Casali A, Zironi G, Piscaglia F, Gramantieri L, Zanetti M, Sherman M. Surveillance programme of cirrhotic patients for early diagnosis and treatment of hepatocellular carcinoma: a cost effectiveness analysis. Gut 2001; 48: [PMID: ] 7 Talwalkar JA. Determining the extent of quality health care for hospitalized patients with cirrhosis. Hepatology 2005; 42: [PMID: DOI: /hep.20753] 8 Roche B, Samuel D. Hepatitis C virus treatment pre- and post-liver transplantation. Liver Int 2012; 32 Suppl 1: [PMID: DOI: /j x] 9 Morisco F, Granata R, Stroffolini T, Guarino M, Donnarumma L, Gaeta L, Loperto I, Gentile I, Auriemma F, Caporaso N. Sustained virological response: a milestone in the treatment of chronic hepatitis C. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19.i ] 10 Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cdna clone derived from a blood-borne non-a, non-b viral hepatitis genome. Science 1989; 244: [PMID: ] 11 Kuo G, Choo QL, Alter HJ, Gitnick GL, Redeker AG, Purcell RH, Miyamura T, Dienstag JL, Alter MJ, Stevens CE. An assay for circulating antibodies to a major etiologic virus of human non-a, non-b hepatitis. Science 1989; 244: [PMID: ] 12 Hoofnagle JH, Mullen KD, Jones DB, Rustgi V, Di Bisceglie A, Peters M, Waggoner JG, Park Y, Jones EA. Treatment of chronic non-a,non-b hepatitis with recombinant human alpha interferon. A preliminary report. N Engl J Med 1986; 315: [PMID: DOI: / nejm ] 13 Lawitz E, Mangia A, Wyles D, Rodriguez-Torres M, Hassanein T, Gordon SC, Schultz M, Davis MN, Kayali Z, Reddy KR, Jacobson IM, Kowdley KV, Nyberg L, Subramanian GM, Hyland RH, Arterburn S, Jiang D, McNally J, Brainard D, Symonds WT, McHutchison JG, Sheikh AM, Younossi Z, Gane EJ. Sofosbuvir for previously untreated chronic hepatitis C infection. N Engl J Med 2013; 368: [PMID: DOI: /NEJMoa ] 14 Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Gonçales FL, Häussinger D, Diago M, Carosi G, Dhumeaux D, Craxi A, Lin A, Hoffman J, Yu J. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: /NEJ- Moa020047] 15 Poordad F, McCone J, Bacon BR, Bruno S, Manns MP, Sulkowski MS, Jacobson IM, Reddy KR, Goodman ZD, Boparai N, DiNubile MJ, Sniukiene V, Brass CA, Albrecht JK, Bronowicki JP. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 16 McHutchison JG, Manns MP, Muir AJ, Terrault NA, Jacobson IM, Afdhal NH, Heathcote EJ, Zeuzem S, Reesink HW, Garg J, Bsharat M, George S, Kauffman RS, Adda N, Di Bisceglie AM. Telaprevir for previously treated chronic HCV infection. N Engl J Med 2010; 362: [PMID: DOI: /NEJMoa ] 17 Suzuki Y, Ikeda K, Suzuki F, Toyota J, Karino Y, Chayama K, Kawakami Y, Ishikawa H, Watanabe H, Hu W, Eley T, McPhee F, Hughes E, Kumada H. Dual oral therapy with daclatasvir and asunaprevir for patients with HCV genotype 1b infection and limited treatment options. J Hepatol 2013; 58: [PMID: DOI: /j.jhep ] 18 Lawitz E, Poordad F, Kowdley KV, Cohen DE, Podsadecki T, Siggelkow S, Larsen L, Menon R, Koev G, Tripathi R, Pilot- Matias T, Bernstein B. A phase 2a trial of 12-week interferonfree therapy with two direct-acting antivirals (ABT-450/r, ABT-072) and ribavirin in IL28B C/C patients with chronic hepatitis C genotype 1. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 19 Trifan A, Stanciu C. Checkmate to liver biopsy in chronic hepatitis C? World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 20 Miller ER, McNally S, Wallace J, Schlichthorst M. The ongoing impacts of hepatitis c--a systematic narrative review of the literature. BMC Public Health 2012; 12: 672 [PMID: DOI: / ] 6707 October 28, 2013 Volume 19 Issue 40

20 Marinho RT et al. Hepatitis C, stigma and cure 21 Braitstein P, Montessori V, Chan K, Montaner JS, Schechter MT, O Shaughnessy MV, Hogg RS. Quality of life, depression and fatigue among persons co-infected with HIV and hepatitis C: outcomes from a population-based cohort. AIDS Care 2005; 17: [PMID: DOI: / ] 22 Younossi Z, Kallman J, Kincaid J. The effects of HCV infection and management on health-related quality of life. Hepatology 2007; 45: [PMID: DOI: / hep.21565] 23 Dieperink E, Willenbring M, Ho SB. Neuropsychiatric symptoms associated with hepatitis C and interferon alpha: A review. Am J Psychiatry 2000; 157: [PMID: ] 24 Schaefer M, Capuron L, Friebe A, Diez-Quevedo C, Robaeys G, Neri S, Foster GR, Kautz A, Forton D, Pariante CM. Hepatitis C infection, antiviral treatment and mental health: a European expert consensus statement. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 25 Johnson ME, Fisher DG, Fenaughty A, Theno SA. Hepatitis C virus and depression in drug users. Am J Gastroenterol 1998; 93: [PMID: DOI: /j _a.x] 26 Nguyen HA, Miller AI, Dieperink E, Willenbring ML, Tetrick LL, Durfee JM, Ewing SL, Ho SB. Spectrum of disease in U.S. veteran patients with hepatitis C. Am J Gastroenterol 2002; 97: [PMID: DOI: / j x] 27 Almasio PL, Cottone C, D Angelo F. Pegylated interferon therapy in chronic hepatitis C: lights and shadows of an innovative treatment. Dig Liver Dis 2007; 39 Suppl 1: S88-S95 [PMID: ] 28 Alvarez F. Therapy for chronic viral hepatitis. Clin Invest Med 1996; 19: [PMID: ] 29 Angelino AF, Treisman GJ. Evidence-informed assessment and treatment of depression in HCV and interferon-treated patients. Int Rev Psychiatry 2005; 17: [PMID: DOI: / ] 30 Valentine AD, Meyers CA. Neurobehavioral effects of interferon therapy. Curr Psychiatry Rep 2005; 7: [PMID: ] 31 Golden J, O Dwyer AM, Conroy RM. Depression and anxiety in patients with hepatitis C: prevalence, detection rates and risk factors. Gen Hosp Psychiatry 2005; 27: [PMID: DOI: /j.genhosppsych ] 32 Falasca K, Mancino P, Ucciferri C, Dalessandro M, Manzoli L, Pizzigallo E, Conti CM, Vecchiet J. Quality of life, depression, and cytokine patterns in patients with chronic hepatitis C treated with antiviral therapy. Clin Invest Med 2009; 32: E212-E218 [PMID: ] 33 von Ammon Cavanaugh S. Depression in the medically ill. Critical issues in diagnostic assessment. Psychosomatics 1995; 36: [PMID: ] 34 Dan AA, Martin LM, Crone C, Ong JP, Farmer DW, Wise T, Robbins SC, Younossi ZM. Depression, anemia and healthrelated quality of life in chronic hepatitis C. J Hepatol 2006; 44: [PMID: DOI: /j.jhep ] 35 Grundy G, Beeching N. Understanding social stigma in women with hepatitis C. Nurs Stand 2004; 19: [PMID: ] 36 Alter MJ. Epidemiology of hepatitis C virus infection. World J Gastroenterol 2007; 13: [PMID: ] 37 Paterson BL, Backmund M, Hirsch G, Yim C. The depiction of stigmatization in research about hepatitis C. Int J Drug Policy 2007; 18: [PMID: DOI: / j.drugpo ] 38 Schäfer M, Boetsch T, Laakmann G. Psychosis in a methadone-substituted patient during interferon-alpha treatment of hepatitis C. Addiction 2000; 95: [PMID: ] 39 Bogart LM, Cowgill BO, Kennedy D, Ryan G, Murphy DA, Elijah J, Schuster MA. HIV-related stigma among people with HIV and their families: a qualitative analysis. AIDS Behav 2008; 12: [PMID: DOI: /s x] 40 Anti-Discrimination Board of New South Wales, Report of the inquiry into hepatitis C related discrimination. Available from: URL: CChange-3MB.pdf 41 Butt G. Stigma in the context of hepatitis C: concept analysis. J Adv Nurs 2008; 62: [PMID: DOI: / j x] 42 Zickmund S, Ho EY, Masuda M, Ippolito L, LaBrecque DR. They treated me like a leper. Stigmatization and the quality of life of patients with hepatitis C. J Gen Intern Med 2003; 18: [PMID: ] 43 Giordanino C, Sacco M, Ceretto S, Smedile A, Ciancio A, Cariti G, De Blasi T, Picciotto A, Marenco S, Grasso A, Pirisi M, Smirne C, Colletta C, Traverso A, Mazzucco D, Ciccone G, Simondi D, Rizzetto M, Saracco G. Durability of the response to peginterferon-α2b and ribavirin in patients with chronic hepatitis C: a cohort study in the routine clinical setting. Eur J Gastroenterol Hepatol 2013; Epub ahead of print [PMID: DOI: /MEG.0b013e328362dc99] 44 Marcellin P, Boyer N, Gervais A, Martinot M, Pouteau M, Castelnau C, Kilani A, Areias J, Auperin A, Benhamou JP, Degott C, Erlinger S. Long-term histologic improvement and loss of detectable intrahepatic HCV RNA in patients with chronic hepatitis C and sustained response to interferonalpha therapy. Ann Intern Med 1997; 127: [PMID: ] 45 García-Bengoechea M, Basaras M, Barrio J, Arrese E, Montalvo II, Arenas JI, Cisterna R. Late disappearance of hepatitis C virus RNA from peripheral blood mononuclear cells in patients with chronic hepatitis C in sustained response after alpha-interferon therapy. Am J Gastroenterol 1999; 94: [PMID: DOI: /j x] 46 Marinho RT, Pinto RM, Santos ML, de Moura MC. Lymphocyte T helper-specific reactivity in sustained responders to interferon and ribavirin with negativation (seroreversion) of anti-hepatitis C virus. Liver Int 2004; 24: [PMID: DOI: /j x] 47 D Ambrosio R, Aghemo A, Fraquelli M, Rumi MG, Donato MF, Paradis V, Bedossa P, Colombo M. The diagnostic accuracy of Fibroscan for cirrhosis is influenced by liver morphometry in HCV patients with a sustained virological response. J Hepatol 2013; 59: [PMID: DOI: /j.jhep ] 48 Longo S, Cotella G, Carletta F, Catacchio M, Antonaci S. Perihepatic lymphadenopathy and the response to therapy in chronic hepatitis C patients. J Ultrasound 2010; 13: [PMID: DOI: /j.jus ] 49 Muller P, Renou C, Harafa A, Jouve E, Kaplanski G, Ville E, Bertrand JJ, Masson C, Benderitter T, Halfon P. Lymph node enlargement within the hepatoduodenal ligament in patients with chronic hepatitis C reflects the immunological cellular response of the host. J Hepatol 2003; 39: [PMID: ] 50 Poynard T, McHutchison J, Manns M, Trepo C, Lindsay K, Goodman Z, Ling MH, Albrecht J. Impact of pegylated interferon alfa-2b and ribavirin on liver fibrosis in patients with chronic hepatitis C. Gastroenterology 2002; 122: [PMID: ] 51 Bruno S, Crosignani A, Facciotto C, Rossi S, Roffi L, Redaelli A, de Franchis R, Almasio PL, Maisonneuve P. Sustained virologic response prevents the development of esophageal varices in compensated, Child-Pugh class A hepatitis C virus-induced cirrhosis. A 12-year prospective follow-up study. Hepatology 2010; 51: [PMID: DOI: /hep.23528] 52 Morgan RL, Baack B, Smith BD, Yartel A, Pitasi M, Falck-Ytter Y. Eradication of hepatitis C virus infection and the devel October 28, 2013 Volume 19 Issue 40

21 Marinho RT et al. Hepatitis C, stigma and cure opment of hepatocellular carcinoma: a meta-analysis of observational studies. Ann Intern Med 2013; 158: [PMID: DOI: / ] 53 van der Meer AJ, Veldt BJ, Feld JJ, Wedemeyer H, Dufour JF, Lammert F, Duarte-Rojo A, Heathcote EJ, Manns MP, Kuske L, Zeuzem S, Hofmann WP, de Knegt RJ, Hansen BE, Janssen HL. Association between sustained virological response and all-cause mortality among patients with chronic hepatitis C and advanced hepatic fibrosis. JAMA 2012; 308: [PMID: DOI: /jama ] 54 Everson GT, Terrault NA, Lok AS, Rodrigo del R, Brown RS, Saab S, Shiffman ML, Al-Osaimi AM, Kulik LM, Gillespie BW, Everhart JE. A randomized controlled trial of pretransplant antiviral therapy to prevent recurrence of hepatitis C after liver transplantation. Hepatology 2013; 57: [PMID: DOI: /hep.25976] 55 Sarkar S, Jiang Z, Evon DM, Wahed AS, Hoofnagle JH. Fatigue before, during and after antiviral therapy of chronic hepatitis C: results from the Virahep-C study. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 56 Terrault NA. Sexual activity as a risk factor for hepatitis C. Hepatology 2002; 36: S [PMID: DOI: / jhep ] 57 Cottrell EB, Chou R, Wasson N, Rahman B, Guise JM. Reducing risk for mother-to-infant transmission of hepatitis C virus: a systematic review for the U.S. Preventive Services Task Force. Ann Intern Med 2013; 158: [PMID: ] 58 Ryan Caballes F, Sendi H, Bonkovsky HL. Hepatitis C, porphyria cutanea tarda and liver iron: an update. Liver Int 2012; 32: [PMID: DOI: / j x] 59 Koskinas J, Kilidireas C, Karandreas N, Kountouras D, Savvas S, Hadziyannis E, Archimandritis AJ. Severe hepatitis C virus-related cryoglobulinaemic sensory-motor polyneuropathy treated with pegylated interferon-a2b and ribavirin: clinical, laboratory and neurophysiological study. Liver Int 2007; 27: [PMID: DOI: / j x] 60 Ito A, Kazama T, Ito K, Ito M. Purpura with cold urticaria in a patient with hepatitis C virus infection-associated mixed cryoglobulinemia type III: successful treatment with interferon-beta. J Dermatol 2003; 30: [PMID: ] 61 Namba T, Shiba R, Yamamoto T, Hirai Y, Moriwaki T, Matsuda J, Kadoya H, Takeji M, Yamada Y, Yoshihara H, Yamauchi A. Successful treatment of HCV-related cryoglobulinemic glomerulonephritis with double-filtration plasmapheresis and interferon combination therapy. Clin Exp Nephrol 2010; 14: [PMID: DOI: / s ] 62 Hermine O, Lefrère F, Bronowicki JP, Mariette X, Jondeau K, Eclache-Saudreau V, Delmas B, Valensi F, Cacoub P, Brechot C, Varet B, Troussard X. Regression of splenic lymphoma with villous lymphocytes after treatment of hepatitis C virus infection. N Engl J Med 2002; 347: [PMID: DOI: /NEJMoa013376] 63 Nunes J, Tato Marinho R, Raposo J, Velosa J. [Influence of hepatitis C virus replication on splenic lymphoma with villous lymphocytes]. Acta Med Port 2010; 23: [PMID: ] 64 Liu S, Cipriano LE, Holodniy M, Owens DK, Goldhaber- Fiebert JD. New protease inhibitors for the treatment of chronic hepatitis C: a cost-effectiveness analysis. Ann Intern Med 2012; 156: [PMID: DOI: / ] 65 Fujiwara K, Allison RD, Wang RY, Bare P, Matsuura K, Schechterly C, Murthy K, Marincola FM, Alter HJ. Investigation of residual hepatitis C virus in presumed recovered subjects. Hepatology 2013; 57: [PMID: DOI: /hep.25921] P- Reviewers Boin I, Tang W S- Editor Song XX L- Editor A E- Editor Zhang DN 6709 October 28, 2013 Volume 19 Issue 40

22 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. FIELD OF VISION Clostridium difficile infection in the community: Are proton pump inhibitors to blame? Daniel E Freedberg, Julian A Abrams Daniel E Freedberg, Julian A Abrams, Division of Digestive and Liver Diseases, Columbia University Medical Center, New York, NY 10032, United States Author contributions: Freedberg DE and Abrams JA contributed equally to this work. Supported by National Institute of Diabetes and Digestive and Kidney Diseases T32 DK to Freedberg DE; a National Cancer Institute Career Development Award K07 CA to Abrams JA Correspondence to: Daniel E Freedberg, MD, Division of Digestive and Liver Diseases, Columbia University Medical Center, 630 West 168 th Street, PH Bldg Floor 7, New York, NY 10032, United States. def2004@columbia.edu Telephone: Fax: Received: August 16, 2013 Revised: September 12, 2013 Accepted: September 15, 2013 Published online: October 28, 2013 Abstract Once a nosocomial disease, Clostridium difficile infection (CDI) now appears frequently in the community in the absence of exposure to antibiotics. Prior studies have shown that patients with community-acquired CDI are younger, more likely to be female, and have fewer comorbidities compared to patients with hospital-associated CDI. Because most studies of CDI are hospitalbased, comparatively little is known about communityacquired CDI. The recent study by Chitnis has received widespread attention because it used active surveillance to capture all cases of community-acquired CDI within a large population and assessed key risk factors. The authors found that low-level healthcare exposure and proton pump inhibitor use were common among those with non-antibiotics associated, community-acquired CDI. In this commentary, we discuss the changing epidemiology of community-acquired CDI and the evidence basis for the controversial association between proton pump inhibitors and community-acquired CDI Baishideng. All rights reserved. Key words: Clostridium difficile ; Pseudomembranous enterocolitis; Proton pump inhibitors; Anti-bacterial agents; Pharmacoepidemiology; Public health; Disease outbreaks; Epidemics Core tip: Population-based studies demonstrate that nonantibiotic associated, community-acquired Clostridium difficile infection (CDI) is increasingly common. Patients with community-acquired CDI are younger and have fewer comorbidities compared to patients with hospital-associated CDI. Proton pump inhibitors may be a risk factor for nonantibiotic associated, community-acquired CDI. Freedberg DE, Abrams JA. Clostridium difficile infection in the community: Are proton pump inhibitors to blame? World J Gastroenterol 2013; 19(40): Available from: URL: DOI: COMMENTARY ON HOT TOPICS Clostridium difficile (C. difficile) infection (CDI) is the most feared gastrointestinal epidemic in the developed world with increasing incidence, virulence, and case fatality rates [1-5]. Formerly a nosocomial disease, CDI has become common in the community [6,7]. Early reports suggested that the risk factors associated with community-acquired CDI differ from the traditional risk factors associated with nosocomial CDI with relatively young and healthy individuals affected [8]. Thus we read with great interest the recent article by Chitnis et al [9] describing a multi-center study of the factors associated with community-acquired CDI. COMMUNITY-ACQUIRED CLOSTRIDIUM DIFFICILE INFECTION Pseudomembranous colitis was reported in the 19 th cen October 28, 2013 Volume 19 Issue 40

23 Freedberg DE et al. C. difficile in the community tury and has long been understood as an antibiotic-associated phenomenon [10,11]. In 1978, C. difficile was identified as the causative agent of disease; subsequent reports recognized that pseudomembranous colitis caused by C. difficile could occur without antibiotics [12]. But it was only beginning in 2005 that it became understood that C. difficile infection was frequently occurring in the community [7]. Community-acquired CDI differs from hospitalassociated disease, although many uncertainties remain. In the United States and Europe, 15%-44% of CDI occurs in the community without an identifiable antecedent healthcare exposure [8,13-15]. Compared to individuals with nosocomial CDI, those with community-acquired CDI are younger, have fewer comorbidities, and are more likely to be female [7]. Most surprisingly, patients with community-acquired CDI often do not report exposure to antibiotics [16]. If antibiotics are not essential in community-acquired CDI, what are the crucial risk factors? This question has been difficult to answer, in part because it is challenging to study community-acquired CDI in the United States. Cases of CDI arising in the community rarely require hospital admission. However, many studies of community-acquired disease are hospital-based and thus miss a large proportion of disease that both arises and is treated in the community [17-21]. In 2009, to address this problem, the Centers for Disease Control and Prevention (CDC) began a population-based program of active surveillance encompassing 11 million people [22]. Working with laboratories within the active surveillance area, all newly positive C. difficile stool tests were prospectively identified. Based on interviews with affected individuals, cases were classified as hospital-associated (defined as diarrhea and stool collected > 3 d to < 12 wk from a hospitalization) or community-acquired (all other cases). Community-acquired cases were assessed for risk factors including use of antibiotics or proton pump inhibitors (PPIs) and healthcare exposures within the previous 12 wk (classified as high-level exposure for dialysis or emergency department visits or low-level exposure for visits to a physician s office). Chitnis et al [9] report on the first results of this valuable project. The authors identified 984 patients with confirmed community-acquired C. difficile infection. Patients were relatively young (median age 51 years old) and predominantly female (67%). Yet morbidity and mortality were surprisingly high. One quarter of patients with community-acquired CDI were hospitalized for treatment and there was a 6% combined rate of death, colectomy, or admission to an intensive care unit. Overall, 41% of patients reported a high-level healthcare exposure, 41% of patients reported a low-level healthcare exposure, and 18% of patients reported no healthcare exposure. Sixtyfour percent of patients recalled antibiotic use within the preceding 12 wk. Compared to patients who reported recent antibiotic use, those that did not report antibiotic use were slightly more likely to report PPI use (31% vs 26%) but not histamine 2-receptor antagonist use (10% vs 9% respectively). The study has no comparison group so its most important findings are essentially descriptive. Nonetheless, the concerning implication is that nonantibiotic associated CDI is rising. Are PPIs to blame? CLOSTRIDIUM DIFFICILE INFECTION AND PPIS Over thirty observational studies and multiple metaanalyses indicate that PPIs are a risk factor for C. difficile infection [17,18]. Citing these findings in 2012, the United States Food and Drug Administration issued a warning regarding increased risk of CDI among patients taking long term PPIs [23]. Yet many questions remain regarding the relationship between PPIs and C. difficile. The data connecting PPIs and CDI is observational. Because patients who are prescribed PPIs differ in many ways from those who are not prescribed PPIs [24,25], it is possible that the observed association between PPIs and CDI is attributable to unmeasured confounding [26]. And there is comparatively little data that specifically addresses PPIs in community-acquired CDI. There are a few reasons to suspect that the relationship between PPIs and CDI might be different among those with community-acquired compared to hospitalassociated CDI. First, the highly toxigenic North American pulsed-field 1 (NAP1) strain has been linked to hospital-associated [3,27] rather than community-acquired cases; it is possible that the relationship between PPIs and CDI is affected by Clostridial strain. Second, a potential mechanism by which PPIs increase risk for CDI may be via alteration of the colonic microbiome [28-31]. Thus hospitalized patients, who can have altered microbiomes compared to those in the community [32], may be affected differently by PPIs. Finally, antibiotic exposure, which differs between hospitalized and non-hospitalized patients, may modify the relationship between PPIs and CDI [33]. So what is the evidence that PPIs are a risk factor for CDI in the community? Only a handful of studies include disease that is both acquired and treated in the community. A large, population-based study conducted within a United Kingdom dataset identified over 1000 cases of community-acquired CDI from 1994 to 2004 [34]. The authors found that only 37% of cases had been prescribed antibiotics within the previous 90 d; compared to matched controls, patients prescribed PPIs within the previous 90 d had a nearly 3-fold increased risk for CDI. A Scottish study conducted among adults 65 years old identified all cases of community-acquired CDI [35]. After adjusting for covariables, the authors found that patients prescribed PPIs within the previous 6 mo had a 1.7-fold increased risk for CDI compared to matched controls. Finally, a study using a large United States insurance claims database identified all cases of CDI from 2004 to 2007 in Iowa and South Dakota [13]. Seventy-three percent of cases had been prescribed antibiotics within the previous 180 d; patients prescribed PPIs or histamine-2 receptor antagonists within the previous 180 d had a 2.3-fold increased 6711 October 28, 2013 Volume 19 Issue 40

24 Freedberg DE et al. C. difficile in the community risk for community-acquired CDI compared to matched controls. These findings imply that the association between PPIs and CDI is at least as strong in communityacquired disease as in its more familiar hospital-associated form. The study by Chitnis et al [9] was not designed to directly test the hypothesis that PPIs are associated with CDI in the community. Instead, this study yields valuable lessons regarding the epidemiology and risk factors for community-acquired C. difficile infection. Using active surveillance to capture all cases of community-acquired CDI, the authors have shown that non-antibiotic associated, community-acquired CDI is common, and that affected patients frequently have some form of healthcare exposure that falls short of actual hospitalization. Overall, rates of PPI use were extraordinarily high, nearly 30% among patients with community-acquired CDI compared to less than 3% in the general population [36]. Future studies should test the hypothesis that PPIs are a risk factor for non-antibiotic associated, community-acquired C. difficile infection and assess whether interventions causing decreased PPI use can also decrease rates of CDI. For now, the findings of Chitnis et al [9] highlight the fact that community-acquired CDI is a very real problem and remind us that PPIs should be prescribed only in situations where they are indicated. REFERENCES 1 O Brien JA, Lahue BJ, Caro JJ, Davidson DM. The emerging infectious challenge of clostridium difficile-associated disease in Massachusetts hospitals: clinical and economic consequences. Infect Control Hosp Epidemiol 2007; 28: [PMID: DOI: /522676] 2 Kelly CP, LaMont JT. Clostridium difficile--more difficult than ever. N Engl J Med 2008; 359: [PMID: DOI: /NEJMra /18/1932] 3 Loo VG, Poirier L, Miller MA, Oughton M, Libman MD, Michaud S, Bourgault AM, Nguyen T, Frenette C, Kelly M, Vibien A, Brassard P, Fenn S, Dewar K, Hudson TJ, Horn R, René P, Monczak Y, Dascal A. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. N Engl J Med 2005; 353: [PMID: DOI: / NEJMoa051639] 4 Gravel D, Miller M, Simor A, Taylor G, Gardam M, Mc- Geer A, Hutchinson J, Moore D, Kelly S, Boyd D, Mulvey M. Health care-associated Clostridium difficile infection in adults admitted to acute care hospitals in Canada: a Canadian Nosocomial Infection Surveillance Program Study. Clin Infect Dis 2009; 48: [PMID: DOI: / /596703] 5 Cohen SH, Gerding DN, Johnson S, Kelly CP, Loo VG, Mc- Donald LC, Pepin J, Wilcox MH. Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the society for healthcare epidemiology of America (SHEA) and the infectious diseases society of America (IDSA). Infect Control Hosp Epidemiol 2010; 31: [PMID: DOI: /651706] 6 Kyne L, Merry C, O Connell B, Keane C, O Neill D. Community-acquired Clostridium difficile infection. J Infect 1998; 36: [PMID: ] 7 Centers for Disease Control and Prevention (CDC). Severe Clostridium difficile-associated disease in populations previously at low risk--four states, MMWR Morb Mortal Wkly Rep 2005; 54: [PMID: ] 8 Khanna S, Pardi DS, Aronson SL, Kammer PP, Orenstein R, St Sauver JL, Harmsen WS, Zinsmeister AR. The epidemiology of community-acquired Clostridium difficile infection: a population-based study. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ajg ] 9 Chitnis AS, Holzbauer SM, Belflower RM, Winston LG, Bamberg WM, Lyons C, Farley MM, Dumyati GK, Wilson LE, Beldavs ZG, Dunn JR, Gould LH, MacCannell DR, Gerding DN, McDonald LC, Lessa FC. Epidemiology of community-associated Clostridium difficile infection, 2009 through JAMA Intern Med 2013; 173: [PMID: DOI: /jamainternmed ] 10 Rifkin GD, Fekety FR, Silva J. Antibiotic-induced colitis implication of a toxin neutralised by Clostridium sordellii antitoxin. Lancet 1977; 2: [PMID: 73011] 11 Climo MW, Israel DS, Wong ES, Williams D, Coudron P, Markowitz SM. Hospital-wide restriction of clindamycin: effect on the incidence of Clostridium difficile-associated diarrhea and cost. Ann Intern Med 1998; 128: [PMID: ] 12 Bartlett JG, Chang TW, Gurwith M, Gorbach SL, Onderdonk AB. Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N Engl J Med 1978; 298: [PMID: DOI: /NEJM ] 13 Kuntz JL, Chrischilles EA, Pendergast JF, Herwaldt LA, Polgreen PM. Incidence of and risk factors for communityassociated Clostridium difficile infection: a nested casecontrol study. BMC Infect Dis 2011; 11: 194 [PMID: DOI: / ] 14 Naggie S, Miller BA, Zuzak KB, Pence BW, Mayo AJ, Nicholson BP, Kutty PK, McDonald LC, Woods CW. A casecontrol study of community-associated Clostridium difficile infection: no role for proton pump inhibitors. Am J Med 2011; 124: 276.e1-276.e7 [PMID: DOI: /j.amj med s (10) ] 15 Kutty PK, Woods CW, Sena AC, Benoit SR, Naggie S, Frederick J, Evans S, Engel J, McDonald LC. Risk factors for and estimated incidence of community-associated Clostridium difficile infection, North Carolina, USA. Emerg Infect Dis 2010; 16: [PMID: DOI: / eid ] 16 Bauer MP, Goorhuis A, Koster T, Numan-Ruberg SC, Hagen EC, Debast SB, Kuijper EJ, van Dissel JT. Communityonset Clostridium difficile-associated diarrhoea not associated with antibiotic usage--two case reports with review of the changing epidemiology of Clostridium difficile-associated diarrhoea. Neth J Med 2008; 66: [PMID: ] 17 Kwok CS, Arthur AK, Anibueze CI, Singh S, Cavallazzi R, Loke YK. Risk of Clostridium difficile infection with acid suppressing drugs and antibiotics: meta-analysis. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ajg ] 18 Janarthanan S, Ditah I, Adler DG, Ehrinpreis MN. Clostridium difficile-associated diarrhea and proton pump inhibitor therapy: a meta-analysis. Am J Gastroenterol 2012; 107: [PMID: DOI: /ajg ] 19 Lowe DO, Mamdani MM, Kopp A, Low DE, Juurlink DN. Proton pump inhibitors and hospitalization for Clostridium difficile-associated disease: a population-based study. Clin Infect Dis 2006; 43: [PMID: ] 20 Dial S, Kezouh A, Dascal A, Barkun A, Suissa S. Patterns of antibiotic use and risk of hospital admission because of Clostridium difficile infection. CMAJ 2008; 179: [PMID: DOI: /cmaj /8/767] 21 McFarland LV, Clarridge JE, Beneda HW, Raugi GJ. Fluoroquinolone use and risk factors for Clostridium difficile-associated disease within a Veterans Administration health care system. Clin Infect Dis 2007; 45: [PMID: ] 6712 October 28, 2013 Volume 19 Issue 40

25 Freedberg DE et al. C. difficile in the community 22 Centers for Disease Control and Prevention. Emerging Infections Program-Healthcare-associated Infections Project. Technical Information-Measuring the Scope of Clostridium difficile Infection in the United States. Available from: URL: 23 Food and Drug Administration. FDA Drug Safety Communication: Clostridium difficile-associated diarrhea can be associated with stomach acid drugs known as proton pump inhibitors (PPIs). Available from: URL: gov/drugs/drugsafety/ucm htm 24 Ho PM, Maddox TM, Wang L, Fihn SD, Jesse RL, Peterson ED, Rumsfeld JS. Risk of adverse outcomes associated with concomitant use of clopidogrel and proton pump inhibitors following acute coronary syndrome. JAMA 2009; 301: [PMID: DOI: / jama /9/937] 25 Brophy S, Jones KH, Rahman MA, Zhou SM, John A, Atkinson MD, Francis N, Lyons RA, Dunstan F. Incidence of Campylobacter and Salmonella infections following first prescription for PPI: a cohort study using routine data. Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ajg201330] 26 Leontiadis GI, Miller MA, Howden CW. How much do PPIs contribute to C. difficile infections? Am J Gastroenterol 2012; 107: [PMID: DOI: / ajg ajg ] 27 McDonald LC, Killgore GE, Thompson A, Owens RC, Kazakova SV, Sambol SP, Johnson S, Gerding DN. An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med 2005; 353: [PMID: ] 28 Garcia-Mazcorro JF, Suchodolski JS, Jones KR, Clark-Price SC, Dowd SE, Minamoto Y, Markel M, Steiner JM, Dossin O. Effect of the proton pump inhibitor omeprazole on the gastrointestinal bacterial microbiota of healthy dogs. FEMS Microbiol Ecol 2012; 80: [PMID: DOI: /j x] 29 Jakobsson HE, Jernberg C, Andersson AF, Sjölund-Karlsson M, Jansson JK, Engstrand L. Short-term antibiotic treatment has differing long-term impacts on the human throat and gut microbiome. PLoS One 2010; 5: e9836 [PMID: DOI: /journal.pone ] 30 Bühling A, Radun D, Müller WA, Malfertheiner P. Influence of anti-helicobacter triple-therapy with metronidazole, omeprazole and clarithromycin on intestinal microflora. Aliment Pharmacol Ther 2001; 15: [PMID: ] 31 Jernberg C, Löfmark S, Edlund C, Jansson JK. Long-term ecological impacts of antibiotic administration on the human intestinal microbiota. ISME J 2007; 1: [PMID: ] 32 Manges AR, Labbe A, Loo VG, Atherton JK, Behr MA, Masson L, Tellis PA, Brousseau R. Comparative metagenomic study of alterations to the intestinal microbiota and risk of nosocomial Clostridum difficile-associated disease. J Infect Dis 2010; 202: [PMID: DOI: /657319] 33 Stevens V, Dumyati G, Brown J, Wijngaarden E. Differential risk of Clostridium difficile infection with proton pump inhibitor use by level of antibiotic exposure. Pharmacoepidemiol Drug Saf 2011; 20: [PMID: DOI: /pds.2198] 34 Dial S, Delaney JA, Barkun AN, Suissa S. Use of gastric acid-suppressive agents and the risk of community-acquired Clostridium difficile-associated disease. JAMA 2005; 294: [PMID: ] 35 Marwick CA, Yu N, Lockhart MC, McGuigan CC, Wiuff C, Davey PG, Donnan PT. Community-associated Clostridium difficile infection among older people in Tayside, Scotland, is associated with antibiotic exposure and care home residence: cohort study with nested case-control. J Antimicrob Chemother 2013; Epub ahead of print [PMID: ] 36 Jacobson BC, Ferris TG, Shea TL, Mahlis EM, Lee TH, Wang TC. Who is using chronic acid suppression therapy and why? Am J Gastroenterol 2003; 98: [PMID: ] P- Reviewers Bhangu A, Borgmann S S- Editor Qi Y L- Editor A E- Editor Zhang DN 6713 October 28, 2013 Volume 19 Issue 40

26 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. TOPIC HIGHLIGHT WJG 20 th Anniversary Special Issues (2): Hepatitis C virus Hepatitis C and pregnancy Annarosa Floreani Annarosa Floreani, Department of Surgery, Oncology and Gastroenterology, University of Padova, Padova, Italy Author contributions: Floreani A designed and wrote the review. Correspondence to: Annarosa Floreani, MD, Department of Surgery, Oncology and Gastroenterology, University of Padova, Via Giustiniani 2, Padova, Italy.annarosa.floreani@unipd.it Telephone: Fax: Received: July 11, 2013 Revised: August 22, 2013 Accepted: September 4, 2013 Published online: October 28, 2013 Abstract Acute hepatitis C is a rare event in pregnancy. The most common scenario is chronic hepatitis C virus (HCV) infection in pregnancy. During pregnancy in women with chronic HCV infection a significant reduction in mean alanine aminotransferase levels has been reported, with a rebound during the postpartum period. In few cases exacerbation of chronic hepatitis C has been reported in pregnancy. A cofactor that might play a role in the reduction of liver damage is the release of endogenous interferon from the placenta. Observations regarding serum HCV-RNA concentration have been variable. In some women HCV-RNA levels rise toward the end of pregnancy. In general, pregnancy does not have a negative effect on HCV infection. Conversely, chronic hepatitis does not appear to have an adverse effect on the course of pregnancy, or the birth weight of the newborn infant. The role of spontaneous abortion is approximately the same as in the general population. The overall rate of mother-to-child transmission for HCV is 3%-5% if the mother is known to be anti-hcv positive. Co-infection with human immunodeficiency virus (HIV) increases the rate of mother-to-child transmission up to 19.4%. Numerous risk factors for vertical transmission have been studied. In general, high viral load defined as at least viral RNA copies/ml, HIV co-infection, and invasive procedures are the most important factors. Both interferon and ribavirin are contraindicated during pregnancy. Viral clearance prior to pregnancy increases the likelihood that a woman remains nonviremic in pregnancy with a consequent reduced risk of vertical transmission Baishideng. All rights reserved. Key words: Hepatitis C virus; Pregnancy; Virus transmission; Liver damage; Viral RNA Core tip: In general, pregnancy does not have a negative effect on hepatitis C virus (HCV) infection. Conversely, chronic hepatitis does not appear to have an adverse effect on the course of pregnancy, or the birth weight of the newborn infant. The overall rate of mother-to-child transmission for HCV is 3%-5% if the mother is known to be anti-hcv positive. Co-infection with HIV increases the rate of mother-to-child transmission up to 19.4%. Floreani A. Hepatitis C and pregnancy. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: org/ /wjg.v19.i INTRODUCTION The global prevalence of hepatitis C virus (HCV) infection is 2%-3%, with million HCV-positive people - most of them chronically infected [1]. The epidemiology of HCV is varies among countries and the reported prevalence of HCV in pregnant women has not been extensively studied, due to the lack of preventative screening of infection and the lack of preventative measures of mother-to-child transmission. The pathogenesis of HCV infection during pregnancy remains poorly understood. During pregnancy, the maternal immune system must at the same time develop tolerance to paternal alloantigens to prevent maternal immune aggression against the fetus 6714 October 28, 2013 Volume 19 Issue 40

27 Floreani A. Hepatitis C and pregnancy Table 1 Prevalence of serum anti-hepatitis C virus and hepatitis C virus RNA in in studies examining 3000 pregnant mothers Ref. No. screened Anti-HCV + HCV RNA + Hillemanns et al [3] % 57% Conte et al [4] % 72% Ward et al [5] % 72% Baldo et al [6] % 42.50% Goldberg et al [7] % NA Kumar et al [8] % NA Sami et al [9] % NA Ohto et al [10] % 54% Seisdedos et al [11] % NA Ugbebor et al [12] % NA Pinto et al [13] % NA Urbanus et al [14] % NA Mean 1.16% 59.75% HCV: Hepatitis C virus; NA: Not available. and maintain active immunity against HCV to protect both mother and fetus from infection [2]. Moreover, it is important to define the effect of pregnancy on HCV and vice versa. Finally, understanding the transmission of HCV to infants and the risk factors correlated with transmission will provide information for counseling and management of HCV infection during puerperium. EPIDEMIOLOGY OF HCV IN PREGNANCY The current prevalence of HCV in pregnant mothers is difficult to be estimated, because of the lack of selective screening in a large proportion of this population. The prevalence of serum HCV antibody in cohorts of 3000 pregnant mothers ranges between 0.1% and 3.6% with a mean of 1.16%, and the prevalence of HCV RNA ranges between 42.5% and 72% [3-14] (Table 1). It is particularly interesting that in Egyptian rural villages the prevalence of anti-hcv reaches a mean of 15.5%, with a 30% rate in women aged > 35 years [15]. The epidemiological risk factors explaining this dramatic high prevalence include: previous delivery attended by a traditional birth assistant; circumcision by a traditional birth assistant or a healthy barber ; and injection therapy for schistosomiasis. In all series the main route of acquiring HCV in pregnant mothers is intravenous drug use, whereas a previous blood transfusion is a risk factor in up to 11% of cases [4,6,16-22] (Table 2). It is should be noted that a large study in Japan has demonstrated a significant decline in HCV prevalence in pregnant women [10]. In a cohort studied between May 1990 and November 2004, a total of consecutive serum samples were screened for anti-hcv. Among women known to be transfused, rates fell from 14.8% to 3.1% with the implementation of HCV screening. In non-transfused women rates fell from 1.8% to 0.3%. This reduction has been mainly explained by the hygienic improvements including needles for medical injections and single-use acupuncture needles. The prevalence of HCV infection has been found to be lower in recent years com- Table 2 Proportion of intravenous drug use or blood transfusion risk factors in pregnant hepatitis C virus-positive mothers Ref. No. screened IVDU BT Paccagnini et al [16] % 9.00% Zanetti et al [17] % 13.00% Granovski et al [18] % NA Hillemanns et al [19] % 11.00% Resti et al [20] % 4.50% Gervais et al [21] % 19.00% Conte et al [4] % 18.00% Baldo et al [6] % 2.50% Mast et al [22] % 19.80% Mean 42.60% 12.10% IVDU: Intravenous drug use; BT: Blood transfusion. pared to the 1990s and 2000s, even in Upper Egypt [23]. The lower prevalence rates may be due to the amelioration of standard care and to the hepatitis B virus (HBV) vaccination of all newborns, together with the mandatory testing of blood donors and blood products and careful preoperative measures. ACUTE HEPATITIS C Acute hepatitis C during pregnancy has been rarely reported in pregnancy, and limited to high-risk groups, such as intravenous drug users, whereas the risk in the general population is negligible. Flichman et al [24] described a case in a 16-year-old pregnant woman who developed icteric acute hepatitis. She was a chronic HIV carrier and was diagnosed with HCV superinfection. HCV infection interfered with HIV replication, because the HIV levels were undetectable during the course of acute HCV infection. Another case of acute hepatitis C was described in a 26-year-old woman at week 16 of pregnancy, who was treated with a short course of interferon [25]. Although the therapy was discontinued due to adverse effects, a complete biochemical and virological response was obtained. Premature labor occurred and healthy twin infants were born transvaginally; they did not acquire HCV infection. A case with acute hepatitis C and premature delivery, but no vertical transmission has also been reported [26]. Finally, acute hepatitis C was reported in a 29-year-old Japanese woman who developed fatigue, jaundice and ascites after a needle-stick injury [27]. When these symptoms were presented, the patient became pregnant by artificial insemination. She was treated with interferon-β following eradication of HCV infection without severe side effects. In general, however, it should be said that acute hepatitis C is a rare event in pregnancy and that there is also a publication bias, due to reporting only severe cases [28]. From the epidemiological point of view, however, acute hepatitis C is not a relevant problem in pregnancy [29,30]. The differential diagnosis of acute hepatitis C requires us to rule out hepatitis caused by other hepatotropic viruses (hepatitis A, B, D and E) and liver disorders unique to pregnancy. Hepatitis A is transmitted by the oral-fecal 6715 October 28, 2013 Volume 19 Issue 40

28 Floreani A. Hepatitis C and pregnancy route. The whole Mediterranean area is endemic for this infection. Acute hepatitis A virus infection in pregnancy has been described only in anecdotal cases, and virtually in 100% of cases it has a favorable outcome [31]. To date, acute episodes of HBV infection in Italy have been rare, because HBV vaccination in newborns and adolescents has been compulsory since However, acute infections in pregnancy can occur in immigrants from developing countries or in high-risk groups, such as intravenous drug users. The clinical course of acute hepatitis B in pregnancy is benign, and the risk of fulminant cases is similar in pregnant and non-pregnant women. Acute infection with hepatitis D virus (HDV) does not represent a relevant risk for death in pregnancy. However, HDV epidemiology has dramatically changed over the past 20 years. Only sporadic cases are recorded in the Mediterranean countries, whereas, it is still a problem in some South American areas (especially in the Amazon Basin) and India [32]. Hepatitis E virus (HEV) is endemic in many tropical and subtropical countries, including Central Asia and India [33]. Sporadic cases in immigrants from these countries might be seen in developed countries. Generally, symptoms of acute illness including jaundice develop in 80% of cases. The reported risk for fulminant hepatic failure in pregnancy was up to 20% in previous studies [34]. Even in mothers who recover from acute hepatitis, an increased frequency of abortion and fetal complications have been reported. Moreover, the severity of acute hepatitis E in pregnant women seems directly correlated with viral load [35]. However, the results from recent studies in India and elsewhere indicate that the severity of viral hepatitis during pregnancy is similar to that in nonpregnant women [36]. Acute viral hepatitis in pregnancy requires differential diagnosis from liver disorders unique to pregnancy, in particular the HELLP syndrome, intrahepatic cholestasis of pregnancy (ICP), and acute fatty liver of pregnancy [37,38]. The HELLP syndrome is a variant of preeclampsia/eclampsia and is characterized by elevated liver enzymes, low platelet count and hemolysis. Its onset is generally in the second trimester of pregnancy, and patients may show initially elevated blood pressure, edema and proteinuria [39]. The intrahepatic cholestasis of pregnancy most frequently occurs in the third trimester of pregnancy with pruritus and elevated serum transaminases and bile salts; jaundice is rare and synthetic function of the liver is conserved [40]. Acute fatty liver of pregnancy is a severe condition that usually occurs in the third trimester with symptoms of encephalopathy and liver failure [41]. Early diagnosis is essential because treatment of acute hepatitis is generally conservative, whereas acute fatty liver of pregnancy and often HELLP syndrome require immediate delivery. CHRONIC HEPATITIS C The most important studies of HCV in pregnancy have dealt with chronically infected women, and the natural history of the liver disease in pregnant mothers and their offspring is not fully understood. EFFECT OF PREGNANCY ON HCV During pregnancy in chronic HCV infection a significant reduction in the mean alanine aminotransferase (ALT) levels has been reported [4,42,43], with rebound during the postpartum period. However, when we consider a cohort of pregnant women with HCV infection and persistently high aspartate aminotransferase/alt levels, this trend is not confirmed [43]. The release of endogenous interferon from the placenta during pregnancy might partly explain changes in liver enzymes, but does not interfere with viral clearance [44]. Other factors, such as hemodilution or immune tolerance, may account for the decrease in serum transaminases during pregnancy. Sex hormones, and possibly immunosuppressive cytokines synthesized during pregnancy, might result in modulation of the immune response against HCV. Observations regarding serum HCV-RNA concentration have been variable. Gervais et al [21] investigated a small number of pregnant women tested for viral load at regular intervals, and found that HCV RNA increased toward the end of pregnancy in some women. In our own study of 65 pregnant women tested during all three trimesters, we failed to show significant changes in viral load during and after pregnancy, although there was a trend toward an increase in the third trimester [43]. However, monitoring of viral load by monthly testing showed that HCV RNA is relatively stable over time in HCV chronic carriers without biochemical activity of the disease, whereas a low number of viremic flares can occur over a year in patients with biochemical activity of liver disease [45]. Spontaneous clearance of HCV has been described in a single pregnant woman [46]. Only two reports describe significant worsening of histological disease consequent to pregnancy [47,48]. The study by Fontaine et al [48] included 12 cases with chronic hepatitis C and 12 controls without HCV infection. The first biopsy was done 1.6 years after delivery and the second at 4.3 years after the first biopsy. The overall Knodell score at initial biopsy was 4.8 in HCV-positive cases vs 5.3 in the controls. The Knodell score in the final biopsy was unchanged in controls, and was 8.4 in HCV-positive cases (P = 0.016). The necroinflammation score showed 83% deterioration in cases and 25% in controls (P = 0.02). The fibrosis score showed 41.6% deterioration in cases and 8.3% in controls (P > 0.05). These findings in a small group of subjects, however, did not allow for any definite conclusion to be drawn. Effect of HCV on course of pregnancy There is no unfavorable effect of HCV on pregnancy. In particular, three studies have addressed this question [18,49,50] (Table 3). The study from Jabeen et al [49] is particularly interesting, because it included a large cohort of rhesus-negative women in Ireland who became in October 28, 2013 Volume 19 Issue 40

29 Floreani A. Hepatitis C and pregnancy Table 3 Effect of hepatitis C virus on the course of pregnancy Hillemanns et al [19] Jabeen et al [49] Floreani et al [50] Miscarriages NA 12.4% vs 22.2% - Typical obstetric complications Preterm delivery 29% vs 19% 4.5% vs 3.2% NA Rate of cesarean 42% vs 21% 5.6% vs 12.7% 41.50% section (P = 0.004) Fetal outcome Good Good Good NA: Not available. fected with HCV following exposure to contaminated anti-d immunoglobulin in Thirty-six women who had been infected after their first pregnancy were compared to an age- and parity-matched control group of rhesus-positive women. Comparison with the control group showed no increase in spontaneous miscarriage rate, and no significant difference in obstetric complications. Taken together, these three studies have documented a good fetal outcome. The rate of cesarean section was significantly higher in the study by Hilleman et al [19] compared to controls (42% vs 21%, P = 0.004) and was similar to that observed in the Italian study [50]. The high rate of cesarean section in our study was due to the local protocol used in the past decade for reducing the rate of transmission of HCV in HCV-positive mothers, rather than peculiar obstetric indications for cesarean section. In a population-based cohort study using Washington state birth records from 2003 to 2005, including 506 HCV-positive mothers, 2022 randomly selected HCVnegative mothers, and 1439 drug-using HCV-negative mothers, it was shown that infants born to HCV-positive women were more likely to have low birth weight, be small for gestational age, be admitted to the intensive care unit, or require assisted ventilation [51]. In a more recent study using birth certificate records of pregnancies, it was found that women with HCV were more likely to have infants born preterm, with low birth weight and congenital anomalies [52]. However, that study had several limitations, in particular, its retrospective design and the lack of association with several variables, such as use of tobacco, alcohol or drugs. Indeed, there is no explanation for prematurity and low birth weight in HCV-negative mothers, although increased cytotoxicity of placental natural killer T cells could be hypothesized possibility [53]. It has also been reported that in pregnant women involved in a methadone treatment program, HCV reactivity was associated with an increased risk of neonatal withdrawal regardless of maternal methadone use [54]. Risk factors for the development of ICP in HCV-positive mothers have been described. The first retrospective study reported a highly significant incidence of ICP in HCV-positive pregnant women compared with HCVnegative women [55]. Subsequently, another prospective Italian study confirmed these results and suggested the need to investigate the HCV status in women with ICP [56]. In a study population of women with ICP identified from the Finnish Hospital Discharge Register during , hepatitis C was found to have a significantly higher incidence than in the controls [57]. More recently, a study of women with births between 1973 and 2009, registered in the Swedish Medical Birth Registry, confirmed a strong positive association between ICP and hepatitis C both before and after ICP diagnosis [58]. The link between ICP and HCV has not been completely explained so far, although several hypotheses can be suggested, including a defect in the transport of sulfated pregnancy hormones in the liver. It has been suggested that HCV downregulates the expression of the ABC transporter multi-drug resistance protein 2 (MRP2) in the liver, thus inducing failure in the transport of various toxic substances [59]. Furthermore, another link may be with a defect in the ABCB11 gene encoding the bile salt export pump [60]. Vertical transmission of HCV The overall rate of mother-to-child transmission of HCV from HCV-infected, HIV-negative mothers has been estimated at 3%-5% [61-66]. However, in an overview of 77 prospective cohort studies with at least 10 mother-infant pairs, the overall rate was 1.7% if the mother was known to be anti-hcv positive. If the mother was known to be viremic, that is HCV-RNA-positive, the rate was 4.3% [67]. At least one-third of infants acquire HCV infection during the intrauterine period; the perinatal transmission is estimated to be as high as 40%-50%, whereas postpartum transmission is rare [30,68]. The detection of HCV RNA in the serum of infants in the first 24 h of life suggests that early intrauterine infection may be possible [68]. The diagnosis of perinatal transmission should be considered in children born to HCV-positive mothers when: HCV RNA is detected in at least two serum samples at least 3 mo apart during the first year of life; and/or when testing of antibodies against HCV is positive after 18 mo of age [69]. There is an interesting observation reported by the European Paediatric Hepatitis C Virus Network from a multicenter prospective study of HCV-infected pregnant women and their infants [69]. In that study girls were twice as likely to be infected as boys. This sex association is an intriguing finding that probably reflects biological differences in susceptibility or response to infection. Co-infection with HIV increases the rate of motherto-child transmission up to 19.4% [67]. The weighted rate of transmission is 8.6% in mothers who are anti-hcv positive and injecting drug users, compared with 3.4% in anti-hcv-positive mothers without known injecting drug use. A meta-analysis including 2382 infants estimated that the risk of HCV vertical transmission was 2.82 from anti- HCV + /HIV + co-infected mothers compared with anti- HCV + /HIV - mothers [70]. Vertical transmission of HIV and HCV separately is most likely from HIV/HCV-coinfected mothers; however, transmission of both infections is less frequent [71]. Numerous risk factors for vertical transmission have been studied. In general, high viral load defined as at least 6717 October 28, 2013 Volume 19 Issue 40

30 Floreani A. Hepatitis C and pregnancy viral RNA copies/ml, HIV co-infection, and invasive procedures are the most important factors [22]. In general, maternal peripheral blood mononuclear cell infection by HCV, membrane rupture > 6 h before delivery, and procedures exposing the infant to maternal blood infected with HCV during vaginal delivery are associated with an increased risk of transmission [69]. Abnormal ALT levels in mothers in the year before pregnancy may reflect a more severe liver disease and may help in identifying mothers with an increased risk of vertical transmission [72]. Finally, a Japanese study suggested that maternal liver dysfunction, large blood loss at delivery, and vaginal delivery were potential novel risk factors for mother-tochild transmission of HCV [66]. ANTIVIRAL THERAPY FOR CHRONIC HCV INFECTION Antiviral therapy for HCV is contraindicated in pregnancy. Pegylated interferon would be problematic because of its psychiatric side effects in these women, who have a high background rate of postpartum depression [73]. Ribavirin carries the risk of teratogenicity for up to 7 mo after cessation of treatment. Treatment options should be offered before pregnancy in HCV-infected women. In fact, delay in initiation of antiviral therapy likely to be much longer than 9 mo, taking into account the postpartum recovery, breastfeeding and infant care. The benefits of considering treatment first and pregnancy second are superior to the drawbacks, including eliminating the risk of transmission of HCV to infants and reducing the risk of liver progression in mothers. Furthermore, improved efficacy of new drug regimens will require reassessment of the utility of universal screening for HCV in pregnant women [74]. MANAGEMENT OF HCV-INFECTED WOMEN All women should receive antenatal screening for hepatitis B surface antigen and anti-hcv; HCV should tested for in those found to be HCV positive, immigrants from developing countries, and in those with high-risk behavior (e.g., multiple sexual partners and intravenous drug use) [75]. A consensus for management of HCV-infected pregnant women and their children by the European Paediatric Network has been recently published [76]. The conclusions of this panel of experts indicate that although several risk factors for vertical transmission have been identified, none are modifiable and there are currently no interventions available to prevent such transmission. Based on the current evidence, it would be prudent to avoid amniocentesis, instrumented vaginal delivery, and prolonged rupture of membranes. A recent meta-analysis including 641 mother-infant pairs showed that cesarean section does not decrease perinatal HCV transmission from HCV-RNA + /HIV - mothers to infants [77]. Thus elective cesarean delivery should not be offered, and breastfeeding should not be discouraged. HCV/HIV co-infected women should be offered elective cesarean section to prevent HIV transmission and avoid breastfeeding where safe alternative are available [78]. REFERENCES 1 Baldo V, Baldovin T, Trivello R, Floreani A. Epidemiology of HCV infection. Curr Pharm Des 2008; 14: [PMID: ] 2 Le Campion A, Larouche A, Fauteux-Daniel S, Soudeyns H. Pathogenesis of hepatitis C during pregnancy and childhood. Viruses 2012; 4: [PMID: DOI: /v ] 3 Hillemanns P, Dannecker C, Kimmig R, Hasbargen U. Obstetric risks and vertical transmission of hepatitis C virus infection in pregnancy. Acta Obstet Gynecol Scand 2000; 79: [PMID: ] 4 Conte D, Fraquelli M, Prati D, Colucci A, Minola E. Prevalence and clinical course of chronic hepatitis C virus (HCV) infection and rate of HCV vertical transmission in a cohort of 15,250 pregnant women. Hepatology 2000; 31: [PMID: ] 5 Ward C, Tudor-Williams G, Cotzias T, Hargreaves S, Regan L, Foster GR. Prevalence of hepatitis C among pregnant women attending an inner London obstetric department: uptake and acceptability of named antenatal testing. Gut 2000; 47: [PMID: ] 6 Baldo V, Floreani A, Menegon T, Grella P, Paternoster DM, Trivello R. Hepatitis C virus, hepatitis B virus and human immunodeficiency virus infection in pregnant women in North-East Italy: a seroepidemiological study. Eur J Epidemiol 2000; 16: [PMID: ] 7 Goldberg D, McIntyre PG, Smith R, Appleyard K, Dunlop J, Taylor A, Hutchinson S. Hepatitis C virus among high and low risk pregnant women in Dundee: unlinked anonymous testing. BJOG 2001; 108: [PMID: ] 8 Kumar A, Sharma KA, Gupta RK, Kar P, Chakravarti A. Prevalence & risk factors for hepatitis C virus among pregnant women. Indian J Med Res 2007; 126: [PMID: ] 9 Sami S, Korejo R, Bhutta SZ. Prevalence of hepatitis B and C: a Jinnah Postgraduate Medical Centre experience. J Obstet Gynaecol Res 2009; 35: [PMID: DOI: /j x] 10 Ohto H, Ishii T, Kitazawa J, Sugiyama S, Ujiie N, Fujimori K, Ariga H, Satoh T, Nollet KE, Okamoto H, Hoshi T. Declining hepatitis C virus (HCV) prevalence in pregnant women: impact of anti-hcv screening of donated blood. Transfusion 2010; 50: [PMID: DOI: / j x] 11 Seisdedos T, Díaz A, Bleda MJ, Ortiz M, García A, Díez M. Prevalence of maternal hepatitis C infection according to HIV serostatus in six Spanish regions ( ). Eur J Public Health 2011; 21: [PMID: DOI: / eurpub/ckq085] 12 Ugbebor O, Aigbirior M, Osazuwa F, Enabudoso E, Zabayo O. The prevalence of hepatitis B and C viral infections among pregnant women. N Am J Med Sci 2011; 3: [PMID: DOI: /najms ] 13 Pinto CS, Martins RM, Andrade SM, Stief AC, Oliveira RD, Castro AR. Hepatitis C virus infection among pregnant women in Central-Western Brazil, Rev Saude Publica 2011; 45: [PMID: ] 14 Urbanus AT, van de Laar TJ, van den Hoek A, Zuure FR, Speksnijder AG, Baaten GG, Heijman T, Vriend HJ, Op de Coul EL, Coutinho RA, Prins M. Hepatitis C in the general population of various ethnic origins living in the Netherlands: should non-western migrants be screened? J 6718 October 28, 2013 Volume 19 Issue 40

31 Floreani A. Hepatitis C and pregnancy Hepatol 2011; 55: [PMID: DOI: / j.jhep ] 15 Stoszek SK, Abdel-Hamid M, Narooz S, El Daly M, Saleh DA, Mikhail N, Kassem E, Hawash Y, El Kafrawy S, Said A, El Batanony M, Shebl FM, Sayed M, Sharaf S, Fix AD, Strickland GT. Prevalence of and risk factors for hepatitis C in rural pregnant Egyptian women. Trans R Soc Trop Med Hyg 2006; 100: [PMID: ] 16 Paccagnini S, Principi N, Massironi E, Tanzi E, Romanò L, Muggiasca ML, Ragni MC, Salvaggio L. Perinatal transmission and manifestation of hepatitis C virus infection in a high risk population. Pediatr Infect Dis J 1995; 14: [PMID: ] 17 Zanetti AR, Tanzi E, Paccagnini S, Principi N, Pizzocolo G, Caccamo ML, D Amico E, Cambiè G, Vecchi L. Mother-toinfant transmission of hepatitis C virus. Lombardy Study Group on Vertical HCV Transmission. Lancet 1995; 345: [PMID: ] 18 Granovsky MO, Minkoff HL, Tess BH, Waters D, Hatzakis A, Devoid DE, Landesman SH, Rubinstein A, Di Bisceglie AM, Goedert JJ. Hepatitis C virus infection in the mothers and infants cohort study. Pediatrics 1998; 102: [PMID: ] 19 Hillemanns P, Langenegger P, Langer BC, Knitza R, Hasbargen U, Hepp H. [Prevalence and follow-up of hepatitis C virus infection in pregnancy]. Z Geburtshilfe Neonatol 1998; 202: [PMID: ] 20 Resti M, Azzari C, Mannelli F, Moriondo M, Novembre E, de Martino M, Vierucci A. Mother to child transmission of hepatitis C virus: prospective study of risk factors and timing of infection in children born to women seronegative for HIV-1. Tuscany Study Group on Hepatitis C Virus Infection. BMJ 1998; 317: [PMID: ] 21 Gervais A, Bacq Y, Bernuau J, Martinot M, Auperin A, Boyer N, Kilani A, Erlinger S, Valla D, Marcellin P. Decrease in serum ALT and increase in serum HCV RNA during pregnancy in women with chronic hepatitis C. J Hepatol 2000; 32: [PMID: ] 22 Mast EE, Hwang LY, Seto DS, Nolte FS, Nainan OV, Wurtzel H, Alter MJ. Risk factors for perinatal transmission of hepatitis C virus (HCV) and the natural history of HCV infection acquired in infancy. J Infect Dis 2005; 192: [PMID: ] 23 Zahran KM, Badary MS, Agban MN, Abdel Aziz NH. Pattern of hepatitis virus infection among pregnant women and their newborns at the Women s Health Center of Assiut University, Upper Egypt. Int J Gynaecol Obstet 2010; 111: [PMID: DOI: /j.ijgo ] 24 Flichman D, Cello J, Castaño G, Campos R, Sookoian S. In vivo down regulation of HIV replication after hepatitis C superinfection. Medicina (B Aires) 1999; 59: [PMID: ] 25 Ozaslan E, Yilmaz R, Simsek H, Tatar G. Interferon therapy for acute hepatitis C during pregnancy. Ann Pharmacother 2002; 36: [PMID: ] 26 Gonzalez F, Medam-Djomo MA, Lucidarme D, Khalil A, Decoster A, Houze de l Aulnoit D, Filoche B. Acute hepatitis C during the third trimester of pregnancy. Gastroenterol Clin Biol 2006; 30: [PMID: ] 27 Kogure T, Ueno Y, Kanno N, Fukushima K, Yamagiwa Y, Nagasaki F, Kakazu E, Matsuda Y, Kido O, Nakagome Y, Ninomiya M, Shimosegawa T. Sustained viral response of a case of acute hepatitis C virus infection via needle-stick injury. World J Gastroenterol 2006; 12: [PMID: ] 28 Sookoian S. Liver disease during pregnancy: acute viral hepatitis. Ann Hepatol 2006; 5: [PMID: ] 29 Khuroo MS, Kamili S. Aetiology, clinical course and outcome of sporadic acute viral hepatitis in pregnancy. J Viral Hepat 2003; 10: [PMID: ] 30 Hsieh TY, Yu CH, Kuo PL, Chang FM. Acute viral hepatitis C-induced jaundice in pregnancy. Taiwan J Obstet Gynecol 2006; 45: [PMID: ] 31 Zhang RL, Zeng JS, Zhang HZ. Survey of 34 pregnant women with hepatitis A and their neonates. Chin Med J (Engl) 1990; 103: [PMID: ] 32 Gomes-Gouvêa MS, Pereira Soares Mdo C, Guedes de Carvalho Mello IM, Brito EM, Pereira Moia Lde J, Bensabath G, Nunes HM, Carrilho FJ, Pinho JR. Hepatitis D and B virus genotypes in chronically infected patients from the Eastern Amazon Basin. Acta Trop 2008; 106: [PMID: DOI: /j.actatropica ] 33 Khuroo MS, Khuroo MS. Hepatitis E virus. Curr Opin Infect Dis 2008; 21: [PMID: DOI: / QCO.0b013e32830ee08a] 34 Doshi S, Zucker SD. Liver emergencies during pregnancy. Gastroenterol Clin North Am 2003; 32: , ix [PMID: ] 35 Kar P, Jilani N, Husain SA, Pasha ST, Anand R, Rai A, Das BC. Does hepatitis E viral load and genotypes influence the final outcome of acute liver failure during pregnancy? Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 36 Meng XJ. Recent advances in Hepatitis E virus. J Viral Hepat 2010; 17: [PMID: DOI: / j x] 37 Riely CA. Liver disease in the pregnant patient. American College of Gastroenterology. Am J Gastroenterol 1999; 94: [PMID: ] 38 Guntupalli SR, Steingrub J. Hepatic disease and pregnancy: an overview of diagnosis and management. Crit Care Med 2005; 33: S332-S339 [PMID: ] 39 Baxter JK, Weinstein L. HELLP syndrome: the state of the art. Obstet Gynecol Surv 2004; 59: [PMID: ] 40 Riely CA, Bacq Y. Intrahepatic cholestasis of pregnancy. Clin Liver Dis 2004; 8: [PMID: ] 41 Hay JE. Liver disease in pregnancy. Hepatology 2008; 47: [PMID: DOI: /hep.22130] 42 Ohto H, Terazawa S, Sasaki N, Sasaki N, Hino K, Ishiwata C, Kako M, Ujiie N, Endo C, Matsui A. Transmission of hepatitis C virus from mothers to infants. The Vertical Transmission of Hepatitis C Virus Collaborative Study Group. N Engl J Med 1994; 330: [PMID: ] 43 Paternoster DM, Santarossa C, Grella P, Palù G, Baldo V, Boccagni P, Floreani A. Viral load in HCV RNA-positive pregnant women. Am J Gastroenterol 2001; 96: [PMID: ] 44 Paternoster DM, Belligoli A, Ngaradoumbe NK, Visentin S, Franco R, Fagiuoli S, Boldrin C, Palù G, Baldo V, Floreani A. Endogenous interferon-alpha level is increased in hepatitis C virus (HCV)-positive pregnant women. J Clin Gastroenterol 2008; 42: [PMID: DOI: /01. mcg e] 45 Pontisso P, Bellati G, Brunetto M, Chemello L, Colloredo G, Di Stefano R, Nicoletti M, Rumi MG, Ruvoletto MG, Soffredini R, Valenza LM, Colucci G. Hepatitis C virus RNA profiles in chronically infected individuals: do they relate to disease activity? Hepatology 1999; 29: [PMID: ] 46 Zein CO, Abu-Lebdeh H, Zein NN. Spontaneous clearance of chronic hepatitis C during pregnancy. Am J Gastroenterol 2001; 96: [PMID: ] 47 Kumar RM, Shahul S. Role of breast-feeding in transmission of hepatitis C virus to infants of HCV-infected mothers. J Hepatol 1998; 29: [PMID: ] 48 Fontaine H, Nalpas B, Carnot F, Bréchot C, Pol S. Effect of pregnancy on chronic hepatitis C: a case-control study. Lancet 2000; 356: [PMID: ] 49 Jabeen T, Cannon B, Hogan J, Crowley M, Devereux C, Fanning L, Kenny-Walsh E, Shanahan F, Whelton MJ. Pregnancy and pregnancy outcome in hepatitis C type 1b. QJM 2000; 93: [PMID: ] 6719 October 28, 2013 Volume 19 Issue 40

32 Floreani A. Hepatitis C and pregnancy 50 Floreani A, Paternoster D, Zappala F, Cusinato R, Bombi G, Grella P, Chiaramonte M. Hepatitis C virus infection in pregnancy. Br J Obstet Gynaecol 1996; 103: [PMID: ] 51 Pergam SA, Wang CC, Gardella CM, Sandison TG, Phipps WT, Hawes SE. Pregnancy complications associated with hepatitis C: data from a Washington state birth cohort. Am J Obstet Gynecol 2008; 199: 38.e1-38.e9 [PMID: DOI: /j.ajog ] 52 Connell LE, Salihu HM, Salemi JL, August EM, Weldeselasse H, Mbah AK. Maternal hepatitis B and hepatitis C carrier status and perinatal outcomes. Liver Int 2011; 31: [PMID: DOI: /j x] 53 Hurtado CW, Golden-Mason L, Brocato M, Krull M, Narkewicz MR, Rosen HR. Innate immune function in placenta and cord blood of hepatitis C-seropositive mother-infant dyads. PLoS One 2010; 5: e12232 [PMID: DOI: /journal.pone ] 54 Berkley EM, Leslie KK, Arora S, Qualls C, Dunkelberg JC. Chronic hepatitis C in pregnancy. Obstet Gynecol 2008; 112: [PMID: DOI: / AOG.0b013e318180a4f3] 55 Locatelli A, Roncaglia N, Arreghini A, Bellini P, Vergani P, Ghidini A. Hepatitis C virus infection is associated with a higher incidence of cholestasis of pregnancy. Br J Obstet Gynaecol 1999; 106: [PMID: ] 56 Paternoster DM, Fabris F, Palù G, Santarossa C, Bracciante R, Snijders D, Floreani A. Intra-hepatic cholestasis of pregnancy in hepatitis C virus infection. Acta Obstet Gynecol Scand 2002; 81: [PMID: ] 57 Ropponen A, Sund R, Riikonen S, Ylikorkala O, Aittomäki K. Intrahepatic cholestasis of pregnancy as an indicator of liver and biliary diseases: a population-based study. Hepatology 2006; 43: [PMID: ] 58 Marschall HU, Wikström Shemer E, Ludvigsson JF, Stephansson O. Intrahepatic cholestasis of pregnancy and associated hepatobiliary disease: A population-based cohort study. Hepatology 2013; 58: [PMID: DOI: /hep.26444] 59 Hinoshita E, Taguchi K, Inokuchi A, Uchiumi T, Kinukawa N, Shimada M, Tsuneyoshi M, Sugimachi K, Kuwano M. Decreased expression of an ATP-binding cassette transporter, MRP2, in human livers with hepatitis C virus infection. J Hepatol 2001; 35: [PMID: ] 60 Iwata R, Baur K, Stieger B, Mertens JC, Daly AK, Frei P, Braun J, Vergopoulos A, Stickel F, Sabrane K, Martin IV, Schmitt J, Goetze O, Day CP, Müllhaupt B, Geier A. A common polymorphism in the ABCB11 gene is associated with advanced fibrosis in hepatitis C but not in non-alcoholic fatty liver disease. Clin Sci (Lond) 2011; 120: [PMID: DOI: /CS ] 61 Tovo PA, Palomba E, Ferraris G, Principi N, Ruga E, Dallacasa P, Maccabruni A. Increased risk of maternal-infant hepatitis C virus transmission for women coinfected with human immunodeficiency virus type 1. Italian Study Group for HCV Infection in Children. Clin Infect Dis 1997; 25: [PMID: ] 62 Zanetti AR, Tanzi E, Romanò L, Zuin G, Minola E, Vecchi L, Principi N. A prospective study on mother-to-infant transmission of hepatitis C virus. Intervirology 1998; 41: [PMID: ] 63 Gibb DM, Goodall RL, Dunn DT, Healy M, Neave P, Cafferkey M, Butler K. Mother-to-child transmission of hepatitis C virus: evidence for preventable peripartum transmission. Lancet 2000; 356: [PMID: ] 64 European Paediatric Hepatitis C Virus Network. Effects of mode of delivery and infant feeding on the risk of mother-tochild transmission of hepatitis C virus. European Paediatric Hepatitis C Virus Network. BJOG 2001; 108: [PMID: ] 65 Mariné-Barjoan E, Berrébi A, Giordanengo V, Favre SF, Haas H, Moreigne M, Izopet J, Tricoire J, Tran A, Pradier C, Bongain A. HCV/HIV co-infection, HCV viral load and mode of delivery: risk factors for mother-to-child transmission of hepatitis C virus? AIDS 2007; 21: [PMID: ] 66 Hayashida A, Inaba N, Oshima K, Nishikawa M, Shoda A, Hayashida S, Negishi M, Inaba F, Inaba M, Fukasawa I, Watanabe H, Takamizawa H. Re-evaluation of the true rate of hepatitis C virus mother-to-child transmission and its novel risk factors based on our two prospective studies. J Obstet Gynaecol Res 2007; 33: [PMID: ] 67 Roberts EA, Yeung L. Maternal-infant transmission of hepatitis C virus infection. Hepatology 2002; 36: S106-S113 [PMID: ] 68 Mok J, Pembrey L, Tovo PA, Newell ML. When does mother to child transmission of hepatitis C virus occur? Arch Dis Child Fetal Neonatal Ed 2005; 90: F156-F160 [PMID: ] 69 Indolfi G, Resti M. Perinatal transmission of hepatitis C virus infection. J Med Virol 2009; 81: [PMID: DOI: /jmv.21437] 70 European Paediatric Hepatitis C Virus Network. A significant sex--but not elective cesarean section--effect on motherto-child transmission of hepatitis C virus infection. J Infect Dis 2005; 192: [PMID: ] 71 Pappalardo BL. Influence of maternal human immunodeficiency virus (HIV) co-infection on vertical transmission of hepatitis C virus (HCV): a meta-analysis. Int J Epidemiol 2003; 32: [PMID: ] 72 England K, Thorne C, Newell ML. Vertically acquired paediatric coinfection with HIV and hepatitis C virus. Lancet Infect Dis 2006; 6: [PMID: ] 73 Indolfi G, Azzari C, Moriondo M, Lippi F, de Martino M, Resti M. Alanine transaminase levels in the year before pregnancy predict the risk of hepatitis C virus vertical transmission. J Med Virol 2006; 78: [PMID: ] 74 Prasad MR, Honegger JR. Hepatitis C virus in pregnancy. Am J Perinatol 2013; 30: [PMID: DOI: /s ] 75 Arshad M, El-Kamary SS, Jhaveri R. Hepatitis C virus infection during pregnancy and the newborn period-are they opportunities for treatment? J Viral Hepat 2011; 18: [PMID: DOI: /j x] 76 López M, Coll O. Chronic viral infections and invasive procedures: risk of vertical transmission and current recommendations. Fetal Diagn Ther 2010; 28: 1-8 [PMID: DOI: / ] 77 Ghamar Chehreh ME, Tabatabaei SV, Khazanehdari S, Alavian SM. Effect of cesarean section on the risk of perinatal transmission of hepatitis C virus from HCV-RNA+/HIVmothers: a meta-analysis. Arch Gynecol Obstet 2011; 283: [PMID: DOI: /s ] 78 Pembrey L, Newell ML, Tovo PA. The management of HCV infected pregnant women and their children European paediatric HCV network. J Hepatol 2005; 43: [PMID: ] P- Reviewers Liu Q, Zeng Z S- Editor Gou SX L- Editor Kerr C E- Editor Wu HL 6720 October 28, 2013 Volume 19 Issue 40

33 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. WJG 20 th Anniversary Special Issues (3): Inflammatory bowel disease TOPIC HIGHLIGHT Impact of exome sequencing in inflammatory bowel disease Christopher J Cardinale, Judith R Kelsen, Robert N Baldassano, Hakon Hakonarson Christopher J Cardinale, Hakon Hakonarson, Center for Applied Genomics, Children s Hospital of Philadelphia, Abramson Research Center Suite 1216, Philadelphia, PA 19104, United States Judith R Kelsen, Robert N Baldassano, Division of Gastroenterology, Hepatology, and Nutrition, Department of Pediatrics, Children s Hospital of Philadelphia, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104, United States Author contributions: Cardinale CJ, Kelsen JR, Baldassano RN, Hakonarson H wrote and edited the manuscript. Supported by A Senior Research Award from the Crohn s to Cardinale CJ; Colitis Foundation of America to Hakonarson H; and a special purpose fund from the Edmunds Family Foundation for Ulcerative Colitis Studies to Baldassano RN Correspondence to: Hakon Hakonarson, MD, PhD, Director, Center for Applied Genomics, Children s Hospital of Philadelphia, Abramson Research Center Suite 1216, 3615 Civic Center Blvd, Philadelphia, PA 19104, United States. hakonarson@chop.edu Telephone: Fax: Received: August 11, 2013 Revised: September 11, 2013 Accepted: September 16, 2013 Published online: October 28, 2013 Abstract Approaches to understanding the genetic contribution to inflammatory bowel disease (IBD) have continuously evolved from family- and population-based epidemiology, to linkage analysis, and most recently, to genome-wide association studies (GWAS). The next stage in this evolution seems to be the sequencing of the exome, that is, the regions of the human genome which encode proteins. The GWAS approach has been very fruitful in identifying at least 163 loci as being associated with IBD, and now, exome sequencing promises to take our genetic understanding to the next level. In this review we will discuss the possible contributions that can be made by an exome sequencing approach both at the individual patient level to aid with disease diagnosis and future therapies, as well as in advancing knowledge of the pathogenesis of IBD Baishideng. All rights reserved. Key words: Sequencing; Exome; Genetics; Inflammatory bowel disease Core tip: The genetic understanding of inflammatory bowel disease (IBD) has progressed over the last twenty years as new technologies and analytic techniques have become available. The nascent revolution in next-generation sequencing will enable us to sequence the exome - all the protein coding genes in the genome - in thousands of individuals. This review discusses the implications of this new approach for diagnosis in very early onset IBD and as a tool to gain understanding of the hereditary basis of the common polygenic form of the disease at the population level. Cardinale CJ, Kelsen JR, Baldassano RN, Hakonarson H. Impact of exome sequencing in inflammatory bowel disease. World J Gastroenterol 2013; 19(40): Available from: URL: i40/6721.htm DOI: INTRODUCTION The inflammatory bowel diseases (IBDs) consist of two main types of pathology: Crohn s disease and ulcerative colitis. Over the preceding decades, genetic epidemiology of twins and families indicated that these diseases have a strong genetic component, but that they do not segregate according to a Mendelian pattern of inheritance such as autosomal dominant, autosomal recessive, or X-linked [1]. Twin studies of Crohn s have shown a concordance of 20%-50% for monozygotic twins and 0%-7% for dizygotic twins [2]. For ulcerative colitis the concordance is 14%-19% for monozygotic and 0%-7% for dizygotic [2]. The fact that the monozygotic concor October 28, 2013 Volume 19 Issue 40

34 Cardinale CJ et al. Exome sequencing in IBD Variant impact Rare mendelian variants Difficult to study with genetics Variant frequency Purifying evolutionary selection GWAS variants Figure 1 Relationship between variant frequency and functional impact. Rare and highly damaging variants such as those associated with familial forms of very early onset inflammatory bowel disease (IBD) tend to occur rarely in the population. They are unable to achieve high allele frequencies due to negative evolutionary selection. Variants captured by genome-wide association studies (GWAS), and which account for much of the population attributable risk of IBD, tend to be quite common but have small functional consequences (typically OR < 1.2). Rare variants with small impacts are difficult to assess statistically with the tools of genetics. Exome sequencing is intended to fill in the middle part of the curve: less common variants that have moderate impacts. dance is well below 100% shows that there are strong environmental contributions and that there is incomplete penetrance of the genetic susceptibility loci. At the same time, the risk is considerably elevated compared to the general population. Supported by the results of recent genome-wide association studies, the most commonly accepted model of IBD susceptibility is a multifactorial model in which polygenic inheritance at hundreds of genetic loci, each with small effects, contribute along with non-genetic factors, such as diet and microbiome composition. One of the first successful approaches to identifying specific risk genes was family-based linkage analysis. This approach seeks to identify chromosomal regions containing causative genes on the basis of recombinations within a family between a microsatellite marker and the trait of interest. Six loci were identified using linkage analysis, including the IBD3 locus containing the human leukocyte antigen complex on chromosome 6, and the IBD1 locus, the single largest genetic risk factor for Crohn s, which contains the nucleotide-binding oligomerization domain protein 2 (NOD2) gene on chromosome 16 [3-5]. The next technology to make a major impact in IBD genetics has been genome-wide association studies (GWAS). These studies involve genotyping hundreds of thousands of single nucleotide polymorphisms (SNPs) throughout the entire genome in order to find direct association between a specific polymorphism and the case/control status. The first successful study found an association between the interleukin (IL)23R locus and Crohn s disease in addition to replicating the NOD2 association [6]. Expanding the number of cases and controls in the cohort as genotyping prices dropped resulted in identification of ATG16L1 [7], IRGM, MST1, NKX2-3, and PTPN2 [8,9]. The first IBD GWAS studies in a pediatric cohort were reported by our group, highlighting associations with TNFRSF6B and IL27 [10,11]. As studies have grown more powered with increased cohort sizes, genotype imputation techniques [12], and international collaboration through the IBD Genetics Consortium, the tally of associated loci for Crohn s and ulcerative colitis has risen to 163 in the latest meta-analysis [13], demonstrating unequivocally the polygenic nature of IBD inheritance. Notably, the distribution of SNPs genotyped in a GWAS study covers intergenic as well as exonic and intronic regions, so that polymorphisms which predominately affect the regulation of gene expression through transcriptional control can be assessed. Analysis of data from the ENCODE consortium has advanced the notion that much of the heritability of complex disorders originates in these non-coding regulatory regions of the genome [14]. There is no assumption in GWAS that the susceptibility or protective variants are confined to amino acid substitutions in proteins, the type of variation that would be found in exome sequencing. However, a major disadvantage of GWAS studies is that they are much more attuned to detecting common variation, that is, greater than 5% minor allele frequency for a SNP. It is worthy of note that IBD has generated a greater number of associations than any form of pathology studied genetically to date, leading some to suggest that evolutionary selective pressures for variants in the genes underlying the immune response drove autoimmune-risk alleles to relatively high frequencies, a phenomenon known as balancing selection [15]. The greater sensitivity of GWAS towards common variants is one reason among many that GWAS studies have only been able to account for a fraction of the heritability of polygenic diseases such as IBD [16]. It is becoming increasingly clear that there is more to the story than the common disease-common variant hypothesis [17], and that rare variants, detectable only through sequencing, must also play a role [18,19]. Moreover, these coding variants are more likely to have high ORs, greater penetrance, and to be amenable to followup by functional experimentation [18]. Figure 1 illustrates the relationship between variant frequency and the phenotypic impact of the variant. Highly disruptive mutations will not rise to high frequency due to purifying selection. Exome sequencing is an ideal technology to fill in the intermediate frequency range of variants which may have stronger impacts than the weak associations detected by common GWAS variants. PROCESS OF EXOME SEQUENCING With current technology, sequencing the whole 3 billionbase pair genome at the required depth of coverage to make rare variant calls is an expensive process, making it impractical to use on the scale required to implicate 6722 October 28, 2013 Volume 19 Issue 40

35 Cardinale CJ et al. Exome sequencing in IBD less-common variants in IBD. Statistically validating less common variants with phenotypic impact would require GWAS-sized datasets comprising thousands of cases and controls [20]. A more practical alternative that has arisen since the emergence of next generation sequencing technology is to sequence the exome, the 1% of the genome that encodes protein. It has been estimated that 85% of monogenic, Mendelian disorders are the result of alterations in protein amino acid sequence [21], supporting the idea that exon-focused sequencing will yield the most functionally interesting variants. The most common way to fractionate the genome for exome sequencing is in-solution hybridization. This can be accomplished by shearing the DNA into small bp fragments by ultrasonic or enzymatic methods followed by ligation of common adapter sequences to the 3' and 5' ends of the fragments so that the sequencing primer can anneal. This whole-genome library is captured by hybridization in solution with nucleotide-long "baits" that are complementary to the exon sequence being targeted. The library-bound baits are bound to magnetic beads and the non-coding DNA is washed out. The captured fragments are eluted and amplified by PCR. Next generation sequencing instruments that utilize the exome library include the HiSeq and MiSeq (Illumina, Inc.) and Ion Torrent Proton (Life Technologies). The instruments sequence by synthesis with a DNA polymerase, analyzing the incorporation of the next nucleotide by fluorescence imaging with modified nucleotides (Illumina) or by electrical measurement of the protons produced by the incorporation of nucleotides (Ion Torrent). This generates a short read typically bp in length, significantly shorter than the 700-bp reads produced by traditional Sanger sequencing. The reads are furnished as a list of sequences accompanied by quality metrics, known as a FASTQ file. One of these instruments can generate gigabases of sequence per day. The FASTQ file is analyzed by a read-mapping program, such as the popular Burrows-Wheeler aligner [22], which matches these short reads with a reference genome. The alignment is stored in a common file format called BAM which is interpretable by a variety of analysis tools for visualization and variant identification. When enough independent reads have been aligned at the same nucleotide location in the genome, usually at least 20 reads, a variant calling application, for instance, Genome Analysis Toolkit [23,24], the variant caller for the 1000 Genomes Project, can be used to decide if the site matches the reference sequence or contains an alternate nucleotide. The variant calls can be collected in a variety of formats, typically the Variant Call File (VCF). A range of statistical analyses can be performed on the VCF files for each exome, including annotating them for function (missense, indel, synonymous) and likely impact of the variant (damaging, tolerated) using tools such as ANNOVAR [25], Sorting Intolerant From Tolerant [26,27], and PolyPhen [28]. These tools use evolutionary conservation of the gene across diverse species as well as the chemistry of the amino acid substitution to generate a predictive score of each variant s potential impact. The software tools also integrate information about the frequency of the variants in the general population using databases such as the The National Heart, Lung, and Blood Institute Exome Sequencing Project [29] and dbsnp [30], since it is most likely that a damaging and impactful mutation would be quite rare due to purifying evolutionary selection. In large case/control studies, the coding variants will be rarer than the polymorphisms identified through GWAS, so that any individual rare variant is unlikely to achieve a threshold of statistical significance [20]. Therefore, a variety of groups have developed methods to aggregate all of the rare variants in a gene and test them collectively in order to identify a rare variant burden in cases compared with controls or to detect an unusual distribution of variant frequencies between cases and controls for a given gene [31]. A number of these tests have the feature of being able to detect association in the presence of a mixture of risk, protective, and neutral variation [32]. ROLE FOR EXOME SEQUENCING IN IBD Individual- and family-based sequencing for clinical use In attempting to identify a role for exome sequencing in inflammatory bowel disease we can appreciate two scenarios where it might be used. The first scenario is that of an individual patient or family with an atypical clinical presentation whose diagnosis or therapeutic decision may be influenced by genetic information. This can be seen in the very young children who present with clinical symptoms of IBD, known as very early onset IBD (VEO-IBD). These children frequently present with a more severe disease and often with a phenotype that is distinct from older children and adults, including extensive colonic disease unresponsive to standard therapy. These findings suggest distinct etiopathogenic pathways. In one well-known case, a 15-mo-old child presented with failure to thrive and perianal fistulae that was refractory to medical care. His disease progressed to pancolonic involvement, however the terminal ileum and upper tract were spared. This early age of onset and severity suggested a severe perturbation of the immune system [33]. He underwent numerous surgical procedures and treatment with immunosuppressive drugs, as well as targeted genetic and immunologic testing that did not yield a recognizable diagnosis or remission of symptoms. Sequencing of the child s exome revealed that this patient had an exceedingly rare mutation on the X chromosome in the XIAP gene, a potent regulator of the inflammatory response. He was treated by bone marrow transplant resulting in resolution of his disease. In our own IBD center at the Children s Hospital of Philadelphia, we encountered a 5-mo-old patient with colonic inflammatory bowel disease. She presented with severe disease that was unresponsive to medical therapy. Her 6723 October 28, 2013 Volume 19 Issue 40

36 Cardinale CJ et al. Exome sequencing in IBD course was complicated by frequent episodes of dehydration and she became transfusion dependent despite various treatments. Exome sequencing in this patient revealed a mutation in the MEFV gene, resulting in a diagnosis of familial Mediterranean fever. The patient was referred to a pediatric rheumatology specialist and is being successfully treated for FMF with colchicine. These successes highlight the critical role of exome sequencing in carefully selected patients by providing diagnoses that can guide treatment. Factors that suggest a patient may have a rare genetic perturbation that might be elucidated by exome sequencing would include early onset of disease, unusual severity, familial pattern of transmission, and a refractory response to standard therapies. In these cases, collecting DNA samples from parents so that exome sequencing in a trio setting can be performed is of high value. This will allow the identification of de novo variants as well as aiding in the elimination of the numerous false positive variant calls that exome sequencing generates by checking for non-mendelian transmission of mutations. If a Mendelian inheritance model can be specified, as in the case of a consanguineous family which is likely to be autosomal recessive, such information can be of great help in narrowing down the causal variant. Homozygosity mapping in two consanguineous families was successfully used to identify mutations in the IL-10 receptor genes that resulted in severe VEO-IBD unresponsive to therapy. With this discovery, the disease resolved with bone marrow transplant [34]. This critical finding has been replicated in larger cohorts of patients with VEO-IBD and has shed light on an important pathway in the development of VEO-IBD [35]. A further appeal of applying exome sequencing in a family setting is in identifying novel monogenic causes of IBD that might yield an unexpected insight into the biology of disease, thereby directing interest towards novel targets for therapeutic development. An example would be the development of monoclonal antibodies that dramatically lower low-density lipoprotein (LDL) cholesterol by inhibiting proprotein convertase subtilisin kexin 9, a protein that was found to be deficient in a small number of individuals which genetically very low LDL [36]. Somatic mutations An area where exome sequencing has been impactful is in the sequencing of cancer tissue exomes in comparison with the patient s inherited exome. Some studies have been successful in identifying somatic driver mutations which are essential for the growth of the tumor, which can spur the development of chemotherapeutic interventions that will target the cancer specifically [37,38]. Great interest has sprung up around the promise of personalized, or precision, medicine for cancer driven by the somatic genomics of tumors [39]. Whether sequencing of intestinal biopsies in IBD present an avenue to identity somatic mutations that may be critically important for microbiome interaction is yet to be determined, but studies are underway that are addressing this possibility. Exome sequencing as a research tool to complement GWAS The second scenario in which exome sequencing can be impactful is as a research tool to augment GWAS in uncovering novel susceptibility loci and specific coding variants in the typical polygenic form of Crohn s and ulcerative colitis. Whether exome sequencing will succeed in this role to the same degree as GWAS is still controversial. It is clear that identifying genes carrying a burden of exonic rare variants in a disease with the highly polygenic architecture of IBD will require GWAS-sized cohorts, that is, ones consisting of tens of thousands of cases and controls [40]. The high cost and labor intensity of such an effort currently makes these studies prohibitively expensive to all but the most resource-rich groups. Nevertheless, some groups have succeeded in finding rare variant associations through sequencing at the phenotypic extremes of several complex traits in carefully selected candidate genes such as ANGPTL4 and ANG- PTL5 [41] or LPL [42] in triglycerides, SLC12A1 in blood pressure [43], and IFIH1 in type 1 diabetes [44]. Targeted next-generation sequencing in IBD has even produced some rare variant associations by following up GWAS hits, such as coding mutations that reduce signaling through the IL-23 receptor [45]. Targeted next-generation sequencing by Rivas et al [46] identified additional NOD2 and IL23R coding variants, as well as novel coding variants in CARD9, IL18RAP, CUL2, C1orf106, PTPN22 and MUC19. Our group has also recently identified rare nonsynonymous variants in the TNFRSF6B gene in IBD patients with pediatric onset disease [47], suggesting that this could be true for other GWAS loci as well. Table 1 summarizes genes that have been shown to have nonsynonymous variants with disease relevance in IBD. Despite the success of these candidate gene efforts, doubts remain about how practical rare variant studies will be when applied to the entire exome. Most of the rare variant associations identified so far in candidate gene sequencing would not meet the stringent Bonferroni correction for multiple testing on an exome scale, estimated to be a P < [31]. Investigators must also consider that supporting novel rare variant associations requires replication in additional cohorts since rare variants are often population-specific and frequencies can vary in very inhomogeneous ways in spatially structured populations [48]. This type of confounding, known as population stratification, can lead to spurious associations. Therefore, replication would likely require additional sequencing of large cohorts since genotyping of specific variants would likely not be useful in a different geography or ethnicity [49], although the replication sequencing might be limited only to genes of interest in the discovery cohort. Concerns about the likelihood of uncovering a substantial amount of heritability in common autoimmune diseases was raised by a recent report by Hunt et al [50]. This effort selected 25 risk genes that were identified in GWAS of at least two different common autoimmune 6724 October 28, 2013 Volume 19 Issue 40

37 Cardinale CJ et al. Exome sequencing in IBD Table 1 Genes implicated as having coding variants in inflammatory bowel disease Gene symbol Description Ref. ADAM17 Disintegrin and metalloproteinase [57] domain-containing protein 17 ATG16L1 Autophagy related 16-like 1 [7] C1orf106 Chromosome 1 open reading frame 106 [46] CARD9 Caspase recruitment domain [46] family, member 9 CUL2 Cullin 2 [46] DLG5 Discs-large 5 [58] HEATR3 HEAT repeat containing 3 [59] IL10RA and B Interleukin-10 receptor [34] IL18RAP Interleukin 18 receptor accessory protein [46] IL23R Interleukin 23 receptor [45] LRBA LPS-responsive vesicle trafficking, [60] beach and anchor containing MDR1 Multi-drug resistance 1 [61] MUC19 Mucin 19, oligomeric NCF2 Neutrophil cytosolic factor 2 [62] NDP52 Antigen nuclear dot 52 kda Protein [55] NOD2 Nucleotide-binding oligomerization [3,4] domain containing 2 PRDM1 PR domain containing 1, with [55] Zinc finger domain PTN22 Protein tyrosine phosphatase, [46] non-receptor type 22 (lymphoid) SLC22A4 Solute carrier family 22 (organic cation/ [63] ergothioneine transporter), member 4 TNFRSF6B Tumor necrosis factor receptor superfamily, member 6b, decoy [47] diseases. The exons of these 25 genes were sequenced with excellent coverage in a cohort of subjects with six autoimmune disease phenotypes and controls. They found that the great majority of variants uncovered occurred in a single subject. Five aggregating gene-based tests (rather than individual variant-based tests) were used to identify rare-variant enrichment for any of the genes but none were found to be statistically significant. The authors concluded that there was little support for large-scale whole-exome sequencing projects in common autoimmune diseases. While this report may portend that the impact from rare coding variants is negligible, there are some limitations to the study that leave open the possibility for meaningful discovery. The study considered only 25 genes, while an exome-based approach would survey all human protein-coding genes. It is likely that the risk conferred by these 25 GWAS genes is carried by non-coding variation, while the risk at some subset of loci in the genome could be carried by rare coding variation that are not captured by GWAS SNPs. This is particularly true for variants in the intermediate 0.5%-5% frequency range which could be impactful in aggregate while escaping detection in GWAS studies due to the weak linkage disequilibrium for variants in this frequency range with common variants [51]. Indeed, Hunt et al [50] did identify three risk mutations at approximately the 5% minor allele frequency. Furthermore, the abundant singleton mutations could still identify IBD risk genes through the use of statistical tests which weight mutations more or less heavily depending on their frequency, as the very rare variants are the most likely to be impactful functionally. Several methods such as adaptive sum tests [52], Sequence Kernel Association Test [53], and Variable Threshold [54] tests have been developed specifically for sustaining a high statistical power with rare variants. Finally, the six autoimmune disease phenotypes were quite heterogeneous in their pathologic nature, ranging from IBD to autoimmune thyroid disease to multiple sclerosis. These diseases have distinct mechanisms with different rare variants underlying them, possibly in none of the 25 genes sequenced. Therefore, it is arguably diluting the power to detect rare variant association by combining diverse diseases. A recent study by Ellinghaus et al [55] utilized exome sequencing to identify a role for missense variants in PRDM1 and NDP52 in Crohn s disease. Variants in these two genes were discovered in a cohort of 42 wholeexome sequenced individuals, with discovered variants being prioritized by functional impact scores and presence within GWAS-delineated loci. Over combined Crohn s and ulcerative colitis cases and controls were genotyped to establish that two variants, p.ser354asn in PRDM1 and p.val248ala in NDP52 were associated with IBD. Functional studies showed that the PRDM1 mutant increased T cell proliferation and cytokine secretion while the NDP52 mutant impaired the ability of the protein to downregulate nuclear factor kappa B signaling in toll-like receptor signaling pathways. This paper provides an example of how exome sequencing, even in a modest cohort, can refine GWAS signals and uncover less common risk variants, especially when coupled with functional validation. Sequencing and risk prediction Our group recently developed a machine-learning approach to predicting risk for IBD using data from the International IBD Genetics Consortium s ImmunoChip project [56]. The ImmunoChip assays SNPs with very dense coverage in genomic regions that have been associated with autoimmune disease through genomewide association studies. Due to the ImmunoChip s wide spectrum of variants and the large number of cases and controls genotyped in the project, it was possible to use a penalized logistic regression model to predict risk for IBD with area under the curve of 0.86 for Crohn s disease and 0.83 for ulcerative colitis. With the coming availability of large-scale whole exome data we expect that risk prediction can be improved further and may achieve clinically-useful levels with the comprehensive catalog of variation that would be produced through eventual whole-genome sequencing. CONCLUSION We can predict with some confidence that exome sequencing will have a place in IBD in a patient- or familybased settings where features of the clinical presentation 6725 October 28, 2013 Volume 19 Issue 40

38 Cardinale CJ et al. Exome sequencing in IBD suggest a likely monogenic, Mendelian basis for the disease. Personalized medicine based on the patient s genome in these carefully selected cases is no longer a far-off dream but a nascent reality. More uncertain are the prospects of large-scale exome sequencing projects for discovery of population-scale heritability for such a common and highly polygenic disease. Theoretical arguments can be made to support either position, but the debate can only be resolved by experimental testing of the common disease-rare variant hypothesis. Exome sequencing of rare variants may not collectively yield much explanation of the population attributable risk of disease, but it has great potential to highlight the key players in the pathogenesis of disease along with variants amenable to functional study and thereby influence the development of potent new therapeutics. REFERENCES 1 Taylor KD, Rotter JI, Yang HY. Genetics of inflammatory bowel disease. 2nd ed. Targan SR, Shanahan F, Karp LC, editors. Inflammatory bowel disease: from bench to bedside. New York: Springer, 2005: Halme L, Paavola-Sakki P, Turunen U, Lappalainen M, Farkkila M, Kontula K. Family and twin studies in inflammatory bowel disease. World J Gastroenterol 2006; 12: [PMID: ] 3 Hugot JP, Chamaillard M, Zouali H, Lesage S, Cézard JP, Belaiche J, Almer S, Tysk C, O Morain CA, Gassull M, Binder V, Finkel Y, Cortot A, Modigliani R, Laurent-Puig P, Gower- Rousseau C, Macry J, Colombel JF, Sahbatou M, Thomas G. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn s disease. Nature 2001; 411: [PMID: DOI: / ] 4 Ogura Y, Bonen DK, Inohara N, Nicolae DL, Chen FF, Ramos R, Britton H, Moran T, Karaliuskas R, Duerr RH, Achkar JP, Brant SR, Bayless TM, Kirschner BS, Hanauer SB, Nuñez G, Cho JH. A frameshift mutation in NOD2 associated with susceptibility to Crohn s disease. Nature 2001; 411: [PMID: DOI: / ] 5 Hugot JP, Laurent-Puig P, Gower-Rousseau C, Olson JM, Lee JC, Beaugerie L, Naom I, Dupas JL, Van Gossum A, Orholm M, Bonaiti-Pellie C, Weissenbach J, Mathew CG, Lennard-Jones JE, Cortot A, Colombel JF, Thomas G. Mapping of a susceptibility locus for Crohn s disease on chromosome 16. Nature 1996; 379: [PMID: DOI: /379821a0] 6 Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, Steinhart AH, Abraham C, Regueiro M, Griffiths A, Dassopoulos T, Bitton A, Yang H, Targan S, Datta LW, Kistner EO, Schumm LP, Lee AT, Gregersen PK, Barmada MM, Rotter JI, Nicolae DL, Cho JH. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 2006; 314: [PMID: DOI: /science ] 7 Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, Albrecht M, Mayr G, De La Vega FM, Briggs J, Günther S, Prescott NJ, Onnie CM, Häsler R, Sipos B, Fölsch UR, Lengauer T, Platzer M, Mathew CG, Krawczak M, Schreiber S. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet 2007; 39: [PMID: DOI: /ng1954] 8 Burton PR, Clayton DG, Cardon LR, Craddock N, Deloukas P, Duncanson A, Kwiatkowski DP, McCarthy MI, Ouwehand WH, Samani NJ, Todd JA, Donnelly P, Barrett JC, Burton PR, Davison D, Donnelly P, Easton D, Evans D, Leung HT, Marchini JL, Morris AP, Spencer CC, Tobin MD, Cardon LR, Clayton DG, Attwood AP, Boorman JP, Cant B, Everson U, Hussey JM, Jolley JD, Knight AS, Koch K, Meech E, Nutland S, Prowse CV, Stevens HE, Taylor NC, Walters GR, Walker NM, Watkins NA, Winzer T, Todd JA, Ouwehand WH, Jones RW, McArdle WL, Ring SM, Strachan DP, Pembrey M, Breen G, St Clair D, Caesar S, Gordon-Smith K, Jones L, Fraser C, Green EK, Grozeva D, Hamshere ML, Holmans PA, Jones IR, Kirov G, Moskvina V, Nikolov I, O Donovan MC, Owen MJ, Craddock N, Collier DA, Elkin A, Farmer A, Williamson R, McGuffin P, Young AH, Ferrier IN, Ball SG, Balmforth AJ, Barrett JH, Bishop DT, Iles MM, Maqbool A, Yuldasheva N, Hall AS, Braund PS, Burton PR, Dixon RJ, Mangino M, Suzanne S, Tobin MD, Thompson JR, Samani NJ, Bredin F, Tremelling M, Parkes M, Drummond H, Lees CW, Nimmo ER, Satsangi J, Fisher SA, Forbes A, Lewis CM, Onnie CM, Prescott NJ, Sanderson J, Mathew CG, Barbour J, Mohiuddin MK, Todhunter CE, Mansfield JC, Ahmad T, Cummings FR, Jewell DP, Webster J, Brown MJ, Clayton DG, Lathrop GM, Connell J, Dominczak A, Samani NJ, Marcano CA, Burke B, Dobson R, Gungadoo J, Lee KL, Munroe PB, Newhouse SJ, Onipinla A, Wallace C, Xue M, Caulfield M, Farrall M, Barton A, Bruce IN, Donovan H, Eyre S, Gilbert PD, Hider SL, Hinks AM, John SL, Potter C, Silman AJ, Symmmons DP, Thomson W, Worthington J, Clayton DG, Dunger DB, Nutland S, Stevens HE, Walker NM, Widmer B, Todd JA, Frayling TA, Freathy RM, Lango H, Perry JR, Shields BM, Weedon MN, Hattersley AT, Hitman GA, Walker M, Elliott KS, Groves CJ, Lindgren CM, Rayner NW, Timpson NJ, Zeggini E, Mc- Carthy MI, Newport M, Sirugo G, Lyons E, Vannberg F, Hill AV, Bradbury LA, Farrar C, Pointon JJ, Wordsworth P, Brown MA, Franklyn JA, Heward JM, Simmonds MJ, Gough SC, Seal S, Stratton MR, Rahman N, Ban M, Goris A, Sawcer SJ, Compston A, Conway D, Jallow M, Newport M, Sirugo G, Rockett KA, Kwiatowski DP, Bumpstead SJ, Chaney A, Downes K, Ghori MJ, Gwilliam R, Hunt SE, Inouye M, Keniry A, King E, McGinnis R, Potter S, Ravindrarajah R, Whittaker P, Widden C, Withers D, Deloukas P, Leung HT, Nutland S, Stevens HE, Walker NM, Todd JA, Easton D, Clayton DG, Burton PR, Tobin MD, Barrett JC, Evans D, Morris AP, Cardon LR, Cardin NJ, Davison D, Ferreira T, Pereira- Gale J, Hallgrimsdottir IB, Howie BN, Marchini JL, Spencer CC, Su Z, Teo YY, Vukcevic D, Donnelly P, Bentley D, Brown MA, Gordon LR, Caulfield M, Clayton DG, Compston A, Craddock N, Deloukas P, Donnelly P, Farrall M, Gough SC, Hall AS, Hattersley AT, Hill AV, Kwiatkowski DP, Mathew C, McCarthy MI, Ouwehand WH, Parkes M, Pembrey M, Rahman N, Samani NJ, Stratton MR, Todd JA, Worthington J. Genome-wide association study of cases of seven common diseases and 3000 shared controls. Nature 2007; 447: [PMID: DOI: /nature05911] 9 Parkes M, Barrett JC, Prescott NJ, Tremelling M, Anderson CA, Fisher SA, Roberts RG, Nimmo ER, Cummings FR, Soars D, Drummond H, Lees CW, Khawaja SA, Bagnall R, Burke DA, Todhunter CE, Ahmad T, Onnie CM, McArdle W, Strachan D, Bethel G, Bryan C, Lewis CM, Deloukas P, Forbes A, Sanderson J, Jewell DP, Satsangi J, Mansfield JC, Cardon L, Mathew CG. Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn s disease susceptibility. Nat Genet 2007; 39: [PMID: DOI: /ng2061] 10 Imielinski M, Baldassano RN, Griffiths A, Russell RK, Annese V, Dubinsky M, Kugathasan S, Bradfield JP, Walters TD, Sleiman P, Kim CE, Muise A, Wang K, Glessner JT, Saeed S, Zhang H, Frackelton EC, Hou C, Flory JH, Otieno G, Chiavacci RM, Grundmeier R, Castro M, Latiano A, Dallapiccola B, Stempak J, Abrams DJ, Taylor K, McGovern D, Silber G, Wrobel I, Quiros A, Barrett JC, Hansoul S, Nicolae DL, Cho JH, Duerr RH, Rioux JD, Brant SR, Silverberg MS, Taylor KD, Barmuda MM, Bitton A, Dassopoulos T, Datta LW, Green T, 6726 October 28, 2013 Volume 19 Issue 40

39 Cardinale CJ et al. Exome sequencing in IBD Griffiths AM, Kistner EO, Murtha MT, Regueiro MD, Rotter JI, Schumm LP, Steinhart AH, Targan SR, Xavier RJ, Libioulle C, Sandor C, Lathrop M, Belaiche J, Dewit O, Gut I, Heath S, Laukens D, Mni M, Rutgeerts P, Van Gossum A, Zelenika D, Franchimont D, Hugot JP, de Vos M, Vermeire S, Louis E, Cardon LR, Anderson CA, Drummond H, Nimmo E, Ahmad T, Prescott NJ, Onnie CM, Fisher SA, Marchini J, Ghori J, Bumpstead S, Gwillam R, Tremelling M, Delukas P, Mansfield J, Jewell D, Satsangi J, Mathew CG, Parkes M, Georges M, Daly MJ, Heyman MB, Ferry GD, Kirschner B, Lee J, Essers J, Grand R, Stephens M, Levine A, Piccoli D, Van Limbergen J, Cucchiara S, Monos DS, Guthery SL, Denson L, Wilson DC, Grant SF, Daly M, Silverberg MS, Satsangi J, Hakonarson H. Common variants at five new loci associated with early-onset inflammatory bowel disease. Nat Genet 2009; 41: [PMID: DOI: /ng.489] 11 Kugathasan S, Baldassano RN, Bradfield JP, Sleiman PM, Imielinski M, Guthery SL, Cucchiara S, Kim CE, Frackelton EC, Annaiah K, Glessner JT, Santa E, Willson T, Eckert AW, Bonkowski E, Shaner JL, Smith RM, Otieno FG, Peterson N, Abrams DJ, Chiavacci RM, Grundmeier R, Mamula P, Tomer G, Piccoli DA, Monos DS, Annese V, Denson LA, Grant SF, Hakonarson H. Loci on 20q13 and 21q22 are associated with pediatric-onset inflammatory bowel disease. Nat Genet 2008; 40: [PMID: DOI: /ng.203] 12 Marchini J, Howie B, Myers S, McVean G, Donnelly P. A new multipoint method for genome-wide association studies by imputation of genotypes. Nat Genet 2007; 39: [PMID: DOI: /ng2088] 13 Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K, Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z, Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN, Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A, Boucher G, Brand S, Büning C, Cohain A, Cichon S, D Amato M, De Jong D, Devaney KL, Dubinsky M, Edwards C, Ellinghaus D, Ferguson LR, Franchimont D, Fransen K, Gearry R, Georges M, Gieger C, Glas J, Haritunians T, Hart A, Hawkey C, Hedl M, Hu X, Karlsen TH, Kupcinskas L, Kugathasan S, Latiano A, Laukens D, Lawrance IC, Lees CW, Louis E, Mahy G, Mansfield J, Morgan AR, Mowat C, Newman W, Palmieri O, Ponsioen CY, Potocnik U, Prescott NJ, Regueiro M, Rotter JI, Russell RK, Sanderson JD, Sans M, Satsangi J, Schreiber S, Simms LA, Sventoraityte J, Targan SR, Taylor KD, Tremelling M, Verspaget HW, De Vos M, Wijmenga C, Wilson DC, Winkelmann J, Xavier RJ, Zeissig S, Zhang B, Zhang CK, Zhao H, Silverberg MS, Annese V, Hakonarson H, Brant SR, Radford- Smith G, Mathew CG, Rioux JD, Schadt EE, Daly MJ, Franke A, Parkes M, Vermeire S, Barrett JC, Cho JH. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 2012; 491: [PMID: DOI: /nature11582] 14 Maurano MT, Humbert R, Rynes E, Thurman RE, Haugen E, Wang H, Reynolds AP, Sandstrom R, Qu H, Brody J, Shafer A, Neri F, Lee K, Kutyavin T, Stehling-Sun S, Johnson AK, Canfield TK, Giste E, Diegel M, Bates D, Hansen RS, Neph S, Sabo PJ, Heimfeld S, Raubitschek A, Ziegler S, Cotsapas C, Sotoodehnia N, Glass I, Sunyaev SR, Kaul R, Stamatoyannopoulos JA. Systematic localization of common diseaseassociated variation in regulatory DNA. Science 2012; 337: [PMID: DOI: /science ] 15 Wang K, Baldassano R, Zhang H, Qu HQ, Imielinski M, Kugathasan S, Annese V, Dubinsky M, Rotter JI, Russell RK, Bradfield JP, Sleiman PM, Glessner JT, Walters T, Hou C, Kim C, Frackelton EC, Garris M, Doran J, Romano C, Catassi C, Van Limbergen J, Guthery SL, Denson L, Piccoli D, Silverberg MS, Stanley CA, Monos D, Wilson DC, Griffiths A, Grant SF, Satsangi J, Polychronakos C, Hakonarson H. Comparative genetic analysis of inflammatory bowel disease and type 1 diabetes implicates multiple loci with opposite effects. Hum Mol Genet 2010; 19: [PMID: DOI: / hmg/ddq078] 16 Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, McCarthy MI, Ramos EM, Cardon LR, Chakravarti A, Cho JH, Guttmacher AE, Kong A, Kruglyak L, Mardis E, Rotimi CN, Slatkin M, Valle D, Whittemore AS, Boehnke M, Clark AG, Eichler EE, Gibson G, Haines JL, Mackay TF, Mc- Carroll SA, Visscher PM. Finding the missing heritability of complex diseases. Nature 2009; 461: [PMID: DOI: /nature08494] 17 Reich DE, Lander ES. On the allelic spectrum of human disease. Trends Genet 2001; 17: [PMID: ] 18 Bodmer W, Bonilla C. Common and rare variants in multifactorial susceptibility to common diseases. Nat Genet 2008; 40: [PMID: DOI: /ng.f.136] 19 Pritchard JK. Are rare variants responsible for susceptibility to complex diseases? Am J Hum Genet 2001; 69: [PMID: DOI: /321272] 20 Tennessen JA, Bigham AW, O Connor TD, Fu W, Kenny EE, Gravel S, McGee S, Do R, Liu X, Jun G, Kang HM, Jordan D, Leal SM, Gabriel S, Rieder MJ, Abecasis G, Altshuler D, Nickerson DA, Boerwinkle E, Sunyaev S, Bustamante CD, Bamshad MJ, Akey JM. Evolution and functional impact of rare coding variation from deep sequencing of human exomes. Science 2012; 337: [PMID: DOI: /science ] 21 Choi M, Scholl UI, Ji W, Liu T, Tikhonova IR, Zumbo P, Nayir A, Bakkaloğlu A, Ozen S, Sanjad S, Nelson-Williams C, Farhi A, Mane S, Lifton RP. Genetic diagnosis by whole exome capture and massively parallel DNA sequencing. Proc Natl Acad Sci USA 2009; 106: [PMID: DOI: /pnas ] 22 Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009; 25: [PMID: DOI: /bioinformatics/ btp324] 23 DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 2011; 43: [PMID: DOI: /ng.806] 24 McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 2010; 20: [PMID: DOI: /gr ] 25 Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 2010; 38: e164 [PMID: DOI: /nar/gkq603] 26 Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res 2001; 11: [PMID: DOI: /gr ] 27 Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res 2003; 31: [PMID: ] 28 Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods 2010; 7: [PMID: DOI: / nmeth ] 29 Fu W, O Connor TD, Jun G, Kang HM, Abecasis G, Leal SM, Gabriel S, Rieder MJ, Altshuler D, Shendure J, Nickerson DA, Bamshad MJ, Akey JM. Analysis of 6,515 exomes reveals the recent origin of most human protein-coding variants. Nature 2013; 493: [PMID: DOI: /na October 28, 2013 Volume 19 Issue 40

40 Cardinale CJ et al. Exome sequencing in IBD ture11690] 30 Sherry ST, Ward M, Sirotkin K. dbsnp-database for single nucleotide polymorphisms and other classes of minor genetic variation. Genome Res 1999; 9: [PMID: ] 31 Li B, Liu DJ, Leal SM. Identifying rare variants associated with complex traits via sequencing. Curr Protoc Hum Genet 2013; Chapter 1: Unit 1.26 [PMID: DOI: / hg0126s78] 32 Neale BM, Rivas MA, Voight BF, Altshuler D, Devlin B, Orho-Melander M, Kathiresan S, Purcell SM, Roeder K, Daly MJ. Testing for an unusual distribution of rare variants. PLoS Genet 2011; 7: e [PMID: DOI: /journal.pgen ] 33 Worthey EA, Mayer AN, Syverson GD, Helbling D, Bonacci BB, Decker B, Serpe JM, Dasu T, Tschannen MR, Veith RL, Basehore MJ, Broeckel U, Tomita-Mitchell A, Arca MJ, Casper JT, Margolis DA, Bick DP, Hessner MJ, Routes JM, Verbsky JW, Jacob HJ, Dimmock DP. Making a definitive diagnosis: successful clinical application of whole exome sequencing in a child with intractable inflammatory bowel disease. Genet Med 2011; 13: [PMID: DOI: / GIM.0b013e ] 34 Glocker EO, Kotlarz D, Boztug K, Gertz EM, Schäffer AA, Noyan F, Perro M, Diestelhorst J, Allroth A, Murugan D, Hätscher N, Pfeifer D, Sykora KW, Sauer M, Kreipe H, Lacher M, Nustede R, Woellner C, Baumann U, Salzer U, Koletzko S, Shah N, Segal AW, Sauerbrey A, Buderus S, Snapper SB, Grimbacher B, Klein C. Inflammatory bowel disease and mutations affecting the interleukin-10 receptor. N Engl J Med 2009; 361: [PMID: DOI: /NEJ- Moa ] 35 Moran CJ, Walters TD, Guo CH, Kugathasan S, Klein C, Turner D, Wolters VM, Bandsma RH, Mouzaki M, Zachos M, Langer JC, Cutz E, Benseler SM, Roifman CM, Silverberg MS, Griffiths AM, Snapper SB, Muise AM. IL-10R polymorphisms are associated with very-early-onset ulcerative colitis. Inflamm Bowel Dis 2013; 19: [PMID: DOI: /ibd.22974] 36 Cohen J, Pertsemlidis A, Kotowski IK, Graham R, Garcia CK, Hobbs HH. Low LDL cholesterol in individuals of African descent resulting from frequent nonsense mutations in PCSK9. Nat Genet 2005; 37: [PMID: DOI: /ng1509] 37 Agrawal N, Frederick MJ, Pickering CR, Bettegowda C, Chang K, Li RJ, Fakhry C, Xie TX, Zhang J, Wang J, Zhang N, El-Naggar AK, Jasser SA, Weinstein JN, Treviño L, Drummond JA, Muzny DM, Wu Y, Wood LD, Hruban RH, Westra WH, Koch WM, Califano JA, Gibbs RA, Sidransky D, Vogelstein B, Velculescu VE, Papadopoulos N, Wheeler DA, Kinzler KW, Myers JN. Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science 2011; 333: [PMID: DOI: /science ] 38 Varela I, Tarpey P, Raine K, Huang D, Ong CK, Stephens P, Davies H, Jones D, Lin ML, Teague J, Bignell G, Butler A, Cho J, Dalgliesh GL, Galappaththige D, Greenman C, Hardy C, Jia M, Latimer C, Lau KW, Marshall J, McLaren S, Menzies A, Mudie L, Stebbings L, Largaespada DA, Wessels LF, Richard S, Kahnoski RJ, Anema J, Tuveson DA, Perez-Mancera PA, Mustonen V, Fischer A, Adams DJ, Rust A, Chan-on W, Subimerb C, Dykema K, Furge K, Campbell PJ, Teh BT, Stratton MR, Futreal PA. Exome sequencing identifies frequent mutation of the SWI/SNF complex gene PBRM1 in renal carcinoma. Nature 2011; 469: [PMID: DOI: /nature09639] 39 Chin L, Andersen JN, Futreal PA. Cancer genomics: from discovery science to personalized medicine. Nat Med 2011; 17: [PMID: DOI: /nm.2323] 40 Kiezun A, Garimella K, Do R, Stitziel NO, Neale BM, McLaren PJ, Gupta N, Sklar P, Sullivan PF, Moran JL, Hultman CM, Lichtenstein P, Magnusson P, Lehner T, Shugart YY, Price AL, de Bakker PI, Purcell SM, Sunyaev SR. Exome sequencing and the genetic basis of complex traits. Nat Genet 2012; 44: [PMID: DOI: /ng.2303] 41 Romeo S, Yin W, Kozlitina J, Pennacchio LA, Boerwinkle E, Hobbs HH, Cohen JC. Rare loss-of-function mutations in ANGPTL family members contribute to plasma triglyceride levels in humans. J Clin Invest 2009; 119: [PMID: DOI: /JCI37118] 42 Johansen CT, Wang J, Lanktree MB, Cao H, McIntyre AD, Ban MR, Martins RA, Kennedy BA, Hassell RG, Visser ME, Schwartz SM, Voight BF, Elosua R, Salomaa V, O Donnell CJ, Dallinga-Thie GM, Anand SS, Yusuf S, Huff MW, Kathiresan S, Hegele RA. Excess of rare variants in genes identified by genome-wide association study of hypertriglyceridemia. Nat Genet 2010; 42: [PMID: DOI: / ng.628] 43 Ji W, Foo JN, O Roak BJ, Zhao H, Larson MG, Simon DB, Newton-Cheh C, State MW, Levy D, Lifton RP. Rare independent mutations in renal salt handling genes contribute to blood pressure variation. Nat Genet 2008; 40: [PMID: DOI: /ng.118] 44 Nejentsev S, Walker N, Riches D, Egholm M, Todd JA. Rare variants of IFIH1, a gene implicated in antiviral responses, protect against type 1 diabetes. Science 2009; 324: [PMID: DOI: /science ] 45 Momozawa Y, Mni M, Nakamura K, Coppieters W, Almer S, Amininejad L, Cleynen I, Colombel JF, de Rijk P, Dewit O, Finkel Y, Gassull MA, Goossens D, Laukens D, Lémann M, Libioulle C, O Morain C, Reenaers C, Rutgeerts P, Tysk C, Zelenika D, Lathrop M, Del-Favero J, Hugot JP, de Vos M, Franchimont D, Vermeire S, Louis E, Georges M. Resequencing of positional candidates identifies low frequency IL23R coding variants protecting against inflammatory bowel disease. Nat Genet 2011; 43: [PMID: DOI: /ng.733] 46 Rivas MA, Beaudoin M, Gardet A, Stevens C, Sharma Y, Zhang CK, Boucher G, Ripke S, Ellinghaus D, Burtt N, Fennell T, Kirby A, Latiano A, Goyette P, Green T, Halfvarson J, Haritunians T, Korn JM, Kuruvilla F, Lagacé C, Neale B, Lo KS, Schumm P, Törkvist L, Dubinsky MC, Brant SR, Silverberg MS, Duerr RH, Altshuler D, Gabriel S, Lettre G, Franke A, D Amato M, McGovern DP, Cho JH, Rioux JD, Xavier RJ, Daly MJ. Deep resequencing of GWAS loci identifies independent rare variants associated with inflammatory bowel disease. Nat Genet 2011; 43: [PMID: DOI: /ng.952] 47 Cardinale CJ, Wei Z, Panossian S, Wang F, Kim CE, Mentch FD, Chiavacci RM, Kachelries KE, Pandey R, Grant SFA, Baldassano RN, Hakonarson H. Targeted resequencing identifies defective variants of Decoy Receptor 3 in pediatric-onset inflammatory bowel disease. Genes Immun 2013; In press [DOI: /gene ] 48 Mathieson I, McVean G. Differential confounding of rare and common variants in spatially structured populations. Nat Genet 2012; 44: [PMID: DOI: / ng.1074] 49 Liu DJ, Leal SM. Replication strategies for rare variant complex trait association studies via next-generation sequencing. Am J Hum Genet 2010; 87: [PMID: DOI: /j.ajhg ] 50 Hunt KA, Mistry V, Bockett NA, Ahmad T, Ban M, Barker JN, Barrett JC, Blackburn H, Brand O, Burren O, Capon F, Compston A, Gough SC, Jostins L, Kong Y, Lee JC, Lek M, MacArthur DG, Mansfield JC, Mathew CG, Mein CA, Mirza M, Nutland S, Onengut-Gumuscu S, Papouli E, Parkes M, Rich SS, Sawcer S, Satsangi J, Simmonds MJ, Trembath RC, Walker NM, Wozniak E, Todd JA, Simpson MA, Plagnol V, van Heel DA. Negligible impact of rare autoimmune-locus coding-region variants on missing heritability. Nature 2013; 6728 October 28, 2013 Volume 19 Issue 40

41 Cardinale CJ et al. Exome sequencing in IBD 498: [PMID: DOI: /nature12170] 51 Terwilliger JD, Hiekkalinna T. An utter refutation of the fundamental theorem of the HapMap. Eur J Hum Genet 2006; 14: [PMID: DOI: / sj.ejhg ] 52 Pan W, Shen X. Adaptive tests for association analysis of rare variants. Genet Epidemiol 2011; 35: [PMID: DOI: /gepi.20586] 53 Wu MC, Lee S, Cai T, Li Y, Boehnke M, Lin X. Rare-variant association testing for sequencing data with the sequence kernel association test. Am J Hum Genet 2011; 89: [PMID: DOI: /j.ajhg ] 54 Price AL, Kryukov GV, de Bakker PI, Purcell SM, Staples J, Wei LJ, Sunyaev SR. Pooled association tests for rare variants in exon-resequencing studies. Am J Hum Genet 2010; 86: [PMID: DOI: /j.ajhg ] 55 Ellinghaus D, Zhang H, Zeissig S, Lipinski S, Till A, Jiang T, Stade B, Bromberg Y, Ellinghaus E, Keller A, Rivas MA, Skieceviciene J, Doncheva NT, Liu X, Liu Q, Jiang F, Forster M, Mayr G, Albrecht M, Häsler R, Boehm BO, Goodall J, Berzuini CR, Lee J, Andersen V, Vogel U, Kupcinskas L, Kayser M, Krawczak M, Nikolaus S, Weersma RK, Ponsioen CY, Sans M, Wijmenga C, Strachan DP, McArdle WL, Vermeire S, Rutgeerts P, Sanderson JD, Mathew CG, Vatn MH, Wang J, Nöthen MM, Duerr RH, Büning C, Brand S, Glas J, Winkelmann J, Illig T, Latiano A, Annese V, Halfvarson J, D Amato M, Daly MJ, Nothnagel M, Karlsen TH, Subramani S, Rosenstiel P, Schreiber S, Parkes M, Franke A. Association between variants of PRDM1 and NDP52 and Crohn s disease, based on exome sequencing and functional studies. Gastroenterology 2013; 145: [PMID: DOI: / j.gastro ] 56 Wei Z, Wang W, Bradfield J, Li J, Cardinale C, Frackelton E, Kim C, Mentch F, Van Steen K, Visscher PM, Baldassano RN, Hakonarson H; the International IBD Genetics Consortium. Large Sample Size, Wide Variant Spectrum, and Advanced Machine-Learning Technique Boost Risk Prediction for Inflammatory Bowel Disease. Am J Hum Genet 2013; Epub ahead of print [PMID: DOI: /j.ajhg ] 57 Blaydon DC, Biancheri P, Di WL, Plagnol V, Cabral RM, Brooke MA, van Heel DA, Ruschendorf F, Toynbee M, Walne A, O Toole EA, Martin JE, Lindley K, Vulliamy T, Abrams DJ, MacDonald TT, Harper JI, Kelsell DP. Inflammatory skin and bowel disease linked to ADAM17 deletion. N Engl J Med 2011; 365: [PMID: DOI: /NEJ- Moa ] 58 Russell RK, Drummond HE, Nimmo ER, Anderson N, Wilson DC, Gillett PM, McGrogan P, Hassan K, Weaver LT, Bisset WM, Mahdi G, Satsangi J. The contribution of the DLG5 113A variant in early-onset inflammatory bowel disease. J Pediatr 2007; 150: [PMID: DOI: / j.jpeds ] 59 Zhang W, Hui KY, Gusev A, Warner N, Ng SM, Ferguson J, Choi M, Burberry A, Abraham C, Mayer L, Desnick RJ, Cardinale CJ, Hakonarson H, Waterman M, Chowers Y, Karban A, Brant SR, Silverberg MS, Gregersen PK, Katz S, Lifton RP, Zhao H, Nuñez G, Pe er I, Peter I, Cho JH. Extended haplotype association study in Crohn s disease identifies a novel, Ashkenazi Jewish-specific missense mutation in the NFκB pathway gene, HEATR3. Genes Immun 2013; 14: [PMID: DOI: /gene ] 60 Alangari A, Alsultan A, Adly N, Massaad MJ, Kiani IS, Aljebreen A, Raddaoui E, Almomen AK, Al-Muhsen S, Geha RS, Alkuraya FS. LPS-responsive beige-like anchor (LRBA) gene mutation in a family with inflammatory bowel disease and combined immunodeficiency. J Allergy Clin Immunol 2012; 130: e2 [PMID: DOI: / j.jaci ] 61 Brant SR, Panhuysen CI, Nicolae D, Reddy DM, Bonen DK, Karaliukas R, Zhang L, Swanson E, Datta LW, Moran T, Ravenhill G, Duerr RH, Achkar JP, Karban AS, Cho JH. MDR1 Ala893 polymorphism is associated with inflammatory bowel disease. Am J Hum Genet 2003; 73: [PMID: DOI: /379927] 62 Muise AM, Xu W, Guo CH, Walters TD, Wolters VM, Fattouh R, Lam GY, Hu P, Murchie R, Sherlock M, Gana JC, Russell RK, Glogauer M, Duerr RH, Cho JH, Lees CW, Satsangi J, Wilson DC, Paterson AD, Griffiths AM, Silverberg MS, Brumell JH. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2. Gut 2012; 61: [PMID: DOI: /gutjnl ] 63 Peltekova VD, Wintle RF, Rubin LA, Amos CI, Huang Q, Gu X, Newman B, Van Oene M, Cescon D, Greenberg G, Griffiths AM, St George-Hyslop PH, Siminovitch KA. Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat Genet 2004; 36: [PMID: DOI: /ng1339] P- Reviewers Decorti G, Fitzpatrick LR, Gazouli M, Yamamoto S S- Editor Gou SX L- Editor A E- Editor Liu XM 6729 October 28, 2013 Volume 19 Issue 40

42 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. WJG 20 th Anniversary Special Issues (9): Hepatitis B virus TOPIC HIGHLIGHT Virus entry mediated by hepatitis B virus envelope proteins John M Taylor John M Taylor, Fox Chase Cancer Center, Philadelphia, PA 19111, United States Correspondence to: John M Taylor, PhD, Professor Emeritus, Fox Chase Cancer Center, 333 Cottman Avenue, Philadelphia, PA 19111, United States. john.taylor@fccc.edu Telephone: Fax: Received: August 25, 2013 Revised: September 14, 2013 Accepted: September 16, 2013 Published online: October 28, 2013 Abstract Hepatitis B virus (HBV), a major cause of human liver disease worldwide, encodes three envelope proteins needed for the attachment and entry of the virus into susceptible host cells. A second virus, hepatitis delta virus, which is known to enhance liver disease in HBV infected patients, diverts the same HBV envelope proteins to achieve its own assembly and infection. In the lab, lentiviral vectors based on human immunodeficiency virus type 1 can be assembled using the HBV envelope proteins, and will similarly infect susceptible cells. This article provides a partial review and some personal reflections of how these three viruses infect and of how recipient cells become susceptible, along with some consideration of questions that remain to be answered Baishideng. All rights reserved. Key words: Hepatitis B virus; Hepatitis delta virus; Receptor; Envelope proteins; Entry Core tip: The recent identification of a key receptor for hepatitis B virus and hepatitis delta virus provokes a wider discussion of how different cells may become susceptible to infection when the receptor is provided. Taylor JM. Virus entry mediated by hepatitis B virus envelope proteins. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6730.htm DOI: i INTRODUCTION The following is a very brief introduction to the envelope proteins of hepatitis B virus (HBV) and of how they can be used to facilitate the assembly and infection by HBV and two other viruses. More detailed recent reviews are available elsewhere [1,2]. HBV encodes three envelope proteins, commonly referred via their size, as large, middle and small, or L, M and S. They have S as a common C-terminal domain. M contains additional N-terminal sequences, referred to as pres2. L, relative to M, has additional N-terminal sequences, referred to as pres1. L, M and S, exist with and without carbohydrate modifications. The L protein undergoes an essential myristoylation of a glycine residue penultimate to the N-terminus. Hepatitis delta virus (HDV) exists in nature in some patients who are also infected with HBV. While HDV uses a totally different method of genome replication than HBV, its final assembly is entirely dependent upon the envelope proteins of HBV; thus, it only produces infectious progeny in hepatocytes already infected with HBV (or producing envelope proteins from fortuitously integrated HBV DNA). HDV can infect a new hepatocyte in the presence or absence of HBV. In the humanized chimeric upa mouse model, human hepatocytes infected with HDV alone can persist for at least six weeks in the absence of HBV, a so-called latent infection, with ultimate rescue of virus production dependent on a follow-up infection by HBV [3]. Such studies suggest that in patients conversion of a latent HDV mono-infection may contribute to the persistence of HDV even in patients with low HBV replication. Many labs have produced retrovirus vectors that have 6730 October 28, 2013 Volume 19 Issue 40

43 Taylor JM. Virus entry been engineered to carry novel genes, that can be expressed following integration of the provirus; that is, the DNA copy of the viral RNA genome. Such retrovirus vectors have been assembled using envelope proteins of the wild type retrovirus, as well as those derived from other viruses, such as vesicular stomatitis or Ebola viruses [4]. However, what is relevant here is that such a retrovirus vector was assembled using the envelope proteins of HBV and acquired the host cell specificity of HBV and HDV [5]. ENVELOPE PROTEIN DETERMINANTS ESSENTIAL FOR INFECTIVITY Several labs have shown that an essential determinant for infectivity using HBV envelope proteins is located near the N-terminus of the pres1 domain of the L protein. The data for this are very good and include evidence that a synthetic peptide containing such sequences, especially if it is myristoylated, will act as a potent inhibitor of virus entry [6]. Interestingly, unlike the L and S proteins, the M protein can be omitted in experimental situations without a loss of assembly or infectivity, at least for HDV [7,8]. Thus, the role of M in HBV infection is unclear. The carbohydrate moieties attached to the three envelope proteins are essential for particle assembly and infectivity [2]. The three envelope proteins share at least four transmembrane domains. One shared loop is presented on the surface of the virus. This loop, containing the so-called A determinant, is highly antigenic. Certainly antibodies raised against the S protein will neutralize virus infectivity. A widely used, S protein based vaccine, protects individuals against both HBV and HDV. WHAT THE HOSTS PROVIDE Until last year, almost the only cells that could be infected by these viruses were primary human hepatocyte cultures. Such cultures are difficult both to establish, and can rapidly lose susceptibility to infection. Some non-human primary hepatocyte cultures were similarly susceptible; examples include chimpanzee and tupaia hepatocytes. Also, primary woodchuck hepatocytes are susceptible to HDV. Several years ago a cell line, HepaRG, was derived from a human liver tumor, and it is susceptible to infection by HBV and HDV [9]. These cells require specific in vitro culture conditions and they are almost as difficult to maintain as primary human hepatocytes. For many years groups worldwide had struggled to identify, and confirm the functionality of host molecules needed for HBV and HDV entry. Many candidates were identified but none were shown to be sufficient for virus entry and initiation of replication [6]. This situation was changed dramatically in late 2012 by a report from Yan et al [10]. They used a synthetic peptide corresponding to the myristoylated N-terminus of the HBV pres1 protein to affinity select a candidate virus receptor from hepatocyte cultures. These hepatocytes were derived the treeshrew (Tupaia belangeri). The purification procedure used nearzero-distance photo-cross-linking and tandem-affinity purification and yielded a single protein. Then, with mass spectrometry, they identified the protein as the sodium taurocholate cotransporting polypeptide, NTCP, also known as SLC10A1 [10]. NTCP transports bile acids from the blood into the liver. Their subsequent findings included evidence that the cdna clone of human NTCP, when transfected into human hepatocellular carcinoma cell lines, specifically HepG2 and Huh7, conferred susceptibility to both HBV and HDV. Susceptibility could be inhibited by the synthetic pres1 peptide. Furthermore, in susceptible primary hepatocyte cultures and HepaRG cells, suppression of NTCP with specific small interfering RNAs inhibited susceptibility. It remains to be shown whether the NTCP functions in vivo as well as in vitro. However, the situation is very promising in that other studies have already shown that the synthetic pres1 peptide to which it binds, is a potent inhibitor of in vivo infections of human hepatocytes (as transplanted into mice) by both HBV and HDV [11]. In their initial paper, the authors made use of prior studies by others of the established role of NTCP in the liver. This protein is 335 amino acids in length and is predicted to have 9 trans-membrane domains [12]. They thus compared the sequence of NTCP of the crab-eating monkey (Macaca fascicularis) (since hepatocytes from these monkeys are not susceptible to HBV infection) and humans. They noted that the primary sequence of the monkey protein has a limited number of specific differences relative to the human protein. The authors experimentally demonstrated that replacement of just nine contiguous amino acids of monkey NTCP with the corresponding sequence from the human protein produced a cdna, that when transfected into nonsusceptible liver cell lines, rendered them susceptible to infection by both HBV and HDV. Several commentaries by others on the NTCP findings have since been published [13-16]. And, several labs, in as yet unpublished studies, have confirmed the ability of recombinant NTCP to facilitate entry of HBV and HDV into otherwise non-susceptible cell lines. Moreover, two follow-up studies by Wenhui Li and coworkers have been published in In the first study, the focus was on the woolly monkey hepadnavirus, WMHBV, and its ability to infect tupaia hepatocytes [17]. Their findings include evidence that cdna of the woolly monkey NTCP when transfected into nonsusceptible liver cell lines renders them susceptible to both WMHBV and HDV pseudotyped with WMHBV envelope proteins. The authors thus suggest that orthologs of NTCP might function as receptors for all known primate hepadnaviruses. In the second study they examined mouse NTCP, and considered many exchanges with the human sequence to determine what might be need to achieve susceptibility [18]. They did find a region, of only two amino acids, that was sufficient to achieve HDV (but, as discussed below, not HBV) susceptibility. These changes 6731 October 28, 2013 Volume 19 Issue 40

44 Taylor JM. Virus entry were not at the same location as the changes needed on the crab-eating monkey NTCP [10]. We can infer that the secondary and maybe the tertiary structure of NTCP are needed for susceptibility. It is relevant that a recently published study by Meier et al [19] reports that cultured mouse hepatocytes will bind the pres1 peptide even though no infection is detected. This suggests that a bona fide binding site may be available on the mouse NTCP, but is insufficient for HBV infection. Scheick et al [20] suggest an additional step might be at the level of membrane fusion. It is important to note that earlier studies showed that HDV can actually infect mouse hepatocytes in vivo, although to only a low extent [21]. Therefore, the changes introduced into the mouse NTCP, as described above, may have increased the affinity of pres1 binding without, for HDV, a need to alter a second step (e.g., fusion) in HDV infection. Thus, it is possible that mice made transgenic for the modified NTCP will be readily infected with HDV. (They will not be infected by HBV and as such, may not be sufficient to create a new model of HBV induced hepatocellular carcinoma.) Or, perhaps, even overexpression of the unmodified mouse NTCP would allow more efficient in vivo infection by HDV. ATTACHMENT AND ENTRY Recent studies have shown that the initial attachment of HBV to susceptible cells depends upon glycosaminoglycans present on the cell surface [22-24]. This is a necessary but not sufficient step. Furthermore, even after virus has attached, entry can be significantly inhibited by a number of agents [25]. Of the latter, the most interesting inhibitor is the previously mentioned synthetic peptide, corresponding to the N-terminus of the pres1 domain [6,11]. It would seem that even after attachment, (additional) interactions with the putative host cell receptor remain to be made [25]. It could also be that multiple such interactions are needed to facilitate entry. FURTHER DISCUSSION AND OUTLOOK Clearly, the combination of attachment, entry, and initiation of HBV replication is more complex than that of HDV. A partial explanation of this difference comes from earlier studies: Firstly, transcription of RNA from HBV covalently closed-circular DNA (CCC DNA) depends upon host transcription factors, some of which are specific for the liver [2]. Additionally, CCC DNA formation is inefficient or even absent in transgenic mice [26]. Secondly, HDV replication can be initiated in many mammalian cell lines, not necessarily those that are derived from liver tissue [1]. Nevertheless, it also remains possible that it is the entry of HBV that differs from that of HDV; that is, it requires host contributions in addition to the expression of NTCP. As exemplified below, there are now multiple questions that can be asked of the entry mechanisms of other members of the hepadnavirus family. Certainly it is time to reinvestigate infection of duck hepatocytes by duck hepatitis B virus (DHBV). It was first found by an affinity strategy, that a host protein identified as carboxy peptidase D, binds the DHBV envelope protein [27]. However, no study has yet been able to confer susceptibility by expression of this protein [28,29]. Some studies have suggested a co-receptor, but again, this has not led to susceptibility [30]. Independently, it has been shown that the myristoylated N-terminus of the DHBV pres region is needed for infectivity [28,31]. Therefore, maybe an analogous application of the powerful peptide affinity strategy used by Wenhui Li and coworkers [10], will identify a functional DHBV receptor. And, an alternative and specific approach would be to directly test whether the duck NTCP can function as receptor. Also one can examine the newly reported HBV of bats [32]. This virus shows more sequence relationship to the orthohepadnavirus than to the avi hepadnaviruses. Novel questions can now be asked, such as what is the sequence of the bat NTCP, and would the cdna of this gene when expressed in human cell lines, confer susceptibility to infection. Another question is why HDV but not HBV will infect primary woodchuck hepatocytes. This may or may not be analogous to the abovementioned situation where human NTCP cdna transfected into non-liver cell lines will allow HDV but not HBV infection. Presumably the woodchuck hepatocytes provides an acceptable NTCP for HDV infection, but now one can address questions such as whether expression of one or more human cd- NAs will make the cells susceptible to HBV. In all these studies of cells susceptible to HDV or HBV, there is a question of the efficiency with which cells are infected. Even with primary hepatocytes and HepaRG cell line, the efficiency is typically less than 1%. Several possible explanations include low levels of expression of NTCP or low levels of NTCP that is functionally active. This efficiency is increased approximately 10-fold by the presence of 2%-4% polyethylene glycol, PEG [9,33]. Studies have shown that infection in the presence of PEG is still be inhibited by the synthetic pres1 peptide, indicating that the infection is still specific for the NTCP receptor. PEG is most likely causing aggregates of virus particles; certainly, at 6%-10% PEG the virus can even be collected by low speed centrifugation. Thus, it may be that the low levels of PEG produce aggregates that can more efficiently make use of the available NTCP receptor present on the surface of the hepatocytes. Future studies with cdna transfected cell lines will no doubt test the relevance of the amount of NTCP expressed at the cell surface and infection by un-aggregated vs aggregated virus. Perhaps controlled mixtures of functional and non-functional NTCP cdnas will also help clarify what is involved. In summary, the important new finding of NTCP as a functional receptor has opened the way for much more basic research concerning the entry of HBV and HDV into susceptible cells. And, in turn, such information will 6732 October 28, 2013 Volume 19 Issue 40

45 Taylor JM. Virus entry Cell Biosci 2013; 3: 2 [PMID: ] 15 Seeger C, Mason WS. Sodium-dependent taurocholic cotransporting polypeptide: a candidate receptor for human hepatitis B virus. Gut 2013; 62: [PMID: DOI: /gutjnl ] 16 Warner N, Locarnini S. The new front-line in hepatitis B/D research: identification and blocking of a functional receptor. Hepatology 2013; 58: 9-12 [PMID: DOI: / hep.26292] 17 Zhong G, Yan H, Wang H, He W, Jing Z, Qi Y, Fu L, Gao Z, Huang Y, Xu G, Feng X, Sui J, Li W. Sodium taurocholate cotransporting polypeptide mediates woolly monkey hepatitis B virus infection of Tupaia hepatocytes. J Virol 2013; 87: [PMID: ] 18 Yan H, Peng B, He W, Zhong G, Qi Y, Ren B, Gao Z, Jing Z, Song M, Xu G, Sui J, Li W. Molecular determinants of hepatitis B and D virus entry restriction in mouse sodium taurocholate cotransporting polypeptide. J Virol 2013; 87: [PMID: ] 19 Meier A, Mehrle S, Weiss TS, Mier W, Urban S. Myristoylated PreS1-domain of the hepatitis B virus L-protein mediates specific binding to differentiated hepatocytes. Hepatology 2013; 58: [PMID: DOI: /hep.26181] 20 Schieck A, Schulze A, Gähler C, Müller T, Haberkorn U, Alexandrov A, Urban S, Mier W. Hepatitis B virus hepatotropism is mediated by specific receptor recognition in the liver and not restricted to susceptible hosts. Hepatology 2013; 58: [PMID: DOI: /hep.26211] 21 Netter HJ, Kajino K, Taylor JM. Experimental transmission of human hepatitis delta virus to the laboratory mouse. J Virol 1993; 67: [PMID: ] 22 Leistner CM, Gruen-Bernhard S, Glebe D. Role of glycosaminoglycans for binding and infection of hepatitis B virus. Cell Microbiol 2008; 10: [PMID: ] 23 Schulze A, Gripon P, Urban S. Hepatitis B virus infection initiates with a large surface protein-dependent binding to heparan sulfate proteoglycans. Hepatology 2007; 46: [PMID: DOI: /hep.21896] 24 Lamas Longarela O, Schmidt TT, Schöneweis K, Romeo R, Wedemeyer H, Urban S, Schulze A. Proteoglycans act as cellular hepatitis delta virus attachment receptors. PLoS One 2013; 8: e58340 [PMID: DOI: /journal. pone ] 25 Han Z, Nogusa S, Nicolas E, Balachandran S, Taylor J. Interferon impedes an early step of hepatitis delta virus infection. PLoS One 2011; 6: e22415 [PMID: DOI: / journal.pone ] 26 Raney AK, Eggers CM, Kline EF, Guidotti LG, Pontoglio M, Yaniv M, McLachlan A. Nuclear covalently closed circular viral genomic DNA in the liver of hepatocyte nuclear factor 1 alpha-null hepatitis B virus transgenic mice. J Virol 2001; 75: [PMID: DOI: / JVI ] 27 Kuroki K, Eng F, Ishikawa T, Turck C, Harada F, Ganem D. gp180, a host cell glycoprotein that binds duck hepatitis B virus particles, is encoded by a member of the carboxypeptidase gene family. J Biol Chem 1995; 270: [PMID: ] 28 Urban S, Breiner KM, Fehler F, Klingmüller U, Schaller H. Avian hepatitis B virus infection is initiated by the interaction of a distinct pre-s subdomain with the cellular receptor gp180. J Virol 1998; 72: [PMID: ] 29 Breiner KM, Urban S, Schaller H. Carboxypeptidase D (gp180), a Golgi-resident protein, functions in the attachment and entry of avian hepatitis B viruses. J Virol 1998; 72: [PMID: ] 30 Li JS, Tong SP, Wands JR. Characterization of a 120-Kilodalton pre-s-binding protein as a candidate duck hepatitis B virus receptor. J Virol 1996; 70: [PMID: ] 31 Urban S, Gripon P. Inhibition of duck hepatitis B virus infecallow new applied research, possibly providing additional novel ways in which such entry can be interfered with, all new armamentaria for treating chronic HBV and HDV infections. ACKNOWLEDGMENTS Helpful discussions and comments on the manuscript were provided by Christoph Seeger and William Mason. REFERENCES 1 Taylor JM, Purcell RH, Farci P. Hepatitis D (Delta) Virus. In: Knipe DM, Howley PM, editors. Fields Virology. 6 ed. Philadelphia: Lippincott Williams & Wilkins, 2013: Seeger C, Zoulim F, Mason WS. Hepadnaviruses. In: Knipe DM, Howley PM, editors. Fields Virology. 6 ed. Philadelphia: Lippincott Williams & Wilkins, 2013: Lütgehetmann M, Mancke LV, Volz T, Helbig M, Allweiss L, Bornscheuer T, Pollok JM, Lohse AW, Petersen J, Urban S, Dandri M. Humanized chimeric upa mouse model for the study of hepatitis B and D virus interactions and preclinical drug evaluation. Hepatology 2012; 55: [PMID: DOI: /hep.24758] 4 Watson DJ, Kobinger GP, Passini MA, Wilson JM, Wolfe JH. Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins. Mol Ther 2002; 5: [PMID: ] 5 Chai N, Chang HE, Nicolas E, Gudima S, Chang J, Taylor J. Assembly of hepatitis B virus envelope proteins onto a lentivirus pseudotype that infects primary human hepatocytes. J Virol 2007; 81: [PMID: ] 6 Urban S. New insights into hepatitis B and hepatitis delta virus entry. Future Virol 2008; 3: Sureau C, Guerra B, Lee H. The middle hepatitis B virus envelope protein is not necessary for infectivity of hepatitis delta virus. J Virol 1994; 68: [PMID: ] 8 Gudima S, He Y, Chai N, Bruss V, Urban S, Mason W, Taylor J. Primary human hepatocytes are susceptible to infection by hepatitis delta virus assembled with envelope proteins of woodchuck hepatitis virus. J Virol 2008; 82: [PMID: ] 9 Gripon P, Rumin S, Urban S, Le Seyec J, Glaise D, Cannie I, Guyomard C, Lucas J, Trepo C, Guguen-Guillouzo C. Infection of a human hepatoma cell line by hepatitis B virus. Proc Natl Acad Sci USA 2002; 99: [PMID: ] 10 Yan H, Zhong G, Xu G, He W, Jing Z, Gao Z, Huang Y, Qi Y, Peng B, Wang H, Fu L, Song M, Chen P, Gao W, Ren B, Sun Y, Cai T, Feng X, Sui J, Li W. Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. Elife 2012; 1: e00049 [PMID: DOI: /eLife.00049] 11 Petersen J, Dandri M, Mier W, Lütgehetmann M, Volz T, von Weizsäcker F, Haberkorn U, Fischer L, Pollok JM, Erbes B, Seitz S, Urban S. Prevention of hepatitis B virus infection in vivo by entry inhibitors derived from the large envelope protein. Nat Biotechnol 2008; 26: [PMID: ] 12 Bijsmans IT, Bouwmeester RA, Geyer J, Faber KN, van de Graaf SF. Homo- and hetero-dimeric architecture of the human liver Na+-dependent taurocholate co-transporting protein. Biochem J 2012; 441: [PMID: DOI: /BJ ] 13 Chen ZJ, Ye J. Getting to grips with hepatitis. Elife 2012; 1: e00301 [PMID: DOI: /eLife.00301] 14 Chen PJ, Wu TC. One step closer to an experimental infection system for Hepatitis B Virus? --- the identification of sodium taurocholate cotransporting peptide as a viral receptor October 28, 2013 Volume 19 Issue 40

46 Taylor JM. Virus entry tion by a myristoylated pre-s peptide of the large viral surface protein. J Virol 2002; 76: [PMID: ] 32 He B, Fan Q, Yang F, Hu T, Qiu W, Feng Y, Li Z, Li Y, Zhang F, Guo H, Zou X, Tu C. Hepatitis virus in long-fingered bats, myanmar. Emerg Infect Dis 2013; 19: [PMID: DOI: /eid ] 33 Gripon P, Diot C, Guguen-Guillouzo C. Reproducible high level infection of cultured adult human hepatocytes by hepatitis B virus: effect of polyethylene glycol on adsorption and penetration. Virology 1993; 192: [PMID: ] P- Reviewers Andrisani O, Suzuki T, Tamori A S- Editor Wen LL L- Editor A E- Editor Zhang DN 6734 October 28, 2013 Volume 19 Issue 40

47 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Pathogenesis of hepatic steatosis: The link between hypercortisolism and non-alcoholic fatty liver disease Giovanni Tarantino, Carmine Finelli Giovanni Tarantino, Department of Clinical Medicine and Surgery, Federico Ⅱ University Medical School of Naples, Naples, Italy Giovanni Tarantino, INT Fondazione Pascale, Cancer Research Center of Mercogliano, Mercogliano (AV), Italy Carmine Finelli, Center of Obesity and Eating Disorder, Stella Maris Mediterraneum Foundation, Contrada Santa Lucia 80035, Chiaromonte, Potenza, Italy Author contributions: Tarantino G conceived the research, contributed to write the paper and critically revised the manuscript; Finelli C drafted the manuscript. Correspondence to: Giovanni Tarantino, MD, Department of Clinical Medicine and Surgery, Federico Ⅱ University Medical School of Naples, Via Sergio Pansini, 5, Naples, Italy. tarantin@unina.it Telephone: Fax: Received: May 28, 2013 Revised: September 10, 2013 Accepted: September 16, 2013 Published online: October 28, 2013 Abstract Based on the available literature, non alcoholic fatty liver disease or generally speaking, hepatic steatosis, is more frequent among people with diabetes and obesity, and is almost universally present amongst morbidly obese diabetic patients. Non alcoholic fatty liver disease is being increasingly recognized as a common liver condition in the developed world, with non alcoholic steatohepatitis projected to be the leading cause of liver transplantation. Previous data report that only 20% of patients with Cushing s syndrome have hepatic steatosis. Aiming at clarifying the reasons whereby patients suffering from Cushing s syndrome - a condition characterized by profound metabolic changes - present low prevalence of hepatic steatosis, the Authors reviewed the current concepts on the link between hypercortisolism and obesity/metabolic syndrome. They hypothesize that this low prevalence of fat accumulation in the liver of patients with Cushing s syndrome could result from the inhibition of the so-called low-grade chronicinflammation, mainly mediated by Interleukin 6, due to an excess of cortisol, a hormone characterized by an anti-inflammatory effect. The Cushing s syndrome, speculatively considered as an in vivo model of the hepatic steatosis, could also help clarify the mechanisms of non alcoholic fatty liver disease Baishideng. All rights reserved. Key words: Nonalcoholic fatty liver disease; Cushing s syndrome; Hypercotisolism Core tip: This overview of the literature is related to hepatic steatosis, its prevalence, clinical consequences and, in particular, the pathogenesis of this disorder. The authors focus on the link between hypercortisolism and obesity/metabolic syndrome. The main question of the work relates to the low prevalence of hepatic steatosis (only 20%) described in 50 newly diagnosed patients with Cushing s syndrome based on appropriate computed tomography scans available for retrospective analysis. The authors try to explain this finding by the anti-inflammatory effect of high circulating levels of glucocorticoids. Tarantino G, Finelli C. Pathogenesis of hepatic steatosis: The link between hypercortisolism and non-alcoholic fatty liver disease. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: INTRODUCTION In Cushing s syndrome, high circulating glucocorticoid (GC) levels cause visceral obesity, insulin resistance, diabetes mellitus, dyslipidemia, hypertension, hepatic steatosis and an increased risk of coronary artery disease (CAD) [1,2]. GCs excess stimulates gluconeogenesis in the 6735 October 28, 2013 Volume 19 Issue 40

48 Tarantino G et al. NAFLD and hypercortisolism liver and inhibits insulin sensitivity both in the liver and in skeletal muscles, which represent the most important sites responsible for glucose metabolism. In particular, glucocorticoid excess stimulates the expression of several key enzymes involved in the process of gluconeogenesis, with a consequent increase in glucose production, and an impairment of insulin sensitivity either directly by interfering with the insulin receptor signaling pathway or indirectly, through the stimulation of lipolysis and proteolysis and the consequent increase in fatty acids and amino acids, which contribute to the development of insulin resistance (IR). Moreover, the peculiar distribution of adipose tissue throughout the body, with the predominance of visceral adipose tissue, significantly contributes to the worsening of IR and to the development of a metabolic syndrome, which has a role in the onset and maintenance of impaired glucose tolerance [3]. METABOLIC SYNDROME AND 11β-HYDROXYSTEROID DEHYDROGENASE TYPE 1 The much more prevalent metabolic syndrome a medical condition with a clustering of risk factors for cardiovascular disease and type 2 diabetes, such as IR, type 2 diabetes, dyslipidemia and hypertension, typically in association with visceral obesity and hepatic steatosis shares metabolic alterations and physical findings with Cushing s syndrome [1]. However, any pathogenic role for GCs in the metabolic syndrome or idiopathic obesity is still unclear [4]. Recent studies in humans and rodents suggest a role for tissue rather than plasma GCs excess in the development of idiopathic obesity and the metabolic syndrome, via intracellular steroid reactivation of inert circulating 11-dehydrocorticosterone (cortisone in humans) into active corticosterone (cortisol) by 11β-hydroxysteroid dehydrogenase (11β-HSD) type 1. Surprisingly, this enzyme is highly expressed not only in adipose tissue and brain but in the liver as well [5]. The 2- to 3-fold-increased 11β-HSD1 activity in adipose tissue in obese Zucker rats [6] and in some [7,8] but not all [9] studies on obese humans may be causal to visceral obesity and its metabolic consequences. Supporting this hypothesis, visceral obesity, hyperlipidemia, IR, glucose intolerance/diabetes [10] and hypertension [11] are driven in transgenic mice by overexpression (2- to 3-fold) of 11β-HSD1 selectively in adipose tissue. Notably, as with the human metabolic syndrome, circulating plasma corticosterone levels in ap2-hsd1 TG mice are unaltered [10]. Conversely, 11β-HSD1 null mice exhibit a protective glycemic, lipid, and lipoprotein profile [12,13] and show increased expression of hepatic mrnas encoding regulators of fatty acid beta-oxidation [13]. While intra-adipose but not systemic corticosterone concentrations are elevated in ap2-hsd1 TG mice, corticosterone delivery to the liver is also increased about three-fold via spillover of adipose steroid production into the portal vein. The highest expression of 11β-HSD1 occurs in the liver [14], and hepatic 11β-HSD1 mrna levels are regulated by diet, gender and hormones [1,14-16]. Heterogeneity of hepatic 11β-HSD1 activity may be relevant to the development of specific fatty liver, insulin-resistant, and hypertensive syndromes without obesity in humans; it is also likely to play a role in myotonic dystrophy, where marked insulin resistance and dyslipidemia have been shown to occur with elevated hepatic 11β-reduction of cortisone to cortisol, which is positively correlated to the severity of disease [17]. Dysregulation of the specific action of GCs and not of the alterations of GC levels has been proposed as a central feature of the metabolic syndrome [18]. In fact, states of GC excess recapitulate almost all features of the metabolic syndrome, but Cushing s disease is rare and circulating cortisol levels are normal in the vast majority of patients with obesity and type 2 diabetes. This finding has raised the possibility that the features of the metabolic syndrome could be due to an increase in locally available glucocorticoids through 11β-HSD1 [19-21]. Subsequently, a range of studies explored the role of 11β-HSD1 in the pathogenesis of the components of the metabolic syndrome including obesity, IR, hyperglycemia, hyperlipidemia and nonalcoholic fatty liver disease (NAFLD), or generally speaking, hepatic steatosis. Hepatic steatosis and visceral fat Indeed, only 20% of patients with Cushing s syndrome have hepatic steatosis [22]. NAFLD ranges from fatty liver to non alcoholic steatohepatitis (NASH) and cirrhosis, and is being increasingly recognized as the most common liver disease in the developed world. NASH - which most Authors consider as completely different from the more benign form, i.e., fatty liver - is projected to be the leading cause of liver transplantation. NAFLD has a great prevalence among people with diabetes and obesity and is almost universally present amongst morbidly obese diabetic patients [23-25]. Being a progressive form of liver injury, NASH carries a risk of developing hepatocarcinoma. There is strong evidence that IR and increased free fatty acids are the major cause ( first hit ) of NASH [26,27]. Inflammation plays an important additional role ( second hit ) with increased production of reactive oxygen species and proinflammatory cytokines. In addition, studies from different groups support the strict link between visceral adipose tissue and NASH [28,29]. In recent years, research has shown that amplification of GCs action by the intracellular enzyme 11β-HSD1 plays a key role in the development of central obesity [30,31] providing a basis for the phenotypic similarity between Cushing s syndrome and obesity in the metabolic syndrome; 11β-HSD1 increases intracellular glucocorticoid levels by converting inert cortisone to active cortisol. In vivo reductase activity of 11β-HSD1 predominates and is driven by NADPH generated by the microsomal enzyme hexose-6-phosphate-dehydrogenase (H6PDH) October 28, 2013 Volume 19 Issue 40

49 Tarantino G et al. NAFLD and hypercortisolism Epidemiological data indicate that hepatic steatosis is associated with IR, dyslipidemia and obesity, especially central obesity [32]. In clinical practice, the co-existence of these conditions defines the so-called metabolic syndrome [33]. Of note, NAFLD is considered by many authors as the hepatic manifestation of the metabolic syndrome [34-36]. Interestingly, the severity of hepatic steatosis is positively correlated with visceral adipose tissue accumulation in both obese and non-obese subjects, suggesting that hepatic fat infiltration may be influenced by visceral fat adipokines or, possibly, specific enzymes, regardless of body mass index [37]. As previously emphasized, some authors have pointed out the phenotypic similarities between central obesity, metabolic syndrome and patients with endogenous or exogenous glucocorticoid excess. These have led them to propose that cortisol contributes, at least in part, to the pathogenesis of those abnormalities, despite the fact that patients with obesity and metabolic syndrome have consistently normal cortisol levels in plasma and urine [38-40]. Accordingly, the concentrations of GCs found in the omental vein, draining into the portal vein, were not different from those detected in peripheral veins [41]. A plausible explanation for this phenomenon could be to consider the metabolic syndrome a result of increased local GC activity in certain organs, suggesting that central obesity might be, as proposed by Bujalska decades ago, a Cushing s disease of the omentum [42]. In connection with this concept, recent studies have shown that intracellular GC action not only depends upon the hypothalamo-pituitary-adrenal axis but also on local regulation at the pre-receptor level by the activity of two isoforms of the 11β-hydroxysteroid dehydrogenase enzyme type 1 and 2 (11β-HSD1 and 11β-HSD2) [43,44]. 11β -hydroxysteroid dehydrogenase type 1 and visceral adipose tissue Enzyme type 1, 11β-HSD1, is a microsomal enzyme, expressed mainly in the liver and adipose tissue, acting as a NADP (H)-dependent reductase converting inactive cortisone to active cortisol, which locally activates GCs receptors [45]. According to this view, progressive expansion of visceral fat would result in an increased production of cortisol by the action of 11β-HSD1, causing splanchnic and portal hypercortisolism, which could contribute to the pathogenesis of such metabolic disorders, including NAFLD [46-48]. Recently, it has been demonstrated that 11β-HSD1 expression levels in the liver and in visceral adipose tissue in morbidly obese patients, correlate with dyslipidemia and IR, suggesting that this enzyme might have a pathogenic role in obesity and the related metabolic disorders [49]. The role of 11β-HSD1 in NAFLD has been largely studied in humans, with conflicting results [46,47]. In any case, in two studies assessing sequential changes of enzyme expression in obese mice developing hepatic steatosis, the Authors found an overexpression of 11β-HSD1 in visceral adipose tissue and hepatic tissue with the occurrence of portal hypercortisolism [50,51]. However, further research is needed to precisely define the role of 11β-HSD1 in the origin and development of NAFLD. In addition, the effects of treatment with specific 11β-HSD1 inhibitors [52] in NAFLD deserve more thorough exploration, as these agents have the potential to improve insulin sensitivity [53] and may ultimately add to the available treatment options. Indeed, the rationale behind this type of intervention is challenged by the observation that in NASH, the more severe form of NAFLD, the increased 11β-HSD1 activity and consequent cortisol regeneration is supposed to limit hepatic inflammation [54]. This point will be further dealt with later on. In general, primary pre-adipocyte cultures isolated from human adipose tissue represent heterogeneous cell populations, some of which can be part of the immune system [55]. GCs affects the genes associated with immune responses, such as interleukin-6 (IL-6), TNFAIP6 [56] and CD163. The simultaneous GC-induced downregulation of the TNFAIP6 and IL-6 in human preadipocytes might reflect the interaction between these two genes in adipose tissue inflammation. Glutathione peroxidase 3 precursor (GPX3), the plasma GPX3, catalyses the reduction of hydrogen peroxide, organic hydroperoxide and lipid peroxides, thus protecting cells against oxidative damage. GPX3 was reported to be present in human adipose tissue [57], and GPX3 was identified as being one of the most highly expressed genes in the pre-adipocyte compartment of human adipose tissue as well as a novel GC-target gene. Recently, adipose tissue has been defined as a major site of production of serum amyloid A (SSA) [58], a wellknown risk factor for CAD [59]. It has been shown that ASSA is a GC-target gene in omental preadipocytes. Together, these findings contribute to the role of omental tissue as a potential link between an inflammatory response and CAD. 11β-HSD1 EXPRESSION AND ACTIVITY IN THE LIVER Conflicting observations have been made regarding this issue. Most studies suggest that 11β-HSD1 expression and activity in the liver is down-regulated in obesity [54, 60]. This down-regulation, however, appears to be defective in insulin resistant individuals [61]. The failure to downregulate hepatic 11β-HSD1 could further contribute to IR and, on the basis of the fact that GCs stimulate lipid production, also exacerbate dyslipidemia. These relationships are complicated by the expression of additional glucocorticoid metabolizing enzymes in the liver, most importantly the A-ring reductases (5α- and 5β- reductase) [15,54]. The expression of these enzymes also appears to be associated with IR and, in a similar manner, to 11β-HSD1, showing a pattern of down-regulation with increased adiposity and insulin resistance. A possible mediator of the hepatic changes seen in the metabolic syndrome could be the increased production of cortisol 6737 October 28, 2013 Volume 19 Issue 40

50 Tarantino G et al. NAFLD and hypercortisolism At least some of the immunomodulatory effects of GCs in the inflammatory response are dependent on 11β-HSD1 activity. For example, 11β-HSD1 -deficient mice suffering from experimental arthritis exhibit a defrom visceral fat in obesity. This increased cortisol would subsequently drain to the liver through portal circulation. However, recent studies examining cortisol and cortisone levels in peripheral, portal, and hepatic vein blood samples indicated that cortisol production from visceral adipose tissue, and thus the amount of exposure of the liver, does not significantly change with increasing obesity [62-64], confirming previous data [41]. ROLE OF INTERLEUKIN-6 IL-6 is expressed in and released from both the subcutaneous and omental adipose tissues [65] with a two- to three-fold higher in vitro release of IL-6 from omental compared to subcutaneous adipocytes in vitro. The in vivo release of IL-6 from fat contributes as much as 35% to the basal circulating levels and may at least in part explain the positive correlation between serum levels of IL-6 and obesity. In rodents, obesity is associated with macrophage accumulation in adipose tissue, and these macrophages release inflammatory mediators and molecules promoting inflammation. Inflammatory mechanisms play a key role in the pathogenesis of type 2 diabetes. This low-grade chronic inflammation has been proposed to be mediated by the IL-6 family of cytokines, tumor necrosis factoralpha, interleukin-1 beta, IL-18, and certain other chemokines. In addition to its immunoregulatory actions IL-6 has been proposed to affect glucose homeostasis and metabolism directly and indirectly by its action on skeletal muscle cells, adipocytes, hepatocytes, pancreatic beta-cells and neuroendocrine cells [66]. It has been suggested that IL-6 might play a role in the pathogenesis of Cushing s disease [67]. Although an increased production of IL-6 has been reported in patients with either active or remitted Cushing s syndrome, elevated GCs levels in these patients may prevent excessive action of IL-6 due to the persistent accumulation of central fat [68]. In fact, it has been hypothesized that IL-6 deficiency exacerbates hepatic insulin resistance and inflammation, a process that appears to be related to defects in mitochondrial metabolism [69]. On the other hand, higher levels of circulating IL-6 were found in patients with the more severe form of NAFLD [70]. IR is strictly linked to anti-apoptotic serum Bcl-2 values [71], which were higher in simple fatty liver than in NASH patients, suggesting a protective role of the antiapoptotic process in liver and perhaps in other areas [72]. Apoptotic cell death is caspase-dependent and is associated with mitochondrial membrane depolarization and cytochrome c release [73]. Adhering to the hypothesis that the exposure of hepatocytes to free fatty acids, resulting in increased reactive oxygen species production and mitochondrial damage, is balanced by the presence of antioxidant substances, circulating levels of gamma-glutamyl transferase, cytochrome c, triglycerides and unconjugated bilirubin were explored in patients suffering from nonalcoholic fatty liver disease with different severity [73]. The resulting findings likely reflect a balance between oxidative stress and anti-oxidant response rather than a lack of reliability of cytochrome c as a reliable biomarker of mitochondrial damage [73]. The inflammatory mediators that are biosynthesized in the liver and increased in NAFLD patients include C-reactive protein (CRP) [74], IL-6 [70], fibrinogen and plasminogen activator inhibitor-1 (PAI-1) [75]. Consequently, fat in the liver represents a site beyond adipose tissue that independently contributes to the inflammatory process. In support of a certain sequence of cellular and molecular events that mediates hepatic IR in NAFLD, recent data lend credence to the fact that hepatic steatosis activates IκB kinase (IKK)-β and nuclear factor (NF)-κB [76]. Among the inducible transcription factors that control inflammatory gene expression, NF-κB plays a central and an evolutionarily conserved role in coordinating the expression of various soluble pro-inflammatory mediators (cytokines and chemokines) and leukocyte adhesion molecules. In non stimulated cells, NF-κB is sequestered in cytosol by the inhibitor of NF-κB (IκB), which masks the nuclear localization signal present along the NF-κB protein sequence. Treatment of cells with pro-inflammatory cytokines such as TNF-α and IL-1, or with bacterial products such as lipopolysaccharide, leads to the activation of a specific- IKK complex that phosphorylates IκB and thereby tags it for ubiquitination and degradation by the proteasome [77]. The degradation of IκB thus allows NF-κB to translocate into the nucleus where it can act as a transcription factor that upregulates IL-6 production and secretion. IL-6 works locally through paracrine and/or endocrine mechanisms to activate IL-6 signaling in the liver. IL-6 is known to induce IR in hepatocytes [78]. Hepatic production of IL-6 also provides a further pathogenic link to extrahepatic organs such as muscle. NF-κB target genes are not upregulated in transgenic mouse muscle, unlike IL-6 target genes and the suppressor of cytokine signaling and signal transducer and activator of transcription proteins. These genes are reversed during IL-6 neutralization, which is consistent with the pathogenic involvement of IL-6. Activation of NF-κB leads to a severe syndrome of muscle wasting, without IR [79]. Fat mass in overweight/obese subjects has a primary role in determining low-grade chronic inflammation and, in turn, IR and ectopic lipid storage within the liver [80]. Obesity, aging, and fat mass all influence the growth hormone/insulin-like growth factor (IGF)-Ⅰ axis, and chronic inflammation might reduce IGF-Ⅰ signaling. Altered IGF-Ⅰaxis is frequently observed in patients with hepatic steatosis [80]. In our study population, lower IGF- Ⅰ status is associated with higher fat mass, spleen longitudinal diameter, CRP and more severe hepatic steatosis [80]. 11β-HSD1 IN INFLAMMATION 6738 October 28, 2013 Volume 19 Issue 40

51 Tarantino G et al. NAFLD and hypercortisolism layed resolution of the inflammatory response, probably due, in part, to attenuated macrophage phagocytosis of leukocyte apoptotic bodies [81,82]. As GCs regulate both the suppression of the early phase and the promotion of the late phase of the inflammatory response, it is conceivable that in generally deregulated - i.e., both decreased and increased - GC levels could contribute to chronic inflammatory disease. Even if not characteristically for all chronic inflammatory conditions, some of them have been associated with increased 11β-HSD1 expression, in particular inflammatory diseases of the digestive tract, such as inflammatory bowel disease and colitis [82-85], as well as atherosclerosis [44,86]. These observations are in line with several reports evidencing the induction of 11β-HSD1 expression by pro-inflammatory cytokines TNF-α and IL-1β in various cell types and lines including fibroblasts, adipocytes, osteoblasts and smooth muscle cells [5-7,87-91]. PARADOX OF IL-6 IN HUMANS AND ANIMALS If global deletion of IL-6 not only develops obesity, but also hepatosteatosis and liver inflammation in animal model [69], what is that determines the low prevalence of hepatic steatosis in patients suffering from Cushing s disease [22]? Ahmed et al [54] defined hepatic GCs metabolism in progressive NAFLD, which can be summarized into two distinct phases of altered regulation of hepatic cortisol metabolism: (1) increased hepatic cortisol clearance in steatosis; and (2) increased hepatic cortisol regeneration in NASH. Failure to regulate in this way may worsen the phenotype of liver disease driving hepatic steatosis or unchecked progressive hepatic inflammation [54]. Considering the broadly accepted presence of inflammatory elements in the etiology of obesity, 11β-HSD1 probably plays an important causative role in the development of the metabolic syndrome, positioning itself at the interface of inflammation, hepatic steatosis and Cushing s syndrome. From another perspective, under conditions that avoided changes in food intake, the efficacy of 11β-HSD1 inhibition to up-regulate hepatic fat oxidation gene expression - which reduces the glucocorticoid effects in liver and fat - functionally translates into enhanced hepatic lipid oxidation in vivo [92]. ANSWERED QUESTIONS AND CONCLUDING REMARKS Considering the 50% five-year survival rate of patients with endogenous Cushing s syndrome (without any treatment) [93] and the fact that all patients enrolled into the study by Rockall et al [22] were all newly diagnosed patients, should we discuss the question of time exposure as a possible explanation for the relatively low prevalence of hepatic steatosis in patients with endogenous Cushing s syndrome? Should the relative hypercortisolemia (the increase in free cortisol or circadian disturbance) in patients with metabolic syndrome not be completely disregarded? At least two diagnostic studies aiming to evaluate patients with Cushing s syndrome among patients with obesity have found that late-night salivary cortisol (free cortisol) is increased in patients with obesity. Baid et al [94] reported that late night salivary cortisol was frequently above the laboratory-provided reference range in obese and overweight subjects (n = 369). In another paper late-night salivary cortisol was statistically significantly increased in patients with obesity and some features of Cushing s syndrome, in whom endogenous Cushing s syndrome was excluded, vs healthy, normal BMI control subjects [95]. Since IL-6 also plays an anti-inflammatory activity, it seems reasonable to assume that favorable aspects exist, such as inactivating proinflammatory mediators that induce the production of cortisol during exercise, and thus influence insulin sensitivity, with enhanced insulin action at muscle level, immediately at early recovery [96]. Could this anti-inflammatory effect of high circulating GCs affect hepatic steatosis in Cushing s disease? REFERENCES 1 Seckl JR, Walker BR. Minireview: 11beta-hydroxysteroid dehydrogenase type 1- a tissue-specific amplifier of glucocorticoid action. Endocrinology 2001; 142: [PMID: DOI: /en ] 2 Hamdy O, Porramatikul S, Al-Ozairi E. Metabolic obesity: the paradox between visceral and subcutaneous fat. Curr Diabetes Rev 2006; 2: [PMID: DOI: / ] 3 Pivonello R, De Leo M, Vitale P, Cozzolino A, Simeoli C, De Martino MC, Lombardi G, Colao A. Pathophysiology of diabetes mellitus in Cushing s syndrome. Neuroendocrinology 2010; 92 Suppl 1: [PMID: DOI: / ] 4 Veyrat-Durebex C, Deblon N, Caillon A, Andrew R, Altirriba J, Odermatt A, Rohner-Jeanrenaud F. Central glucocorticoid administration promotes weight gain and increased 11β-hydroxysteroid dehydrogenase type 1 expression in white adipose tissue. PLoS One 2012; 7: e34002 [PMID: DOI: /journal.pone ] 5 Wyrwoll CS, Holmes MC, Seckl JR. 11β-hydroxysteroid dehydrogenases and the brain: from zero to hero, a decade of progress. Front Neuroendocrinol 2011; 32: [PMID: DOI: /j.yfrne ] 6 Czegle I, Csala M, Mandl J, Benedetti A, Karádi I, Bánhegyi G. G6PT-H6PDH-11βHSD1 triad in the liver and its implication in the pathomechanism of the metabolic syndrome. World J Hepatol 2012; 4: [PMID: DOI: /wjh.v4.i4.129] 7 Wang L, Liu J, Zhang A, Cheng P, Zhang X, Lv S, Wu L, Yu J, Di W, Zha J, Kong X, Qi H, Zhong Y, Ding G. BVT.2733, a selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, attenuates obesity and inflammation in diet-induced obese mice. PLoS One 2012; 7: e40056 [PMID: DOI: /journal.pone ] 8 Gathercole LL, Morgan SA, Bujalska IJ, Hauton D, Stewart PM, Tomlinson JW. Regulation of lipogenesis by glucocorticoids and insulin in human adipose tissue. PLoS One 2011; 6: e26223 [PMID: DOI: /journal.pone ] 9 Tomlinson JW, Sinha B, Bujalska I, Hewison M, Stewart PM October 28, 2013 Volume 19 Issue 40

52 Tarantino G et al. NAFLD and hypercortisolism Expression of 11beta-hydroxysteroid dehydrogenase type 1 in adipose tissue is not increased in human obesity. J Clin Endocrinol Metab 2002; 87: [PMID: DOI: /jc ] 10 Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS. A transgenic model of visceral obesity and the metabolic syndrome. Science 2001; 294: [PMID: DOI: /science ] 11 Masuzaki H, Yamamoto H, Kenyon CJ, Elmquist JK, Morton NM, Paterson JM, Shinyama H, Sharp MG, Fleming S, Mullins JJ, Seckl JR, Flier JS. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. J Clin Invest 2003; 112: [PMID: ] 12 Morton NM, Paterson JM, Masuzaki H, Holmes MC, Staels B, Fievet C, Walker BR, Flier JS, Mullins JJ, Seckl JR. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11 beta-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 2004; 53: [PMID: DOI: /diabetes ] 13 Morton NM, Holmes MC, Fiévet C, Staels B, Tailleux A, Mullins JJ, Seckl JR. Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerance in 11betahydroxysteroid dehydrogenase type 1 null mice. J Biol Chem 2001; 276: [PMID: DOI: /jbc. M ] 14 Ricketts ML, Shoesmith KJ, Hewison M, Strain A, Eggo MC, Stewart PM. Regulation of 11 beta-hydroxysteroid dehydrogenase type 1 in primary cultures of rat and human hepatocytes. J Endocrinol 1998; 156: [PMID: DOI: /joe ] 15 Tomlinson JW, Finney J, Gay C, Hughes BA, Hughes SV, Stewart PM. Impaired glucose tolerance and insulin resistance are associated with increased adipose 11betahydroxysteroid dehydrogenase type 1 expression and elevated hepatic 5alpha-reductase activity. Diabetes 2008; 57: [PMID: DOI: /db ] 16 Morton NM. Obesity and corticosteroids: 11beta-hydroxysteroid type 1 as a cause and therapeutic target in metabolic disease. Mol Cell Endocrinol 2010; 316: [PMID: DOI: /j.mce ] 17 Wang M. The role of glucocorticoid action in the pathophysiology of the Metabolic Syndrome. Nutr Metab (Lond) 2005; 2: 3 [PMID: DOI: / ] 18 Jeong IK. The role of cortisol in the pathogenesis of the metabolic syndrome. Diabetes Metab J 2012; 36: [PMID: DOI: /dmj ] 19 Sakkiah S, Meganathan C, Sohn YS, Namadevan S, Lee KW. Identification of important chemical features of 11β-hydroxysteroid dehydrogenase type1 inhibitors: application of ligand based virtual screening and density functional theory. Int J Mol Sci 2012; 13: [PMID: DOI: /ijms ] 20 Lawson AJ, Walker EA, Lavery GG, Bujalska IJ, Hughes B, Arlt W, Stewart PM, Ride JP. Cortisone-reductase deficiency associated with heterozygous mutations in 11betahydroxysteroid dehydrogenase type 1. Proc Natl Acad Sci USA 2011; 108: [PMID: DOI: / pnas ] 21 Su X, Pradaux-Caggiano F, Vicker N, Thomas MP, Halem H, Culler MD, Potter BV. Adamantyl ethanone pyridyl derivatives: potent and selective inhibitors of human 11β-hydroxysteroid dehydrogenase type 1. ChemMed- Chem 2011; 6: [PMID: DOI: / cmdc ] 22 Rockall AG, Sohaib SA, Evans D, Kaltsas G, Isidori AM, Monson JP, Besser GM, Grossman AB, Reznek RH. Hepatic steatosis in Cushing s syndrome: a radiological assessment using computed tomography. Eur J Endocrinol 2003; 149: [PMID: DOI: /eje ] 23 Bellentani S, Saccoccio G, Masutti F, Crocè LS, Brandi G, Sasso F, Cristanini G, Tiribelli C. Prevalence of and risk factors for hepatic steatosis in Northern Italy. Ann Intern Med 2000; 132: [PMID: ] 24 Obika M, Noguchi H. Diagnosis and evaluation of nonalcoholic fatty liver disease. Exp Diabetes Res 2012; 2012: [PMID: DOI: /2012/145754] 25 Colicchio P, Tarantino G, del Genio F, Sorrentino P, Saldalamacchia G, Finelli C, Conca P, Contaldo F, Pasanisi F. Nonalcoholic fatty liver disease in young adult severely obese non-diabetic patients in South Italy. Ann Nutr Metab 2005; 49: [PMID: DOI: / ] 26 Tiniakos DG. Nonalcoholic fatty liver disease/nonalcoholic steatohepatitis: histological diagnostic criteria and scoring systems. Eur J Gastroenterol Hepatol 2010; 22: [PMID: ] 27 Scheen AJ, Luyckx FH. Nonalcoholic steatohepatitis and insulin resistance: interface between gastroenterologists and endocrinologists. Acta Clin Belg 2003; 58: [PMID: ] 28 Choudhary NS, Duseja A, Kalra N, Das A, Dhiman RK, Chawla YK. Correlation of adipose tissue with liver histology in Asian Indian patients with nonalcoholic fatty liver disease (NAFLD). Ann Hepatol 2012; 11: [PMID: ] 29 Kern PA, Di Gregorio GB, Lu T, Rassouli N, Ranganathan G. Adiponectin expression from human adipose tissue: relation to obesity, insulin resistance, and tumor necrosis factor-alpha expression. Diabetes 2003; 52: [PMID: DOI: /diabetes ] 30 Odermatt A, Nashev LG. The glucocorticoid-activating enzyme 11beta-hydroxysteroid dehydrogenase type 1 has broad substrate specificity: Physiological and toxicological considerations. J Steroid Biochem Mol Biol 2010; 119: 1-13 [PMID: DOI: /j.jsbmb ] 31 Morton NM, Seckl JR. 11beta-hydroxysteroid dehydrogenase type 1 and obesity. Front Horm Res 2008; 36: [PMID: DOI: / ] 32 Younossi ZM. Review article: current management of nonalcoholic fatty liver disease and non-alcoholic steatohepatitis. Aliment Pharmacol Ther 2008; 28: 2-12 [PMID: DOI: /j x] 33 Eckel RH, Alberti KG, Grundy SM, Zimmet PZ. The metabolic syndrome. Lancet 2010; 375: [PMID: DOI: /S (09) ] 34 Gastaldelli A. Fatty liver disease: the hepatic manifestation of metabolic syndrome. Hypertens Res 2010; 33: [PMID: DOI: /hr ] 35 Boppidi H, Daram SR. Nonalcoholic fatty liver disease: hepatic manifestation of obesity and the metabolic syndrome. Postgrad Med 2008; 120: E01-E07 [PMID: DOI: /pgm ] 36 Tarantino G, Saldalamacchia G, Conca P, Arena A. Nonalcoholic fatty liver disease: further expression of the metabolic syndrome. J Gastroenterol Hepatol 2007; 22: [PMID: DOI: /j x] 37 Finelli C, Tarantino G. Is visceral fat reduction necessary to favour metabolic changes in the liver? J Gastrointestin Liver Dis 2012; 21: [PMID: ] 38 Stimson RH, Walker BR. Glucocorticoids and 11beta-hydroxysteroid dehydrogenase type 1 in obesity and the metabolic syndrome. Minerva Endocrinol 2007; 32: [PMID: ] 39 Baudrand R, Carvajal CA, Riquelme A, Morales M, Solis N, Pizarro M, Escalona A, Boza C, Pérez G, Domínguez A, Arrese M, Fardella CE. Overexpression of 11beta-hydroxysteroid dehydrogenase type 1 in hepatic and visceral adipose tissue is associated with metabolic disorders in morbidly obese patients. Obes Surg 2010; 20: [PMID: DOI: /s ] 40 Alberti L, Girola A, Gilardini L, Conti A, Cattaldo S, Mi October 28, 2013 Volume 19 Issue 40

53 Tarantino G et al. NAFLD and hypercortisolism cheletto G, Invitti C. Type 2 diabetes and metabolic syndrome are associated with increased expression of 11betahydroxysteroid dehydrogenase 1 in obese subjects. Int J Obes (Lond) 2007; 31: [PMID: DOI: / sj.ijo ] 41 Tarantino G, Lobello R, Scopacasa F, Contaldo F, Pasanisi F, Cirillo M, De Caterina M, Conca P, Terracciano D, Gennarelli N, Ariello M, Mazzarella C, Grimaldi E, Macchia V. The contribution of omental adipose tissue to adipokine concentrations in patients with the metabolic syndrome. Clin Invest Med 2007; 30: E192-E199 [PMID: ] 42 Bujalska IJ, Kumar S, Stewart PM. Does central obesity reflect Cushing s disease of the omentum? Lancet 1997; 349: [PMID: DOI: / S (96) ] 43 Krozowski Z, Li KX, Koyama K, Smith RE, Obeyesekere VR, Stein-Oakley A, Sasano H, Coulter C, Cole T, Sheppard KE. The type I and type II 11beta-hydroxysteroid dehydrogenase enzymes. J Steroid Biochem Mol Biol 1999; 69: [PMID: ] 44 Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, Hewison M, Stewart PM. 11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of glucocorticoid response. Endocr Rev 2004; 25: [PMID: DOI: /er ] 45 Bujalska IJ, Draper N, Michailidou Z, Tomlinson JW, White PC, Chapman KE, Walker EA, Stewart PM. Hexose-6-phosphate dehydrogenase confers oxo-reductase activity upon 11 beta-hydroxysteroid dehydrogenase type 1. J Mol Endocrinol 2005; 34: [PMID: DOI: /jme ] 46 Stimson RH, Andrew R, McAvoy NC, Tripathi D, Hayes PC, Walker BR. Increased whole-body and sustained liver cortisol regeneration by 11beta-hydroxysteroid dehydrogenase type 1 in obese men with type 2 diabetes provides a target for enzyme inhibition. Diabetes 2011; 60: [PMID: DOI: /db ] 47 Cooper MS, Stewart PM. 11Beta-hydroxysteroid dehydrogenase type 1 and its role in the hypothalamus-pituitaryadrenal axis, metabolic syndrome, and inflammation. J Clin Endocrinol Metab 2009; 94: [PMID: DOI: /jc ] 48 Peckett AJ, Wright DC, Riddell MC. The effects of glucocorticoids on adipose tissue lipid metabolism. Metabolism 2011; 60: [PMID: DOI: / j.metabol ] 49 Baudrand R, Domínguez JM, Carvajal CA, Riquelme A, Campino C, Macchiavello S, Bozinovic M, Morales M, Pizarro M, Solis N, Escalona A, Boza C, Arrese M, Fardella CE. Overexpression of hepatic 5α-reductase and 11β-hydroxysteroid dehydrogenase type 1 in visceral adipose tissue is associated with hyperinsulinemia in morbidly obese patients. Metabolism 2011; 60: [PMID: DOI: /j.metabol ] 50 Nagarajan P, Mahesh Kumar MJ, Venkatesan R, Majundar SS, Juyal RC. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18. i ] 51 Takahashi Y, Soejima Y, Fukusato T. Animal models of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 52 Terao M, Murota H, Kimura A, Kato A, Ishikawa A, Igawa K, Miyoshi E, Katayama I. 11β-Hydroxysteroid dehydrogenase-1 is a novel regulator of skin homeostasis and a candidate target for promoting tissue repair. PLoS One 2011; 6: e25039 [PMID: DOI: /journal.pone ] 53 Morgan SA, Tomlinson JW. 11beta-hydroxysteroid dehydrogenase type 1 inhibitors for the treatment of type 2 diabetes. Expert Opin Investig Drugs 2010; 19: [PMID: DOI: / ] 54 Ahmed A, Rabbitt E, Brady T, Brown C, Guest P, Bujalska IJ, Doig C, Newsome PN, Hubscher S, Elias E, Adams DH, Tomlinson JW, Stewart PM. A switch in hepatic cortisol metabolism across the spectrum of non alcoholic fatty liver disease. PLoS One 2012; 7: e29531 [PMID: DOI: /journal.pone ] 55 Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. J Clin Endocrinol Metab 2004; 89: [PMID: DOI: /jc ] 56 Klampfer L, Chen-Kiang S, Vilcek J. Activation of the TSG-6 gene by NF-IL6 requires two adjacent NF-IL6 binding sites. J Biol Chem 1995; 270: [PMID: DOI: / jbc ] 57 Maeda K, Okubo K, Shimomura I, Mizuno K, Matsuzawa Y, Matsubara K. Analysis of an expression profile of genes in the human adipose tissue. Gene 1997; 190: [PMID: DOI: /S (96) ] 58 Olsson M, Ahlin S, Olsson B, Svensson PA, Ståhlman M, Borén J, Carlsson LM, Sjöholm K. Establishment of a transgenic mouse model specifically expressing human serum amyloid A in adipose tissue. PLoS One 2011; 6: e19609 [PMID: DOI: /journal.pone ] 59 Johnson BD, Kip KE, Marroquin OC, Ridker PM, Kelsey SF, Shaw LJ, Pepine CJ, Sharaf B, Bairey Merz CN, Sopko G, Olson MB, Reis SE. Serum amyloid A as a predictor of coronary artery disease and cardiovascular outcome in women: the National Heart, Lung, and Blood Institute-Sponsored Women s Ischemia Syndrome Evaluation (WISE). Circulation 2004; 109: [PMID: DOI: /01. CIR B1] 60 Esteves CL, Kelly V, Bégay V, Man TY, Morton NM, Leutz A, Seckl JR, Chapman KE. Regulation of adipocyte 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) by CCAAT/enhancer-binding protein (C/EBP) β isoforms, LIP and LAP. PLoS One 2012; 7: e37953 [PMID: DOI: /journal.pone ] 61 Valsamakis G, Anwar A, Tomlinson JW, Shackleton CH, McTernan PG, Chetty R, Wood PJ, Banerjee AK, Holder G, Barnett AH, Stewart PM, Kumar S. 11beta-hydroxysteroid dehydrogenase type 1 activity in lean and obese males with type 2 diabetes mellitus. J Clin Endocrinol Metab 2004; 89: [PMID: DOI: /jc ] 62 Basu R, Basu A, Grudzien M, Jung P, Jacobson P, Johnson M, Singh R, Sarr M, Rizza RA. Liver is the site of splanchnic cortisol production in obese nondiabetic humans. Diabetes 2009; 58: [PMID: DOI: /db ] 63 Wamil M, Battle JH, Turban S, Kipari T, Seguret D, de Sousa Peixoto R, Nelson YB, Nowakowska D, Ferenbach D, Ramage L, Chapman KE, Hughes J, Dunbar DR, Seckl JR, Morton NM. Novel fat depot-specific mechanisms underlie resistance to visceral obesity and inflammation in 11 β-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 2011; 60: [PMID: DOI: / db ] 64 Candia R, Riquelme A, Baudrand R, Carvajal CA, Morales M, Solís N, Pizarro M, Escalona A, Carrasco G, Boza C, Pérez G, Padilla O, Cerda J, Fardella CE, Arrese M. Overexpression of 11β-hydroxysteroid dehydrogenase type 1 in visceral adipose tissue and portal hypercortisolism in non-alcoholic fatty liver disease. Liver Int 2012; 32: [PMID: ] 65 Fried SK, Bunkin DA, Greenberg AS. Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab 1998; 83: [PMID: DOI: /jc ] 66 Kristiansen OP, Mandrup-Poulsen T. Interleukin-6 and diabetes: the good, the bad, or the indifferent? Diabetes 2005; 54 Suppl 2: S114-S124 [PMID: DOI: /diabetes.54.suppl_2.S114] 6741 October 28, 2013 Volume 19 Issue 40

54 Tarantino G et al. NAFLD and hypercortisolism 67 Pereda MP, Lohrer P, Kovalovsky D, Perez Castro C, Goldberg V, Losa M, Chervín A, Berner S, Molina H, Stalla GK, Renner U, Arzt E. Interleukin-6 is inhibited by glucocorticoids and stimulates ACTH secretion and POMC expression in human corticotroph pituitary adenomas. Exp Clin Endocrinol Diabetes 2000; 108: [PMID: DOI: /s ] 68 Barahona MJ, Sucunza N, Resmini E, Fernández-Real JM, Ricart W, Moreno-Navarrete JM, Puig T, Farrerons J, Webb SM. Persistent body fat mass and inflammatory marker increases after long-term cure of Cushing s syndrome. J Clin Endocrinol Metab 2009; 94: [PMID: DOI: /jc ] 69 Matthews VB, Allen TL, Risis S, Chan MH, Henstridge DC, Watson N, Zaffino LA, Babb JR, Boon J, Meikle PJ, Jowett JB, Watt MJ, Jansson JO, Bruce CR, Febbraio MA. Interleukin- 6-deficient mice develop hepatic inflammation and systemic insulin resistance. Diabetologia 2010; 53: [PMID: DOI: /s y] 70 Tarantino G, Conca P, Pasanisi F, Ariello M, Mastrolia M, Arena A, Tarantino M, Scopacasa F, Vecchione R. Could inflammatory markers help diagnose nonalcoholic steatohepatitis? Eur J Gastroenterol Hepatol 2009; 21: [PMID: DOI: /MEG.0b013e b40] 71 Tarantino G, Scopacasa F, Colao A, Capone D, Tarantino M, Grimaldi E, Savastano S. Serum Bcl-2 concentrations in overweight-obese subjects with nonalcoholic fatty liver disease. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i ] 72 Tarantino G. Should nonalcoholic fatty liver disease be regarded as a hepatic illness only? World J Gastroenterol 2007; 13: [PMID: ] 73 Tarantino G, Colao A, Capone D, Conca P, Tarantino M, Grimaldi E, Chianese D, Finelli C, Contaldo F, Scopacasa F, Savastano S. Circulating levels of cytochrome C, gamma-glutamyl transferase, triglycerides and unconjugated bilirubin in overweight/obese patients with non-alcoholic fatty liver disease. J Biol Regul Homeost Agents 2011; 25: [PMID: ] 74 Tarantino G, Colicchio P, Conca P, Finelli C, Di Minno MN, Tarantino M, Capone D, Pasanisi F. Young adult obese subjects with and without insulin resistance: what is the role of chronic inflammation and how to weigh it non-invasively? J Inflamm (Lond) 2009; 6: 6 [PMID: ] 75 Barbato A, Iacone R, Tarantino G, Russo O, Sorrentino P, Avallone S, Galletti F, Farinaro E, Della Valle E, Strazzullo P. Relationships of PAI-1 levels to central obesity and liver steatosis in a sample of adult male population in southern Italy. Intern Emerg Med 2009; 4: [PMID: DOI: /s ] 76 Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, Shoelson SE. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med 2005; 11: [PMID: DOI: /nm1166] 77 Karin M, Ben-Neriah Y. Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol 2000; 18: [PMID: DOI: /annurev. immunol ] 78 Klover PJ, Zimmers TA, Koniaris LG, Mooney RA. Chronic exposure to interleukin-6 causes hepatic insulin resistance in mice. Diabetes 2003; 52: [PMID: DOI: /diabetes ] 79 Cai D, Frantz JD, Tawa NE, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ, Shoelson SE. IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 2004; 119: [PMID: DOI: /j.cell ] 80 Savastano S, Di Somma C, Pizza G, De Rosa A, Nedi V, Rossi A, Orio F, Lombardi G, Colao A, Tarantino G. Liver-spleen axis, insulin-like growth factor-(igf)-i axis and fat mass in overweight/obese females. J Transl Med 2011; 9: 136 [PMID: DOI: / ] 81 Chapman KE, Coutinho AE, Gray M, Gilmour JS, Savill JS, Seckl JR. The role and regulation of 11beta-hydroxysteroid dehydrogenase type 1 in the inflammatory response. Mol Cell Endocrinol 2009; 301: [PMID: DOI: /j.mce ] 82 Gilmour JS, Coutinho AE, Cailhier JF, Man TY, Clay M, Thomas G, Harris HJ, Mullins JJ, Seckl JR, Savill JS, Chapman KE. Local amplification of glucocorticoids by 11 betahydroxysteroid dehydrogenase type 1 promotes macrophage phagocytosis of apoptotic leukocytes. J Immunol 2006; 176: [PMID: ] 83 Stegk JP, Ebert B, Martin HJ, Maser E. Expression profiles of human 11beta-hydroxysteroid dehydrogenases type 1 and type 2 in inflammatory bowel diseases. Mol Cell Endocrinol 2009; 301: [PMID: DOI: / j.mce ] 84 Zbánková S, Bryndová J, Leden P, Kment M, Svec A, Pácha J. 11beta-hydroxysteroid dehydrogenase 1 and 2 expression in colon from patients with ulcerative colitis. J Gastroenterol Hepatol 2007; 22: [PMID: DOI: / j x] 85 Ergang P, Leden P, Bryndová J, Zbánková S, Miksík I, Kment M, Pácha J. Glucocorticoid availability in colonic inflammation of rat. Dig Dis Sci 2008; 53: [PMID: DOI: /s ] 86 Luo MJ, Thieringer R, Springer MS, Wright SD, Hermanowski-Vosatka A, Plump A, Balkovec JM, Cheng K, Ding GJ, Kawka DW, Koo GC, Grand CB, Luo Q, Maletic MM, Malkowitz L, Shah K, Singer I, Waddell ST, Wu KK, Yuan J, Zhu J, Stepaniants S, Yang X, Lum PY, Wang IM. 11β-HSD1 inhibition reduces atherosclerosis in mice by altering proinflammatory gene expression in the vasculature. Physiol Genomics 2013; 45: [PMID: DOI: /physiolgenomics ] 87 Cai TQ, Wong B, Mundt SS, Thieringer R, Wright SD, Hermanowski-Vosatka A. Induction of 11beta-hydroxysteroid dehydrogenase type 1 but not -2 in human aortic smooth muscle cells by inflammatory stimuli. J Steroid Biochem Mol Biol 2001; 77: [PMID: DOI: / S (01) ] 88 Patel P, Hardy R, Sumathi V, Bartle G, Kindblom LG, Grimer R, Bujalska I, Stewart PM, Rabbitt E, Gittoes NJ, Cooper MS. Expression of 11β-hydroxysteroid dehydrogenase enzymes in human osteosarcoma: potential role in pathogenesis and as targets for treatments. Endocr Relat Cancer 2012; 19: [PMID: DOI: /ERC ] 89 Hochberg Z, Friedberg M, Yaniv L, Bader T, Tiosano D. Hypothalamic regulation of adiposity: the role of 11betahydroxysteroid dehydrogenase type 1. Horm Metab Res 2004; 36: [PMID: DOI: /s ] 90 Coutinho AE, Gray M, Brownstein DG, Salter DM, Sawatzky DA, Clay S, Gilmour JS, Seckl JR, Savill JS, Chapman KE. 11β-Hydroxysteroid dehydrogenase type 1, but not type 2, deficiency worsens acute inflammation and experimental arthritis in mice. Endocrinology 2012; 153: [PMID: DOI: /en ] 91 Ignatova ID, Kostadinova RM, Goldring CE, Nawrocki AR, Frey FJ, Frey BM. Tumor necrosis factor-alpha upregulates 11beta-hydroxysteroid dehydrogenase type 1 expression by CCAAT/enhancer binding protein-beta in HepG2 cells. Am J Physiol Endocrinol Metab 2009; 296: E367-E377 [PMID: DOI: /ajpendo ] 92 Tahrani AA, Bailey CJ, Del Prato S, Barnett AH. Management of type 2 diabetes: new and future developments in treatment. Lancet 2011; 378: [PMID: DOI: /S (11) ] 93 PLOTZ CM, KNOWLTON AI, RAGAN C. The natural history of Cushing s syndrome. Am J Med 1952; 13: October 28, 2013 Volume 19 Issue 40

55 Tarantino G et al. NAFLD and hypercortisolism [PMID: DOI: / (52) ] 94 Baid SK, Rubino D, Sinaii N, Ramsey S, Frank A, Nieman LK. Specificity of screening tests for Cushing s syndrome in an overweight and obese population. J Clin Endocrinol Metab 2009; 94: [PMID: DOI: / jc ] 95 Belaya ZE, Iljin AV, Melnichenko GA, Rozhinskaya LY, Dragunova NV, Dzeranova LK, Butrova SA, Troshina EA, Dedov II. Diagnostic performance of late-night salivary cortisol measured by automated electrochemiluminescence immunoassay in obese and overweight patients referred to exclude Cushing s syndrome. Endocrine 2012; 41: [PMID: DOI: /s ] 96 Fisman EZ, Tenenbaum A. The ubiquitous interleukin-6: a time for reappraisal. Cardiovasc Diabetol 2010; 9: 62 [PMID: DOI: / ] P- Reviewers Belaya ZE, de Bruin C S- Editor Wen LL L- Editor A E- Editor Wu HL 6743 October 28, 2013 Volume 19 Issue 40

56 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Surveillance for hepatocellular carcinoma in chronic liver disease: Evidence and controversies Suzanne van Meer, Robert A de Man, Peter D Siersema, Karel J van Erpecum Suzanne van Meer, Peter D Siersema, Karel J van Erpecum, Department of Gastroenterology and Hepatology, University Medical Center Utrecht, 3508 GA Utrecht, The Netherlands Robert A de Man, Department of Gastroenterology and Hepatology, Erasmus Medical Center, 3015 CE Rotterdam, The Netherlands Author contributions: Van Meer S, van Erpecum KJ collected the materials and wrote the manuscript; Siersema PD, de Man RA critically revised the manuscript and contributed to the manuscript writing; van Erpecum KJ supervised the manuscript; all authors approved the final version of the manuscript. Correspondence to: Karel J van Erpecum, MD, PhD, Department of Gastroenterology and Hepatology, University Medical Center Utrecht, Po BOX 85500, 3508 GA Utrecht, The Netherlands. k.j.vanerpecum@umcutrecht.nl Telephone: Fax: Received: June 8, 2013 Revised: September 2, 2013 Accepted: September 15, 2013 Published online: October 28, 2013 Abstract Primary liver cancer is the sixth most common cancer in the world and the third cause of cancer-related death. Hepatocellular carcinoma (HCC) represents more than 90% of primary liver cancers and generally occurs in patients with underlying chronic liver disease such as viral hepatitis, hemochromatosis, primary biliary cirrhosis and non-alcoholic steatohepatitis. Especially cirrhotic patients are at risk of HCC and regular surveillance could enable early detection and therapy, with potentially improved outcome. We here summarize existing evidence for surveillance including ultrasound, other radiological modalities and various serum biomarkers, and current international guideline recommendations for surveillance. Ultrasound and α-fetoprotein (alone or in combination) are most frequently used for surveillance, but their sensitivities and specificities are still far from perfect, and evidence for surveillance remains weak and controversial. Various other potential surveillance tools have been tested, including serum markers as des-carboxyprothrombin, lectin-bound α-fetoprotein, and (most recently) circulating TIE2-expressing monocytes, and radiological investigations such as computed tomographyscan or magnetic resonance imaging-scan. Although early results appear promising, these tools have generally been tested in diagnostic rather than surveillance setting, and in most cases, no detailed information is available on their cost-effectiveness. For the near future, it remains important to define those patients with highest risk of HCC and most benefit from surveillance, and to restrict surveillance to these categories Baishideng. All rights reserved. Key words: Hepatocellular carcinoma; Surveillance; Chronic liver disease Core tip: Hepatocellular carcinoma is a frequent phenomenon in cirrhotic patients. Survival is generally poor, and curative options only exist if the tumor is detected in an early stage (Barcelona Clinic Liver Cancer stage 0 or A). This review summarizes existing evidence for surveillance including ultrasound, other radiological modalities and various serum biomarkers, and current guideline recommendations for surveillance. Selection of the appropriate high risk populations remains an important tool for cost-effective surveillance. van Meer S, de Man RA, Siersema PD, van Erpecum KJ. Surveillance for hepatocellular carcinoma in chronic liver disease: Evidence and controversies. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6744.htm DOI: org/ /wjg.v19.i INTRODUCTION Primary liver cancer is the sixth most common cancer 6744 October 28, 2013 Volume 19 Issue 40

57 van Meer S et al. Surveillance for hepatocellular carcinoma in the world and the third cause of cancer-related death. Hepatocellular carcinoma (HCC) represents more than 90% of primary liver cancers and generally occurs in patients with underlying chronic liver disease. Incidence rates are highest in East Asia and Sub-Saharan Africa, where approximately 85% of all cases occur. The high HCC risk in these regions can be explained at least in part by the high prevalence of underlying risk factors, especially chronic hepatitis B virus (HBV) infection and aflatoxin B1 in the diet [1,2]. Nevertheless, also in countries with relatively low incidence rates such as the United States, incidences have doubled over the last two decades, due to growing impact of chronic liver disease from hepatitis C virus (HCV) and non-alcoholic steatohepatitis (NASH) [3,4]. In Europe, there is a mixed pattern, with increasing or decreasing incidence rates in various countries. These geographical differences are thought to be the consequence of changing patterns of underlying risk factors for HCC, such as viral hepatitis, alcohol abuse and NASH. Although NASH conveys relatively modest risks of HCC, the burden of metabolic syndrome and insulin resistance is expected to have significant further impact on HCC incidence in the Western world in the near future. Also, coexistent metabolic syndrome and obesity further increase HCC risk in patients with other underlying liver diseases [5-7]. Smoking is another cofactor leading to increased HCC risk [7]. Interestingly, the use of cholesterol synthesis inhibitors and metformin and coffee consumption are associated with decreased HCC risk [8-11]. New local treatment options such as radiofrequency ablation (RFA) or transarterial chemo- and radioembolisation (TACE and TARE) have been introduced in recent years. Also, the multikinase inhibitor sorafenib leads to improved survival in patients with advanced stage disease [12]. Nevertheless, most patients present at relatively late stage, without options for curative treatment. Survival remains poor under these circumstances [median survival: Barcelona Clinic Liver Cancer (BCLC) stage B, 15 mo; BCLC stage C, 6 mo; BCLC stage D, < 3 mo] [13]. Therefore, new strategies are urgently needed to decrease the burden of HCC. First, primary prevention of HCC can be achieved by hepatitis B vaccination, especially in endemic countries [14]. Second, antiviral therapies appear to be associated with decreased HCC risks in patients with chronic viral hepatitis. Interestingly, according to recent meta-analyses and systematic reviews, interferon-based antiviral treatment for hepatitis B is associated with only modest decrease of HCC risk (RR = 0.66, 95%CI: ). Treatment with the nucleoside analog lamivudine is associated with a more substantial risk reduction (RR = 0.22, 95%CI: ) [15-17]. It is reasonable to expect even better results with the currently available potent nucleos(t)ide analogs tenofovir and entecavir [18]. Third, and focus of the current review, surveillance of patients at increased risk because of underlying chronic liver disease might detect HCC at earlier stages, and could lead to better outcomes with decreased mortality (5-year survival with curative treatment in BCLC stage 0 or A: 40%-70%) [13]. Intuitively, this approach is attractive. Indeed, several international guidelines currently advise surveillance programs, defined as the repeated and systematic administration of a screening test, including registration and patient recall where applicable [19-21]. Nevertheless, surveillance remains controversial because of limited evidence for its efficiency and potential risk of side effects (for example complication from diagnostic biopsy of liver mass detected during surveillance which subsequently proves to be benign) [22,23]. This review offers an overview of current knowledge on HCC surveillance and gives a perspective on current international guidelines. BIOMARKERS FOR HCC SURVEILLANCE When introducing a surveillance program, applying the optimal screening modality is essential. Detection of HCC at intermediate or advanced stage [according to Barcelona Clinic Liver Cancer Staging (BCLC) system] by surveillance could have some impact, by allowing TACE or sorafenib therapy. Nevertheless, surveillance should preferably detect (very) early stage HCC (single lesion 5 cm or 3 lesions each 3 cm without vascular involvement or metastasis), allowing potentially curative therapy. Serological biomarkers can be used at relatively low costs, without burden for the patient. Several biomarkers have been investigated for HCC detection, generally in diagnostic setting rather than in surveillance studies. α-fetoprotein (AFP) is the most frequently used biomarker for HCC worldwide. AFP is a glycoprotein expressed by fetal hepatocytes or poorly differentiated HCC cells. Nevertheless, not all HCC cells secrete AFP into the circulation. Also, serum AFP levels may be elevated in patients with chronic liver disease in the absence of HCC (related to height of transaminases) and in patients with other malignancies [24]. Gupta et al [25] published a systematic review with five included studies on diagnostic value of AFP for detecting HCC (all stages combined) in cirrhotic and non-cirrhotic HCV patients. They concluded that even if one assumes best-case estimates of sensitivity and specificity, the case for surveillance by AFP remains weak. By using the usual cut-off point of 20 ng/ml, sensitivities and specificities for detecting all stages of HCC were 41%-65% and 80%-94%, respectively. Positive and negative likelihood ratios ranged from 3.1 to 6.8 and from 0.4 to 0.6, respectively. In a recent large case-control study with 419 included HCC patients and 417 cirrhotic controls (with various underlying etiologies of liver disease), the performance of AFP in early stage HCC was compared with other biomarkers, such as des-carboxyprothrombin (DCP) and lectin-bound AFP, with more encouraging results [26]. In this study, diagnosis of HCC was based on current criteria for diagnosis, with appropriate blinding and 6-mo post-enrollment follow October 28, 2013 Volume 19 Issue 40

58 van Meer S et al. Surveillance for hepatocellular carcinoma up for controls to eliminate false negatives. Sensitivity and specificity of AFP for detecting early stage HCC were 53% and 90%, respectively, using the currently recommended clinical cut-off point of 20 ng/ml. When the point in the receiver operating characteristics (ROC) curve with optimal sensitivity and specificity was used as cut off (10.9 ng/ml), sensitivity was 66% and specificity 82%. This finding would suggest that the usual cut off of 20 ng/ml is too high for optimal performance of AFP surveillance. In a previous small case-control study with 170 HCC patients (68 early stage HCC) and 170 matched cirrhotic controls, the cut off of 20 ng/ml appeared to exhibit optimal sensitivities and specificities [27]. Nevertheless, at this cut off, sensitivities and/or specificities were often insufficient in other studies [28,29]. DCP is an abnormal protein generated as a result of an acquired defect in the posttranslational carboxylation of the prothrombin precursor in malignant liver cells [30]. Several studies investigated the performance of DCP as biomarker for early HCC, with inconclusive results [26,31-34]. For example, in a case-control study with 39 HCC patients and 77 matched controls, DCP had a greater accuracy than AFP [34]. DCP testing alone had a sensitivity and specificity of 74% and 86%, respectively, using a cutoff value of 40 mau/ml. Another study reported much lower sensitivities for DCP with the best performance in chronic viral hepatitis [26]. Another potential biomarker for HCC is lectin-bound AFP: One of the three glycoforms of AFP, based on its reactivity in lectin affinity electrophoresis [35]. In a multicenter prospective study, the diagnostic accuracy of lectin-bound AFP vs AFP was compared in patients with HCV-related cirrhosis [36]. The prevalence of HCC at baseline and during the two years of follow-up was significantly higher in patients with elevated lectin-bound AFP than in those with elevated AFP. The relatively high prognostic value of lectin-bound AFP was even higher in patients with concomitantly elevated AFP levels. This suggests that lectin-bound AFP has some clinical utility as secondary test in HCV patients with mildly elevated AFP levels, by identifying a subgroup with a relatively high likelihood of HCC. Nevertheless, this study has important limitations, such as a relatively short followup and potential selection bias. Also, other investigators report less encouraging results. For example, in the previously mentioned case-control study of Marrero et al [26], sensitivity of lectin-bound AFP for detecting early HCC was only 37%. Several studies investigated the diagnostic performance of a combination of serum biomarkers. Nevertheless, when combining AFP and DCP, there appeared to be only little or no improvement in sensitivity rates for detecting early stage HCC [26,33,34]. Recently, new serum biomarkers for HCC have been suggested. Tyrosine kinase with Ig and EGF homology domains 2 (TIE2) is a receptor of angiopoietins. TIE2- expressing monocytes (TEMs) were recently reported to be enriched in HCC and other tumors where angiogenesis is known to be important for tumor progression. In a recent publication on 168 HCV infected patients (89 with HCC), frequency of circulating TEMs in peripheral blood was significantly higher in case of HCC, and independent of tumor stage [37]. TEMs were also increased in a separate group of non-hcv HCC patients. Performance of TEMs in discriminating HCC from chronic hepatitis or cirrhosis was superior to AFP or DCP (sensitivities 86% and 71% respectively; specificities 81% and 90% respectively. Nevertheless, another study found increased circulating and intrahepatic TEMs in HCV patients without HCC [38]. Although these findings relate to a relatively small cohort of HCV-infected patients, they raise concern that mobilization and expansion of TEMs may not be strictly HCC-driven, but more generally associated with chronic liver infection [39]. Several other studies investigated the performance of Glypican-3 (GPC3). GPC3 is a surface protein expressed in high percentages of HCCs, whereas it is not detectable in hepatocytes from normal subjects or patients with benign liver disease [40-42]. Another potential marker is Golgi protein 73 (GP73): An amino acid that normally remains in the Golgi complex. Marrero et al [43] reported that levels of GP73 are increased in serum of patients with HCC. In this study, sensitivity of GP73 for detecting early HCC was 62%. Also, interleukin-6 (IL-6) has been studied as potential marker for HCC. IL-6 is a cytokine involved in cell growth and differentiation. Serum IL-6 concentrations appeared to be increased in HCC patients (all stages combined) compared to controls [44,45]. Sensitivities of IL-6 for discrimination between HCC patients (all stages combined) and controls ranged from 46% to 73% and specificities from 87% to 95%. Also, levels of squamous cell carcinoma antigen (SCCA: A component of serine protease inhibitors) appeared to be significantly higher in HCC patients than in controls [46,47]. It remains to be seen, whether these new serum biomarkers will provide satisfactory results in the setting of surveillance in clinical practice. ULTRASONOGRAPHY FOR HCC SUR- VEILLANCE Currently, ultrasonography (US) is the most widely used method for HCC surveillance. US is not invasive, but time-consuming, relatively expensive and operator-dependent. Also, this investigation is often not suitable in case of overweight. According to a recent meta-analysis with 13 included studies by Singal et al [48], pooled sensitivities and specificities for detecting HCC at any stage were both 94%. However, US was less effective for detecting early stage -potentially curable- HCC, with a pooled sensitivity of 63% (95%CI: 49%-76%). Another systematic review concluded that US is insufficiently sensitive for HCC surveillance [49]. Sensitivities for detecting HCC (all stages combined) of the 14 included studies ranged from 30% to 100% and specificities from 73% to 100%. Possible explanations for the large variability between studies are differences in opera October 28, 2013 Volume 19 Issue 40

59 van Meer S et al. Surveillance for hepatocellular carcinoma tor skills and experience, in tested populations and/or in tumor size. The potential benefit of combining US with AFP for detection of early stage HCC was also explored in the previously mentioned meta-analysis by Singal et al [48]. The pooled sensitivities increased from 63% to 69% (95%CI: 53%-81%), but this was not statistically significant (P = 0.65). This result suggests that adding AFP to ultrasound is not very useful for HCC surveillance. The optimal interval for ultrasonographic surveillance is not known. It should be based on rate of tumor growth up to the limit of its detectability: Available evidence on tumor growth suggests that the interval from undetectable to a two cm diameter lesion ranges from 4-12 mo [50]. According to the meta-analysis by Singal et al [48] mentioned above, US sensitivities for detecting early-hcc may be improved by US at 6-mo intervals compared to surveillance intervals between 6-12 mo (pooled sensitivities: 70% vs 50%, P = 0.001). However, confidence intervals of pooled sensitivities were overlapping (95%CI: vs ). Two recent retrospective cohort studies from Italy and South Korea report that HCC is detected at earlier stage, with curative therapy more often applied and better survival in case of surveillance interval 6 mo compared to longer surveillance intervals, even after correction for lead time bias [51,52]. A recent randomized control trial investigated whether a 3-mo interval of US surveillance was more effective than a 6-mo interval [53]. More focal lesions < 10 mm were found in the group with 3-mo surveillance (5-year cumulative incidence: 41% vs 28%, P = 0.002). Nevertheless, 44% of all focal liver lesions detected during surveillance remained indeterminate. No differences in detection rates of small HCCs eligible for curative treatment were observed between the two randomized groups. Inadequate compliance occurred in approximately 10% of both groups. Also, overall 5-year survival rates were similar in both groups (85% vs 86%, P = 0.38). Finally, a recent cluster-randomized trial from Taiwan compared 4- and 12-mo intervals in chronic HBV or HCV patients with thrombopenia. Although tumors were smaller in the group with 4-mo intervals, and curative treatment modalities more often applied, 4-year overall survival did not differ [54]. OTHER IMAGING TECHNIQUES FOR HCC SURVEILLANCE Computed tomography (CT) and magnetic resonance (MR) imaging are potential tools for HCC surveillance. Until now, these imaging modalities are mainly used for further evaluation in case of abnormal findings with ultrasonographic surveillance and to determine extent of disease. Test characteristics of CT and MR imaging reported below are therefore all based on diagnostic studies rather than in a setting of surveillance. According to a systematic review of Colli et al [49] (studies in the period: included), spiral CT imaging appeared to offer comparable sensitivities and specificities as US for detecting HCC (all stages) in patients with chronic liver disease. The pooled sensitivities for US and spiral CT imaging were 60% vs 68% and the pooled specificities 97% vs 93%. In the same systematic review, the reported pooled sensitivities (81%) and specificities (85%) of magnetic resonance imaging (MRI)-scan were, respectively, higher and lower than those obtained with US or CT imaging. However, diagnostic accuracies of CT-scan and MRIscan have increased in the past decade due to improvement of techniques [55-58]. For example, according to a recent retrospective study, the overall sensitivities of triplephase multidetector CT (MDCT) imaging for detecting HCC (all stages combined) ranged between various observers from 78% to 81% [57]. Sensitivity improved with increasing HCC diameter. Also, in another recent study with prospective design, the diagnostic performances of US, MDCT imaging and contrast-enhanced MRI-scan were compared in a population of cirrhotic candidates for liver transplantation [58]. Dynamic MRI-scan with inclusion of the hepatobiliary phase had the highest accuracy with sensitivities for detecting early stage HCC, ranging from 59% to 85%. In contrast to CT imaging, MRI-scan is not associated with radiation exposure. However, MRIscan is costly and there are no data from clinical practice to support the use of MRI-scan for surveillance. SURVEILLANCE EFFICIENCY The aim of surveillance is to decrease HCC-related mortality. Unfortunately, high-level evidence is limited in this respect. A recent Cochrane review [59] identified only one study with data on mortality: Zhang et al [60] performed a large cluster randomized controlled trial in which a policy of surveillance vs no surveillance was compared in patients with current or prior HBV infection or a history of chronic hepatitis. There proved to be a survival benefit for the strategy of a 6-monthly surveillance with combined AFP and US compared to the no surveillance strategy. Despite poor adherence to surveillance (58%), HCC-related mortality rates were significantly lower in the surveillance group than in the disease control group (83.2/ and 131.5/100000, respectively, OR = 0.63). Since this study was performed in chronic HBV patients in China, it is not clear whether its results can be extrapolated to the Western World. Also, according to the Cochrane review, there are some discrepancies between this publication and earlier publications about the same trial [61-63]. For example, numbers of disease controls and total numbers of participants dropped from 9711 and 19144, respectively, in the initial preliminary publication in 1997 [62] to 9443 and 18816, respectively, in two later publications in 1999 and 2004, after completion of the trial [60,61]. Also, confidence intervals were computed as if cohorts had been randomly assigned for each individual patient, without taking the cluster randomization into account and statistical significance 6747 October 28, 2013 Volume 19 Issue 40

60 van Meer S et al. Surveillance for hepatocellular carcinoma was claimed with a 95%CI that was only borderline significant (95%CI: ) [22]. In another large randomized controlled trial from China, the effectiveness of surveillance by 6-monthly AFP measurement in 5581 HBV carriers was investigated [29]. HCC-related mortality rates were not significantly different in the surveillance group compared to the control group (1138/ and 1114/100000, respectively, P = 0.86). At lower evidence level, several cohort studies suggest that survival is improved with HCC surveillance [64,65]. In a population-based study of Alaska natives, 1487 HBV carriers had surveillance with AFP at 6-mo intervals [64]. In case of elevated AFP, US was performed. The long-term survival rate for patients whose HCCs were detected by the surveillance program was compared with a historical disease control group of patients with HCC: Survival rates were significantly higher for patients with HCC detected by surveillance (5-year survival rates: 42% and 0%, respectively, P = 0.008; 10-year survival rates: 30% and 0%, respectively, P = 0.07). Similar results were found in the study of Wong et al [65]. In this study, 56 HCC patients were retrospectively divided in three groups according to their initial presentation: Symptomatic patients presenting with abdominal pain, mass, bleeding, or weight loss; asymptomatic patients who had ultrasound for abnormal liver enzyme levels or other (unrelated) indications; and asymptomatic patients with underlying chronic liver diseases in a surveillance program. Patients in the surveillance group survived significantly longer than those in the symptomatic group (median survival of 1300 d vs 234 d, P = 0.009). Median survival of the asymptomatic group without surveillance did not differ significantly from the other groups. However, lead time bias due to disease detection in an early stage could have affected the results of the two previously mentioned studies. Also, length time bias could have biased results by preferential detection of slowly growing lesions that are more likely to remain asymptomatic until late in disease course. Several studies indicate that surveillance programs could lead to more frequent detection of HCC at early stages, when curative treatment is still possible [60,61,66,67]. In the previously mentioned large randomized controlled trial by Yang et al [61], more resectable HCC cases were detected in the surveillance group than in the disease control group during five years follow-up (OR = 7.14; 95%CI: ). In the later publication about the same trial, Zhang et al [60] reported similar results. Again, detection rates of small HCC (defined as a tumor diameter < 5 cm) were higher in the surveillance group than in the disease control group (45% vs 0%, P < 0.01). In the systematic review by Gebo et al [66] covering publications in the period: , one prospective cohort study was identified that investigated HCC surveillance in HCV patients. This study by Solmi et al [67], compared 360 patients in the surveillance group (combined US and AFP measurements at 6-mo intervals) with a disease control group of 2170 patients who received usual care in other hepatology clinics. During a mean follow-up of 56 mo, the incidence of HCC in the surveillance group was 6.7% and 5.5% in the disease control group. Of note, in the surveillance group, 75% of the HCC s was unifocal and 3 cm in diameter compared to only 16% in the disease control group (P = 0.000). Success of a surveillance program depends in general not only on the surveillance modality or target population. Recall strategy and adherence to follow-up are also important factors. In a large retrospective cohort study in the United States, 1873 HCC patients with a prior diagnosis of cirrhosis were identified in the period: [68]. In the three years before HCC diagnosis, 17% received regular surveillance, 38% received inconsistent surveillance and 45% no surveillance. In the regular surveillance group, 52% received both US and AFP, 46% AFP only and 2% US only. In a subset of 541 patients in whom cirrhosis was diagnosed at least three years prior to HCC, 29% received regular surveillance and 33% inconsistent surveillance. In another prospective cohort study, 1005 HCV patients were included in a surveillance program with combined US and AFP at 6- to 12-mo intervals [69]. During a mean follow-up of 6.1 years, 83 HCC cases were detected: 28% of those were tumors outside Milan criteria. 70% of patients with HCCs outside Milan criteria had experienced consistent surveillance and follow-up, which was not different from the total study group. Only in a minority of patients, absence of surveillance (13%) or follow-up (17%) could explain failure to detect patients at earlier stages. On multivariate analysis, study site was a strong independent predictor of consistent surveillance (P < 0.001). After correction for study site, also platelet counts > /ml and complete clinic visit adherence were positively associated with consistent surveillance. TARGET POPULATIONS FOR SURVEIL- LANCE Most HCCs develop in patients with chronic liver diseases. The decision to start surveillance should depend on the chance of developing HCC, i.e., the incidence of HCC in specific populations. Especially high risk patients should be included in surveillance programs. However, selection of these patients remains a subject of debate. Also, it is important to decide, prior to surveillance, whether the clinical condition of the patient would allow any therapy in case of HCC detection. Computer analyses in hypothetical cirrhotic patients Several studies have investigated cost-effectiveness of HCC surveillance in cirrhotic patients based on computer analyses of theoretical models. In general, surveillance is considered cost-effective, if costs are less than $50000 per life-year or quality-adjusted life-year (QALY) gained. According to Sarasin et al [70], surveillance with combined US and AFP measurements at 6-mo intervals in patients with compensated cirrhosis results in an increase of life 6748 October 28, 2013 Volume 19 Issue 40

61 van Meer S et al. Surveillance for hepatocellular carcinoma expectancy of 3 mo when HCC incidence is 1.5%/year. However, in this case cost-effectiveness ratio of $55264 per life year gained exceeds the generally accepted threshold of $50000 per life year gained. When HCC incidence rates are higher, increase of life expectancy will be even more substantial. Cost-effectiveness ratios of systematic surveillance range between $26000 (HCC incidence: 6%/ year) and $55000 (HCC incidence: 1.5%/year) for each additional life-year gained, in best case scenarios. Another study, using similar analyses in HCV cirrhotics, suggested that HCC surveillance with combined three-phase CTscans and AFP measurements at 6-mo intervals was more cost-effective than other surveillance strategies [71]. This strategy was associated with an incremental cost-utility ratio of $25232/QALY compared to no surveillance. These results are based on estimated HCC incidences of 1.4%/ year in patients with compensated cirrhosis and 4%/year in patients with decompensated cirrhosis. Lin et al [72] suggested that combined US and AFP measurements at 6-mo intervals was the most effective surveillance strategy in HCV patients with compensated cirrhosis compared to other surveillance strategies (estimated annual HCC incidence: 0.02%-0.1%). However, this strategy entailed higher additional cost per QALY or life-year gained compared to a strategy of annual US and AFP measurements (incremental cost-effectiveness ratio: $106871/QALY) or no surveillance (incremental cost-effectiveness ratio: $129915/QALY). In this computerized decision model, surveillance with US at 12-mo intervals and AFP measurements at 6-mo intervals offered the greatest gain in life-expectancy, while still maintaining a cost-effectiveness ratio < $50000/QALY or life-year gained, regardless of HCC incidence. Another study in a hypothetical mixed-etiology cohort of compensated cirrhotic patients suggested that combined AFP measurement and US imaging on a 6-monthly basis is the most effective surveillance strategy [73]. Compared to no surveillance, this strategy is estimated to increase the numbers of HCCs resectable at time of diagnosis more than three-fold with 50% decrease of HCC-related deaths. Significantly more small and medium-sized HCCs (diameter < 2 cm or diameter 2-5 cm, respectively) would be identified by surveillance. However, when costs were taken into account, it was doubtful whether US should be routinely offered to those with serum AFP levels 20 ng/ml (> $45000/QALY). Also, cost-effectiveness varied considerably depending on type of underlying chronic liver disease. In this computerized decision model, annual HCC incidence ranged from 1.2% to 4.1%. HCC incidence in cirrhotic patients Annual incidence rates of HCC in specific populations with cirrhosis have been investigated extensively. Cirrhotic HBV patients have an increased risk for developing HCC. Studies that included only East Asian cirrhotic HBV patients showed HCC incidence rates around 3.2 per 100 person-years and 5-year cumulative HCC incidence of 15% [74,75]. Studies in European HBV cirrhotics reported lower incidence rates: 2.2 per 100 persons-years and 5-year cumulative HCC incidence of 9% [76-79]. Several studies have investigated the risk of developing HCC in HCV patients [76,80-83]. In a large prospective study of Taiwanese males, anti-hcv positive subjects had a 20-fold increased risk of developing HCC in comparison with anti-hcv negative subjects [81]. In this study, the presence or absence of cirrhosis was not evaluated. Other studies reported that especially cirrhotic HCV patients are at increased risk for developing HCC [76,80,83]. In a retrospective cohort study, the annual HCC incidence was 1.4% in European cirrhotic HCV patients [76]. Also, Degos et al [83] reported HCC incidence rates of 13.4% after five years follow-up in a cohort of French patients with compensated HCV-related cirrhosis. In another study from Germany, 17 of 838 HCV patients (2%) developed HCC during a mean follow-up of 50 mo [80]. All HCCs occurred in cirrhotic livers. Cirrhotic patients had a 20-fold higher risk of developing HCC than HCV patients without cirrhosis at study entry (RR = 20.2, 95%CI: ). Also, Lok et al [82] reported that HCC incidence was higher in HCV patients with cirrhosis than in those with bridging fibrosis (annual HCC incidence rates: 1.45% vs 0.8%, Ptrend = 0.08). This study was performed in the United States. In patients with cirrhosis due to causes other than viral hepatitis, HCC incidence rates are generally not precisely known. Nevertheless, alcoholic liver disease is a clear risk factor for HCC. In a meta-analysis of Bagnardi et al [84], the consumption of alcohol was associated with an increased risk for developing liver cancer (RR = 1.86, 95%CI: for alcohol consumption of 100 g/d compared to no alcohol). The presence or absence of cirrhosis was not evaluated in this meta-analysis. In a Danish nationwide cohort study, 169 (2%) of 8482 patients with alcoholic cirrhosis developed HCC during a median follow-up of 4.1 years [85]. Five-years cumulative HCC risk was 1.0% (95%CI: ). Kuper et al [86] reported a relative risk of HCC of 2.4 for alcoholism alone and 22.4 for alcoholic cirrhosis compared to the general population. Several other studies also reported increased HCC risk in cirrhotic patients with alcohol as primary cause [87-91]. In a case-control study, heavy alcohol consumption contributed to a significant part of the 115 included HCC cases (32%), independent of other known risk factors [92]. Patients with cirrhosis due to genetic hemochromatosis also are at increased risk of developing HCC. According to a meta-analysis, patients with genetic hemochromatosis who are homozygous for the C282Y mutation have a 11-fold increased HCC risk compared to controls (OR = 11, 95%CI: ) [93]. In a Swedish population-based cohort study, patients with genetic hemochromatosis had a 20-fold increased risk for developing primary liver cancer compared to the general population (standardized incidence ratio: 21, 95%CI: 17-28) [94]. In both studies, the presence or absence of cirrhosis was not evaluated. Several other studies reported similar results [95-98] October 28, 2013 Volume 19 Issue 40

62 van Meer S et al. Surveillance for hepatocellular carcinoma Table 1 Characteristics and results of studies on risk of hepatocellular carcinoma in patients with autoimmune hepatitis, a 1-antitrypsin deficiency and Wilson s disease Ref. Study design Study period Patient No. Duration follow-up Results Autoimmune hepatitis Yeoman et al [110] Prospective cohort study Wang et al [111] Werner et al [112] Wong et al [113] Park et al [114] Teufel et al [115] Prospective cohort study Retrospective cohort study Retrospective cohort study Retrospective cohort study Retrospective cohort study median: 11 yr (range 1-36) Annual HCC incidence: 1.1% HCC occurred more often in cirrhotic patients (9.3% vs 3.4%, P = 0.048) Unknown 124 mean: 111 HCC incidence: 1 per 350 patient-year ± 6 mo HCC incidence in cirrhotics: 1 per 182 patient-year median: 8.8 yr (range 1-45) 23-fold increased HCC risk compared to the general population. Only HCC in cirrhotics mean: 6.25 yr HCC incidence all patients: 459 per patient-year (0.5%/yr) In cirrhotics: 1920 per patient-year (1.9%/yr) Unknown 212 (88 cirrhotics) mean: 123 HCC incidence in cirrhotics: 1 per ± 9 mo 1002 patient-year. (0.1%/yr) (89 cirrhotics) mean: 4.8 yr No HCC observed in 431 cirrhotic patient-year (in cirrhotic pts) α 1-antitrypsin deficiency Eriksson et al [116] Autopsy study NA Increased HCC risk in patients with A1AD (17 pts with A1AD) compared to controls. (OR = 20, 95%CI: ) Elzouki et al [117] Autopsy study NA Increased HCC risk in patients with A1AD (31 pts with A1AD) compared to controls (OR = 5.0, 95%CI: ; P = 0.008). Only significant in males Propst et al [118] Wilson s disease Walshe et al [119] Thattil et al [120] Retrospective cohort study Retrospective cohort study Case report and review Group 1: 240 cirrhotics with different etiologies (25% A1AD) Group 2: 130 non-cirrhotic A1AD pts Unknown No significant differences in HCC prevalence between cirrhotic A1AD patients and cirrhotic subjects due to other causes No HCC in non-cirrhotic A1AD patients 159 range: yr 9 patients (6%) developed abdominal malignancies (2 HCC). Higher incidence compared to the general population No limitation NA NA 19 published case reports of HCC in patients with Wilson s disease HCC: Hepatocellular carcinoma; A1AD: α 1-antitrypsin deficiency; NA: Not applicable; pts: Patients. Primary biliary cirrhosis (PBC) is another important risk factor for HCC development. In a recent meta-analysis, PBC patients had a 19-fold higher risk to develop HCC compared to the general population [99]. In a large Japanese cohort of PBC patients, HCC incidence was 2.4% during a mean follow up of 80 mo. HCC incidence was higher in males than in females (5.1% vs 2.0%) [100]. Caballeria et al [101] compared HCC incidence in 140 PBC patients and a group of cirrhotic HCV patients. Cumulative HCC incidence in PBC patients was 3.6% during a mean follow-up of 5.6 years. Incidence rates were much higher (11.1%), when considering only those patients with late stages of disease. PBC patients in stages Ⅲ and Ⅳ appeared to have comparable risks for HCC as cirrhotic HCV patients. Other studies reported similar results [ ]. The exact incidence of HCC in patients with cirrhosis due to non-alcoholic fatty liver disease (NAFLD) is not known. Nevertheless, a recent systematic review of White et al [106] reported that patients with NASH-cirrhosis had a consistently higher risk of HCC. Cumulative incidence rates ranged from 2.4% over 7 years to 12.8% over 3 years. In cohorts with non-cirrhotic patients with NAFLD and NASH the risk of developing HCC was minimal: cumulative HCC mortality ranged from 0%-3% for study periods ranging from 6 to 21 years. Ascha et al [107] reported that annual cumulative HCC incidence in patients with NASH-cirrhosis was 2.6%, compared to 4.0% in patients with HCV cirrhosis (P = 0.09). Besides, in several studies features suggestive of NAFLD were occasionally observed in HCC patients without a welldefined other cause of chronic liver disease [108,109]. Cirrhotics patients with autoimmune hepatitis (AIH) [ ] or α 1-antitrypsin deficiency [ ] seem to have an increased HCC risk. However, the HCC incidence is lower than in cirrhotics with viral hepatitis. HCC in patients with Wilson s disease seems to be rare [119,120] (Table 1). Only case-reports are available for HCC in patients with cystic fibrosis [ ]. HCC incidence in non-cirrhotic patients The previously mentioned cost-effectiveness analyses were all restricted to cirrhotic patients and cannot be extrapolated to non-cirrhotic patients. However, also in some subgroups of HBV carriers without cirrhosis, HCC surveillance with US and AFP could be cost-effective [19]. HCC incidence should exceed 0.2%/year under these circumstances to allow cost-effective surveillance October 28, 2013 Volume 19 Issue 40

63 van Meer S et al. Surveillance for hepatocellular carcinoma Table 2 Comparison of recommendations regarding hepatocellular carcinoma surveillance in guidelines Characteristics AASLD guideline [19] EASL guideline [20] APASL guideline [21] Recommended target population Surveillance benefit uncertain Cirrhotic HBV and HCV patients Cirrhotic patients with Child-Pugh stage A and B Cirrhotic HBV Alcoholic Cirrhotic patients with Child-Pugh stage C and HCV patients cirrhosis awaiting liver transplantation Stage 4 primary biliary cirrhosis Cirrhosis due to genetic hemochromatosis Cirrhosis due to α 1-antitrypsin deficiency HBV carriers of Asian origin (male > 40 yr, female > 50 yr) African/North American Blacks with hepatitis B HBV carriers with family history of HCC HBV carriers younger than 40 (males) or 50 (females) Hepatitis C and stage 3 fibrosis Non-cirrhotic NAFLD Non-cirrhotic HBV carriers with active hepatitis or family history of HCC Non-cirrhotic patients with chronic hepatitis C and advanced liver fibrosis F3 Surveillance modality US US US and AFP Interval (mo) AASLD: American Association for Study of Liver Disease; APASL: Asian Pacific Association for the Study of the Liver; HBV: Hepatitis B virus; HCV: Hepatitis C virus; NAFLD: Non-alcoholic fatty liver disease; US: Ultrasound, AFP: α-fetoprotein; HCC: Hepatocellular carcinoma; EASL: European Association for the Study of the Liver. A prospective population study in Taiwanese male HBV carriers without cirrhosis showed that annual HCC incidence rate was 0.5% [124]. Annual rates increased with age. A Japanese study also reported a relatively high incidence of HCC in HBV carriers (0.4%/year) [125]. Both studies only included East Asian patients. In this population, with in general early HBV infection through vertical transmission, annual HCC incidence in non-cirrhotic carriers depends on age and starts to exceed the threshold of 0.2% per year around the age of 40 years [126]. In two large community-based prospective cohort studies from Taiwan, predictors of progressive disease in chronic hepatitis B were evaluated [127,128]. High transaminases, HBeAg positive status and high serum HBV DNA levels were risk factors for developing HCC. Nevertheless, non-western HBV carriers remain at significant risk for developing HCC, regardless viral replication status [127,129,130]. Although HBsAg loss leads to a pronounced reduction of HCC risk, incidence remains higher that in the general population due to HBV DNA integration in the liver cell [124,131,132]. In contrast, uncontrolled prospective cohort studies in North America have indicated that the HCC incidence in HBV carriers could vary considerably [133,134]. Annual HCC incidence rates ranged between 0.06% and 0.46%. Non-Asian HBV carriers without cirrhosis are generally infected in adulthood by horizontal transmission and often exhibit low level of viral replication. They appear to be at limited risk of developing HCC [ ]. However, HBV carriers with HCV or HIV co-infection or with a first degree relative with HCC are at increased risk for developing HCC [ ]. Chronic HBV patients from sub- Saharan Africa often develop HCC at young age [129,141]. The HCC incidence in HCV patients without cirrhosis is not clear. A Japanese study investigated HCC incidence in HCV patients and reported that annual HCC incidences ranged from 0.5% to 7.9% in untreated chronic HCV patients with mild fibrosis and cirrhosis, respectively [142]. However, Lok et al [82] reported that annual HCC incidence in HCV patients with bridging fibrosis was only 0.8%. The risk of developing HCC in noncirrhotic patients with chronic liver disease due to other causes than viral hepatitis, is not exactly known. RECOMMENDATIONS OF GUIDELINES In the last decade, several guidelines for management of HCC have been published worldwide. Most relevant are the practice guidelines of the American Association for Study of Liver Disease (AASLD) [19], the EASL-EORTC Clinical Practice Guidelines on the management of hepatocellular carcinoma [20] and the Asian Pacific Association for the Study of the Liver (APASL) consensus recommendations on hepatocellular carcinoma [21] (Table 2). The AASLD guideline recommends surveillance for selected groups of cirrhotics (viral hepatitis, alcohol, PBC, genetic hemochromatosis, α-1 antitrypsin deficiency) and high risk HBV patients without cirrhosis [19]. It is stated that there is insufficient evidence to recommend surveillance in HCV patients with advanced fibrosis or non-cirrhotic NAFLD. The EASL guideline advises surveillance in cirrhotics (regardless underlying cause) [20]. Also for HCV patients with advanced fibrosis and non-cirrhotic HBV carriers with active hepatitis or family history of HCC, surveillance is recommended. Of note, according to the EASL guideline, the presence of advanced (Child-Pugh C) cirrhosis prevents potentially curative therapies to be employed, and surveillance is not cost-effective under these circumstances, except for patients on the waiting list for transplantation. In fact, Child-Pugh C cirrhosis will also exclude radiologic interventions or sorafenib in palliative setting. According 6751 October 28, 2013 Volume 19 Issue 40

64 van Meer S et al. Surveillance for hepatocellular carcinoma to the APASL recommendations, cirrhotic patients with HBV and/or HCV should undergo surveillance [21]. Regarding modality of surveillance, the AASLD and EASL guidelines both recommend surveillance by US [19,20]. According to the APASL guideline, surveillance should be performed by combined US and AFP measurements [21]. All three guidelines recommend a surveillance interval of 6 mo [19-21]. CONCLUSION In the last decade, there has been a marked increase in therapeutic options for HCC. Nevertheless, curative options are only feasible in case of early detection. Although regular surveillance could be beneficial in this respect, there is only limited evidence for its effectiveness in clinical practice. US at 6-mo intervals appears the most promising tool for surveillance, but the debate on serum tumor markers such as AFP has not yet ended. Defining those high risk subgroups who will benefit most from surveillance remains an important research goal for the near future. REFERENCES 1 Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, CA Cancer J Clin 2005; 55: [PMID: ] 2 Liu Y, Wu F. Global burden of aflatoxin-induced hepatocellular carcinoma: a risk assessment. Environ Health Perspect 2010; 118: [PMID: DOI: /ehp ] 3 Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ. Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med 2003; 348: [PMID: ] 4 Everhart JE, Ruhl CE. Burden of digestive diseases in the United States Part Ⅲ: Liver, biliary tract, and pancreas. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 5 El-Serag HB, Hampel H, Javadi F. The association between diabetes and hepatocellular carcinoma: a systematic review of epidemiologic evidence. Clin Gastroenterol Hepatol 2006; 4: [PMID: ] 6 Chen CL, Yang HI, Yang WS, Liu CJ, Chen PJ, You SL, Wang LY, Sun CA, Lu SN, Chen DS, Chen CJ. Metabolic factors and risk of hepatocellular carcinoma by chronic hepatitis B/C infection: a follow-up study in Taiwan. Gastroenterology 2008; 135: [PMID: DOI: /j.gastro ] 7 Marrero JA, Fontana RJ, Fu S, Conjeevaram HS, Su GL, Lok AS. Alcohol, tobacco and obesity are synergistic risk factors for hepatocellular carcinoma. J Hepatol 2005; 42: [PMID: ] 8 Singh S, Singh PP, Singh AG, Murad MH, Sanchez W. Statins are associated with a reduced risk of hepatocellular cancer: a systematic review and meta-analysis. Gastroenterology 2013; 144: [PMID: DOI: /j.gastro.2012] 9 Zhang ZJ, Zheng ZJ, Shi R, Su Q, Jiang Q, Kip KE. Metformin for liver cancer prevention in patients with type 2 diabetes: a systematic review and meta-analysis. J Clin Endocrinol Metab 2012; 97: [PMID: DOI: / jc ] 10 Chen HP, Shieh JJ, Chang CC, Chen TT, Lin JT, Wu MS, Lin JH, Wu CY. Metformin decreases hepatocellular carcinoma risk in a dose-dependent manner: population-based and in vitro studies. Gut 2013; 62: [PMID: DOI: /gutjnl ] 11 Bravi F, Bosetti C, Tavani A, Bagnardi V, Gallus S, Negri E, Franceschi S, La Vecchia C. Coffee drinking and hepatocellular carcinoma risk: a meta-analysis. Hepatology 2007; 46: [PMID: ] 12 Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, de Oliveira AC, Santoro A, Raoul JL, Forner A, Schwartz M, Porta C, Zeuzem S, Bolondi L, Greten TF, Galle PR, Seitz JF, Borbath I, Häussinger D, Giannaris T, Shan M, Moscovici M, Voliotis D, Bruix J. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med 2008; 359: [PMID: DOI: /NEJMoa ] 13 Llovet JM, Bruix J. Molecular targeted therapies in hepatocellular carcinoma. Hepatology 2008; 48: [PMID: DOI: /hep.22506] 14 Chang MH, You SL, Chen CJ, Liu CJ, Lee CM, Lin SM, Chu HC, Wu TC, Yang SS, Kuo HS, Chen DS. Decreased incidence of hepatocellular carcinoma in hepatitis B vaccinees: a 20-year follow-up study. J Natl Cancer Inst 2009; 101: [PMID: DOI: /jnci/djp288] 15 Papatheodoridis GV, Lampertico P, Manolakopoulos S, Lok A. Incidence of hepatocellular carcinoma in chronic hepatitis B patients receiving nucleos(t)ide therapy: a systematic review. J Hepatol 2010; 53: [PMID: DOI: /j.jhep ] 16 Sung JJ, Tsoi KK, Wong VW, Li KC, Chan HL. Meta-analysis: Treatment of hepatitis B infection reduces risk of hepatocellular carcinoma. Aliment Pharmacol Ther 2008; 28: [PMID: DOI: /j x] 17 Lai CL, Yuen MF. Prevention of hepatitis B virus-related hepatocellular carcinoma with antiviral therapy. Hepatology 2013; 57: [PMID: DOI: /hep.25937] 18 Hosaka T, Suzuki F, Kobayashi M, Seko Y, Kawamura Y, Sezaki H, Akuta N, Suzuki Y, Saitoh S, Arase Y, Ikeda K, Kobayashi M, Kumada H. Long-term entecavir treatment reduces hepatocellular carcinoma incidence in patients with hepatitis B virus infection. Hepatology 2013; 58: [PMID: DOI: /hep.26180] 19 Bruix J, Sherman M. Management of hepatocellular carcinoma: an update. Hepatology 2011; 53: [PMID: DOI: /hep.24199] 20 European Association For The Study Of The Liver; European Organisation For Research And Treatment Of Cancer. EASL-EORTC clinical practice guidelines: management of hepatocellular carcinoma. J Hepatol 2012; 56: [PMID: DOI: /j.jhep ] 21 Omata M, Lesmana LA, Tateishi R, Chen PJ, Lin SM, Yoshida H, Kudo M, Lee JM, Choi BI, Poon RT, Shiina S, Cheng AL, Jia JD, Obi S, Han KH, Jafri W, Chow P, Lim SG, Chawla YK, Budihusodo U, Gani RA, Lesmana CR, Putranto TA, Liaw YF, Sarin SK. Asian Pacific Association for the Study of the Liver consensus recommendations on hepatocellular carcinoma. Hepatol Int 2010; 4: [PMID: DOI: /s ] 22 Lederle FA, Pocha C. Screening for liver cancer: the rush to judgment. Ann Intern Med 2012; 156: [PMID: DOI: / ] 23 Sherman M, Bruix J, Porayko M, Tran T. Screening for hepatocellular carcinoma: the rationale for the American Association for the Study of Liver Diseases recommendations. Hepatology 2012; 56: [PMID: DOI: / hep.25869] 24 Di Bisceglie AM, Sterling RK, Chung RT, Everhart JE, Dienstag JL, Bonkovsky HL, Wright EC, Everson GT, Lindsay KL, Lok AS, Lee WM, Morgan TR, Ghany MG, Gretch DR. Serum α-fetoprotein levels in patients with advanced hepatitis C: results from the HALT-C Trial. J Hepatol 2005; 43: [PMID: ] 25 Gupta S, Bent S, Kohlwes J. Test characteristics of α-fetoprotein for detecting hepatocellular carcinoma in patients with hepatitis C. A systematic review and critical analysis. Ann Intern Med 6752 October 28, 2013 Volume 19 Issue 40

65 van Meer S et al. Surveillance for hepatocellular carcinoma 2003; 139: [PMID: ] 26 Marrero JA, Feng Z, Wang Y, Nguyen MH, Befeler AS, Roberts LR, Reddy KR, Harnois D, Llovet JM, Normolle D, Dalhgren J, Chia D, Lok AS, Wagner PD, Srivastava S, Schwartz M. α-fetoprotein, des-gamma carboxyprothrombin, and lectin-bound α-fetoprotein in early hepatocellular carcinoma. Gastroenterology 2009; 137: [PMID: DOI: /j.gastro ] 27 Trevisani F, D Intino PE, Morselli-Labate AM, Mazzella G, Accogli E, Caraceni P, Domenicali M, De Notariis S, Roda E, Bernardi M. Serum α-fetoprotein for diagnosis of hepatocellular carcinoma in patients with chronic liver disease: influence of HBsAg and anti-hcv status. J Hepatol 2001; 34: [PMID: ] 28 Tong MJ, Blatt LM, Kao VW. Surveillance for hepatocellular carcinoma in patients with chronic viral hepatitis in the United States of America. J Gastroenterol Hepatol 2001; 16: [PMID: ] 29 Chen JG, Parkin DM, Chen QG, Lu JH, Shen QJ, Zhang BC, Zhu YR. Screening for liver cancer: results of a randomised controlled trial in Qidong, China. J Med Screen 2003; 10: [PMID: ] 30 Liebman HA. Isolation and characterization of a hepatomaassociated abnormal (des-gamma-carboxy) prothrombin. Cancer Res 1989; 49: [PMID: ] 31 Ikoma J, Kaito M, Ishihara T, Nakagawa N, Kamei A, Fujita N, Iwasa M, Tamaki S, Watanabe S, Adachi Y. Early diagnosis of hepatocellular carcinoma using a sensitive assay for serum des-gamma-carboxy prothrombin: a prospective study. Hepatogastroenterology 2002; 49: [PMID: ] 32 Ishii M, Gama H, Chida N, Ueno Y, Shinzawa H, Takagi T, Toyota T, Takahashi T, Kasukawa R. Simultaneous measurements of serum α-fetoprotein and protein induced by vitamin K absence for detecting hepatocellular carcinoma. South Tohoku District Study Group. Am J Gastroenterol 2000; 95: [PMID: ] 33 Marrero JA, Su GL, Wei W, Emick D, Conjeevaram HS, Fontana RJ, Lok AS. Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in american patients. Hepatology 2003; 37: [PMID: ] 34 Lok AS, Sterling RK, Everhart JE, Wright EC, Hoefs JC, Di Bisceglie AM, Morgan TR, Kim HY, Lee WM, Bonkovsky HL, Dienstag JL. Des-gamma-carboxy prothrombin and α-fetoprotein as biomarkers for the early detection of hepatocellular carcinoma. Gastroenterology 2010; 138: [PMID: DOI: /j.gastro ] 35 Li D, Mallory T, Satomura S. AFP-L3: a new generation of tumor marker for hepatocellular carcinoma. Clin Chim Acta 2001; 313: [PMID: ] 36 Sterling RK, Jeffers L, Gordon F, Sherman M, Venook AP, Reddy KR, Satomura S, Schwartz ME. Clinical utility of AFP-L3% measurement in North American patients with HCV-related cirrhosis. Am J Gastroenterol 2007; 102: [PMID: ] 37 Matsubara T, Kanto T, Kuroda S, Yoshio S, Higashitani K, Kakita N, Miyazaki M, Sakakibara M, Hiramatsu N, Kasahara A, Tomimaru Y, Tomokuni A, Nagano H, Hayashi N, Takehara T. TIE2-expressing monocytes as a diagnostic marker for hepatocellular carcinoma correlates with angiogenesis. Hepatology 2013; 57: [PMID: DOI: /hep.25965] 38 Rodríguez-Muñoz Y, Martín-Vílchez S, López-Rodríguez R, Hernández-Bartolomé A, Trapero-Marugán M, Borque MJ, Moreno-Otero R, Sanz-Cameno P. Peripheral blood monocyte subsets predict antiviral response in chronic hepatitis C. Aliment Pharmacol Ther 2011; 34: [PMID: DOI: /j x] 39 De Palma M, Coukos G, Semela D. TIE2-expressing monocytes: a novel cellular biomarker for hepatocellular carcinoma? Hepatology 2013; 57: [PMID: DOI: /hep.26025] 40 Capurro M, Wanless IR, Sherman M, Deboer G, Shi W, Miyoshi E, Filmus J. Glypican-3: a novel serum and histochemical marker for hepatocellular carcinoma. Gastroenterology 2003; 125: [PMID: ] 41 Tangkijvanich P, Chanmee T, Komtong S, Mahachai V, Wisedopas N, Pothacharoen P, Kongtawelert P. Diagnostic role of serum glypican-3 in differentiating hepatocellular carcinoma from non-malignant chronic liver disease and other liver cancers. J Gastroenterol Hepatol 2010; 25: [PMID: DOI: /j x] 42 Yasuda E, Kumada T, Toyoda H, Kaneoka Y, Maeda A, Okuda S, Yoshimi N, Kozawa O. Evaluation for clinical utility of GPC3, measured by a commercially available ELISA kit with Glypican-3 (GPC3) antibody, as a serological and histological marker for hepatocellular carcinoma. Hepatol Res 2010; 40: [PMID: DOI: /j X x] 43 Marrero JA, Romano PR, Nikolaeva O, Steel L, Mehta A, Fimmel CJ, Comunale MA, D Amelio A, Lok AS, Block TM. GP73, a resident Golgi glycoprotein, is a novel serum marker for hepatocellular carcinoma. J Hepatol 2005; 43: [PMID: ] 44 Porta C, De Amici M, Quaglini S, Paglino C, Tagliani F, Boncimino A, Moratti R, Corazza GR. Circulating interleukin-6 as a tumor marker for hepatocellular carcinoma. Ann Oncol 2008; 19: [PMID: ] 45 Hsia CY, Huo TI, Chiang SY, Lu MF, Sun CL, Wu JC, Lee PC, Chi CW, Lui WY, Lee SD. Evaluation of interleukin-6, interleukin-10 and human hepatocyte growth factor as tumor markers for hepatocellular carcinoma. Eur J Surg Oncol 2007; 33: [PMID: ] 46 Giannelli G, Marinosci F, Trerotoli P, Volpe A, Quaranta M, Dentico P, Antonaci S. SCCA antigen combined with α-fetoprotein as serologic markers of HCC. Int J Cancer 2005; 117: [PMID: ] 47 Hussein MM, Ibrahim AA, Abdella HM, Montasser IF, Hassan MI. Evaluation of serum squamous cell carcinoma antigen as a novel biomarker for diagnosis of hepatocellular carcinoma in Egyptian patients. Indian J Cancer 2008; 45: [PMID: ] 48 Singal A, Volk ML, Waljee A, Salgia R, Higgins P, Rogers MA, Marrero JA. Meta-analysis: surveillance with ultrasound for early-stage hepatocellular carcinoma in patients with cirrhosis. Aliment Pharmacol Ther 2009; 30: [PMID: DOI: /j x] 49 Colli A, Fraquelli M, Casazza G, Massironi S, Colucci A, Conte D, Duca P. Accuracy of ultrasonography, spiral CT, magnetic resonance, and α-fetoprotein in diagnosing hepatocellular carcinoma: a systematic review. Am J Gastroenterol 2006; 101: [PMID: ] 50 Aljabiri MR, Lodato F, Burroughs AK. Surveillance and diagnosis for hepatocellular carcinoma. Liver Transpl 2007; 13: S2-12 [PMID: ] 51 Santi V, Trevisani F, Gramenzi A, Grignaschi A, Mirici- Cappa F, Del Poggio P, Di Nolfo MA, Benvegnù L, Farinati F, Zoli M, Giannini EG, Borzio F, Caturelli E, Chiaramonte M, Bernardi M. Semiannual surveillance is superior to annual surveillance for the detection of early hepatocellular carcinoma and patient survival. J Hepatol 2010; 53: [PMID: DOI: /j.jhep ] 52 Han KH, Kim do Y, Park JY, Ahn SH, Kim J, Kim SU, Kim JK, Lee KS, Chon CY. Survival of hepatocellular carcinoma patients may be improved in surveillance interval not more than 6 mo compared with more than 6 mo: a 15-year prospective study. J Clin Gastroenterol 2013; 47: [PMID: DOI: /MCG.0b013e c13] 53 Trinchet JC, Chaffaut C, Bourcier V, Degos F, Henrion J, Fontaine H, Roulot D, Mallat A, Hillaire S, Cales P, Ollivier 6753 October 28, 2013 Volume 19 Issue 40

66 van Meer S et al. Surveillance for hepatocellular carcinoma I, Vinel JP, Mathurin P, Bronowicki JP, Vilgrain V, N Kontchou G, Beaugrand M, Chevret S. Ultrasonographic surveillance of hepatocellular carcinoma in cirrhosis: a randomized trial comparing 3- and 6-mo periodicities. Hepatology 2011; 54: [PMID: DOI: /hep.24545] 54 Wang JH, Chang KC, Kee KM, Chen PF, Yen YH, Tseng PL, Kuo YH, Tsai MC, Hung CH, Chen CH, Tai WC, Tsai LS, Chen SC, Lin SC, Lu SN. Hepatocellular carcinoma surveillance at 4- vs. 12-mo intervals for patients with chronic viral hepatitis: a randomized study in community. Am J Gastroenterol 2013; 108: [PMID: DOI: / ajg ] 55 Ronzoni A, Artioli D, Scardina R, Battistig L, Minola E, Sironi S, Vanzulli A. Role of MDCT in the diagnosis of hepatocellular carcinoma in patients with cirrhosis undergoing orthotopic liver transplantation. AJR Am J Roentgenol 2007; 189: [PMID: ] 56 Addley HC, Griffin N, Shaw AS, Mannelli L, Parker RA, Aitken S, Wood H, Davies S, Alexander GJ, Lomas DJ. Accuracy of hepatocellular carcinoma detection on multidetector CT in a transplant liver population with explant liver correlation. Clin Radiol 2011; 66: [PMID: DOI: /j.crad ] 57 Denecke T, Grieser C, Fröling V, Steffen IG, Rudolph B, Stelter L, Lehmkuhl L, Streitparth F, Langrehr J, Neuhaus P, Lopez Hänninen E. Multislice computed tomography using a triple-phase contrast protocol for preoperative assessment of hepatic tumor load in patients with hepatocellular carcinoma before liver transplantation. Transpl Int 2009; 22: [PMID: DOI: / j x] 58 Di Martino M, De Filippis G, De Santis A, Geiger D, Del Monte M, Lombardo CV, Rossi M, Corradini SG, Mennini G, Catalano C. Hepatocellular carcinoma in cirrhotic patients: prospective comparison of US, CT and MR imaging. Eur Radiol 2013; 23: [PMID: DOI: /s z] 59 Aghoram R, Cai P, Dickinson JA. α-foetoprotein and/or liver ultrasonography for screening of hepatocellular carcinoma in patients with chronic hepatitis B. Cochrane Database Syst Rev 2012; 9: CD [PMID: DOI: / CD pub2] 60 Zhang BH, Yang BH, Tang ZY. Randomized controlled trial of screening for hepatocellular carcinoma. J Cancer Res Clin Oncol 2004; 130: [PMID: ] 61 Yang B, Zhang B, Tang Z. Randomized controlled prospective study of secondary prevention for primary liver cancer. Zhonghua Yixue Zazhi 1999; 79: [PMID: ] 62 Yang B, Zhang B, Xu Y, Wang W, Shen Y, Zhang A, Xu Z. Prospective study of early detection for primary liver cancer. J Cancer Res Clin Oncol 1997; 123: [PMID: ] 63 Yang B, Zhang B, Xu Y. A prospective study of early detection for primary liver cancer. Zhonghua Zhongliu Zazhi 1996; 18: [PMID: ] 64 McMahon BJ, Bulkow L, Harpster A, Snowball M, Lanier A, Sacco F, Dunaway E, Williams J. Screening for hepatocellular carcinoma in Alaska natives infected with chronic hepatitis B: a 16-year population-based study. Hepatology 2000; 32: [PMID: ] 65 Wong LL, Limm WM, Severino R, Wong LM. Improved survival with screening for hepatocellular carcinoma. Liver Transpl 2000; 6: [PMID: ] 66 Gebo KA, Chander G, Jenckes MW, Ghanem KG, Herlong HF, Torbenson MS, El-Kamary SS, Bass EB. Screening tests for hepatocellular carcinoma in patients with chronic hepatitis C: a systematic review. Hepatology 2002; 36: S84-S92 [PMID: ] 67 Solmi L, Primerano AM, Gandolfi L. Ultrasound follow-up of patients at risk for hepatocellular carcinoma: results of a prospective study on 360 cases. Am J Gastroenterol 1996; 91: [PMID: ] 68 Davila JA, Morgan RO, Richardson PA, Du XL, McGlynn KA, El-Serag HB. Use of surveillance for hepatocellular carcinoma among patients with cirrhosis in the United States. Hepatology 2010; 52: [PMID: DOI: / hep.23615] 69 Singal AG, Nehra M, Adams-Huet B, Yopp AC, Tiro JA, Marrero JA, Lok AS, Lee WM. Detection of hepatocellular carcinoma at advanced stages among patients in the HALT-C trial: where did surveillance fail? Am J Gastroenterol 2013; 108: [PMID: DOI: /ajg ] 70 Sarasin FP, Giostra E, Hadengue A. Cost-effectiveness of screening for detection of small hepatocellular carcinoma in western patients with Child-Pugh class A cirrhosis. Am J Med 1996; 101: [PMID: ] 71 Arguedas MR, Chen VK, Eloubeidi MA, Fallon MB. Screening for hepatocellular carcinoma in patients with hepatitis C cirrhosis: a cost-utility analysis. Am J Gastroenterol 2003; 98: [PMID: ] 72 Lin OS, Keeffe EB, Sanders GD, Owens DK. Cost-effectiveness of screening for hepatocellular carcinoma in patients with cirrhosis due to chronic hepatitis C. Aliment Pharmacol Ther 2004; 19: [PMID: ] 73 Thompson Coon J, Rogers G, Hewson P, Wright D, Anderson R, Cramp M, Jackson S, Ryder S, Price A, Stein K. Surveillance of cirrhosis for hepatocellular carcinoma: systematic review and economic analysis. Health Technol Assess 2007; 11: [PMID: ] 74 Beasley RP. Hepatitis B virus. The major etiology of hepatocellular carcinoma. Cancer 1988; 61: [PMID: ] 75 Liaw YF, Lin DY, Chen TJ, Chu CM. Natural course after the development of cirrhosis in patients with chronic type B hepatitis: a prospective study. Liver 1989; 9: [PMID: ] 76 Fattovich G, Pantalena M, Zagni I, Realdi G, Schalm SW, Christensen E. Effect of hepatitis B and C virus infections on the natural history of compensated cirrhosis: a cohort study of 297 patients. Am J Gastroenterol 2002; 97: [PMID: ] 77 Mazzella G, Accogli E, Sottili S, Festi D, Orsini M, Salzetta A, Novelli V, Cipolla A, Fabbri C, Pezzoli A, Roda E. α interferon treatment may prevent hepatocellular carcinoma in HCV-related liver cirrhosis. J Hepatol 1996; 24: [PMID: ] 78 Chiaramonte M, Stroffolini T, Vian A, Stazi MA, Floreani A, Lorenzoni U, Lobello S, Farinati F, Naccarato R. Rate of incidence of hepatocellular carcinoma in patients with compensated viral cirrhosis. Cancer 1999; 85: [PMID: ] 79 Di Marco V, Lo Iacono O, Cammà C, Vaccaro A, Giunta M, Martorana G, Fuschi P, Almasio PL, Craxì A. The long-term course of chronic hepatitis B. Hepatology 1999; 30: [PMID: ] 80 Niederau C, Lange S, Heintges T, Erhardt A, Buschkamp M, Hürter D, Nawrocki M, Kruska L, Hensel F, Petry W, Häussinger D. Prognosis of chronic hepatitis C: results of a large, prospective cohort study. Hepatology 1998; 28: [PMID: ] 81 Sun CA, Wu DM, Lin CC, Lu SN, You SL, Wang LY, Wu MH, Chen CJ. Incidence and cofactors of hepatitis C virusrelated hepatocellular carcinoma: a prospective study of 12,008 men in Taiwan. Am J Epidemiol 2003; 157: [PMID: ] 82 Lok AS, Seeff LB, Morgan TR, di Bisceglie AM, Sterling RK, Curto TM, Everson GT, Lindsay KL, Lee WM, Bonkovsky HL, Dienstag JL, Ghany MG, Morishima C, Goodman ZD. Incidence of hepatocellular carcinoma and associated risk factors in hepatitis C-related advanced liver disease. Gastroenterology 2009; 136: [PMID: DOI: / 6754 October 28, 2013 Volume 19 Issue 40

67 van Meer S et al. Surveillance for hepatocellular carcinoma j.gastro ] 83 Degos F, Christidis C, Ganne-Carrie N, Farmachidi JP, Degott C, Guettier C, Trinchet JC, Beaugrand M, Chevret S. Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death. Gut 2000; 47: [PMID: ] 84 Bagnardi V, Blangiardo M, La Vecchia C, Corrao G. A metaanalysis of alcohol drinking and cancer risk. Br J Cancer 2001; 85: [PMID: ] 85 Jepsen P, Ott P, Andersen PK, Sørensen HT, Vilstrup H. Risk for hepatocellular carcinoma in patients with alcoholic cirrhosis: a Danish nationwide cohort study. Ann Intern Med 2012; 156: , W295 [PMID: DOI: / ] 86 Kuper H, Ye W, Broomé U, Romelsjö A, Mucci LA, Ekbom A, Adami HO, Trichopoulos D, Nyrén O. The risk of liver and bile duct cancer in patients with chronic viral hepatitis, alcoholism, or cirrhosis. Hepatology 2001; 34: [PMID: ] 87 Kodama K, Tokushige K, Hashimoto E, Taniai M, Shiratori K. Hepatic and extrahepatic malignancies in cirrhosis caused by nonalcoholic steatohepatitis and alcoholic liver disease. Alcohol Clin Exp Res 2013; 37 Suppl 1: E247-E252 [PMID: DOI: /j x] 88 Alvarez MA, Cirera I, Solà R, Bargalló A, Morillas RM, Planas R. Long-term clinical course of decompensated alcoholic cirrhosis: a prospective study of 165 patients. J Clin Gastroenterol 2011; 45: [PMID: DOI: / MCG.0b013e e13] 89 Toshikuni N, Izumi A, Nishino K, Inada N, Sakanoue R, Yamato R, Suehiro M, Kawanaka M, Yamada G. Comparison of outcomes between patients with alcoholic cirrhosis and those with hepatitis C virus-related cirrhosis. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: /j x] 90 Mancebo A, González-Diéguez ML, Cadahía V, Varela M, Pérez R, Navascués CA, Sotorríos NG, Martínez M, Rodrigo L, Rodríguez M. Annual incidence of hepatocellular carcinoma among patients with alcoholic cirrhosis and identification of risk groups. Clin Gastroenterol Hepatol 2013; 11: [PMID: DOI: /j.cgh ] 91 Schöniger-Hekele M, Müller C, Kutilek M, Oesterreicher C, Ferenci P, Gangl A. Hepatocellular carcinoma in Austria: aetiological and clinical characteristics at presentation. Eur J Gastroenterol Hepatol 2000; 12: [PMID: ] 92 Hassan MM, Hwang LY, Hatten CJ, Swaim M, Li D, Abbruzzese JL, Beasley P, Patt YZ. Risk factors for hepatocellular carcinoma: synergism of alcohol with viral hepatitis and diabetes mellitus. Hepatology 2002; 36: [PMID: ] 93 Ellervik C, Birgens H, Tybjaerg-Hansen A, Nordestgaard BG. Hemochromatosis genotypes and risk of 31 disease endpoints: meta-analyses including 66,000 cases and 226,000 controls. Hepatology 2007; 46: [PMID: ] 94 Elmberg M, Hultcrantz R, Ekbom A, Brandt L, Olsson S, Olsson R, Lindgren S, Lööf L, Stål P, Wallerstedt S, Almer S, Sandberg-Gertzén H, Askling J. Cancer risk in patients with hereditary hemochromatosis and in their first-degree relatives. Gastroenterology 2003; 125: [PMID: ] 95 Beaton MD, Adams PC. Prognostic factors and survival in patients with hereditary hemochromatosis and cirrhosis. Can J Gastroenterol 2006; 20: [PMID: ] 96 Fargion S, Mandelli C, Piperno A, Cesana B, Fracanzani AL, Fraquelli M, Bianchi PA, Fiorelli G, Conte D. Survival and prognostic factors in 212 Italian patients with genetic hemochromatosis. Hepatology 1992; 15: [PMID: ] 97 Fracanzani AL, Conte D, Fraquelli M, Taioli E, Mattioli M, Losco A, Fargion S. Increased cancer risk in a cohort of 230 patients with hereditary hemochromatosis in comparison to matched control patients with non-iron-related chronic liver disease. Hepatology 2001; 33: [PMID: ] 98 Hsing AW, McLaughlin JK, Olsen JH, Mellemkjar L, Wacholder S, Fraumeni JF. Cancer risk following primary hemochromatosis: a population-based cohort study in Denmark. Int J Cancer 1995; 60: [PMID: ] 99 Liang Y, Yang Z, Zhong R. Primary biliary cirrhosis and cancer risk: a systematic review and meta-analysis. Hepatology 2012; 56: [PMID: DOI: / hep.25788] 100 Harada K, Hirohara J, Ueno Y, Nakano T, Kakuda Y, Tsubouchi H, Ichida T, Nakanuma Y. Incidence of and risk factors for hepatocellular carcinoma in primary biliary cirrhosis: national data from Japan. Hepatology 2013; 57: [PMID: DOI: /hep.26176] 101 Caballería L, Parés A, Castells A, Ginés A, Bru C, Rodés J. Hepatocellular carcinoma in primary biliary cirrhosis: similar incidence to that in hepatitis C virus-related cirrhosis. Am J Gastroenterol 2001; 96: [PMID: ] 102 Hosonuma K, Sato K, Yanagisawa M, Kakizaki S, Takagi H, Hirato J, Mori M. Incidence, mortality, and predictive factors of hepatocellular carcinoma in primary biliary cirrhosis. Gastroenterol Res Pract 2013; 2013: [PMID: DOI: /2013/168012] 103 Deutsch M, Papatheodoridis GV, Tzakou A, Hadziyannis SJ. Risk of hepatocellular carcinoma and extrahepatic malignancies in primary biliary cirrhosis. Eur J Gastroenterol Hepatol 2008; 20: 5-9 [PMID: ] 104 Wong GL, Hui AY, Wong VW, Chan FK, Sung JJ, Chan HL. A retrospective study on clinical features and prognostic factors of biopsy-proven primary biliary cirrhosis in Chinese patients. Am J Gastroenterol 2005; 100: [PMID: ] 105 Farinati F, Floreani A, De Maria N, Fagiuoli S, Naccarato R, Chiaramonte M. Hepatocellular carcinoma in primary biliary cirrhosis. J Hepatol 1994; 21: [PMID: ] 106 White DL, Kanwal F, El-Serag HB. Association between nonalcoholic fatty liver disease and risk for hepatocellular cancer, based on systematic review. Clin Gastroenterol Hepatol 2012; 10: e2 [PMID: DOI: / j.cgh ] 107 Ascha MS, Hanouneh IA, Lopez R, Tamimi TA, Feldstein AF, Zein NN. The incidence and risk factors of hepatocellular carcinoma in patients with nonalcoholic steatohepatitis. Hepatology 2010; 51: [PMID: ] 108 Takuma Y, Nouso K. Nonalcoholic steatohepatitis-associated hepatocellular carcinoma: our case series and literature review. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg.v16.i ] 109 Bugianesi E, Leone N, Vanni E, Marchesini G, Brunello F, Carucci P, Musso A, De Paolis P, Capussotti L, Salizzoni M, Rizzetto M. Expanding the natural history of nonalcoholic steatohepatitis: from cryptogenic cirrhosis to hepatocellular carcinoma. Gastroenterology 2002; 123: [PMID: ] 110 Yeoman AD, Al-Chalabi T, Karani JB, Quaglia A, Devlin J, Mieli-Vergani G, Bomford A, O Grady JG, Harrison PM, Heneghan MA. Evaluation of risk factors in the development of hepatocellular carcinoma in autoimmune hepatitis: Implications for follow-up and screening. Hepatology 2008; 48: [PMID: DOI: /hep.22432] 111 Wang KK, Czaja AJ. Hepatocellular carcinoma in corticosteroid-treated severe autoimmune chronic active hepatitis. Hepatology 1988; 8: [PMID: ] 112 Werner M, Almer S, Prytz H, Lindgren S, Wallerstedt S, Björnsson E, Bergquist A, Sandberg-Gertzén H, Hultcrantz R, Sangfelt P, Weiland O, Danielsson A. Hepatic and extrahepatic malignancies in autoimmune hepatitis. A longterm follow-up in 473 Swedish patients. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 113 Wong RJ, Gish R, Frederick T, Bzowej N, Frenette C. Devel October 28, 2013 Volume 19 Issue 40

68 van Meer S et al. Surveillance for hepatocellular carcinoma opment of hepatocellular carcinoma in autoimmune hepatitis patients: a case series. Dig Dis Sci 2011; 56: [PMID: DOI: /s ] 114 Park SZ, Nagorney DM, Czaja AJ. Hepatocellular carcinoma in autoimmune hepatitis. Dig Dis Sci 2000; 45: [PMID: ] 115 Teufel A, Weinmann A, Centner C, Piendl A, Lohse AW, Galle PR, Kanzler S. Hepatocellular carcinoma in patients with autoimmune hepatitis. World J Gastroenterol 2009; 15: [PMID: ] 116 Eriksson S, Carlson J, Velez R. Risk of cirrhosis and primary liver cancer in α 1-antitrypsin deficiency. N Engl J Med 1986; 314: [PMID: ] 117 Elzouki AN, Eriksson S. Risk of hepatobiliary disease in adults with severe α 1-antitrypsin deficiency (PiZZ): is chronic viral hepatitis B or C an additional risk factor for cirrhosis and hepatocellular carcinoma? Eur J Gastroenterol Hepatol 1996; 8: [PMID: ] 118 Propst T, Propst A, Dietze O, Judmaier G, Braunsteiner H, Vogel W. Prevalence of hepatocellular carcinoma in α-1- antitrypsin deficiency. J Hepatol 1994; 21: [PMID: ] 119 Walshe JM, Waldenström E, Sams V, Nordlinder H, Westermark K. Abdominal malignancies in patients with Wilson s disease. QJM 2003; 96: [PMID: ] 120 Thattil R, Dufour JF. Hepatocellular carcinoma in a noncirrhotic patient with Wilson s disease. World J Gastroenterol 2013; 19: [PMID: DOI: /wjg.v19. i ] 121 O Donnell DH, Ryan R, Hayes B, Fennelly D, Gibney RG. Hepatocellular carcinoma complicating cystic fibrosis related liver disease. J Cyst Fibros 2009; 8: [PMID: DOI: /j.jcf ] 122 McKeon D, Day A, Parmar J, Alexander G, Bilton D. Hepatocellular carcinoma in association with cirrhosis in a patient with cystic fibrosis. J Cyst Fibros 2004; 3: [PMID: ] 123 Kelleher T, Staunton M, O Mahony S, McCormick PA. Advanced hepatocellular carcinoma associated with cystic fibrosis. Eur J Gastroenterol Hepatol 2005; 17: [PMID: ] 124 Beasley RP, Hwang LY, Lin CC, Chien CS. Hepatocellular carcinoma and hepatitis B virus. A prospective study of men in Taiwan. Lancet 1981; 2: [PMID: ] 125 Sakuma K, Saitoh N, Kasai M, Jitsukawa H, Yoshino I, Yamaguchi M, Nobutomo K, Yamumi M, Tsuda F, Komazawa T. Relative risks of death due to liver disease among Japanese male adults having various statuses for hepatitis B s and e antigen/antibody in serum: a prospective study. Hepatology 1988; 8: [PMID: ] 126 Beasley RP. Hepatitis B virus as the etiologic agent in hepatocellular carcinoma. Hepatology 1982; 2(suppl): 21S-26S 127 Yang HI, Lu SN, Liaw YF, You SL, Sun CA, Wang LY, Hsiao CK, Chen PJ, Chen DS, Chen CJ. Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med 2002; 347: [PMID: ] 128 Chen CJ, Yang HI, Su J, Jen CL, You SL, Lu SN, Huang GT, Iloeje UH. Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 2006; 295: [PMID: ] 129 Kew MC, Marcus R, Geddes EW. Some characteristics of Mozambican Shangaans with primary hepatocellular cancer. S Afr Med J 1977; 51: [PMID: 66757] 130 Hsu YS, Chien RN, Yeh CT, Sheen IS, Chiou HY, Chu CM, Liaw YF. Long-term outcome after spontaneous HBeAg seroconversion in patients with chronic hepatitis B. Hepatology 2002; 35: [PMID: ] 131 Wong DK, Huang FY, Lai CL, Poon RT, Seto WK, Fung J, Hung IF, Yuen MF. Occult hepatitis B infection and HBV replicative activity in patients with cryptogenic cause of hepatocellular carcinoma. Hepatology 2011; 54: [PMID: ] 132 Huo TI, Wu JC, Lee PC, Chau GY, Lui WY, Tsay SH, Ting LT, Chang FY, Lee SD. Sero-clearance of hepatitis B surface antigen in chronic carriers does not necessarily imply a good prognosis. Hepatology 1998; 28: [PMID: ] 133 McMahon BJ, Alberts SR, Wainwright RB, Bulkow L, Lanier AP. Hepatitis B-related sequelae. Prospective study in 1400 hepatitis B surface antigen-positive Alaska native carriers. Arch Intern Med 1990; 150: [PMID: ] 134 Sherman M, Peltekian KM, Lee C. Screening for hepatocellular carcinoma in chronic carriers of hepatitis B virus: incidence and prevalence of hepatocellular carcinoma in a North American urban population. Hepatology 1995; 22: [PMID: ] 135 de Franchis R, Meucci G, Vecchi M, Tatarella M, Colombo M, Del Ninno E, Rumi MG, Donato MF, Ronchi G. The natural history of asymptomatic hepatitis B surface antigen carriers. Ann Intern Med 1993; 118: [PMID: ] 136 Fattovich G, Olivari N, Pasino M, D Onofrio M, Martone E, Donato F. Long-term outcome of chronic hepatitis B in Caucasian patients: mortality after 25 years. Gut 2008; 57: [PMID: ] 137 Manno M, Cammà C, Schepis F, Bassi F, Gelmini R, Giannini F, Miselli F, Grottola A, Ferretti I, Vecchi C, De Palma M, Villa E. Natural history of chronic HBV carriers in northern Italy: morbidity and mortality after 30 years. Gastroenterology 2004; 127: [PMID: ] 138 Bräu N, Fox RK, Xiao P, Marks K, Naqvi Z, Taylor LE, Trikha A, Sherman M, Sulkowski MS, Dieterich DT, Rigsby MO, Wright TL, Hernandez MD, Jain MK, Khatri GK, Sterling RK, Bonacini M, Martyn CA, Aytaman A, Llovet JM, Brown ST, Bini EJ. Presentation and outcome of hepatocellular carcinoma in HIV-infected patients: a U.S.-Canadian multicenter study. J Hepatol 2007; 47: [PMID: ] 139 Yu MW, Chang HC, Liaw YF, Lin SM, Lee SD, Liu CJ, Chen PJ, Hsiao TJ, Lee PH, Chen CJ. Familial risk of hepatocellular carcinoma among chronic hepatitis B carriers and their relatives. J Natl Cancer Inst 2000; 92: [PMID: ] 140 Turati F, Edefonti V, Talamini R, Ferraroni M, Malvezzi M, Bravi F, Franceschi S, Montella M, Polesel J, Zucchetto A, La Vecchia C, Negri E, Decarli A. Family history of liver cancer and hepatocellular carcinoma. Hepatology 2012; 55: [PMID: ] 141 Kew MC, Macerollo P. Effect of age on the etiologic role of the hepatitis B virus in hepatocellular carcinoma in blacks. Gastroenterology 1988; 94: [PMID: ] 142 Yoshida H, Shiratori Y, Moriyama M, Arakawa Y, Ide T, Sata M, Inoue O, Yano M, Tanaka M, Fujiyama S, Nishiguchi S, Kuroki T, Imazeki F, Yokosuka O, Kinoyama S, Yamada G, Omata M. Interferon therapy reduces the risk for hepatocellular carcinoma: national surveillance program of cirrhotic and noncirrhotic patients with chronic hepatitis C in Japan. IHIT Study Group. Inhibition of Hepatocarcinogenesis by Interferon Therapy. Ann Intern Med 1999; 131: [PMID: ] P- Reviewers Chen JL, Grasso A S- Editor Zhai HH L- Editor A E- Editor Liu XM 6756 October 28, 2013 Volume 19 Issue 40

69 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Role of stem cells in repair of liver injury: Experimental and clinical benefit of transferred stem cells on liver failure Mukaddes Esrefoglu Mukaddes Esrefoglu, Department of Histology and Embryology, Medical Faculty, Bezmialem Vakif University, Istanbul, Turkey Author contributions: Esrefoglu M solely contributed to this paper. Correspondence to: Mukaddes Esrefoglu, Professor, Department of Histology and Embryology, Medical Faculty, Bezmialem Vakif University, Adnan Menderes Bulvari, Vatan Cad, Istanbul 34093, Turkey. drmukaddes@hotmail.com Telephone: Fax: Received: May 10, 2013 Revised: July 23, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 capacity, as a result of massive hepatocyte death, liver failure occurs. In recent years, there has been extensive experimental and clinical research in the field of cellular transplantation. Transplantation of cell lineages involved in liver regeneration, including mature and fetal hepatocytes, fetal liver progenitor and stem cells, hepatic progenitor and stem cells, mesenchymal stem cells, hematopoietic stem cells, and peripheral blood and umbilical cord blood stem cells, have been found to be beneficial for treating of liver failure. Herein, I review the results of experimental and clinical cell transplantation trials for liver failure. Abstract Although the liver has a high regenerative capacity, as a result of massive hepatocyte death, liver failure occurs. In addition to liver failure, for acute, chronic and hereditary diseases of the liver, cell transplantation therapies can stimulate regeneration or at least ensure sufficient function until liver transplantation can be performed. The lack of donor organs and the risks of rejection have prompted extensive experimental and clinical research in the field of cellular transplantation. Transplantation of cell lineages involved in liver regeneration, including mature hepatocytes, fetal hepatocytes, fetal liver progenitor cells, fetal stem cells, hepatic progenitor cells, hepatic stem cells, mesenchymal stem cells, hematopoietic stem cells, and peripheral blood and umbilical cord blood stem cells, have been found to be beneficial in the treatment of liver failure. In this article, the results of experimental and clinical cell transplantation trials for liver failure are reviewed, with an emphasis on regeneration Baishideng. All rights reserved. Key words: Liver regeneration; Liver failure; Stem cell Core tip: Although the liver has a high regenerative Esrefoglu M. Role of stem cells in repair of liver injury: Experimental and clinical benefit of transferred stem cells on liver failure. World J Gastroenterol 2013; 19(40): Available from: URL: i40/6757.htm DOI: INTRODUCTION The liver provides various vital functions, including protein synthesis, detoxification, bile excretion and storage of vitamins. It is necessary for survival that it should be regenerated following massive damage induced by environmental toxins, infections and alcohol, etc. Although in normal conditions, hepatocytes, the primary cell type of the liver, are in G0 phase of mitosis, following any injury they rapidly enter the G1 phase and undergo mitosis. S-phase hepatocytes can be located in all segments of the lobule in the normal adult liver [1]. In the regenerating liver after partial hepatectomy (PH), periportal cells replicate first, probably reflecting their shorter G1 phase [2]. The peak of DNA synthesis is within h after PH in mice [3]. The average life span of the hepatocytes is relatively long, about 5 mo. These long-lived cells are capable of at least 69 cell divisions and can restore normal architecture and impaired function in the injured liver [4]. He October 28, 2013 Volume 19 Issue 40

70 Esrefoglu M. Stem cells on liver regeneration patocytes are the cells that normally shoulder the burden of regenerative growth after liver damage; therefore, they can be considered as the functional stem cells under most circumstances [5]. The liver is the only internal human organ capable of natural regeneration. Detailed studies of the mechanisms that regulate liver growth have been performed in animals subjected to PH or chemical injury. Livers from small animals enlarge after transplantation to reach a liver size in proportion to the size of the recipient animal (e.g., baboons to humans, small dogs to large dogs) [6]. In humans, previous studies have shown that the mean liver volume 6 mo after donor hepatectomy was 90.7% of the initial liver volume [7], and that the livers of the right lobe donor group regenerated faster than those of the left lobe donor group [8]. In fact, the growth of the liver is a restoration of function; the lobes that are removed do not regrow into their original form [9]. Nevertheless, functional restoration may be sufficient for survival of the organism. The human liver is composed of mainly parenchymal cells, commonly referred to as hepatocytes, which are arranged in 1-2 cells-thick plates surrounded by hepatic sinusoids. They constitute 80% of the cell population of the liver. Sinusoidal endothelial cells, perisinusoidal macrophages (Kupffer cells), stallate cells (Ito cells) and liverspecific natural killer cells (pit cells) represent the nonparenchymal cells [10]. Hepatocytes are rich in membranous and non-membranous organelles and inclusions. Bile is secreted into the bile canaliculi, which are a part of the intercellular space isolated by junctional complexes from the rest of the intercellular compartment. Near the portal space, bile canaliculi transform into the canal of Hering, which is lined by both hepatocytes and cholangiocytes [10]. The canal of Hering is thought to serve a reservoir of liver progenitor cells. The cell compartment that resides in the canal of Hering has been called the progenitor (in humans) or the oval cell compartment (in rodents) [11]. In rodents, the canal barely extends beyond the limiting plate; in contrast, in humans, it extends to the proximate third of the lobule [12]. The epithelial cells of the canal, called oval cells, are oval in shape and can differentiate into both hepatocytes and cholangiocytes. Thus, it would appear that a name change from oval cells to hepatic progenitor cells (HPCs) is required [13]. The transdifferentiation of oval cells to hepatocytes may determine survival when it occurs during liver failure in humans. Adult hepatic stem cells are scarcely detectable under physiological conditions and during the normal process of liver regeneration, presumably because of their small numbers. Analyses of oval cells have raised the possibility that adult hepatic stem cells are present in the canals of Herring, and that oval cells originate from the stem cells and differentiate into both the hepatic and cholangiocytic lineages [14]. Kuwahara et al [15] enumerated four distinct stem cell niches: the canal of Hering (proximal biliary tree), the intralobular bile ducts, the peri-ductal null mononuclear cells and the peri-biliary hepatocytes. Although the liver has a high regenerative capacity, as a result of massive hepatocyte death, liver failure occurs. Liver transplantation, sometimes the only option for patient survival, often leads to immunological complications. On the other hand, it is limited by the availability of donor organs. In addition to liver failure, for acute, chronic and hereditary diseases of the liver, cell transplantation therapies can stimulate regeneration or at least ensure sufficient function until liver transplantation can be performed. The lack of donor organs and risks of rejection have prompted extensive research in the field of cellular transplantation. In this article, I review hepatic cell types involved in liver regeneration and cell transplantation therapies for liver failure, with an emphasis on regeneration. CATEGORIZATION OF STEM CELLS Stem cells are the main cells of organisms from which the all of the mature body cells are derived. Their high proliferative capacity for self-renewal permit them to increase their numbers by symmetric division. They may remain in the undifferentiated state for long periods. When the morphological as well as functional, differentiation begins, these cells differentiate into multiple specialized cell lineages. Stem cells are the source of progenitor cells committed to one or several lineages. The committed progenitor cells exhibit a capacity for active proliferation and supply abundant daughter cells, which in turn give rise to terminally differentiated cells [14]. Stem cells are classified depending on the potential for differentiation into specialized cell types. The most talented stem cells, totipotent cells of the zygote within first 4 d of the intrauterine life, are able to form a full organism in an appropriate microenvironment. However, pluripotent cells, known as embryonic stem cells (ESCs), derived from the inner cell mass of the embryo, can form virtually any cell type derived from any of three embryonic germ layers; ectoderm, mesoderm or endoderm. Thus, an embryonic stem cell can form hepatocytes (endodermal in origin), cardiomyocytes (mesodermal in origin), and neurons (ectodermal in origin). Surplus embryos obtained from in-vitro fertilization laboratories are the main sources of the ESCs. However, some disadvantages including, high immune reaction risk and ethical concerns, limit their applications. Multipotent stem cells, known as adult stem cells, with a relatively limited differentiation potential, can form different cell types of the tissue. These cells reside together with the specialized cell types of the adult tissues and are thought to be responsible for the tissue maintenance and repair. The exact mechanisms that force them to differentiate into a specialized cell type are not fully known. The two major populations of adult stem cells are bone marrow mesenchymal and hematopoietic stem cells (HSCs). Hematopoietic stem cells have a predetermined fate to form all types of mature blood cells. Mesenchymal stem cells 6758 October 28, 2013 Volume 19 Issue 40

71 Esrefoglu M. Stem cells on liver regeneration can differentiate into multiple cell lineages, including tendon cells, muscle cells, osteocytes and fat cells. The term multipotent stromal cell implies the multipotent stem cells of both bone morrow and of non-marrow tissue, such as umbilical cord blood, adipose tissue, muscle tissue and dental pulp. In laboratory conditions, multipotent cells show plasticity. Plasticity or transdifferentiation means that the stem cells of an adult tissue can generate differentiated cells types of a different tissue. For instance, HSCs can transform into hepatocytes or brain stem cells or form skeletal muscle fibers. It is not clear if this occurs in the body. Multipotent cells do not cause any immune reaction, because they are genetically identical to their hosts. However, these cells are restricted in their ability to form different cell types. Moreover, they have some disadvantages, including slow rate of cell division and difficulties in isolating sufficient numbers for application because of their scarcity within tissues. The last type of stem cells is unipotent stem cells, which have very limited capacity for differentiation and can give rise to only one type of cell under normal conditions. For example, unipotent stem cells of colony forming unit of erythrocytes (CFU-E) can only give rise to mature blood erythrocytes. In recent years, stem cells have been widely studied for their potential therapeutic use. However, some of studies were not successful. Researchers agree that as well as isolation of adequate numbers of healthy stem cells, selection of the most convenient transportation route, regulation of stem cell differentiation into a special cell type and obtaining the normal functions of the differentiated cells are very important regarding the benefit of stem cell applications. The most important risk of the transplanted stem cells is generation of tumors if cell division occurs in an uncontrolled manner. Unfortunately, stem cell transplantation therapy may be considered as a double-edged sword. HEPATIC CELLS INVOLVED IN REGENERATION The liver can regenerate itself by increasing the rate of hepatocyte mitosis and differentiation of stem cells into hepatocytes or cholangiocytes. Stem cells are the main cell lineage for liver regeneration. Several studies suggest the existence of one or more population of cells (e.g., stem cells, progenitor cells and extrahepatic stem cells) that are able to differentiate into hepatocytes and biliary epithelial cells. However, the exact location of these cells is not yet clear. In humans and rodents, potential liver stem cells may exist within the biliary tree. Both rodent and human ESCs, bone marrow HSCs, mesenchymal stem cells (MSCs), umbilical cord stem cells, fetal and adult liver progenitor cells, and mature hepatocytes have been reported to be capable of self-renewal, giving rise to daughter hepatocytes both in vivo and in vitro [16]. Although the factors controlling proliferation, differentiation and secretion processes are not well defined, recent studies emphasize the role of several local (microenvironment) and systemic factors. However, the exact triggering mechanisms for differentiation of these cells into mature hepatocytes are not fully understood. During embryonic development, hepatoblasts generate the two epithelial cell lineages: hepatocytes and biliary cells [17]. The area connecting the terminal segment of the biliary ductular system with parenchymal hepatocytes persists in the adult liver and is known as the canals of Hering [18]. The primitive intrahepatic bile ducts expressing both hepatocyte proteins and biliary epithelial markers have consequently been referred to as transitional cells [19-21]. Transitional cells have properties intermediate between those of oval cells and hepatocytes [20]. These cells are believed to remain in the adult liver as bipotential progenitors for both hepatocytes and biliary cells [21]. Many investigators favor the view that the liver harbors facultative stem cells that are located throughout the biliary epithelium. The activation of these cells for transformation into mature hepatocytes is a conditional process that occurs only when the regenerative capacity of hepatocytes is overwhelmed [22]. Hepatocyte differentiation within bile ducts in the human liver has been noted, which has led to the belief that small biliary cells, hepatocyte-like cells expressing both markers of bile duct cells and hepatocytes, which repopulate severely damaged liver parenchyma, can function as a progenitor cell population for new hepatocytes [23]. In rodents, early reactive bile ductules do not generally resemble hepatocytes, but later acquire features of hepatocytes [22]. By contrast, direct evidence for the transformation of hepatocytes into biliary cells provided in cell culture had raised a possibility that hepatocytes themselves may be precursor cells for the biliary epithelium if the latter s ability to proliferate and repair themselves is compromised for some reason [24,25]. The oval cells represent the progeny of liver stem cells and function as an amplification compartment for the generation of new hepatocytes [22]. The oval cell compartment, consisting of small ovoid cells with scant, lightly basophilic cytoplasm and pale blue staining oval nuclei [26], is widely used to describe liver progenitors. It is generally accepted that oval cells are bipotential transitamplified cells derived from normally quiescent true stem cells, which reside in the biliary tree and are absent in the healthy liver [27]. In fact, to date, whether oval cells pre-exist in the tissue or develop from other adult cell types (e.g., bile duct cells) after injury, is unknown. The restricted potential to differentiate into hepatocytes and cholangiocytes qualifies oval cells more as progenitor cells than as true stem cells [28]. The oval cells compartment can probably not to be attributed to a single cell type. A primitive oval cell population that do not express alpha-fetoprotein (AFP), cytokeratin 19 (CK-19), OV-6; a hepatocyte-like oval cell population that express AFP, but not OV-6; and a ductular-like oval cell population that not express AFP, but express CK 19 and OV-6 have been isolated [29]. It is presently unclear if antigenically distinct subpopulations of oval cells are derived from different 6759 October 28, 2013 Volume 19 Issue 40

72 Esrefoglu M. Stem cells on liver regeneration injury. These cells are rare in the liver, have a very long proliferation potential, and may be multipotent; however, their full potential has yet to be defined. These cells may be hematopoietic stem cell types that either reside in liver or bone marrow [50]. Another cell type related to the regeneration of rat liver has been identified, referred to as small hepatocytes (small hepatocyte-like progenitor cells) [51,52]. This cell population is phenotypically different from fully differentiated hepatocytes, cholangiocytes and oval cells. They represent a unique parenchymal (less differentiated) progenitor cell population [53]. These cells have an extensive proliferative capacity and may represent a novel progenitor cell population that responds to liver deficit when the replicative capacity of differentiated hepatocytes is impaired, and can restore tissue mass [52]. However, there is still controversy as to whether these cells represent an intermediate state in oval cell differentiation or are derived from hepatocytes resistant to stem cells. Best et al [54] suggested that small hepatocytes are not the progeny of oval cell precursors, but represent an independent liver progenitor cell population. By contrast, Vig et al [55] showed that oval cells can form small hepatocyte-like progenitor cell nodules during the regeneration stage after chronic hepatocellular liver injury. A number of studies have been published demonstrating that stem/progenitor cells can be differentiated toward hepatocyte-like cells, a term that has been used to describe cells generated in vitro that show some characteristics of mature hepatocytes, but are still not fully mature and/or characterized [56]. Classic studies by Evarts et al [57-59] demonstrated that oval cells gradually transform themselves into small basophilic hepatocytes, which then become fully mature hepatocytes and replace the lost liver mass. They also showed the transfer of radiolabeled thymidine from oval cells to newly formed hepatocytes in vivo. Thus, the precursor-product relationship between oval cells and basophilic hepatocytes has been suggested [59]. Recently, a unique population of liver-derived bipotential liver progenitors was isolated from unmanipulated rat liver [60]. These bipotential liver cells express both hematopoietic stem cell markers, such as CD45, CD34 and thy-1, similar to oval cells [60,61], and endodermal/hepatic markers. In contrast to oval cells, these liver progenitors are negative for OV-6, cytokeratin 7 and CK 19, and express very little or no AFP [60,62]. Their capacity for hepatic differentiation makes them a valuable resource for important applications such as cell therapies for a variety of liver diseases [62]. Although mature hepatocytes and cholangiocytes represent the first and most important resource for tissue repair, experimental data support the hypothesis that the liver also contains or activates a stem cell compartment [63,64]. Herrera et al [65] isolated a pluripotent population similar to rodent oval cells from adult liver and may be more mesenchymal in lineage. These cells expressed mesenchymal stem cell markers, but not the hematopoiprecursor cells or if their phenotype merely reflects the commitment of an oval cell to a specific lineage [30]. Oval cells form ductular structures that communicate with the biliary system at one end and terminate at a hepatocyte-forming blind end [31]. Markers commonly used to assess differentiation and to trace lineages of oval cells include expressed antigenic markers for hepatocytes, biliary ducts and oval cells (BSD7, OC2, OC3, OV-1, and OV-6), intermediate filaments, extracellular matrix proteins (CK8, 18, 19), enzymes and secreted proteins (alpha-fetoprotein and gamma-glutamyl transferase) [32,33]. Oval cells also express some markers considered characteristic of stem cells, including stem cell factor [34], bcl-2 [35] and cytokeratin 14 [36]. They are also immunoreactive to antibodies generally associated with hematopoietic lineages, such as CD34, and c-kit [37,38] ; therefore, there may be a common lineage between hematopoietic and liver cell precursors. In a recent study, a population of cells (beta-2-microglobulin-ve, Thy-1+ve) in rat and human bone marrow was identified that also expressed hepatocyte specific functions, suggesting that these cells may be hepatic stem cells. After intraportal infusion into rat livers, rat-derived bone marrow cells integrated with hepatic cell plates and differentiated into mature hepatocytes [39]. Moreover, Crosby et al [37] have shown that c-kit and CD34 positive cells isolated from human liver are able to differentiate into biliary epithelial cells and endothelial cells. Thus, biliary cells and endothelial cells may also share some common precursors. It has been postulated that oval cells arise either from cells lining the canals of Hering [31,40], from mature biliary cells [12], liver epithelial or stromal cells [41], or from circulating hematopoietic stem cells [42,43]. Additionally, some antigens traditionally associated with hematopoietic cells (c-kit and CD34) can also be expressed by oval cells, leading to the notion that at least some hepatic oval cells are directly derived from a precursor of bone marrow origin [39,44]. Fausto et al [45] suggested that bone barrow stem cells can generate oval cells and hepatocytes; however, transdifferentiation is very rare and inefficient. Bone marrow derived hepatocytes constituted from 0.008% to 0.8% of total parenchymal cells; therefore, differentiation of bone marrow cells into mature hepatocytes is very inefficient under physiological conditions [46]. Additionally, the repopulation process is not complete and is relatively slow [43,47]. Studies have demonstrated that HSCs have the capacity to fuse with other cell types [48]. Several publications subsequently emerged to demonstrate that the appearance of new hepatocytes from bone marrow precursors in liver repopulation models was not caused by transdifferentiation of the marrow stem cells to hepatocytes, but to fusion of the marrow cells with the hepatocytes of the recipient [48,49]. While fusion with hepatocytes in whole animal experiments may have a role, it cannot explain the appearance of hepatocyte-like cells in cell cultures of bone marrow [25]. The periductular stem cells are one of the other cell types related to liver regeneration in some types of liver 6760 October 28, 2013 Volume 19 Issue 40

73 Esrefoglu M. Stem cells on liver regeneration etic stem cell markers. The absence of staining for cytokeratin-19, CD117, and CD34 indicated that these cells were not oval stem cells. Castorina et al [64] reported that human liver stem cells express several mesenchymal markers, such as CD 44, but not hematopoietic stem cell markers. Additionally these multipotent cells express AFP, albumin, CK7 and CK19, indicating a partial commitment to hepatic and biliary lineages. Schmelzer et al [66,67] isolated two pluripotent hepatic progenitors: hepatic stem cells and progenitors. The gene expression profile of hepatic stem cells throughout life consists of high levels of expression of cytokeratin 19 (CK19), neuronal cell adhesion molecule (NCAM), epithelial cell adhesion molecule (EpCAM), and claudin-3 (CLDN-3); low levels of albumin; and a complete absence of expression of AFP. By contrast, hepatoblasts, found as < 0.1% of normal adult livers, express high levels of AFP, elevated levels of albumin, low levels of CK19 and a loss of NCAM and CLDN-3. Notably, both hepatocytes and hepatic progenitor cells may differentiate into hepatocytes and biliary cells, as well indicating their bipotent differentiation capacity. Hence, both cell types meet the minimal definition criteria of a stem cell, i.e., the potential of self-renewal to maintain the stem cell reserve, and a multiple differentiation potential giving rise to progeny of at least two different lineages [68]. FACTORS RELATED TO HEPATIC REGENERATION Studies of liver injury have led the identification of several factors that are involved in the regulation of cell activation related to liver regeneration. It is not clear whether the same factors known to be involved in normal hepatic regeneration are also involved in regeneration via the stem cell compartment. As mentioned before, the hepatic progenitor cell niche is located at the level of the canals of Hering. The ductular and periductular area is composed of numerous different cells, such as portal myofibroblasts, stellate cells, endothelial cells, hepatocytes, cholangiocytes, Kupffer cells, pit cells and inflammatory cells. All these cells could interact and crosstalk with hepatic parenchymal cells, influencing their proliferative and differentiative processes through the provision of numerous signals within the niche [5]. The local environments of endogenous and transplanted cells mainly affect their proliferation, differentiation, secretion, and other functions [69,70]. Hepatocyte growth factor (HGF), epidermal growth factor (EGF), and transforming growth factor-α (TGF-α), as potent mitogens, are primarily associated with normal hepatic regeneration [71-73]. In cultures, the mouse liver progenitor cells differentiated into hepatocytes upon treatment with EGF or differentiated into biliary lineage cells upon treatment with HGF [74]. In their quiescent state, hepatocytes do not fully respond to growth factors such as HGF, TGF and EGF, which are potent stimulators of DNA replication for hepatocytes in primary culture [75-77]. In the intact liver, hepatocytes need to be primed to enter the cell cycle and respond to growth factors [73]. The results show that TNF acts as a primer to sensitize hepatocytes to the proliferative effects of growth factors, and offers a mechanism to explain the initiation and progression phases of liver regeneration after PH [77]. In addition to hepatocyte-autonomous signals, endocrine and paracrine factors are critical to normal regeneration, and extensive work has focused on the role of the liver microenvironment, i.e., non-parenchymal cells and the extra-cellular matrix (ECM), in liver homeostasis and regeneration [71,78]. Non-parenchymal cells, such as endothelial cells, Kupffer cells, stellate cell and intrahepatic lymphocytes provide critical signals to hepatocytes during regeneration [78-80]. Intercellular interaction seems to be crucial during liver regeneration. Indeed, the initiation of liver regeneration involves the rapid and simultaneous activation of multiple signaling pathways in both hepatocytes and non-parenchymal cells, which are the main sources of tumor necrosis factor, interleukin-6,and heparin binding EGF [75,76,81]. Following acute liver injury, release of IL-6 from Kupffer cells and neutrophils and the growth factors including HGF, EGF, TGF-α, and fibroblast growth factor-α released from hepatic stellate cells, stimulate hepatocytes to enter mitosis [76,81]. Stellate cells are regarded as the principal source of extracellular matrix proteins during hepatic regeneration [82]. A recent study demonstrated that HSCs act as a positive regulator at the early phase and a negative regulator at the terminal phase of liver regeneration through cell-cell interaction and cytokine networks [83]. The authors reported that high levels of HGF at early phase of liver regeneration stimulated oval cell proliferation via extracellular signalregulated kinase and p38 pathway, whereas high levels of TGF-β1 at the terminal phase of liver regeneration suppressed DNA synthesis of oval cells. The shift between these two distinct effects depended on the balance between HGF and TGF-β1 secreted by HSCs. Paku et al [31] demonstrated that proliferating oval cells are closely associated with stellate cells, suggesting that non-parenchymal cells nurture oval cell growth and differentiation through secretion of growth factors and cytokines, and also by direct cell-to-cell interactions. The factors involved in the regulation of oval cell activation include TGF, HGF and its receptor c-met, IL-6 and peroxisome proliferators/ peroxisome proliferator activated receptor alpha [84-87]. It is clear that from the first stem/progenitor activation phase to the final differentiation phase of the oval cell cycle, several growth factors and other factors are effective. More recent studies have emphasized the involvement of TNF-like weak inducer of apoptosis (TWEAK), a member of the TNF family, in the proliferation of oval cells. TWEAK expressed by T cells can stimulate hepatic progenitor cell proliferation. It appears that TWEAK selectively promotes proliferation of oval cells without having an effect on hepatocytes [87]. Some of the other key molecules in the liver microen October 28, 2013 Volume 19 Issue 40

74 Esrefoglu M. Stem cells on liver regeneration vironment that determine regenerative behavior include the pro-inflammatory cytokines and angiogenic factors, such as vascular endothelial growth factor (VEGF) [80,88]. Changes in microenvironments may have contributed to the positive outcomes of many liver cell transplantation studies, and might be initiated by the strong outputs (e.g., signaling, secretion) from the transplanted hepatocytes that drastically affect the environments to stimulate endogenous hepatocyte regeneration [89]. Improvement of liver microenvironments related to liver regeneration is one of the goals of cell transplantation therapies. Recently, numerous experimental and clinical studies have been performed investigating the factors that increase the benefit of cell transplantation therapies and survival of the patients with liver damage or failure. CELL TYPES TRANSPLANTED FOR LIVER FAILURE Cell transplantation therapy is a promising alternative approach that leads to donor cell-mediated repopulation of the liver and improved survival rates in experimental models of liver disease. It may serve to alleviate the symptoms while the patients are waiting for liver transplantation. However, significant challenges remain before these cells can be used in humans, such as the lack of consensus about the immunophenotype of liver progenitor cells, uncertainty of the physiological role of reported candidate stem/progenitor cells, practicality of obtaining sufficient quantity of cells for clinical use, and concerns over ethics, long-term efficacy, and safety [16]. A registered clinical application based on stem cell technology will take at least an additional 5-10 years because of certain limitations; e.g., the lack of suitable cell sources and risk of teratoma formation [90]. Stem cell therapy exerts its beneficial effect through a number of mechanisms, not necessarily transdifferentiation. Paracrine factors also have an important role in the improvement mechanism. Mature hepatocytes, stem/progenitor cells (ESCs, adipose-derived stem cells, umbilical stem cells, bone marrow-derived stem cells and oval cells), and hepatocyte-like cells are the main cell types used for cell transplantation in experimental and/ or clinical studies. Transplanted hepatocytes have high function, but short survival time, whereas transplanted stem/progenitor cells have weak function, but high proliferative capacity. Hepatocyte-like cells accumulate over time via differentiation and proliferation [91]. However, the numbers of hepatocytes needed for transplantation in humans can be quite large [92], cells that can differentiate into mature hepatocytes have been great interest. Additionally, since hepatocytes are large in diameter, up to 70% of transplanted hepatocytes get trapped in the hepatic sinusoids, which leads to temporary obstruction with subsequent portal hypertension [93], and they have a poor engraftment rate [94]. MATURE HEPATOCYTES Hepatocyte transplantation has been performed for more than 10 years in humans, meeting with varied degrees of success [95]. Data published for almost 70 years have unequivocally shown that hepatocytes are the replicating cells responsible for liver regeneration and that progenitor cell activation leading to lineage generation is not observed during this process [3,19,96]. Although the other cell types of the liver are necessary to support hepatocyte replication and hepatic growth, it has now been established that the hepatocyte has a remarkable capacity for cell proliferation and is the most efficient cell for liver repopulation after injury [45,75]. Therefore, transplantation of mature hepatocytes into an injured liver seems to be helpful to support recovery process. However, transplanted hepatocytes have a low liver-engraftment rate and survival [97], and hepatocytes are only available from cadaveric donor livers, which mean that the cells largely lack transplantation quality and quantity. Moreover, cryopreservation of mature hepatocytes before use leads to an additional substantial loss of viability and function. Thus, research is aiming to obtain transplantable cells from embryonic and adult stem cells, or liver progenitor cells that can be expanded in vitro. One attractive alternative source of transplantable hepatocytes is cells derived from an immortalized hepatocyte cell line that provides an unlimited supply of transplantable cells [98]. Immortalized hepatocytes could then grow in tissue culture and subsequently function as differentiated, non transformed hepatocytes following transplantation [98,99]. Experimental results Rhim et al [100,101] showed that a small number of transplanted hepatocytes could repopulate the liver of newborn urokinase-type plasminogen activator (upa) transgenic mice. Transplantation of rat liver cells into these mice resulted in the complete reconstitution of a mouse liver with rat hepatocytes. The transplanted liver cell populations replaced up to 80 % of the diseased recipient liver. Overturf et al [102] found evidence that short-term therapeutic liver repopulation does not require progenitor or stem cells. The majority of the transplanted cells apparently participated in the repopulation process and intermediate-size hepatocytes appeared to have a better replicative capacity than small hepatocytes. Recently, transplanted hepatocytes were shown to engraft in the liver of animals with acute liver failure (ALF) [103]. However, only 20%-30% of the transplanted hepatocytes survive and engraft in the liver of rats [104]. In fact, several studies using rat models of primary hepatocyte transplantation revealed that transplantation leads to efficacious donor chimerism [ ]. When hepatocytes were transplanted via the spleen, cells were distributed immediately in periportal areas, fibrous septa and regenerative nodules of the cirrhotic liver [107]. However, transplanted cell proliferation in the liver was limited, and animals did not show any dif October 28, 2013 Volume 19 Issue 40

75 Esrefoglu M. Stem cells on liver regeneration ferences in mortality over a 12-mo period. On the contrary, Kobayashi et al [108] found that intrasplenic cell transplantation in extremely sick cirrhotic rats was associated with improvement in liver tests, coagulation abnormality and outcomes. Additionally, cell transplantation has been shown to prevent the development of intracranial hypertension in pigs following acute ischemic liver failure [109]. Immortalized hepatocytes have also been shown to improve the survival rate in an ALF model [110]. Immortalized hepatocytes that can function as well as primary hepatocytes following transplantation were found to be effective in the treatment of liver failure in rats with endstage cirrhosis with hepatic encephalopathy [98,111]. The immortalized hepatocytes may achieve a meaningful liver population using a clonal cell line; however, the malignant potential of these immortalized cell lines needs to be fully investigated before they could be applied in the clinic. Clinical results In an early study, in 10 Japanese patients with cirrhosis, hepatocytes ( ) isolated from a piece of their own liver were transplanted into various sites, including the spleen [112]. In one of these patients, transplanted hepatocytes were detected in the spleen 11 mo following transplantation. One of these patients recovered. In another trial, five patients with hepatic encephalopathy and multiple organ failure were transplanted with allogeneic hepatocytes ( ) through the splenic artery [113]. Biochemical evidence of liver injury improved significantly and blood ammonia levels decreased significantly to normal levels in the hepatocyte-treated patients. Three of these patients bridged to liver transplantation and were normal with more than 20 mo of follow-up. Transplantation of hepatocytes via the abdominal cavity also has been found beneficial. Seven patients with fulminant hepatic failure (FHF) were transplanted ( /kgbw) via the abdominal cavity resulting in survival and improved encephalopathy [114]. Cryopreserved hepatocyte transplantation is a bridging method while patients with chronic liver failure await liver transplantation. Three of five patients with ALF who received transplantation of cryopreserved hepatocytes through intrasplenic and intraportal infusion improved afterwards [115]. A patient with ALF infused intraportally with cryopreserved human hepatocytes fully recovered 12 wk after transplantation [116]. Repeated application of primary human hepatocytes seems to be safe and results in measurable benefits for patients with ALF. HEPATIC PROGENITOR/STEM CELLS Human hepatic stem cells, constituting approximately 0.5%-2.5% of liver parenchyma, can be isolated by immunoselection for epithelial cell adhesion moleculepositive cells (EpCAM+) [67]. Isolation of hepatic progenitor cells from human material has proven to be very difficult. In fact, although hepatic progenitor cells express several markers, their unequivocal isolation as a pure fraction has been a major obstacle in liver progenitor cell research. Novel cell surface markers in adult progenitor cells include tight junction proteins, integrins, cadherins, cell adhesion molecules, receptors, membrane channels and other transmembrane proteins. Cell surface markers, CD133, claudin-7, cadherin 22, mucin-1, ros-1 and Gabrp 9 are overexpressed and are unique for the adult progenitors [117]. Thymus cell antigen 1 (Thy-1) is a marker for sorting bipotential progenitor cells from human livers [118]. None of the described markers are completely specific; therefore, isolation of viable cells is limited [119]. Much less is known about the mechanisms of oval cell replication and differentiation, although new information on these topics is rapidly accumulating. Regarding cellular aspects of liver growth and regeneration, it needs to be established what kind of signaling mechanisms may exist, direct and/or indirect, between hepatocytes and oval cells that determines whether one cell type or the other is the main or initial target for a growth stimulus [45]. Experimental results Schmelzer et al [67] demonstrated that purified EpCAM+ cells from fetal or postnatal livers are able to engraft the livers of immunodeficient adult mice (with or without prior injury) and give rise to mature human liver parenchymal cells. Similar results were obtained by Weiss et al [118] through the isolation of Thy-1+ cells from adult human livers and their transplantation in immunodeficient Pfp/Rag2 mice. Analysis of in situ material revealed that transplanted cells express human hepatic markers HepPar1 and albumin, indicating functional engraftment. Oval cell proliferation is prominent in many models of liver injury, including CCl4 treatment in combination with PH [120,121]. A recent study showed that transfer of oval cells to Wistar rats with FHF could significantly increase their survival rate [122]. In the study of Wang et al [123], 3,5-diethoxycarbonyl-1,4-dihydrocollidine induced oval cell proliferation. Transplantation of murine oval cells could repopulate the recipient liver in fumarylacetoacetate hydrolase-deficient mice, and rescue the phenotype. Clinical results As far as I know, to date, no clinical application has been performed. FETAL HEPATOCYTES/FETAL LIVER PROGENITOR CELLS/FETAL STEM CELLS Fetal human hepatocytes exhibit unique properties, including the capacity for extensive proliferation and excellent recovery following partial liver resection [124]. However, experimental studies have predominantly focused on transplantation of fetal hepatic progenitor cells. Oertel et al [125] purified hepatic stem/progenitor cells from fetal livers that are fully capable of repopulating the normal adult liver. This represents a major advance toward developing 6763 October 28, 2013 Volume 19 Issue 40

76 Esrefoglu M. Stem cells on liver regeneration protocols that will be essential for clinical application of liver cell transplantation therapy. Experimental results After transplantation of mouse fetal liver progenitor cells into 14 to 20 d-old upa-mice with subacute liver failure, donor-derived regeneration nodules were detectable. Fetal liver cells showed a mature hepatic phenotype, as established by gene expression profiling and a functional integration within in the first 4 wk after transplantation [126]. Transplanted rat fetal liver epithelial progenitor cells were able to repopulate a recipient liver subjected to PH, alone or with retrorsine, in syngeneic dipeptidyl peptidase IV (DPPIV) mutant rats [127]. Progenitor cells were able to differentiate into both hepatocytes and bile epithelial cells, unlike mature hepatocytes that are not able to differentiate to bile epithelial cells. Moreover, progenitor cells continued to proliferate for longer than hepatocytes after transplantation. Likewise, Dlk+ hepatic stem/progenitor cells purified from rat midgestational fetal livers were able to extensively repopulate the host liver in syngeneic DPPIV mutant rats subjected to PH alone [125]. In the CCl4 rat model of FHF with 2/3 hepatectomy, fetal liver stem/progenitor cells were found to be effective to repair the damaged liver [89]. Thus, fetal hepatic stem/progenitor cells exhibit potency for reconstitution of the adult liver under a particular set of conditions. Clinical results As far as I know, to date, no clinical application has been performed. EMBRYONIC STEM CELLS Experimental results The first report of hepatic differentiation of mouse embryonic cells was in 2001 by Hamazaki et al [128], who produced an embryoid body from an ES cell and subsequently added fibroblast growth factor, HGF, oncostatin M (OsM) and dexamethasone (Dex) to induce the differentiation of cells exhibiting hepatocyte-like properties. The results of Heo et al [129] are particularly noteworthy, as they report that liver precursor cells induced from ES cells in the absence of exogenous growth factors or feeder cell layers also have the ability to differentiate into biliary epithelial cells. In 2003, Yamamoto et al [130] produced hepatic cells with a high level of liver function by transplanting ES cells into mice livers 24 h after CCl4 intoxication. In terms of ultrastructural analysis, these ES-derived hepatocytes were generally similar to normal hepatocytes. Additionally, no teratoma formation was observed in the transplant recipients. In the study of Hu et al [131], ES-derived hepatocytes could improve the life quality and lengthen the survival time of CCl4-induced FHF. Sprague-Dawley rats with surgically induced liver failure via 90% hepatectomy, receiving ESCs as splenic transplantation, showed 100% survival rate up to 3 mo [132]. Similarly, hepatocytes derived from ES cells in a bioartificial assisted liver device were able to improve survival in rats with liver failure induced by galactosamine after 10 h of extracorporeal liver dialysis [133]. Additionally, embryonic derived hepatocytes, implanted subcutaneously as a bioartificial liver device into mice subjected to 90% hepatectomy, reversed the liver failure [134]. Transplantation of ES cell-derived hepatic cells significantly suppressed the onset of fibrosis in mice [135]. Clinical results Embryonic stem cell studies remain at the preclinical stage because of the risk of teratomas. Despite these successful animal studies, there have been no clinical trials using human ES cells to treat liver diseases in human patients, because utilization of human ES cells raises serious ethical questions in many countries. MESENCHYMAL STEM CELLS Mesenchymal stem cells (MSCs) are an adult stem cells population found in numerous living tissues. It has been reported that among MSCs obtained from bone marrow, adipose tissue, umbilical cord blood and placenta, several hepatocyte-like cells have the ability to differentiate [ ]. Besides, MSCs, immune-privileged cells with low MHC Ⅰ and no MHC Ⅱ expression have low rejection risk and, as such, are a particularly promising source of cells for the treatment of acute and degenerative liver diseases [136]. Chamberlain et al [139] transplanted clonal human MSCs into preimmune fetal sheep by intrahepatic and intraperitoneal routes in their study. The intrahepatic injection of human MSCs was safe and resulted in more efficient generation of hepatocytes throughout the liver parenchyma at days Human MSCs cells accumulated in the injured liver. The injured liver may produce regulatory factors for homing of stem cells to the injury site [135]. Bone marrow-derived mesenchymal stem cells The most important source of MSCs is bone marrow. Experimental results: A recent study by Carvalho et al [140] demonstrated that MSCs injection into the portal vein of mice or rats with liver cirrhosis induced by CCl4 and ethanol did not reduce hepatic fibrosis or promote any improvement in parameters of liver function. However; Oyagi et al [141] demonstrated benefits in transplantation of bone marrow-derived mesenchymal stem cells (BMMCs) cultured with HGF in CCl4-induced rats. Transplantation of the BMMCs into liver-injured rats restored their serum albumin level and significantly suppressed transaminase activity and liver fibrosis. These effects were not seen when the BMMCs were cultured without HGF. Similar results of Fang et al [142] supported the beneficial effects of BMMCs on reducing collagen deposition. Clinical results: Autologous BMMC transplantation to 53 patients with liver failure caused by hepatitis B had fa October 28, 2013 Volume 19 Issue 40

77 Esrefoglu M. Stem cells on liver regeneration vorable short-term efficacy with improved levels total bilirubin, prothrombin time and Model for End-Stage Liver Disease score of patients 2-3 wk after transplantation [143]. Patients who received 120 ml of autologous bone marrow fluid via a hepatic artery showed improved hepatic function in the early period (1-48 wk). Analysis showed no adverse effects from bone marrow administration a long observation period. Additionally, data obtained from eight patients with liver cirrhosis showed that MSCs injection through peripheral or portal vein under ultrasound guidance could be used for the treatment of endstage liver disease with satisfactory tolerability [144]. The study of Amer et al [145] reported the safety and short-term efficacy of autologous bone marrow-derived hepatocytelike cell transplantation in the treatment of patients with end-stage liver cell failure. Comparing hepatic and splenic routes of injection, there was no significant difference, except in the first month. The splenic route was technically easier, although it was associated with a higher incidence of mild complications (fever and transient shivering). Placenta-derived mesenchymal stem cells Another promising source of MSCs is the placenta. Human placental MSCs are free of ethical concerns, are non-invasively accessible, abundant and strongly immunosuppressive [146,147]. Placenta derived MSCs can be differentiated into hepatocyte-like cells in vitro [148]. Experimental results: The experimental study of Cao et al [149] revealed that human placental MSCs could not only differentiate into hepatocyte-like cells in vitro and in vivo, but also could prolong the survival time of pigs with ALF. The survival rate was significantly higher in the transplantation group than in the control group (66.7% vs 0%). Recently, van Poll et al [150] provided evidence that MSC-derived molecules directly inhibit hepatocellular death, enhance liver regeneration and ultimately improve survival in rats undergoing D-galactosamine-induced FHF. Systemic infusion of MSC-conditioned medium resulted in a 90% reduction of apoptotic hepatocellular death and a three-fold increment in the number of proliferating hepatocytes. Moreover, transplanted human placental MSCs ameliorate CCl4- induced liver cirrhosis by their anti-fibrotic effect in a rat model [151]. Mohsin et al [152] reported that pretreated MSCs expressing high levels of albumin, cytokeratin 8, 18, TAT and HNF1α transplanted in the left lateral lobe of mice with liver fibrosis resulted in a significant reduction in the fibrotic area in the liver, concomitant with improved serum levels of bilirubin and alkaline phosphatase. Cao et al [149] compared the effects of transplantation of placental MSCs through the peripheral (jugular) and portal veins; their data suggested that both transplantation routes were safe, with no portal vein thrombosis. However, histological data revealed that transplantation of human placental MSCs via the portal vein reduced liver inflammation, decreased hepatic denaturation and necrosis, and promoted liver regeneration. Clinical results: Despite the several positive results gained from experimental studies, the therapeutic role of MSCs in liver regeneration must be further investigated, as the clinical evidence is still limited. As far as I know, to date, no clinical application has been performed. Adipose tissue-derived mesenchymal stem cells Adipose tissue is a source of MSCs that can be easily isolated, selected and induced into mature, transplantable hepatocytes. The fact that they are easy to procure ex vivo in large numbers makes them an attractive tool for clinical studies in the context of establishing an alternative therapy for liver dysfunction [153]. Adipose tissue-derived MSCs have immunomodulation, differentiation (plasticity), homing, revascularization, anti-apoptotic and tissue regenerating abilities [136]. Experimental results: Transplanted adipose-derived MSCs through tail vein injection were able to differentiate into hepatocytes in BALB/c nude mice with CCl4-induced liver injury, and were able to function like human mature hepatocytes. Adipose-derived MSCs could be differentiated into hepatocytes within 13 d [154]. When approximately 10 5 of adipose-derived human MSCs (0.2 ml of the cell suspension via tail vein) transplanted by injection into mice with liver failure, the ammonia concentration fell to near normal levels within 24 h [153]. Of the various transplantation routes (tail vein, portal vein, and direct liver parenchymal injections), transplantation via the tail vein was found to be the most effective in reducing biochemical parameters in CCl4-induced liver failure in mice [155]. Clinical results: In the study of Zhang et al [156] 30 chronic hepatitis B patients with decompensated livers received umbilical cord-derived MSC transfusion. No significant side effects or complications were observed. Liver function improved and the volume of ascites significantly decreased. Umbilical cord-derived MSC have also been found to be safe and beneficial in the treatment of the patients with acute-on chronic liver failure associated with hepatitis B virus infection. The cell transfusions significantly increased the survival rates in ACLF patients [157]. Bone marrow-derived hematopoietic stem cells In 1999 Petersen et al [42] and in 2000 Lagesaa et al [43] described the contribution of bone marrow-derived stem cells (BMSs) to liver regeneration. Data in the literature increasingly suggest bone marrow as a transplantable source of hepatic progenitors [158,159]. Initial reports of the hepatic potential of HSCs were later shown to have resulted from fusion between transplanted donor cells and resident recipient hepatocytes [48,160]. The authors analyzed sex-mismatched bone marrow and liver transplantations in rats [42], mice [158] and humans [161], and were able to show Y-chromosome-positive hepatocytes as single cells or small clusters in the recipients. Adjusted Y-positive hepatocyte and cholangiocyte engraftment ranged from 4% to 43%, and from 4% to 38%, respectively [160] October 28, 2013 Volume 19 Issue 40

78 Esrefoglu M. Stem cells on liver regeneration Experimental results: Cantz et al [162] have investigated the contribution of intrasplenic bone marrow transplants or in vivo mobilized HSCs to the formation of hepatocytes in normal and injured liver by CCl4. They concluded that there is little or no contribution of BMSs to the regeneration of normal and injured livers in the animal models used. Kanazawa et al [163] also demonstrated that there is little or no contribution of BMCs to the replacement of injured livers (both acute and chronic) in three different models, as follows: CCl4 treatment, albuminurokinase transgenic mouse, hepatitis B transgenic mouse. By contrast, Jang et al [164] reported that transplantation of a population of bone marrow purified stem cells promoted functional improvement in mice with CCl4-induced acute liver injury. Moreover, liver function was restored 2-7 d after transplantation. Fibrosis reduction was also reported in rats with CCl4-induced acute liver injury after bone marrow mononuclear cells transplantation via the portal vein. The general condition of the rats in the treatment group also improved markedly [165]. In the study of Shizhu et al [166] transplanted bone marrow mononuclear cells via tail veins of mice were found to populate the damaged liver around the portal and centrolobular regions, and they appeared to differentiate into albumin-producing hepatocyte-like cells. Animals that received bone marrow mononuclear cells also showed a trend toward improved liver enzymes, as well enhanced survival rates, relative to controls. Clinical results: Although the results of experiments on rodents are conflicting, several clinical trials found that BMSCs were beneficial in the treatment of the patients with liver failure. Autologous BMSCs transplantation via the portal vein, peripheral vein or hepatic artery into patients with cirrhosis, resulted in improvement of liver function tests [ ]. Clinical studies by Lyra et al [172,173] suggested the safety of autologous bone marrow-derived cells through a hepatic artery for chronic liver disease patients. In nine patients with alcohol-related cirrhosis, the reinfusion of CD34+ HSCs into the hepatic artery was well tolerated and beneficial to liver function [174]. However, in the study of Cauto et al [171], one case of dissection of the hepatic artery and one case of Takotsubo syndrome occurred as early complications. A patient developed a cutaneous immunological disorder and another patient developed hepatocellular carcinoma 12 mo after infusion via the hepatic artery. A phase 1 trial using BMSCs injected via the hepatic artery after portal embolization was prematurely terminated when a patient with decompensated cirrhosis died from radio contrast nephropathy and hepatorenal syndrome [175]. A recent case report described the use of autologous unsorted BMSCs as rescue treatment for hepatic failure in a 67-year-old man ineligible for liver transplantation [176]. Apparent rapid improvement in hepatic synthetic function was obtained after the portal venous infusion of the cells. A liver biopsy performed 20 d after cell transplant was reported to show increased hepatocyte replication around necrotic foci. Salama et al [177] reported that near normalization of liver enzymes was observed in 54% of 90 patients with end-stage liver disease received GSF for five days followed by autologous CD34+ and CD133+ stem cell infusion in the portal vein. Similarly, in a phase I clinical trial of five patients with acute on chronic liver failure, administering G-CSF and then reinfusing the CD34+ cells improved liver function in more than 50% of cases during a 60-d follow-up [167]. The patients receiving autologous infusion of mobilized adult bone marrow derived CD34+ cells without G-CSF were monitored for up to 18 mo, which confirmed the safety of the procedure, with beneficial effects lasting around 12 mo [170]. Terai et al [169] implemented a clinical trial on nine patients with decompensated liver cirrhosis. These patients were infused with 5.2 ± autologous bone marrow cells from the peripheral vein. At 24 wk after transplantation, significant improvements were observed. Peripheral and umbilical blood stem cells Stem cells derived from cord blood of human origin exhibit higher plasticity than the respective mouse or rat cells [178]. Like the BMSCs, cell fusion has been implicated as the mechanism by which human cells are seen in the recipient s liver. Some researchers observed cell fusion in most cells [179] and some claim no evidence of cell fusion [180]. Newsome et al [180] demonstrated that human umbilical cord-blood (hucb)-derived cells could differentiate into hepatocytes after transplantation into immunodeficient mice. The percentage of human, compared with mouse, hepatocytes reached an average of 0.011% after 16 wk. Kögler et al [181] reported that these somatic multipotent stem cells could differentiate into hepatocytes after transplantation into a pre-immune fetal sheep model. Human hepatocytes constituted as much as 20% of the liver 11 mo after transplantation [182]. Experimental results: Intraperitoneal administration resulted in a rapid liver engraftment using a model of hepatic damage induced by allyl alcohol in nonobese diabetic-severe combined immunodeficient (NOD/SCID) mice [178]. Hepatocyte-like cells, known as NeoHeps, which are derived from terminally differentiated peripheral blood monocytes, also seem to be very effective in treating experimental ALF in Wistar rats [183]. Clinical results: In a clinical trial, 40 patients with HBVrelated cirrhosis were randomized to receive G-CSF alone or in combination with the reinfusion of peripheral blood monocytes in the hepatic artery. Over a 6-mo follow-up, significant biochemical and clinical improvement was seen in both groups [184]. In a different setting, Gasbarini et al [176]. transplanted peripheral blood stem cells into a single patient with ALF and showed improvement of liver function over 30 d, although the patient eventually succumbed to sepsis October 28, 2013 Volume 19 Issue 40

79 Esrefoglu M. Stem cells on liver regeneration CONCLUSION Although several cell transplantation trials concerning different types of mature or progenitor/stem cells in rodents succeeded in improving liver failure, cell transplantation therapies for human liver disorders are still in the early stages of development. Animal models of small animals may not reproduce the clinical syndrome of LF adequately, and trials in large animal models are required. Also mechanisms concerning transplanted cell engraftment and proliferation in LF need further analysis. Most of these clinical trials have limitations, being performed on small groups of patients, with no controls and using outcome parameters that are easily biased. The current inability to track transplanted or infused cells in human subjects represents a major challenge in further developing and understanding stem cell therapies. Clinical trials should be planned, with the development of standardized protocols for standardized procedures to define the nature of cells, the patients enrolled, the transplantation procedure and pre-treatment of the liver, as well as standard data collection regarding efficacy, and possible side effects. The results of the experiments are promising; therefore, cell transplantation therapies should be the first choice in the treatment of acute or end-stage liver failure in the near future. REFERENCES 1 Wright N, Alison M. The Biology of Epithelial Cell Populations. In: Wright N, Alison M. The Liver. Oxford: Clarendon Press, 1984: Rabes HM. Kinetics of hepatocellular proliferation after partial resection of the liver. Prog Liver Dis 1976; 5: [PMID: ] 3 Fausto N. Liver regeneration. J Hepatol 2000; 32: [PMID: ] 4 Overturf K, al-dhalimy M, Ou CN, Finegold M, Grompe M. Serial transplantation reveals the stem-cell-like regenerative potential of adult mouse hepatocytes. Am J Pathol 1997; 151: [PMID: ] 5 Alison MR, Islam S, Lim S. Stem cells in liver regeneration, fibrosis and cancer: the good, the bad and the ugly. J Pathol 2009; 217: [PMID: DOI: /path.2453] 6 Starzl TE, Fung J, Tzakis A, Todo S, Demetris AJ, Marino IR, Doyle H, Zeevi A, Warty V, Michaels M. Baboon-to-human liver transplantation. Lancet 1993; 341: [PMID: ] 7 Ibrahim S, Chen CL, Wang CC, Wang SH, Lin CC, Liu YW, Yang CH, Yong CC, Concejero A, Cheng YF. Liver regeneration and splenic enlargement in donors after living-donor liver transplantation. World J Surg 2005; 29: [PMID: ] 8 Haga J, Shimazu M, Wakabayashi G, Tanabe M, Kawachi S, Fuchimoto Y, Hoshino K, Morikawa Y, Kitajima M, Kitagawa Y. Liver regeneration in donors and adult recipients after living donor liver transplantation. Liver Transpl 2008; 14: [PMID: DOI: /lt.21622] 9 Demetriou AA, Brown RS, Busuttil RW, Fair J, McGuire BM, Rosenthal P, Am Esch JS, Lerut J, Nyberg SL, Salizzoni M, Fagan EA, de Hemptinne B, Broelsch CE, Muraca M, Salmeron JM, Rabkin JM, Metselaar HJ, Pratt D, De La Mata M, McChesney LP, Everson GT, Lavin PT, Stevens AC, Pitkin Z, Solomon BA. Prospective, randomized, multicenter, controlled trial of a bioartificial liver in treating acute liver failure. Ann Surg 2004; 239: ; discussion [PMID: ] 10 Esrefoglu M. Ozel Histoloji. 1st ed. Malatya: Medipres matbaacilik yayincilik, 2009: Gaudio E, Carpino G, Cardinale V, Franchitto A, Onori P, Alvaro D. New insights into liver stem cells. Dig Liver Dis 2009; 41: [PMID: DOI: / j.dld ] 12 Theise ND, Saxena R, Portmann BC, Thung SN, Yee H, Chiriboga L, Kumar A, Crawford JM. The canals of Hering and hepatic stem cells in humans. Hepatology 1999; 30: [PMID: ] 13 Roskams TA, Theise ND, Balabaud C, Bhagat G, Bhathal PS, Bioulac-Sage P, Brunt EM, Crawford JM, Crosby HA, Desmet V, Finegold MJ, Geller SA, Gouw AS, Hytiroglou P, Knisely AS, Kojiro M, Lefkowitch JH, Nakanuma Y, Olynyk JK, Park YN, Portmann B, Saxena R, Scheuer PJ, Strain AJ, Thung SN, Wanless IR, West AB. Nomenclature of the finer branches of the biliary tree: canals, ductules, and ductular reactions in human livers. Hepatology 2004; 39: [PMID: ] 14 Kakinuma S, Nakauchi H, Watanabe M. Hepatic stem/progenitor cells and stem-cell transplantation for the treatment of liver disease. J Gastroenterol 2009; 44: [PMID: DOI: /s z] 15 Kuwahara R, Kofman AV, Landis CS, Swenson ES, Barendswaard E, Theise ND. The hepatic stem cell niche: identification by label-retaining cell assay. Hepatology 2008; 47: [PMID: DOI: /hep.22218] 16 Bae SH. [Clinical application of stem cells in liver diseases]. Korean J Hepatol 2008; 14: [PMID: DOI: /kjhep ] 17 Sadler TW. Langman s Medical Embryology. 10th ed. Philadelphia: Lippincott Williams and Wilkins, 2006: Saxena R, Theise ND, Crawford JM. Microanatomy of the human liver-exploring the hidden interfaces. Hepatology 1999; 30: [PMID: ] 19 Fausto N, Lemire JM, Shiojiri N. Cell lineages in hepatic development and the identification of progenitor cells in normal and injured liver. Proc Soc Exp Biol Med 1993; 204: [PMID: ] 20 Sells MA, Katyal SL, Shinozuka H, Estes LW, Sell S, Lombardi B. Isolation of oval cells and transitional cells from the livers of rats fed the carcinogen DL-ethionine. J Natl Cancer Inst 1981; 66: [PMID: ] 21 Shiojiri N, Lemire JM, Fausto N. Cell lineages and oval cell progenitors in rat liver development. Cancer Res 1991; 51: [PMID: ] 22 Golding M, Sarraf C, Lalani EN, Alison MR. Reactive biliary epithelium: the product of a pluripotential stem cell compartment? Hum Pathol 1996; 27: [PMID: ] 23 Nomoto M, Uchikosi Y, Kajikazawa N, Tanaka Y, Asakura H. Appearance of hepatocytelike cells in the interlobular bile ducts of human liver in various liver disease states. Hepatology 1992; 16: [PMID: ] 24 Nishikawa Y, Doi Y, Watanabe H, Tokairin T, Omori Y, Su M, Yoshioka T, Enomoto K. Transdifferentiation of mature rat hepatocytes into bile duct-like cells in vitro. Am J Pathol 2005; 166: [PMID: ] 25 Michalopoulos GK. Liver regeneration: alternative epithelial pathways. Int J Biochem Cell Biol 2011; 43: [PMID: DOI: /j.biocel ] 26 Xiao JC, Ruck P, Kaiserling E. Small epithelial cells in extrahepatic biliary atresia: electron microscopic and immunoelectron microscopic findings suggest a close relationship to liver progenitor cells. Histopathology 1999; 35: [PMID: ] 27 Shafritz DA, Oertel M, Menthena A, Nierhoff D, Dabeva MD. Liver stem cells and prospects for liver reconstitution by transplanted cells. Hepatology 2006; 43: S89-S98 [PMID: 6767 October 28, 2013 Volume 19 Issue 40

80 Esrefoglu M. Stem cells on liver regeneration ] 28 Cantz T, Manns MP, Ott M. Stem cells in liver regeneration and therapy. Cell Tissue Res 2008; 331: [PMID: ] 29 Lee JH, Rim HJ, Sell S. Heterogeneity of the oval-cell response in the hamster liver during cholangiocarcinogenesis following Clonorchis sinensis infection and dimethylnitrosamine treatment. J Hepatol 1997; 26: [PMID: ] 30 Faris RA, Konkin T, Halpert G. Liver stem cells: a potential source of hepatocytes for the treatment of human liver disease. Artif Organs 2001; 25: [PMID: ] 31 Paku S, Schnur J, Nagy P, Thorgeirsson SS. Origin and structural evolution of the early proliferating oval cells in rat liver. Am J Pathol 2001; 158: [PMID: ] 32 Germain L, Noël M, Gourdeau H, Marceau N. Promotion of growth and differentiation of rat ductular oval cells in primary culture. Cancer Res 1988; 48: [PMID: ] 33 Thorgeirsson SS. Hepatic stem cells in liver regeneration. FASEB J 1996; 10: [PMID: ] 34 Fujio K, Evarts RP, Hu Z, Marsden ER, Thorgeirsson SS. Expression of stem cell factor and its receptor, c-kit, during liver regeneration from putative stem cells in adult rat. Lab Invest 1994; 70: [PMID: ] 35 Burt AD, MacSween RN. Bile duct proliferation--its true significance? Histopathology 1993; 23: [PMID: ] 36 Bisgaard HC, Nagy P, Ton PT, Hu Z, Thorgeirsson SS. Modulation of keratin 14 and alpha-fetoprotein expression during hepatic oval cell proliferation and liver regeneration. J Cell Physiol 1994; 159: [PMID: ] 37 Crosby HA, Kelly DA, Strain AJ. Human hepatic stem-like cells isolated using c-kit or CD34 can differentiate into biliary epithelium. Gastroenterology 2001; 120: [PMID: ] 38 Omori N, Omori M, Evarts RP, Teramoto T, Miller MJ, Hoang TN, Thorgeirsson SS. Partial cloning of rat CD34 cdna and expression during stem cell-dependent liver regeneration in the adult rat. Hepatology 1997; 26: [PMID: ] 39 Avital I, Inderbitzin D, Aoki T, Tyan DB, Cohen AH, Ferraresso C, Rozga J, Arnaout WS, Demetriou AA. Isolation, characterization, and transplantation of bone marrowderived hepatocyte stem cells. Biochem Biophys Res Commun 2001; 288: [PMID: ] 40 Demetris AJ, Seaberg EC, Wennerberg A, Ionellie J, Michalopoulos G. Ductular reaction after submassive necrosis in humans. Special emphasis on analysis of ductular hepatocytes. Am J Pathol 1996; 149: [PMID: ] 41 Deng H, Wang HF, Gao YB, Jin XL, Xiao JC. Hepatic progenitor cell represents a transitioning cell population between liver epithelium and stroma. Med Hypotheses 2011; 76: [PMID: DOI: /j.mehy ] 42 Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, Boggs SS, Greenberger JS, Goff JP. Bone marrow as a potential source of hepatic oval cells. Science 1999; 284: [PMID: DOI: /science ] 43 Lagasse E, Connors H, Al-Dhalimy M, Reitsma M, Dohse M, Osborne L, Wang X, Finegold M, Weissman IL, Grompe M. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 2000; 6: [PMID: DOI: /81326] 44 Oh SH, Witek RP, Bae SH, Zheng D, Jung Y, Piscaglia AC, Petersen BE. Bone marrow-derived hepatic oval cells differentiate into hepatocytes in 2-acetylaminofluorene/partial hepatectomy-induced liver regeneration. Gastroenterology 2007; 132: [PMID: DOI: / j.gastro ] 45 Fausto N, Campbell JS. The role of hepatocytes and oval cells in liver regeneration and repopulation. Mech Dev 2003; 120: [PMID: DOI: / S (02) ] 46 Mallet VO, Mitchell C, Mezey E, Fabre M, Guidotti JE, Renia L, Coulombel L, Kahn A, Gilgenkrantz H. Bone marrow transplantation in mice leads to a minor population of hepatocytes that can be selectively amplified in vivo. Hepatology 2002; 35: [PMID: DOI: / jhep ] 47 Wang X, Montini E, Al-Dhalimy M, Lagasse E, Finegold M, Grompe M. Kinetics of liver repopulation after bone marrow transplantation. Am J Pathol 2002; 161: [PMID: DOI: /S (10) ] 48 Terada N, Hamazaki T, Oka M, Hoki M, Mastalerz DM, Nakano Y, Meyer EM, Morel L, Petersen BE, Scott EW. Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 2002; 416: [PMID: DOI: /nature730] 49 Wang X, Willenbring H, Akkari Y, Torimaru Y, Foster M, Al-Dhalimy M, Lagasse E, Finegold M, Olson S, Grompe M. Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 2003; 422: [PMID: DOI: /nature01531] 50 Sell S. Heterogeneity and plasticity of hepatocyte lineage cells. Hepatology 2001; 33: [PMID: DOI: /jhep ] 51 Dabeva MD, Laconi E, Oren R, Petkov PM, Hurston E, Shafritz DA. Liver regeneration and alpha-fetoprotein messenger RNA expression in the retrorsine model for hepatocyte transplantation. Cancer Res 1998; 58: [PMID: ] 52 Gordon GJ, Coleman WB, Hixson DC, Grisham JW. Liver regeneration in rats with retrorsine-induced hepatocellular injury proceeds through a novel cellular response. Am J Pathol 2000; 156: [PMID: ] 53 Gordon GJ, Coleman WB, Grisham JW. Temporal analysis of hepatocyte differentiation by small hepatocyte-like progenitor cells during liver regeneration in retrorsine-exposed rats. Am J Pathol 2000; 157: [PMID: ] 54 Best DH, Coleman WB. Treatment with 2-AAF blocks the small hepatocyte-like progenitor cell response in retrorsineexposed rats. J Hepatol 2007; 46: [PMID: ] 55 Vig P, Russo FP, Edwards RJ, Tadrous PJ, Wright NA, Thomas HC, Alison MR, Forbes SJ. The sources of parenchymal regeneration after chronic hepatocellular liver injury in mice. Hepatology 2006; 43: [PMID: ] 56 Soto-Gutierrez A, Navarro-Alvarez N, Yagi H, Yarmush ML. Stem cells for liver repopulation. Curr Opin Organ Transplant 2009; 14: [PMID: DOI: / MOT.0b013e ] 57 Evarts RP, Hu Z, Omori N, Omori M, Marsden ER, Thorgeirsson SS. Precursor-product relationship between oval cells and hepatocytes: comparison between tritiated thymidine and bromodeoxyuridine as tracers. Carcinogenesis 1996; 17: [PMID: ] 58 Evarts RP, Nagy P, Nakatsukasa H, Marsden E, Thorgeirsson SS. In vivo differentiation of rat liver oval cells into hepatocytes. Cancer Res 1989; 49: [PMID: ] 59 Evarts RP, Nagy P, Marsden E, Thorgeirsson SS. A precursor-product relationship exists between oval cells and hepatocytes in rat liver. Carcinogenesis 1987; 8: [PMID: ] 60 Sahin MB, Schwartz RE, Buckley SM, Heremans Y, Chase L, Hu WS, Verfaillie CM. Isolation and characterization of a novel population of progenitor cells from unmanipulated rat liver. Liver Transpl 2008; 14: [PMID: DOI: /lt.21380] 61 Petersen BE, Grossbard B, Hatch H, Pi L, Deng J, Scott EW. Mouse A6-positive hepatic oval cells also express several hematopoietic stem cell markers. Hepatology 2003; 37: [PMID: ] 6768 October 28, 2013 Volume 19 Issue 40

81 Esrefoglu M. Stem cells on liver regeneration 62 Chen Y, Zhou H, Sarver AL, Zeng Y, Roy-Chowdhury J, Steer CJ, Sahin MB. Hepatic differentiation of liver-derived progenitor cells and their characterization by microrna analysis. Liver Transpl 2010; 16: [PMID: DOI: /lt.22111] 63 Suzuki A, Zheng YW, Kaneko S, Onodera M, Fukao K, Nakauchi H, Taniguchi H. Clonal identification and characterization of self-renewing pluripotent stem cells in the developing liver. J Cell Biol 2002; 156: [PMID: ] 64 Castorina S, Luca T, Torrisi A, Privitera G, Panebianco M. Isolation of epithelial cells with hepatobiliary phenotype. Ital J Anat Embryol 2008; 113: [PMID: ] 65 Herrera MB, Bruno S, Buttiglieri S, Tetta C, Gatti S, Deregibus MC, Bussolati B, Camussi G. Isolation and characterization of a stem cell population from adult human liver. Stem Cells 2006; 24: [PMID: ] 66 Schmelzer E, Wauthier E, Reid LM. The phenotypes of pluripotent human hepatic progenitors. Stem Cells 2006; 24: [PMID: ] 67 Schmelzer E, Zhang L, Bruce A, Wauthier E, Ludlow J, Yao HL, Moss N, Melhem A, McClelland R, Turner W, Kulik M, Sherwood S, Tallheden T, Cheng N, Furth ME, Reid LM. Human hepatic stem cells from fetal and postnatal donors. J Exp Med 2007; 204: [PMID: ] 68 Christ B, Brückner S. Rodent animal models for surrogate analysis of cell therapy in acute liver failure. Front Physiol 2012; 3: 78 [PMID: DOI: /fphys ] 69 Liu L, Yannam GR, Nishikawa T, Yamamoto T, Basma H, Ito R, Nagaya M, Dutta-Moscato J, Stolz DB, Duan F, Kaestner KH, Vodovotz Y, Soto-Gutierrez A, Fox IJ. The microenvironment in hepatocyte regeneration and function in rats with advanced cirrhosis. Hepatology 2012; 55: [PMID: DOI: /hep.24815] 70 Sell S. The role of progenitor cells in repair of liver injury and in liver transplantation. Wound Repair Regen 2001; 9: [PMID: ] 71 Michalopoulos GK. Liver regeneration after partial hepatectomy: critical analysis of mechanistic dilemmas. Am J Pathol 2010; 176: 2-13 [PMID: DOI: /ajpath ] 72 Marsden ER, Hu Z, Fujio K, Nakatsukasa H, Thorgeirsson SS, Evarts RP. Expression of acidic fibroblast growth factor in regenerating liver and during hepatic differentiation. Lab Invest 1992; 67: [PMID: ] 73 Webber EM, Godowski PJ, Fausto N. In vivo response of hepatocytes to growth factors requires an initial priming stimulus. Hepatology 1994; 19: [PMID: ] 74 Li WL, Su J, Yao YC, Tao XR, Yan YB, Yu HY, Wang XM, Li JX, Yang YJ, Lau JT, Hu YP. Isolation and characterization of bipotent liver progenitor cells from adult mouse. Stem Cells 2006; 24: [PMID: ] 75 Fausto N, Laird AD, Webber EM. Liver regeneration. 2. Role of growth factors and cytokines in hepatic regeneration. FASEB J 1995; 9: [PMID: ] 76 Fausto N, Riehle KJ. Mechanisms of liver regeneration and their clinical implications. J Hepatobiliary Pancreat Surg 2005; 12: [PMID: ] 77 Webber EM, Bruix J, Pierce RH, Fausto N. Tumor necrosis factor primes hepatocytes for DNA replication in the rat. Hepatology 1998; 28: [PMID: ] 78 Fausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology 2006; 43: S45-S53 [PMID: ] 79 Greenbaum LE, Wells RG. The role of stem cells in liver repair and fibrosis. Int J Biochem Cell Biol 2011; 43: [PMID: ] 80 Ding BS, Nolan DJ, Butler JM, James D, Babazadeh AO, Rosenwaks Z, Mittal V, Kobayashi H, Shido K, Lyden D, Sato TN, Rabbany SY, Rafii S. Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 2010; 468: [PMID: ] 81 Cressman DE, Greenbaum LE, DeAngelis RA, Ciliberto G, Furth EE, Poli V, Taub R. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 1996; 274: [PMID: ] 82 Lemoinne S, Cadoret A, El Mourabit H, Thabut D, Housset C. Origins and functions of liver myofibroblasts. Biochim Biophys Acta 2013; 1832: [PMID: DOI: / j.bbadis] 83 Chen L, Zhang W, Zhou QD, Yang HQ, Liang HF, Zhang BX, Long X, Chen XP. HSCs play a distinct role in different phases of oval cell-mediated liver regeneration. Cell Biochem Funct 2012; 30: [PMID: ] 84 Okano J, Shiota G, Matsumoto K, Yasui S, Kurimasa A, Hisatome I, Steinberg P, Murawaki Y. Hepatocyte growth factor exerts a proliferative effect on oval cells through the PI3K/AKT signaling pathway. Biochem Biophys Res Commun 2003; 309: [PMID: ] 85 Matthews VB, Klinken E, Yeoh GC. Direct effects of interleukin-6 on liver progenitor oval cells in culture. Wound Repair Regen 2004; 12: [PMID: ] 86 Kaplanski C, Pauley CJ, Griffiths TG, Kawabata TT, Ledwith BJ. Differentiation of rat oval cells after activation of peroxisome proliferator-activated receptor alpha43. Cancer Res 2000; 60: [PMID: ] 87 Jakubowski A, Ambrose C, Parr M, Lincecum JM, Wang MZ, Zheng TS, Browning B, Michaelson JS, Baetscher M, Wang B, Bissell DM, Burkly LC. TWEAK induces liver progenitor cell proliferation. J Clin Invest 2005; 115: [PMID: ] 88 Taub R. Liver regeneration: from myth to mechanism. Nat Rev Mol Cell Biol 2004; 5: [PMID: ] 89 Zhang H, Liu Z, Li R, Wang D, Liu W, Li J, Yu H, Zhang F, Dou K. Transplantation of embryonic small hepatocytes induces regeneration of injured liver in adult rat. Transplant Proc 2009; 41: [PMID: DOI: /j.tra nsproceed ] 90 Szidonya J, Farkas T, Pali T. The fatty acid constitution and ordering state of membranes in dominant temperature-sensitive lethal mutation and wild-type Drosophila melanogaster larvae. Biochem Genet 1990; 28: [PMID: DOI: /s ] 91 Zhang W, Tucker-Kellogg L, Narmada BC, Venkatraman L, Chang S, Lu Y, Tan N, White JK, Jia R, Bhowmick SS, Shen S, Dewey CF, Yu H. Cell-delivery therapeutics for liver regeneration. Adv Drug Deliv Rev 2010; 62: [PMID: DOI: /j.addr ] 92 Sgroi A, Serre-Beinier V, Morel P, Bühler L. What clinical alternatives to whole liver transplantation? Current status of artificial devices and hepatocyte transplantation. Transplantation 2009; 87: [PMID: DOI: / TP.0b013e ad3] 93 Weber A, Groyer-Picard MT, Franco D, Dagher I. Hepatocyte transplantation in animal models. Liver Transpl 2009; 15: 7-14 [PMID: DOI: /lt.21670] 94 Allen KJ, Soriano HE. Liver cell transplantation: the road to clinical application. J Lab Clin Med 2001; 138: [PMID: ] 95 Fisher RA, Strom SC. Human hepatocyte transplantation: worldwide results. Transplantation 2006; 82: [PMID: ] 96 Michalopoulos GK, DeFrances MC. Liver regeneration. Science 1997; 276: [PMID: ] 97 Wang N, Wang Z, Sun H, Shi X, Zhang Y, Liu Q. Augmenter of liver regeneration improves therapeutic effect of hepatocyte homotransplantation in acute liver failure rats. Int Immunopharmacol 2013; 15: [PMID: DOI: /j.intimp ] 98 Cai J, Ito M, Nagata H, Westerman KA, Lafleur D, Chowdhury JR, Leboulch P, Fox IJ. Treatment of liver failure in rats with end-stage cirrhosis by transplantation of immortalized 6769 October 28, 2013 Volume 19 Issue 40

82 Esrefoglu M. Stem cells on liver regeneration hepatocytes. Hepatology 2002; 36: [PMID: ] 99 Cai J, Ito M, Westerman KA, Kobayashi N, Leboulch P, Fox IJ. Construction of a non-tumorigenic rat hepatocyte cell line for transplantation: reversal of hepatocyte immortalization by site-specific excision of the SV40 T antigen. J Hepatol 2000; 33: [PMID: ] 100 Rhim JA, Sandgren EP, Palmiter RD, Brinster RL. Complete reconstitution of mouse liver with xenogeneic hepatocytes. Proc Natl Acad Sci USA 1995; 92: [PMID: ] 101 Rhim JA, Sandgren EP, Degen JL, Palmiter RD, Brinster RL. Replacement of diseased mouse liver by hepatic cell transplantation. Science 1994; 263: [PMID: ] 102 Overturf K, Al-Dhalimy M, Finegold M, Grompe M. The repopulation potential of hepatocyte populations differing in size and prior mitotic expansion. Am J Pathol 1999; 155: [PMID: ] 103 Gupta S, Rajvanshi P, Irani AN, Palestro CJ, Bhargava KK. Integration and proliferation of transplanted cells in hepatic parenchyma following D-galactosamine-induced acute injury in F344 rats. J Pathol 2000; 190: [PMID: ] 104 Gupta S, Rajvanshi P, Sokhi R, Slehria S, Yam A, Kerr A, Novikoff PM. Entry and integration of transplanted hepatocytes in rat liver plates occur by disruption of hepatic sinusoidal endothelium. Hepatology 1999; 29: [PMID: ] 105 Makowka L, Rotstein LE, Falk RE, Falk JA, Nossal NA, Langer B, Blendis LM, Phillips MJ. Allogeneic and xenogeneic hepatocyte transplantation in experimental hepatic failure. Transplantation 1980; 30: [PMID: ] 106 Rajvanshi P, Kerr A, Bhargava KK, Burk RD, Gupta S. Studies of liver repopulation using the dipeptidyl peptidase IV-deficient rat and other rodent recipients: cell size and structure relationships regulate capacity for increased transplanted hepatocyte mass in the liver lobule. Hepatology 1996; 23: [PMID: ] 107 Gagandeep S, Rajvanshi P, Sokhi RP, Slehria S, Palestro CJ, Bhargava KK, Gupta S. Transplanted hepatocytes engraft, survive, and proliferate in the liver of rats with carbon tetrachloride-induced cirrhosis. J Pathol 2000; 191: [PMID: ] 108 Kobayashi N, Ito M, Nakamura J, Cai J, Gao C, Hammel JM, Fox IJ. Hepatocyte transplantation in rats with decompensated cirrhosis. Hepatology 2000; 31: [PMID: ] 109 Arkadopoulos N, Chen SC, Khalili TM, Detry O, Hewitt WR, Lilja H, Kamachi H, Petrovic L, Mullon CJ, Demetriou AA, Rozga J. Transplantation of hepatocytes for prevention of intracranial hypertension in pigs with ischemic liver failure. Cell Transplant 1998; 7: [PMID: ] 110 Kobayashi N, Fujiwara T, Westerman KA, Inoue Y, Sakaguchi M, Noguchi H, Miyazaki M, Cai J, Tanaka N, Fox IJ, Leboulch P. Prevention of acute liver failure in rats with reversibly immortalized human hepatocytes. Science 2000; 287: [PMID: ] 111 Schumacher IK, Okamoto T, Kim BH, Chowdhury NR, Chowdhury JR, Fox IJ. Transplantation of conditionally immortalized hepatocytes to treat hepatic encephalopathy. Hepatology 1996; 24: [PMID: ] 112 Mito M, Kusano M, Kawaura Y. Hepatocyte transplantation in man. Transplant Proc 1992; 24: [PMID: ] 113 Strom SC, Fisher RA, Thompson MT, Sanyal AJ, Cole PE, Ham JM, Posner MP. Hepatocyte transplantation as a bridge to orthotopic liver transplantation in terminal liver failure. Transplantation 1997; 63: [PMID: ] 114 Habibullah CM, Syed IH, Qamar A, Taher-Uz Z. Human fetal hepatocyte transplantation in patients with fulminant hepatic failure. Transplantation 1994; 58: [PMID: ] 115 Bilir BM, Guinette D, Karrer F, Kumpe DA, Krysl J, Stephens J, McGavran L, Ostrowska A, Durham J. Hepatocyte transplantation in acute liver failure. Liver Transpl 2000; 6: [PMID: ] 116 Schneider A, Attaran M, Meier PN, Strassburg C, Manns MP, Ott M, Barthold M, Arseniev L, Becker T, Panning B. Hepatocyte transplantation in an acute liver failure due to mushroom poisoning. Transplantation 2006; 82: [PMID: ] 117 Yovchev MI, Grozdanov PN, Joseph B, Gupta S, Dabeva MD. Novel hepatic progenitor cell surface markers in the adult rat liver. Hepatology 2007; 45: [PMID: ] 118 Weiss TS, Lichtenauer M, Kirchner S, Stock P, Aurich H, Christ B, Brockhoff G, Kunz-Schughart LA, Jauch KW, Schlitt HJ, Thasler WE. Hepatic progenitor cells from adult human livers for cell transplantation. Gut 2008; 57: [PMID: DOI: /gut ] 119 Roskams T. Different types of liver progenitor cells and their niches. J Hepatol 2006; 45: 1-4 [PMID: ] 120 Petersen BE, Zajac VF, Michalopoulos GK. Hepatic oval cell activation in response to injury following chemically induced periportal or pericentral damage in rats. Hepatology 1998; 27: [PMID: ] 121 Chiu CC, Huang GT, Chou SH, Chien CT, Chiou LL, Chang MH, Lee HS, Chen DS. Characterization of cytokeratin 19-positive hepatocyte foci in the regenerating rat liver after 2-AAF/CCl4 injury. Histochem Cell Biol 2007; 128: [PMID: ] 122 Wu CX, Zou Q, Zhu ZY, Gao YT, Wang YJ. Intrahepatic transplantation of hepatic oval cells for fulminant hepatic failure in rats. World J Gastroenterol 2009; 15: [PMID: ] 123 Wang X, Foster M, Al-Dhalimy M, Lagasse E, Finegold M, Grompe M. The origin and liver repopulating capacity of murine oval cells. Proc Natl Acad Sci USA 2003; 100 Suppl 1: [PMID: ] 124 Elchaninov AV, Bolshakova GB. Dynamics of hepatocyte proliferation in regenerating fetal rat liver. Bull Exp Biol Med 2011; 151: [PMID: ] 125 Oertel M, Menthena A, Chen YQ, Teisner B, Jensen CH, Shafritz DA. Purification of fetal liver stem/progenitor cells containing all the repopulation potential for normal adult rat liver. Gastroenterology 2008; 134: [PMID: DOI: /j.gastro ] 126 Cantz T, Zuckerman DM, Burda MR, Dandri M, Göricke B, Thalhammer S, Heckl WM, Manns MP, Petersen J, Ott M. Quantitative gene expression analysis reveals transition of fetal liver progenitor cells to mature hepatocytes after transplantation in upa/rag-2 mice. Am J Pathol 2003; 162: [PMID: ] 127 Sandhu JS, Petkov PM, Dabeva MD, Shafritz DA. Stem cell properties and repopulation of the rat liver by fetal liver epithelial progenitor cells. Am J Pathol 2001; 159: [PMID: ] 128 Hamazaki T, Iiboshi Y, Oka M, Papst PJ, Meacham AM, Zon LI, Terada N. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett 2001; 497: [PMID: ] 129 Heo J, Factor VM, Uren T, Takahama Y, Lee JS, Major M, Feinstone SM, Thorgeirsson SS. Hepatic precursors derived from murine embryonic stem cells contribute to regeneration of injured liver. Hepatology 2006; 44: [PMID: ] 130 Yamamoto H, Quinn G, Asari A, Yamanokuchi H, Teratani T, Terada M, Ochiya T. Differentiation of embryonic stem cells into hepatocytes: biological functions and therapeutic application. Hepatology 2003; 37: [PMID: ] 131 Hu AB, He XS, Zheng QC, Cai JY. [Curative effects of transplantation of hepatocytes differentiated from embryonic stem cells on treatment of fulminant hepatic failure: experiment with mice]. Zhonghua Yi Xue Zazhi 2006; 86: [PMID: ] 132 Tabei I, Hashimoto H, Ishiwata I, Tachibana T, Akahori M, 6770 October 28, 2013 Volume 19 Issue 40

83 Esrefoglu M. Stem cells on liver regeneration Ohi S, Kubo H, Satou K, Yamazaki Y, Yanaga K, Ishikawa H. Characteristics of hepatocytes derived from early ES cells and treatment of surgically induced liver failure rats by transplantation. Transplant Proc 2005; 37: [PMID: ] 133 Cho CH, Parashurama N, Park EY, Suganuma K, Nahmias Y, Park J, Tilles AW, Berthiaume F, Yarmush ML. Homogeneous differentiation of hepatocyte-like cells from embryonic stem cells: applications for the treatment of liver failure. FASEB J 2008; 22: [PMID: ] 134 Soto-Gutiérrez A, Kobayashi N, Rivas-Carrillo JD, Navarro- Alvarez N, Zhao D, Okitsu T, Noguchi H, Basma H, Tabata Y, Chen Y, Tanaka K, Narushima M, Miki A, Ueda T, Jun HS, Yoon JW, Lebkowski J, Tanaka N, Fox IJ. Reversal of mouse hepatic failure using an implanted liver-assist device containing ES cell-derived hepatocytes. Nat Biotechnol 2006; 24: [PMID: ] 135 Teratani T, Yamamoto H, Aoyagi K, Sasaki H, Asari A, Quinn G, Sasaki H, Terada M, Ochiya T. Direct hepatic fate specification from mouse embryonic stem cells. Hepatology 2005; 41: [PMID: ] 136 Ochiya T, Yamamoto Y, Banas A. Commitment of stem cells into functional hepatocytes. Differentiation 2010; 79: [PMID: ] 137 Seo MJ, Suh SY, Bae YC, Jung JS. Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo. Biochem Biophys Res Commun 2005; 328: [PMID: ] 138 Hong SH, Gang EJ, Jeong JA, Ahn C, Hwang SH, Yang IH, Park HK, Han H, Kim H. In vitro differentiation of human umbilical cord blood-derived mesenchymal stem cells into hepatocyte-like cells. Biochem Biophys Res Commun 2005; 330: [PMID: ] 139 Chamberlain J, Yamagami T, Colletti E, Theise ND, Desai J, Frias A, Pixley J, Zanjani ED, Porada CD, Almeida-Porada G. Efficient generation of human hepatocytes by the intrahepatic delivery of clonal human mesenchymal stem cells in fetal sheep. Hepatology 2007; 46: [PMID: ] 140 Carvalho AB, Quintanilha LF, Dias JV, Paredes BD, Mannheimer EG, Carvalho FG, Asensi KD, Gutfilen B, Fonseca LM, Resende CM, Rezende GF, Takiya CM, de Carvalho AC, Goldenberg RC. Bone marrow multipotent mesenchymal stromal cells do not reduce fibrosis or improve function in a rat model of severe chronic liver injury. Stem Cells 2008; 26: [PMID: DOI: / stemcells ] 141 Oyagi S, Hirose M, Kojima M, Okuyama M, Kawase M, Nakamura T, Ohgushi H, Yagi K. Therapeutic effect of transplanting HGF-treated bone marrow mesenchymal cells into CCl4-injured rats. J Hepatol 2006; 44: [PMID: ] 142 Fang B, Shi M, Liao L, Yang S, Liu Y, Zhao RC. Systemic infusion of FLK1(+) mesenchymal stem cells ameliorate carbon tetrachloride-induced liver fibrosis in mice. Transplantation 2004; 78: [PMID: ] 143 Peng L, Xie DY, Lin BL, Liu J, Zhu HP, Xie C, Zheng YB, Gao ZL. Autologous bone marrow mesenchymal stem cell transplantation in liver failure patients caused by hepatitis B: short-term and long-term outcomes. Hepatology 2011; 54: [PMID: DOI: /hep.24434] 144 Kharaziha P, Hellström PM, Noorinayer B, Farzaneh F, Aghajani K, Jafari F, Telkabadi M, Atashi A, Honardoost M, Zali MR, Soleimani M. Improvement of liver function in liver cirrhosis patients after autologous mesenchymal stem cell injection: a phase I-II clinical trial. Eur J Gastroenterol Hepatol 2009; 21: [PMID: DOI: / MEG.0b013e32832a1f6c] 145 Amer ME, El-Sayed SZ, El-Kheir WA, Gabr H, Gomaa AA, El-Noomani N, Hegazy M. Clinical and laboratory evaluation of patients with end-stage liver cell failure injected with bone marrow-derived hepatocyte-like cells. Eur J Gastroenterol Hepatol 2011; 23: [PMID: DOI: / MEG.0b013e b00] 146 Wulf GG, Viereck V, Hemmerlein B, Haase D, Vehmeyer K, Pukrop T, Glass B, Emons G, Trümper L. Mesengenic progenitor cells derived from human placenta. Tissue Eng 2004; 10: [PMID: ] 147 Semenov OV, Koestenbauer S, Riegel M, Zech N, Zimmermann R, Zisch AH, Malek A. Multipotent mesenchymal stem cells from human placenta: critical parameters for isolation and maintenance of stemness after isolation. Am J Obstet Gynecol 2010; 202: 193.e1-193.e13 [PMID: DOI: /j.ajog ] 148 Chien CC, Yen BL, Lee FK, Lai TH, Chen YC, Chan SH, Huang HI. In vitro differentiation of human placenta-derived multipotent cells into hepatocyte-like cells. Stem Cells 2006; 24: [PMID: ] 149 Cao H, Yang J, Yu J, Pan Q, Li J, Zhou P, Li Y, Pan X, Li J, Wang Y, Li L. Therapeutic potential of transplanted placental mesenchymal stem cells in treating Chinese miniature pigs with acute liver failure. BMC Med 2012; 10: 56 [PMID: DOI: / ] 150 van Poll D, Parekkadan B, Cho CH, Berthiaume F, Nahmias Y, Tilles AW, Yarmush ML. Mesenchymal stem cell-derived molecules directly modulate hepatocellular death and regeneration in vitro and in vivo. Hepatology 2008; 47: [PMID: DOI: /hep.22236] 151 Lee MJ, Jung J, Na KH, Moon JS, Lee HJ, Kim JH, Kim GI, Kwon SW, Hwang SG, Kim GJ. Anti-fibrotic effect of chorionic plate-derived mesenchymal stem cells isolated from human placenta in a rat model of CCl(4)-injured liver: potential application to the treatment of hepatic diseases. J Cell Biochem 2010; 111: [PMID: DOI: / jcb.22873] 152 Mohsin S, Shams S, Ali Nasir G, Khan M, Javaid Awan S, Khan SN, Riazuddin S. Enhanced hepatic differentiation of mesenchymal stem cells after pretreatment with injured liver tissue. Differentiation 2011; 81: [PMID: ] 153 Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Quinn G, Okochi H, Ochiya T. Adipose tissue-derived mesenchymal stem cells as a source of human hepatocytes. Hepatology 2007; 46: [PMID: ] 154 Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kato T, Okochi H, Ochiya T. Rapid hepatic fate specification of adipose-derived stem cells and their therapeutic potential for liver failure. J Gastroenterol Hepatol 2009; 24: [PMID: DOI: / j x] 155 Kim SJ, Park KC, Lee JU, Kim KJ, Kim DG. Therapeutic potential of adipose tissue-derived stem cells for liver failure according to the transplantation routes. J Korean Surg Soc 2011; 81: [PMID: DOI: / jkss ] 156 Zhang Z, Lin H, Shi M, Xu R, Fu J, Lv J, Chen L, Lv S, Li Y, Yu S, Geng H, Jin L, Lau GK, Wang FS. Human umbilical cord mesenchymal stem cells improve liver function and ascites in decompensated liver cirrhosis patients. J Gastroenterol Hepatol 2012; 27 Suppl 2: [PMID: DOI: /j x] 157 Shi M, Zhang Z, Xu R, Lin H, Fu J, Zou Z, Zhang A, Shi J, Chen L, Lv S, He W, Geng H, Jin L, Liu Z, Wang FS. Human mesenchymal stem cell transfusion is safe and improves liver function in acute-on-chronic liver failure patients. Stem Cells Transl Med 2012; 1: [PMID: DOI: /sctm ] 158 Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford JM, Krause DS. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 2000; 31: [PMID: ] 159 Alison MR, Poulsom R, Jeffery R, Dhillon AP, Quaglia A, 6771 October 28, 2013 Volume 19 Issue 40

84 Esrefoglu M. Stem cells on liver regeneration Jacob J, Novelli M, Prentice G, Williamson J, Wright NA. Hepatocytes from non-hepatic adult stem cells. Nature 2000; 406: 257 [PMID: DOI: / ] 160 Quintana-Bustamante O, Alvarez-Barrientos A, Kofman AV, Fabregat I, Bueren JA, Theise ND, Segovia JC. Hematopoietic mobilization in mice increases the presence of bone marrow-derived hepatocytes via in vivo cell fusion. Hepatology 2006; 43: [PMID: DOI: / hep.21005] 161 Theise ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, Henegariu O, Krause DS. Liver from bone marrow in humans. Hepatology 2000; 32: [PMID: DOI: /jhep ] 162 Cantz T, Sharma AD, Jochheim-Richter A, Arseniev L, Klein C, Manns MP, Ott M. Reevaluation of bone marrow-derived cells as a source for hepatocyte regeneration. Cell Transplant 2004; 13: [PMID: DOI: / ] 163 Kanazawa Y, Verma IM. Little evidence of bone marrowderived hepatocytes in the replacement of injured liver. Proc Natl Acad Sci USA 2003; 100 Suppl 1: [PMID: DOI: /pnas ] 164 Jang YY, Collector MI, Baylin SB, Diehl AM, Sharkis SJ. Hematopoietic stem cells convert into liver cells within days without fusion. Nat Cell Biol 2004; 6: [PMID: DOI: /ncb1132] 165 Cao BQ, Lin JZ, Zhong YS, Huang SB, Lin N, Tang ZF, Chen R, Xiang P, Xu RY. Contribution of mononuclear bone marrow cells to carbon tetrachloride-induced liver fibrosis in rats. World J Gastroenterol 2007; 13: ; discussion ; [PMID: ] 166 Shizhu J, Xiangwei M, Xun S, Mingzi H, Bingrong L, Dexia K, Xinghong W, Fenghua P. Bone marrow mononuclear cell transplant therapy in mice with CCl4-induced acute liver failure. Turk J Gastroenterol 2012; 23: [PMID: ] 167 Gordon MY, Levicar N, Pai M, Bachellier P, Dimarakis I, Al- Allaf F, M Hamdi H, Thalji T, Welsh JP, Marley SB, Davies J, Dazzi F, Marelli-Berg F, Tait P, Playford R, Jiao L, Jensen S, Nicholls JP, Ayav A, Nohandani M, Farzaneh F, Gaken J, Dodge R, Alison M, Apperley JF, Lechler R, Habib NA. Characterization and clinical application of human CD34+ stem/progenitor cell populations mobilized into the blood by granulocyte colony-stimulating factor. Stem Cells 2006; 24: [PMID: DOI: /j.bpg ] 168 Salama H, Zekri AR, Zern M, Bahnassy A, Loutfy S, Shalaby S, Vigen C, Burke W, Mostafa M, Medhat E, Alfi O, Huttinger E. Autologous hematopoietic stem cell transplantation in 48 patients with end-stage chronic liver diseases. Cell Transplant 2010; 19: [PMID: DOI: / X514314] 169 Terai S, Ishikawa T, Omori K, Aoyama K, Marumoto Y, Urata Y, Yokoyama Y, Uchida K, Yamasaki T, Fujii Y, Okita K, Sakaida I. Improved liver function in patients with liver cirrhosis after autologous bone marrow cell infusion therapy. Stem Cells 2006; 24: [PMID: ] 170 Levicar N, Pai M, Habib NA, Tait P, Jiao LR, Marley SB, Davis J, Dazzi F, Smadja C, Jensen SL, Nicholls JP, Apperley JF, Gordon MY. Long-term clinical results of autologous infusion of mobilized adult bone marrow derived CD34+ cells in patients with chronic liver disease. Cell Prolif 2008; 41 Suppl 1: [PMID: ] 171 Couto BG, Goldenberg RC, da Fonseca LM, Thomas J, Gutfilen B, Resende CM, Azevedo F, Mercante DR, Torres AL, Coelho HS, Maiolino A, Alves AL, Dias JV, Moreira MC, Sampaio AL, Sousa MA, Kasai-Brunswick TH, Souza SA, Campos-de-Carvalho AC, Rezende GF. Bone marrow mononuclear cell therapy for patients with cirrhosis: a Phase 1 study. Liver Int 2011; 31: [PMID: DOI: /j x] 172 Lyra AC, Soares MB, da Silva LF, Fortes MF, Silva AG, Mota AC, Oliveira SA, Braga EL, de Carvalho WA, Genser B, dos Santos RR, Lyra LG. Feasibility and safety of autologous bone marrow mononuclear cell transplantation in patients with advanced chronic liver disease. World J Gastroenterol 2007; 13: [PMID: ] 173 Lyra AC, Soares MB, da Silva LF, Braga EL, Oliveira SA, Fortes MF, Silva AG, Brustolim D, Genser B, Dos Santos RR, Lyra LG. Infusion of autologous bone marrow mononuclear cells through hepatic artery results in a short-term improvement of liver function in patients with chronic liver disease: a pilot randomized controlled study. Eur J Gastroenterol Hepatol 2010; 22: [PMID: DOI: / MEG.0b013e32832eb69a] 174 Pai M, Zacharoulis D, Milicevic MN, Helmy S, Jiao LR, Levicar N, Tait P, Scott M, Marley SB, Jestice K, Glibetic M, Bansi D, Khan SA, Kyriakou D, Rountas C, Thillainayagam A, Nicholls JP, Jensen S, Apperley JF, Gordon MY, Habib NA. Autologous infusion of expanded mobilized adult bone marrow-derived CD34+ cells into patients with alcoholic liver cirrhosis. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 175 Mohamadnejad M, Namiri M, Bagheri M, Hashemi SM, Ghanaati H, Zare Mehrjardi N, Kazemi Ashtiani S, Malekzadeh R, Baharvand H. Phase 1 human trial of autologous bone marrow-hematopoietic stem cell transplantation in patients with decompensated cirrhosis. World J Gastroenterol 2007; 13: [PMID: ] 176 Gasbarrini A, Rapaccini GL, Rutella S, Zocco MA, Tittoto P, Leone G, Pola P, Gasbarrini G, Di Campli C. Rescue therapy by portal infusion of autologous stem cells in a case of druginduced hepatitis. Dig Liver Dis 2007; 39: [PMID: DOI: /j.dld ] 177 Salama H, Zekri AR, Bahnassy AA, Medhat E, Halim HA, Ahmed OS, Mohamed G, Al Alim SA, Sherif GM. Autologous CD34+ and CD133+ stem cells transplantation in patients with end stage liver disease. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg.v16. i ] 178 Di Campli C, Piscaglia AC, Pierelli L, Rutella S, Bonanno G, Alison MR, Mariotti A, Vecchio FM, Nestola M, Monego G, Michetti F, Mancuso S, Pola P, Leone G, Gasbarrini G, Gasbarrini A. A human umbilical cord stem cell rescue therapy in a murine model of toxic liver injury. Dig Liver Dis 2004; 36: [PMID: DOI: /j.dld ] 179 Fujino H, Hiramatsu H, Tsuchiya A, Niwa A, Noma H, Shiota M, Umeda K, Yoshimoto M, Ito M, Heike T, Nakahata T. Human cord blood CD34+ cells develop into hepatocytes in the livers of NOD/SCID/gamma(c)null mice through cell fusion. FASEB J 2007; 21: [PMID: DOI: /fj com] 180 Newsome PN, Johannessen I, Boyle S, Dalakas E, McAulay KA, Samuel K, Rae F, Forrester L, Turner ML, Hayes PC, Harrison DJ, Bickmore WA, Plevris JN. Human cord blood-derived cells can differentiate into hepatocytes in the mouse liver with no evidence of cellular fusion. Gastroenterology 2003; 124: [PMID: DOI: / S (03) ] 181 Kögler G, Sensken S, Airey JA, Trapp T, Müschen M, Feldhahn N, Liedtke S, Sorg RV, Fischer J, Rosenbaum C, Greschat S, Knipper A, Bender J, Degistirici O, Gao J, Caplan AI, Colletti EJ, Almeida-Porada G, Müller HW, Zanjani E, Wernet P. A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiation potential. J Exp Med 2004; 200: [PMID: DOI: / jem ] 182 Almeida-Porada G, Porada CD, Chamberlain J, Torabi A, Zanjani ED. Formation of human hepatocytes by human hematopoietic stem cells in sheep. Blood 2004; 104: [PMID: DOI: /blood ] 6772 October 28, 2013 Volume 19 Issue 40

85 Esrefoglu M. Stem cells on liver regeneration 183 Glanemann M, Gaebelein G, Nussler N, Hao L, Kronbach Z, Shi B, Neuhaus P, Nussler AK. Transplantation of monocytederived hepatocyte-like cells (NeoHeps) improves survival in a model of acute liver failure. Ann Surg 2009; 249: [PMID: DOI: /SLA.0b013e31818a1543] 184 Han Y, Yan L, Han G, Zhou X, Hong L, Yin Z, Zhang X, Wang S, Wang J, Sun A, Liu Z, Xie H, Wu K, Ding J, Fan D. Controlled trials in hepatitis B virus-related decompensate liver cirrhosis: peripheral blood monocyte transplant versus granulocyte-colony-stimulating factor mobilization therapy. Cytotherapy 2008; 10: [PMID: DOI: / ] P- Reviewers Asahina K, Qin JM, Yagi K S- Editor Zhai HH L- Editor Stewart GJ E- Editor Zhang DN 6773 October 28, 2013 Volume 19 Issue 40

86 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Risk of ileal pouch neoplasms in patients with familial adenomatous polyposis Masahiro Tajika, Yasumasa Niwa, Vikram Bhatia, Tsutomu Tanaka, Makoto Ishihara, Kenji Yamao Masahiro Tajika, Yasumasa Niwa, Tsutomu Tanaka, Makoto Ishihara, Department of Endoscopy, Aichi Cancer Center Hospital, Nagoya , Japan Vikram Bhatia, Department of Medical Hepatology, Institute of Liver and Biliary Sciences, New Delhi , India Kenji Yamao, Department of Gastroenterology, Aichi Cancer Center Hospital, Nagoya , Japan Author contributions: Tajika M contributed to study conception and design, analysis and interpretation of the data, and drafting of the article; Niwa Y and Yamao K contributed to critical revision of the article for important intellectual content and final approval of the article; Bhatia V contributed to critical revision of the article and drafting of the article; Tanaka T and Ishihara M collected and interpreted the data. Correspondence to: Masahiro Tajika, MD, PhD, Department of Endoscopy, Aichi Cancer Center Hospital, 1-1 Kanokoden, Chikusa-ku, Nagoya , Japan. mtajika@aichi-cc.jp Telephone: Fax: Received: June 26, 2013 Revised: August 14, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 Abstract Restorative proctocolectomy is the most common surgical option for patients with familial adenomatous polyposis (FAP). However, adenomas may develop in the ileal pouch mucosa over time, and even carcinoma in the pouch has been reported. We therefore reviewed the prevalence, nature, and treatment of adenomas and carcinoma that develop after proctocolectomy in the ileal pouch mucosa in patients with FAP. In 25 reports that were reviewed, the incidence of adenomas in the ileal pouch varied from 6.7% to 73.9%. Several potential factors that favor the development of pouch polyposis have been investigated, but many remain controversial. Nevertheless, it seems certain that the age of the pouch is important. The risk appears to be 7% to 16% after 5 years, 35% to 42% after 10 years, and 75% after 15 years. On the other hand, only 21 cases of ileal pouch carcinoma have been recorded in the literature to date. The diagnosis of pouch carcinoma was made between 3 to 20 years (median, 10 years) after pouch construction. Although the risk of malignant transformation in ileal pouches is probably low, it is not negligible, and the long-term risk cannot presently be well quantified. Regular endoscopic surveillance, especially using chromoendoscopy, is recommended Baishideng. All rights reserved. Key words: Familial adenomatous polyposis; Restorative proctocolectomy; Ileal pouch; Ileal pouch-anal anastomosis; Ileo-rectal anastomosis; Adenoma; Adenocarcinoma; Pouch polyp; Pouch neoplasm Core tip: To eliminate the risk of colorectal cancer, the majority of patients with familial adenomatous polyposis (FAP) are treated with restorative proctocolectomy and an ileal pouch-anal anastomosis. However, as these patients are followed-up for longer intervals, it has gradually become recognized that adenomas and adenocarcinomas may develop in the ileal pouch. If the standard-of-care surgery for FAP patients does not eliminate all cancer risk, surgical and follow-up strategies may need to be altered. In this review, we summarize the data from the published English literature regarding the incidence of adenomas and carcinomas in the ileal pouch after proctocolectomy in FAP patients. Tajika M, Niwa Y, Bhatia V, Tanaka T, Ishihara M, Yamao K. Risk of ileal pouch neoplasms in patients with familial adenomatous polyposis. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6774.htm DOI: i INTRODUCTION Familial adenomatous polyposis (FAP) is an inherited, autosomal-dominant disease caused by a germline muta October 28, 2013 Volume 19 Issue 40

87 Tajika M et al. Ileal pouch neoplasms in FAP patients tion of the adenomatous polyposis coli gene (APC) [1]. The phenotype is characterized by the development of hundreds of colorectal adenomas, leading to a 100% lifetime risk of colorectal cancer [2]. For this reason, a prophylactic colectomy is recommended for patients with FAP to prevent the development of colorectal cancer. The main surgical strategy in patients with FAP is restorative proctocolectomy with ileal pouch-anal anastomosis (IPAA) [3-6]. As originally described by Parks et al [7], IPAA included an anal mucosectomy to eliminate the risk of malignancy in the remaining anorectal mucosa. However, many surgeons now prefer to preserve the anal transition zone (ATZ) during the double-stapled IPAA technique because of its simplicity and better functional outcome [8-10]. The trade-off is a risk of neoplasia developing in the retained ATZ mucosa [8], with a 10%-15% incidence of adenoma [8,11-13]. Another widely accepted surgical procedure is colectomy with ileorectal anastomosis (IRA), performed when there are few polyps in the rectum. The major advantage of IRA is preservation of the rectal innervation, with subsequent better quality of life. However, continuing endoscopic surveillance for adenomas in the rectum is necessary, and there is a 13%-25% cumulative risk of rectal cancer after years despite surveillance [14-16]. On the other hand, it has been thought that IPAA theoretically eliminates the risk of colorectal cancer and adenomas, and perhaps the need for further lower gastrointestinal surveillance. However, there are recent reports of adenomas or carcinomas developing not only in the residual rectal mucosa or anastomosis after IRA, but also in the ileal pouch mucosa after IPAA [17-39]. In addition, there are several reports of cancers arising from the ileal pouch mucosa, as opposed to the anastomotic site, in patients with FAP [31,36,37,40-47]. The aim of this review is to describe the prevalence, nature, and treatment of adenomas and carcinoma developing in the ileal pouch mucosa after proctocolectomy in patients with FAP. INCIDENCE OF ILEAL POUCH ADENOMAS The basic premise underlying the popularity of IPAA in patients with FAP is that it results in a significantly lower risk of rectal cancer than IRA. Although this is likely to be true, the risk of pouch polyposis and pouch cancer has not been recognized so far. After the advent of pouch surgery, several reports of adenomatous polyps in the pouches of FAP patients have appeared in the literature. In 1982, Beart et al [17] first described a FAP patient with continent ileostomy, in whom a large sessile tubulovillous adenoma and multiple smaller adenomatous polyps developed. Since then, there have been at least 25 reports of ileal pouch adenomas developing in these patients (Table 1). We reviewed only those studies that clearly described adenomas appearing within the ileal pouch mucosa. These included 8 case reports, 7 retrospective studies, and 10 prospective studies. The incidence of adenomas in the ileal pouch varied from 6.7% to 73.9%. This variation in the prevalence of ileal pouch adenomatosis could be due to differences in the way endoscopy was performed in the various studies. Adequacy of bowel preparation, type of instrument employed, use of chromoendoscopy, and other miscellaneous factors influence the detection rates of pouch polyps. Good bowel preparation and a flexible video colonoscope are essential in identifying pouch polyps because most ileal adenomas are flat or sessile, measuring only 1 mm to 3 mm in diameter, and having a morphology different from large bowel adenomas [36]. Therefore, a careful examination of the entire pouch, anal canal, and pouch-anal anastomosis should be performed. Although Polese et al [25] reported the prevalence of ileal pouch adenomas as 6.7%, these investigators used a rigid sigmoidoscope with enema preparation, without chromoendoscopy. These technical factors may explain the low prevalence of ileal pouch adenomas in the study by Polese et al. The only meaningful estimates of adenoma incidence have come from prospective studies, with all 10 prospective studies showing that the incidence of pouch adenomas increases with the follow-up duration [4,21,22,24,28,29,31,32,35,36]. The risk appears to be 7% to 16% after 5 years, 35% to 42% after 10 years, and 75% after 15 years. The great majority of pouch polyps described in the literature are small, tubular adenomas with mild atypia. The incidence of adenoma with advanced pathology (size > 1 cm, villous pattern, or moderate-to-severe dysplasia) is less. According to Banasiewicz et al [35], the estimated frequency of low-grade dysplasia 4 years after IPAA surgery is 4%, and increases to 50% after 15 years. The same percentage of patients, but with high-grade dysplasia, develop high-grade dysplasia 2.5 years later, that is to say, 17.5 years after IPAA, and with neoplasia 18.5 years after the above procedure. The full impact of pouch polyposis will not be fully understood until most pouch patients reach a follow-up duration of 20 to 40 years [48]. RISK FACTORS FOR DEVELOPMENT OF ADENOMAS IN THE ILEAL POUCH Phenotype At present it does not seem possible to predict who is at risk for developing polyps in the pouch. Some studies show that there is no apparent high-risk phenotype for the development of ileal polyps [22,24,30,33]. However, other studies describe risk factors that favor the development of pouch polyposis. Parc et al [49] observed that patients with pouch polyps are younger, and have a longer followup period since IPAA, than patients without pouch polyps. A more aggressive disease requiring earlier surgery could explain these features. However, Groves et al [28] analyzed the risk factors by using logistic regression, and found that age was a more significant predictor of pouch adenomas than the follow-up period, sex, or type of primary or secondary procedures. Groves et al [28] reported that, in their experience, all patients older than 60 years 6775 October 28, 2013 Volume 19 Issue 40

88 Tajika M et al. Ileal pouch neoplasms in FAP patients Table 1 Summary of 25 reports of ileal pouch adenomas in familial adenomatous polyposis Ref. Study Year Operation n Type of pouch Findings % of adenoma Time to neoplasia Beart et al [17] Case 1982 Kock 1 Kock pouch Tubulovillous Adenomas 6 yr Wolfstein et al [18] Case 1982 IAA 2 Soave Adenomas in 2 pts 3 and 7 yr Shepherd et al [19] Retro 1987 IPAA 12 N Tubular Adenoma in 2 pts 16.7 Stryker et al [20] Case 1987 Brooke 1 Kock pouch Tubular Adenomas 12 yr ileostomy Nugent et al [16] Retro 1993 IPAA 38 N Tubular Adenoma in 5 pts yr (1-7) Bertoni [21] Pros 1995 IAA 3 N Tubular Adenoma in 2 pts mo Wu et al [22] Pros 1998 IPAA 26 S/J-pouch 9/16, 1 N Tubular Adenoma in 11 pts yr Valle et al [23] Case 2001 IPAA 5 N Adenomas 20 5 yr Thompson-Fawcett Pros 2001 Kock 5, et al [24] IPAA N Adenoma in 14 pts (with microadenoma 20 pts) Parc et al [4] Pros 2001 IPAA 85 J-pouch 30 pts (28 grossly visible, 2 microadenoma) Polese et al [25] Retro 2002 IPAA 46 S/W/J-pouch 2/1/43, Kock (60.6) 7 yr (1-19) 35.3 Cumulative risk of 7%, 35%, and 75% at 5, 10, and 15 yr Adenoma in 2 of 30 pts 6.7 risk of Adenoma after 8 yr; 20%, (9-11 yr) Beveridge et al [26] Case 2004 IPAA 2 J-pouch 1, Kock 1 2 large VA, VA 4-10 yr Vrouenraets et al [27] Case 2004 IPAA 1 J-pouch Adenomas with focal 6 yr severe dysplastic change Groves et al [28] Pros 2005 Kock 4, 60 W/J-pouch 13/43, Mild dysplasia 23, more yr (1-17) IPAA 56 Kock 4 advanced 11 Nilubol et al [29] Pros 2007 IPAA 10 N Tubular Adenoma in 1of yr pts Moussata et al [30] Retro 2008 IPAA 23 N Low-grade 16, high-grade yr (1-14) Friederich et al [31] Pros 2008 IPAA 212 N Adenoma 74 pts, AAP 25 pts 46.7 Cumulative risk of 16% and 42.2% at 5 and 10 yr Schulz et al [32] Pros 2008 IPAA 35 N Low-grade mean of 5 yr Tajika et al [33] Retro 2009 Kock 8, IPAA J-pouch 16 pts, (advanced 1, carcinoma 2) Kang et al [34] Case 2010 Kock 2 Kock pouch 2 (the largest one is 15mm in size) Banasiewicz et al [35] Pros 2011 IPAA 165 J-pouch Low-grade 13, high-grade 8, neoplasia 5 Tonelli et al [36] Pros 2012 IPAA 69 S/J-pouch 25/29, SIMM 15 Adenoma 25 pts, carcinoma 2 pts 66.7 Cumulative risk of 13%, 43%, and 72% at 5, 10, and 20 yr 15.8 Cumulative risk of 50%, Lowgrade at 15 yr, high-grade at 17.5 yr, neoplasia 18.5 yr 39.1 Cumulative risk of 28.5% at 5 yr Makni et al [37] Case 2012 IPAA 1 J-pouch Adenoma and carcinoma 10 yr Wasmuth et al [38] Retro 2013 IPAA 61 N 14 pts 23 Estimated cumulative rate of first Adenoma diagnosed was 38% Pommaret [39] Retro 2013 IPAA 118 J-pouch 57 pts (12 advanced Adenomas) yr Study: Type of study; Retro: Retrospective series; Pros: Prospective series; n: Number of patients in the study; IPAA: Ileal pouch-anal anastomosis; Kock: Kock continent ileostomy; N: Not described; AV: Anal verge; pts: Patients. will develop polyps in the pouch. Tonelli et al [36] reported that an age of more than 50 years was associated with pouch adenomas, but not sex or elapsed time since restorative proctocolectomy. Several studies found that the severity of duodenal polyposis was related to the presence of pouch adenomatous polyps. In a multivariate analysis of 118 FAP patients who had undergone surgery, Pommaret et al [39] discovered that the presence of advanced duodenal adenomas was an independent risk factor for the development of pouch adenomas, in addition to follow-up duration. Tonelli et al [36] found that patients affected by pouch adenomas had high polyp counts (> 1000) at colectomy, as well as duodenal adenomas. Several potential factors that favor the development of pouch polyposis have been investigated; a number of them remain controversial, although it seems certain that the age of the pouch is important. Pathogenesis The mucosa of the ileal pouch may be subjected to not only the tumorigenic consequences of APC gene mutations [50], but also to luminal factors due to fecal stasis, which may also exert an important effect. Fecal stasis, such as occurs in a reconstructed pouch, may promote neoplastic changes in the ileal mucosa. Several authors have implicated colonic metaplasia of the ileal mucosa as a precursor for the development of ileal adenomas [19,51,52], and even carcinomas in the surgically constructed pouches of patients with FAP [53-55]. Colonic metaplasia was frequently recognized even in earlier descriptions of the changes observed in the ileal pouch mucosa. Some authors have considered colonic metaplasia as an adaptive response of the ileal pouch to its role as a neo October 28, 2013 Volume 19 Issue 40

89 Tajika M et al. Ileal pouch neoplasms in FAP patients Although it is currently recognized that adenomas may develop in the ileal pouch, the risk of adenomas occurring in the afferent ileal loop above the pouch is unclear. The incidence of adenomas above the IPAA pouch was rarely recognized previously, and it seemed to be low, with reported figures ranging from 4% to 16% [22,28,33,82]. The majority of pre-pouch ileal adenomas have measured 4 mm or smaller. Pommaret et al [39] reported that only nine (6.5%) of 118 patients had afferent ileal loop adenomas after an IPAA. The only independent predictive factor for the occurrence of afferent ileal loop adenoma was found to be the presence of pouch adenomas (OR: 2.16; 95%CI: ; P = 0.007). Pommaret et al [39] concluded that because afferent ileum loop adenomas are rare and have an unclear pathologic significance, there is no justification for their systematic search, particularly among patients without any duodenal or pouch adenorectum [18,19,56,57]. Further investigations have shown that colonic transformation is only partial. Small-bowel brush border disaccharidase activity is preserved, as is the ability to absorb vitamin B12, D-xylose, phenylalanine, and bile acids [52,58-60]. The mucosal changes described as colonic metaplasia are likely a response to chronic inflammation caused by changes in the luminal contents due to stasis. In FAP, these changes may, at least in theory, favor the development of adenomas in a region of the gut where they are not usually observed. There is an increase in the concentration of luminal short chain fatty acids to levels that are seen in the colon [61], an increase in anaerobic bacterial counts with a more colonic type flora [62,63], and increased deconjugation and dehydroxylation of bile acids by the anaerobic bacteria [64]. In particular, deoxycholic acid and lithocholic acid, which are known carcinogens, have concentrations several times higher in an ileal pouch than in an end ileostomy [65]. On the other hand, reduction of glutathione S-transferase (GST) detoxification activity in the pouch compared with the afferent ileal loop after IPAA may promote tumorigenesis [64]. APC gene mutations FAP develops due to a dominant autosomal mutation of the APC gene in more than 80% of patients [65]. Recently, it has been discovered that a biallelic mutation of the MUTYH gene might exist in 5% of patients with colorectal polyposis and 20% of FAP patients, with no APC mutation found [66]. Many researchers have investigated APC gene mutations in pouch patients with FAP, although none has demonstrated obvious genotype-phenotype correlations that would predict the development of pouch adenomas [28,30,36,49]. Hence, the available evidence suggests that systematic surveillance of all patients who undergo IPAA is necessary. Targeted surveillance of a defined subgroup of patients is currently not feasible. Type of pouch and anastomosis There are different pouch configurations. Parks et al [7] originally devised a triple-limb S-shaped pouch. This pouch was relatively complicated to construct, and suffered from kinking of the efferent limb if it was left too long [67]. Alternative designs have included the high-capacity W-pouch, the H-pouch and the J-pouch. The majority of surgeons now favor the J-pouch due to ease of construction, economical use of the terminal ileum, and reliable emptying [68]. Functional results are equal to those of other reservoir designs [69-71]. The pouch is formed from the terminal 40 cm of ileum, using several applications of a linear-cutting stapler to join the anti-mesenteric borders of two 20-cm ileal limbs. Several authors have shown that there is no apparent relationship between the development of pouch polyps and the type of ileal pouch construction [36] or the suture used (hand-sewn or stapled) [25,28,36]. However, other authors have reported that patients with a stapled IPAA are at a significantly increased risk of developing adenomas at the anastomotic site: 1.5% to 20.9% vs 27% to 66% for hand-sewn and stapled anastomoses, respectively [9,11,22,36,72,73]. These data suggest that a handsewn IPAA may be a preferable strategy for decreasing the occurrence of adenomas at the anastomotic ileo-anal site. Recently, Wasmuth et al [38] evaluated the differences between adenoma formation at the anastomotic site and in the ileal pouch after IPAA, with or without mucosectomy. These investigators found that an occurrence of adenomas at the anastomotic site was significantly reduced after mucosectomy. However, there was no difference in the occurrence of ileal pouch adenomas between patients who underwent mucosectomy and those who retained a rectal mucosal remnant (8/39 vs 6/22; P = 0.57) [38]. Pouchitis In patients with ulcerative colitis, concern about the risk of neoplasia in ileal pouches was raised after observing a combination of histologic changes in the ileal mucosa of the pouch, including villous atrophy, inflammation and metaplasia [74-76]. These transformations in the ileal pouches are likely caused by the chronic inflammatory state. The inflammatory process in pouchitis may lead to dysplasia [47] and loss of heterozygosity, consistent with precancerous lesions of the colon [77]. Thus, a dysplasiato-neoplasia progression can occur in ileal pouches and can lead to cancer of the pouch. The cumulative risk of pouchitis is up to 50% in patients with ulcerative colitis [78-81], with most patients experiencing at least one episode of pouchitis during the first ten years after surgical pouch construction. In contrast, the pouchitis rate is below 25% in patients with FAP [4-6,29,33,35]. Banasiewicz et al [35] analyzed the frequency and progression of dysplasia and inflammation in the intestinal pouch of FAP patients after restorative proctocolectomy. Although these authors diagnosed pouchitis in 20.6% of patients after restorative proctocolectomy, no relationship was found between pouchitis and pouch dysplasia in FAP patients. THE PREVALENCE OF ADENOMAS IN THE PRE-POUCH ILEUM 6777 October 28, 2013 Volume 19 Issue 40

90 Tajika M et al. Ileal pouch neoplasms in FAP patients A B Figure 1 Endoscopic view of ileal pouch adenomas in patients with familial adenomatous polyposis. A: Multiple white flat lesions are observed in the ileal pouch mucosa; B: Multiple sessile polyps are revealed by indigo carmine. The data available from reference [33]. mas. In cases of extensive pouch polyposis with a significant cancer risk, this viewpoint could allow clinicians to consider resection of the adenomatous pouch, with construction of a new one using the afferent ileum. SURVEILLANCE OF THE ILEAL POUCH Saurin et al [83] described methods of surveillance and therapeutic indications in FAP patients following colectomy. Although there are no validated data in the literature, on the basis of expert opinion, endoscopic surveillance is performed at 6 mo, 1 year, and then every 2 years after surgery. In the presence of polyps with high-grade dysplasia, and/or polyps > 1 cm size, and/or presence of large polyp number (> 30), surveillance should be repeated every 6 mo [83]. Many authors have performed pouch endoscopy every 6-12 mo after surgery [30,33,35,36,38,84]. Optimum bowel preparation and the use of indigo carmine surface staining are necessary [31-33,35]. The main utility of chromoendoscopy is to highlight the small lymphoid lesions that are characteristic of the terminal ileum in FAP patients, and to distinguish flat polyps (Figure 1). In the experience of the Dutch Registry [31], indigo carmine chromoendoscopy significantly increases the detection rates of adenomas < 5 mm in size. Investigators with the Dutch Registry found that 75.7% of FAP patients harbored adenomas in the pouch at a median follow-up duration of 8 years after IPAA [31]. Because some patients have a stricture at the anal anastomosis, a pediatric colonoscope or gastroscope may sometimes be required [35]. TREATMENT OF ADENOMAS IN THE ILEAL POUCH According to Saurin et al [83], no systematic endoscopic treatment of adenomas of the ileal pouch or afferent loop can be recommended. For large adenomas (> 1 cm), or in patients with high-grade dysplasia, endoscopic resection must be considered; however, a skilled team is needed because of the thin ileal mucosa [83]. Our current strategy in patients with IPAA is regular followup starting at 1 year after surgery, and then every year thereafter [33]. If adenomas are observed in the pouch, we recommend endoscopic resection or argon plasma coagulation where feasible, and then follow-up every 6 mo. Other reports [30,35,36,84] also describe polypectomy of large polyps, and ablation by fulguration or electrocoagulation for small lesions. In patients having extensive pouch polyposis with no possibility of endoscopic treatment, together with invasive cancer, pouch excision and terminal ileostomy has to be considered [40,83]. Although there have been some reports suggesting the efficacy of nonsteroidal anti-inflammatory drugs (NSAIDs) in suppressing the development of ileal pouch adenomas [32,48,85], this has not been systematically studied [34]. THE PREVALENCE OF ADENOCARCINOMAS IN THE ILEAL POUCH The progression from a dysplastic lesion in the ileal pouch to invasive carcinoma appears to be rare, occurring in no more than 1% of patients with ileal pouches [31]. However, in the past few years, several cases of carcinoma have been observed after IPAA, although the majority of them occurred at the level of the anal canal [8,9,13,27,38,86-91]. Patients with either hand-sewn or stapled IPAA are at risk for developing a carcinoma in any residual rectal mucosa that harbors dysplasia or is prone to dysplasia. To date, only 21 cases of ileal pouch carcinoma have been recorded in the literature (Table 2). No relationship has been found between the occurrence of pouch carcinoma and the shape (J or S) of the pouch, or the type (hand-sewn or stapled) of IPAA [36]. These pouch cancers have clearly appeared in the ileal pouch, and not in the ATZ. The time elapsed between pouch construction and diagnosis of pouch carcinoma has been between 3 and 20 years (median, 10 years). It is noteworthy that in at least seven patients, the development of advanced cancer was detected within a very short interval-within 1 year since last pouch endoscopy [25,36]. Furthermore, in four of the patients, ileal polyps 6778 October 28, 2013 Volume 19 Issue 40

91 Tajika M et al. Ileal pouch neoplasms in FAP patients Table 2 Summary of 21 cases of ileal pouch cancer in familial adenomatous polyposis Ref. Year Sex Operation Type of pouch Staging of initial surgery Age of pouch (yr) Shape Size (mm) Staging of pouch cancer No. of pouch polyps Time to cancer (yr) Outcome Interval since last endoscopy (yr) Bassuini et al [40] 1996 M IPAA /handsewn No cancer 28 Large polypoid Palkar et al [41] 1997 F IPAA J-pouch handsewn No cancer 39 Large polypoid N T3,N+ N 3 N No follow-up T4N0 Exist 4.7 Alive 0.3 Kim et al [42] 1997 N N N N N N N N N N N N Cherki et al [43] 2003 F IPAA J-pouch TisN0M0 35 N N T3N1M1 N 3.5 Died 0.5 handsewn Linehan et al [44] 2007 M IPAA /double stapled Dukes A 30 N N T3N0 N 9 Alive No follow-up Friederich et al [31] 2008 M IPAA /handsewn No cancer 21.3 N N Dukes C 0 14 N 4.4 M IPAA /stapled No cancer 26.7 N N Dukes B 0 10 N 2.1 M IPAA /handsewn No cancer 16 N N Dukes B N 16 N No follow-up F IPAA /stapled No cancer 29.6 N N Dukes B exist 6 N 0.6 Tajika et al [45] 2009 F IPAA J-pouch/ TisN0M0 46 Type T4N2M Died 3Y 0.75 handsewn M Kock Kock/ handsewn No cancer 48 Type T3N0M0 10 < 20 Died by U No follow-up Ault et al [46] 2009 M IPAA S-pouch/ handsewn Four cancer 61 ND T2N1 N 11 Died by U F IPAA ND No cancer 40 Type 1 N N N 13 meta No follow-up Lee et al [47] 2009 F IPAA J-pouch/ T2N0 56 Type T3N2 0 7 meta 2Y 4 Banasiewicz et al [35] 2011 N IPAA J-pouch/ N N N N N N N N N N IPAA J-pouch/ N N N N N N N N N N IPAA J-pouch/ N N N N N N N N N N IPAA J-pouch/ N N N N N N N N N Tonelli et al [36] 2012 M IPAA S-pouch/ handsewn F IPAA S-pouch/ handsewn No cancer 26 Type 2 20 < T3N0M0 ND 3 Died 6 mo TisN0M0 47 Ⅱa + Ⅱc N T2N0M Alive at 56 mo Makni et al [37] 2012 F IPAA J-pouch/ No cancer 26 N 20 N Many 10 Died 1Y M: Male; F: Female; IPAA: Ileal pouch-anal anastomosis; Kock: Kock continent ileostomy; N: Not described; AV: Anal verge; U: Unrelated disease; Time to cancer: Interval between cancer diagnosis and pouch construction. were not found during endoscopic follow-up until the development of pouch carcinoma. It seems that neoplasia that appears in the ileal pouch may not always follow the classic adenoma-carcinoma sequence. We strongly recommend a strict surveillance program for FAP patients, including annual flexible colonoscopy, irrespective of the phenotype and genotype. IRA VS IPAA In a review of 12 studies containing 1002 patients with FAP (53.4% IPAA, 46.6% IRA), Aziz et al [92] showed that bowel frequency, nocturnal defecation, and incontinence rates were significantly less in IRA patients, although fecal urgency was less among IPAA patients. There was no significant difference between IPAA and IRA in terms of sexual dysfunction, dietary restrictions, or postoperative complications. In their review, Aziz et al [92] could not identify any malignancies in IPAA patients, and rectal cancer was a diagnosis only in the IRA patients (5.5%). At the present time, IPAA anastomosis is recommended by a majority of surgical teams as the preferred option for FAP patients [4-6,10,92,93]. Although cancer formation after IPAA in patients with FAP may be rare, it is of concern that several of the recently reported patients had an advanced stage at diagnosis, with poor outcome. Recent reports of a high frequency of adenomas after IPAA, together with favorable functional outcomes in patients who underwent IRA, may lead to reconsideration of the latter surgical option for some FAP patients, especially when quality of life and fertility criteria are taken into account [30]. In clinical practice, the results of preoperative evaluation of the rectal stump using indigo carmine chromoendoscopy are a major deciding factor. A limited number (< 10-20) of rectal polyps without any cancer would lead to preservation of the rectal stump in a majority of patients [94,95]. However, with the availability of better endoscopic instruments and resection techniques, and the possibility of enhanced post-operative surveillance, > 20 rectal polyps and/or non-invasive cancers can now also be managed endoscopically. So, there is a possibility that the criteria for IRA will expand in the near future. Of course, based on clinical and genetic data, a stepwise surgical strategy with a primary IRA followed at a later age by a secondary proctectomy and IPAA could be proposed [5]. An ongoing multicenter study in Japan is being conducted by Ishikawa et al [96] under the title Intervention trial for colorectal cancer prevention by endoscopic polypectomy in patients with familial adenomatous pol October 28, 2013 Volume 19 Issue 40

92 Tajika M et al. Ileal pouch neoplasms in FAP patients yposis (UMIN ). The aim of this study is to evaluate the usefulness and safety of thorough endoscopic polypectomy in FAP patients who have (or had) 100 colonic adenomas and who refuse surgery, as well as post-operative patients who have (or had) 100 colonic adenomas and who have 10 cm of remnant colon. CONCLUSION The development of adenomas with high-grade dysplasia and carcinoma in the ileal pouch is an important issue because the choice between IPAA and IRA is based mainly on the expected low risk of cancer development after the former surgery. Although the risk of malignant transformation in ileal pouches is probably low, it is not negligible, and the long-term risk cannot presently be well quantified. IPAA will not prevent cancer development in the terminal remnant intestine, and patients who undergo IPAA require regular follow-up similar to patients who receive IRA. A detailed analysis of the phenotypes and mutations in the APC gene of patients with FAP may allow tailoring of the surgical options in the future. REFERENCES 1 Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn G, Stevens J, Spirio L, Robertson M. Identification and characterization of the familial adenomatous polyposis coli gene. Cell 1991; 66: [PMID: DOI: / (81) ] 2 Bussey HJ, Veale AM, Morson BC. Genetics of gastrointestinal polyposis. Gastroenterology 1978; 74: [PMID: ] 3 Jagelman DG. Choice of operation in familial adenomatous polyposis. World J Surg 1991; 15: [PMID: DOI: /BF ] 4 Parc YR, Olschwang S, Desaint B, Schmitt G, Parc RG, Tiret E. Familial adenomatous polyposis: prevalence of adenomas in the ileal pouch after restorative proctocolectomy. Ann Surg 2001; 233: [PMID: DOI: / ] 5 Kartheuser AH, Parc R, Penna CP, Tiret E, Frileux P, Hannoun L, Nordlinger B, Loygue J. Ileal pouch-anal anastomosis as the first choice operation in patients with familial adenomatous polyposis: a ten-year experience. Surgery 1996; 119: [PMID: DOI: / S (96) ] 6 Nyam DC, Brillant PT, Dozois RR, Kelly KA, Pemberton JH, Wolff BG. Ileal pouch-anal canal anastomosis for familial adenomatous polyposis: early and late results. Ann Surg 1997; 226: ; discussion [PMID: DOI: / ] 7 Parks AG, Nicholls RJ. Proctocolectomy without ileostomy for ulcerative colitis. Br Med J 1978; 2: [PMID: DOI: /bmj ] 8 Remzi FH, Church JM, Bast J, Lavery IC, Strong SA, Hull TL, Harris GJ, Delaney CP, O Riordain MG, McGannon EA, Fazio VW. Mucosectomy vs. stapled ileal pouch-anal anastomosis in patients with familial adenomatous polyposis: functional outcome and neoplasia control. Dis Colon Rectum 2001; 44: [PMID: DOI: /BF ] 9 Ozdemir Y, Kalady MF, Aytac E, Kiran RP, Erem HH, Church JM, Remzi FH. Anal transitional zone neoplasia in patients with familial adenomatous polyposis after restorative proctocolectomy and IPAA: incidence, management, and oncologic and functional outcomes. Dis Colon Rectum 2013; 56: [PMID: DOI: / DCR.0b013e db] 10 Fazio VW, Kiran RP, Remzi FH, Coffey JC, Heneghan HM, Kirat HT, Manilich E, Shen B, Martin ST. Ileal pouch anal anastomosis: analysis of outcome and quality of life in 3707 patients. Ann Surg 2013; 257: [PMID: DOI: /SLA.0b013e31827d99a2] 11 van Duijvendijk P, Vasen HF, Bertario L, Bülow S, Kuijpers JH, Schouten WR, Guillem JG, Taat CW, Slors JF. Cumulative risk of developing polyps or malignancy at the ileal pouch-anal anastomosis in patients with familial adenomatous polyposis. J Gastrointest Surg 1999; 3: [PMID: DOI: /S X(99) ] 12 von Roon AC, Tekkis PP, Clark SK, Heriot AG, Lovegrove RE, Truvolo S, Nicholls RJ, Phillips RK. The impact of technical factors on outcome of restorative proctocolectomy for familial adenomatous polyposis. Dis Colon Rectum 2007; 50: [PMID: DOI: /s z] 13 von Roon AC, Will OC, Man RF, Neale KF, Phillips RK, Nicholls RJ, Clark SK, Tekkis PP. Mucosectomy with handsewn anastomosis reduces the risk of adenoma formation in the anorectal segment after restorative proctocolectomy for familial adenomatous polyposis. Ann Surg 2011; 253: [PMID: DOI: /SLA.0b013e318f3f498] 14 Bess MA, Adson MA, Elveback LR, Moertel CG. Rectal cancer following colectomy for polyposis. Arch Surg 1980; 115: [PMID: DOI: /archsurg ] 15 De Cosse JJ, Bülow S, Neale K, Järvinen H, Alm T, Hultcrantz R, Moesgaard F, Costello C. Rectal cancer risk in patients treated for familial adenomatous polyposis. The Leeds Castle Polyposis Group. Br J Surg 1992; 79: [PMID: DOI: /bjs ] 16 Nugent KP, Phillips RK. Rectal cancer risk in older patients with familial adenomatous polyposis and an ileorectal anastomosis: a cause for concern. Br J Surg 1992; 79: [PMID: DOI: /bjs ] 17 Beart RW, Fleming CR, Banks PM. Tubulovillous adenomas in a continent ileostomy after proctocolectomy for familial polyposis. Dig Dis Sci 1982; 27: [PMID: DOI: /BF ] 18 Wolfstein IH, Bat L, Neumann G. Regeneration of rectal mucosa and recurrent polyposis coli after total colectomy and ileoanal anastomosis. Arch Surg 1982; 117: [PMID: DOI: /archsurg ] 19 Shepherd NA, Jass JR, Duval I, Moskowitz RL, Nicholls RJ, Morson BC. Restorative proctocolectomy with ileal reservoir: pathological and histochemical study of mucosal biopsy specimens. J Clin Pathol 1987; 40: [PMID: DOI: /jcp ] 20 Stryker SJ, Carney JA, Dozois RR. Multiple adenomatous polyps arising in a continent reservoir ileostomy. Int J Colorectal Dis 1987; 2: [PMID: DOI: / BF ] 21 Bertoni G, Sassatelli R, Nigrisoli E, Tansini P, Roncucci L, Ponz de Leon M, Bedogni G. First observation of microadenomas in the ileal mucosa of patients with familial adenomatous polyposis and colectomies. Gastroenterology 1995; 109: [PMID: DOI: / (95) ] 22 Wu JS, McGannon EA, Church JM. Incidence of neoplastic polyps in the ileal pouch of patients with familial adenomatous polyposis after restorative proctocolectomy. Dis Colon Rectum 1998; 41: ; discussion [PMID: DOI: /BF ] 23 Valle RD, de Angelis GL. Pouch adenomas after ileal pouchanal anastomosis for familial adenomatous polyposis. Dis Colon Rectum 2001; 44: [PMID: DOI: /BF ] 24 Thompson-Fawcett MW, Marcus VA, Redston M, Cohen Z, 6780 October 28, 2013 Volume 19 Issue 40

93 Tajika M et al. Ileal pouch neoplasms in FAP patients Mcleod RS. Adenomatous polyps develop commonly in the ileal pouch of patients with familial adenomatous polyposis. Dis Colon Rectum 2001; 44: [PMID: DOI: /BF ] 25 Polese L, Keighley MR. Adenomas at resection margins do not influence the long-term development of pouch polyps after restorative proctocolectomy for familial adenomatous polyposis. Am J Surg 2003; 186: [PMID: DOI: /S (03) ] 26 Beveridge IG, Swain DJ, Groves CJ, Saunders BP, Windsor AC, Talbot IC, Nicholls RJ, Phillips RK. Large villous adenomas arising in ileal pouches in familial adenomatous polyposis: report of two cases. Dis Colon Rectum 2004; 47: [PMID: DOI: /s y] 27 Vrouenraets BC, Van Duijvendijk P, Bemelman WA, Offerhaus GJ, Slors JF. Adenocarcinoma in the anal canal after ileal pouch-anal anastomosis for familial adenomatous polyposis using a double-stapled technique: report of two cases. Dis Colon Rectum 2004; 47: [PMID: DOI: /s y] 28 Groves CJ, Beveridge lg, Swain DJ, Saunders BP, Talbot IC, Nicholls RJ, Phillips RK. Prevalence and morphology of pouch and ileal adenomas in familial adenomatous polyposis. Dis Colon Rectum 2005; 48: [PMID: DOI: /s ] 29 Nilubol N, Scherl E, Bub DS, Gorfine SR, Marion J, Harris MT, Kornbluth A, Lichtiger S, Rubin P, George J, Chapman M, Harpaz N, Present D, Bauer JJ. Mucosal dysplasia in ileal pelvic pouches after restorative proctocolectomy. Dis Colon Rectum 2007; 50: [PMID: DOI: / s ] 30 Moussata D, Nancey S, Lapalus MG, Prost B, Chavaillon A, Bernard G, Ponchon T, Saurin JC. Frequency and severity of ileal adenomas in familial adenomatous polyposis after colectomy. Endoscopy 2008; 40: [PMID: DOI: /s ] 31 Friederich P, de Jong AE, Mathus-Vliegen LM, Dekker E, Krieken HH, Dees J, Nagengast FM, Vasen HF. Risk of developing adenomas and carcinomas in the ileal pouch in patients with familial adenomatous polyposis. Clin Gastroenterol Hepatol 2008; 6: [PMID: DOI: /j.cgh ] 32 Schulz AC, Bojarski C, Buhr HJ, Kroesen AJ. Occurrence of adenomas in the pouch and small intestine of FAP patients after proctocolectomy with ileoanal pouch construction. Int J Colorectal Dis 2008; 23: [PMID: DOI: /s ] 33 Tajika M, Nakamura T, Nakahara O, Kawai H, Komori K, Hirai T, Kato T, Bhatia V, Baba H, Yamao K. Prevalence of adenomas and carcinomas in the ileal pouch after proctocolectomy in patients with familial adenomatous polyposis. J Gastrointest Surg 2009; 13: [PMID: DOI: /s ] 34 Kang JM, Byeon JS, Park JH, Ahn JY, Ko OB, Myung SJ, Yang SK, Kim JH. [Two cases of multiple adenomas in the ileal pouch after total proctocolectomy in patients with familial adenomatous polyposis]. Korean J Gastroenterol 2010; 56: [PMID: DOI: /kjg ] 35 Banasiewicz T, Marciniak R, Kaczmarek E, Krokowicz P, Paszkowski J, Lozynska-Nelke A, Gronek P, Plawski A, Drews M. The prognosis of clinical course and the analysis of the frequency of the inflammation and dysplasia in the intestinal J-pouch at the patients after restorative proctocolectomy due to FAP. Int J Colorectal Dis 2011; 26: [PMID: DOI: /s ] 36 Tonelli F, Ficari F, Bargellini T, Valanzano R. Ileal pouch adenomas and carcinomas after restorative proctocolectomy for familial adenomatous polyposis. Dis Colon Rectum 2012; 55: [PMID: DOI: / DCR.0b013e318241e6f2] 37 Makni A, Chebbi F, Rebai W, Ayadi S, Fekih M, Jouini M, Kacem M, Ben Safta Z. Adenocarcinoma arising in the J pouch after total proctocolectomy for familial polyposis coli. Tunis Med 2012; 90: [PMID: ] 38 Wasmuth HH, Tranø G, Myrvold HE, Aabakken L, Bakka A. Adenoma formation and malignancy after restorative proctocolectomy with or without mucosectomy in patients with familial adenomatous polyposis. Dis Colon Rectum 2013; 56: [PMID: DOI: / DCR.0b013e31827c970f] 39 Pommaret E, Vienne A, Lefevre JH, Sogni P, Florent C, Desaint B, Parc Y. Prevalence and risk factors for adenomas in the ileal pouch and the afferent loop after restorative proctocolectomy for patients with familial adenomatous polyposis. Surg Endosc 2013; 27: [PMID: DOI: /s x] 40 Bassuini MM, Billings PJ. Carcinoma in an ileoanal pouch after restorative proctocolectomy for familial adenomatous polyposis. Br J Surg 1996; 83: 506 [PMID: DOI: /bjs ] 41 Palkar VM, desouza LJ, Jagannath P, Naresh KN. Adenocarcinoma arising in J pouch after total proctocolectomy for familial polyposis coli. Indian J Cancer 1997; 34: [PMID: ] 42 Kim HR, Kim DY, Kim YJ. Carcinoma in an ileal pouch after proctocolectomy, with ileal pouch-anal [abstract]. J Korean Soc Coloproctol 1997; 13: Cherki S, Glehen O, Moutardier V, François Y, Gilly FN, Vignal J. Pouch adenocarcinoma after restorative proctocolectomy for familial adenomatous polyposis. Colorectal Dis 2003; 5: [PMID: DOI: / j x] 44 Linehan G, Cahill RA, Kalimuthu SN, O Connell F, Redmond HP, Kirwan WO. Adenocarcinoma arising in the ileoanal pouch after restorative proctocolectomy for familial adenomatous polyposis. Int J Colorectal Dis 2008; 23: [PMID: DOI: /s ] 45 Tajika M, Nakamura T, Bhatia V, Komori K, Kato T, Yamao K. Ileal pouch adenocarcinoma after proctocolectomy for familial adenomatous polyposis. Int J Colorectal Dis 2009; 24: [PMID: DOI: /s ] 46 Ault GT, Nunoo-Mensah JW, Johnson L, Vukasin P, Kaiser A, Beart RW. Adenocarcinoma arising in the middle of ileoanal pouches: report of five cases. Dis Colon Rectum 2009; 52: [PMID: DOI: / DCR.0b013e318199effe] 47 Lee SH, Ahn BK, Chang HK, Baek SU. Adenocarcinoma in ileal pouch after proctocolectomy for familial adenomatous polyposis: report of a case. J Korean Med Sci 2009; 24: [PMID: DOI: /jkms ] 48 Church J, Simmang C. Practice parameters for the treatment of patients with dominantly inherited colorectal cancer (familial adenomatous polyposis and hereditary nonpolyposis colorectal cancer). Dis Colon Rectum 2003; 46: [PMID: DOI: /s y] 49 Parc Y, Piquard A, Dozois RR, Parc R, Tiret E. Long-term outcome of familial adenomatous polyposis patients after restorative coloproctectomy. Ann Surg 2004; 239: [PMID: DOI: /01.sla f6] 50 Will OC, Robinson J, Günther T, Phillips RK, Clark SK, Tomlinson I. APC mutation spectrum in ileoanal pouch polyps resembles that of colorectal polyps. Br J Surg 2008; 95: [PMID: DOI: /bjs.6110] 51 Corfield AP, Warren BF, Bartolo DC, Wagner SA, Clamp JR. Mucin changes in ileoanal pouches monitored by metabolic labelling and histochemistry. Br J Surg 1992; 79: [PMID: DOI: /bjs ] 52 de Silva HJ, Millard PR, Kettlewell M, Mortensen NJ, Prince C, Jewell DP. Mucosal characteristics of pelvic ileal pouches. Gut 1991; 32: [PMID: DOI: /gut ] 6781 October 28, 2013 Volume 19 Issue 40

94 Tajika M et al. Ileal pouch neoplasms in FAP patients 53 Johnson JA, Talton DS, Poole GV. Adenocarcinoma of a Brooke ileostomy for adenomatous polyposis coli. Am J Gastroenterol 1993; 88: [PMID: ] 54 Johnson CD, White H. Colonic metaplasia with colonic-type polyps on an ileostomy stoma in polyposis coli. Report of a case. Dis Colon Rectum 1988; 31: [PMID: DOI: /BF ] 55 Nakahara S, Itoh H, Iida M, Iwashita A, Ohsato K. Ileal adenomas in familial polyposis coli. Differences before and after colectomy. Dis Colon Rectum 1985; 28: [PMID: DOI: /BF ] 56 Go PM, Lens J, Bosman FT. Mucosal alterations in the reservoir of patients with Kock s continent ileostomy. Scand J Gastroenterol 1987; 22: [PMID: DOI: / ] 57 Lerch MM, Braun J, Harder M, Hofstădter F, Schumpelick V, Matern S. Postoperative adaptation of the small intestine after total colectomy and J-pouch-anal anastomosis. Dis Colon Rectum 1989; 32: [PMID: DOI: / BF ] 58 Bayat M, Brynskov J, Dige-Petersen H, Hippe E, Lønborg- Jensen H. Direct and quantitative vitamin B12 absorption measurement in patients with disorders in the distal part of the bowel. Comparison of stool spot test [SST] with whole body counting in patients with ileal pelvic reservoir, ileostomy or Crohn s disease. Int J Colorectal Dis 1994; 9: [PMID: DOI: /BF ] 59 de Silva HJ, Kettlewell MG, Mortensen NJ, Jewell DP. Review Acute inflammation in ileal pouches (pouchitis). Eur J Gastroenterol Hepatol 1991; 3: Apel R, Cohen Z, Andrews CW, McLeod R, Steinhart H, Odze RD. Prospective evaluation of early morphological changes in pelvic ileal pouches. Gastroenterology 1994; 107: [PMID: ] 61 Clausen MR, Tvede M, Mortensen PB. Short-chain fatty acids in pouch contents from patients with and without pouchitis after ileal pouch-anal anastomosis. Gastroenterology 1992; 103: [PMID: ] 62 Nasmyth DG, Godwin PG, Dixon MF, Williams NS, Johnston D. Ileal ecology after pouch-anal anastomosis or ileostomy. A study of mucosal morphology, fecal bacteriology, fecal volatile fatty acids, and their interrelationship. Gastroenterology 1989; 96: [PMID: ] 63 Natori H, Utsunomiya J, Yamamura T, Benno Y, Uchida K. Fecal and stomal bile acid composition after ileostomy or ileoanal anastomosis in patients with chronic ulcerative colitis and adenomatosis coli. Gastroenterology 1992; 102: [PMID: ] 64 Friederich P, Berkhout M, Roelofs HM, van Goor H, van Krieken JH, Peters WH, Nagengast FM. Decreased levels of mucosal detoxification enzymes in the pouch of patients with familial adenomatous polyposis. Br J Surg 2006; 93: [PMID: DOI: /bjs.5348] 65 Moisio AL, Järvinen H, Peltomäki P. Genetic and clinical characterisation of familial adenomatous polyposis: a population based study. Gut 2002; 50: [PMID: DOI: /gut ] 66 Lefevre JH, Rodrigue CM, Mourra N, Bennis M, Flejou JF, Parc R, Tiret E, Gespach C, Parc YR. Implication of MYH in colorectal polyposis. Ann Surg 2006; 244: ; discussion [PMID: DOI: /01. sla ] 67 Liljeqvist L, Lindquist K. A reconstructive operation on malfunctioning S-shaped pelvic reservoirs. Dis Colon Rectum 1985; 28: [PMID: DOI: /BF ] 68 Lewis WG, Miller AS, Williamson ME, Sagar PM, Holdsworth PJ, Axon AT, Johnston D. The perfect pelvic pouch- -what makes the difference? Gut 1995; 37: [PMID: DOI: /gut ] 69 Utsunomiya J, Iwama T, Imajo M, Matsuo S, Sawai S, Yaegashi K, Hirayama R. Total colectomy, mucosal proctectomy, and ileoanal anastomosis. Dis Colon Rectum 1980; 23: [PMID: DOI: /BF ] 70 McHugh SM, Diamant NE, McLeod R, Cohen Z. S-pouches vs. J-pouches. A comparison of functional outcomes. Dis Colon Rectum 1987; 30: [PMID: DOI: / BF ] 71 Oresland T, Fasth S, Nordgren S, Hallgren T, Hultén L. A prospective randomized comparison of two different pelvic pouch designs. Scand J Gastroenterol 1990; 25: [PMID: DOI: / ] 72 Uff CR, Phillips RK. Effect of suture material on tumor cell adherence at sites of colonic injury. Br J Surg 1993; 80: 1354 [PMID: DOI: /bjs ] 73 Remzi FH, Fazio VW, Delaney CP, Preen M, Ormsby A, Bast J, O Riordain MG, Strong SA, Church JM, Petras RE, Gramlich T, Lavery IC. Dysplasia of the anal transitional zone after ileal pouch-anal anastomosis: results of prospective evaluation after a minimum of ten years. Dis Colon Rectum 2003; 46: 6-13 [PMID: DOI: /s ] 74 Gullberg K, Ståhlberg D, Liljeqvist L, Tribukait B, Reinholt FP, Veress B, Löfberg R. Neoplastic transformation of the pelvic pouch mucosa in patients with ulcerative colitis. Gastroenterology 1997; 112: [PMID: DOI: / S (97) ] 75 Veress B, Reinholt FP, Lindquist K, Löfberg R, Liljeqvist L. Long-term histomorphological surveillance of the pelvic ileal pouch: dysplasia develops in a subgroup of patients. Gastroenterology 1995; 109: [PMID: DOI: / (95) ] 76 Setti Carraro P, Talbot IC, Nicholls RJ. Longterm appraisal of the histological appearances of the ileal reservoir mucosa after restorative proctocolectomy for ulcerative colitis. Gut 1994; 35: [PMID: DOI: /gut ] 77 Gullberg K, Lindforss U, Zetterquist H, Stålberg D, Reinholt FP, Veress B, Tribukait B, Olivecrona H, Löfberg R. Cancer risk assessment in long-standing pouchitis. DNA aberrations are rare in transformed neoplastic pelvic pouch mucosa. Int J Colorectal Dis 2002; 17: [PMID: DOI: / s ] 78 Dozois RR, Kelly KA, Welling DR, Gordon H, Beart RW, Wolff BG, Pemberton JH, Ilstrup DM. Ileal pouch-anal anastomosis: comparison of results in familial adenomatous polyposis and chronic ulcerative colitis. Ann Surg 1989; 210: ; discussion [PMID: DOI: / ] 79 Fazio VW, Ziv Y, Church JM, Oakley JR, Lavery IC, Milsom JW, Schroeder TK. Ileal pouch-anal anastomoses complications and function in 1005 patients. Ann Surg 1995; 222: [PMID: DOI: / ] 80 Meagher AP, Farouk R, Dozois RR, Kelly KA, Pemberton JH. J ileal pouch-anal anastomosis for chronic ulcerative colitis: complications and long-term outcome in 1310 patients. Br J Surg 1998; 85: [PMID: DOI: / j x] 81 Heuschen UA, Autschbach F, Allemeyer EH, Zöllinger AM, Heuschen G, Uehlein T, Herfarth C, Stern J. Long-term follow-up after ileoanal pouch procedure: algorithm for diagnosis, classification, and management of pouchitis. Dis Colon Rectum 2001; 44: [PMID: DOI: / BF ] 82 Will OC, Man RF, Phillips RK, Tomlinson IP, Clark SK. Familial adenomatous polyposis and the small bowel: a locoregional review and current management strategies. Pathol Res Pract 2008; 204: [PMID: DOI: / j.prp ] 83 Saurin JC, Napoleon B, Gay G, Ponchon T, Arpurt JP, Boustiere C, Boyer J, Canard JM, Dalbies PA, Escourrou J, Greff M, Lapuelle J, Laugier R, Letard JC, Marchetti B, Palazzo L, 6782 October 28, 2013 Volume 19 Issue 40

95 Tajika M et al. Ileal pouch neoplasms in FAP patients Sautereau D, Vedrenne B. Endoscopic management of patients with familial adenomatous polyposis (FAP) following a colectomy. Endoscopy 2005; 37: [PMID: DOI: /s ] 84 Church J. Ileoanal pouch neoplasia in familial adenomatous polyposis: an underestimated threat. Dis Colon Rectum 2005; 48: [PMID: DOI: / s ] 85 Church JM, Oakley JR, Wu JS. Pouch polyposis after ileal pouch-anal anastomosis for familial adenomatous polyposis: report of a case. Dis Colon Rectum 1996; 39: [PMID: DOI: /BF ] 86 von Herbay A, Stern J, Herfarth C. Pouch-anal cancer after restorative proctocolectomy for familial adenomatous polyposis. Am J Surg Pathol 1996; 20: [PMID: DOI: / ] 87 Vuilleumier H, Halkic N, Ksontini R, Gillet M. Columnar cuff cancer after restorative proctocolectomy for familial adenomatous polyposis. Gut 2000; 47: [PMID: DOI: /gut ] 88 Brown SR, Donati D, Seow-Choen F. Rectal cancer after mucosectomy for ileoanal pouch in familial adenomatous polyposis: report of a case. Dis Colon Rectum 2001; 44: [PMID: DOI: /BF ] 89 Ooi BS, Remzi FH, Gramlich T, Church JM, Preen M, Fazio VW. Anal transitional zone cancer after restorative proctocolectomy and ileoanal anastomosis in familial adenomatous polyposis: report of two cases. Dis Colon Rectum 2003; 46: ; discussion [PMID: DOI: /s ] 90 Ulaş M, Neşşar G, Bostanoğlu A, Aydoğ G, Kayaalp C, Ozoğul Y, Seven C. Development of two cancers in the same patient after ileorectal and ileal pouch anal anastomosis for familial adenomatous polyposis. Med Princ Pract 2006; 15: [PMID: DOI: / ] 91 Booij KA, Mathus-Vliegen EM, Taminiau JA, Ten Kate FJ, Slors JF, Tabbers MM, Aronson DC. Evaluation of 28 years of surgical treatment of children and young adults with familial adenomatous polyposis. J Pediatr Surg 2010; 45: [PMID: DOI: /j.jpedsurg ] 92 Aziz O, Athanasiou T, Fazio VW, Nicholls RJ, Darzi AW, Church J, Phillips RK, Tekkis PP. Meta-analysis of observational studies of ileorectal versus ileal pouch-anal anastomosis for familial adenomatous polyposis. Br J Surg 2006; 93: [PMID: DOI: /bjs.5276] 93 Ambroze WL, Dozois RR, Pemberton JH, Beart RW, Ilstrup DM. Familial adenomatous polyposis: results following ileal pouch-anal anastomosis and ileorectostomy. Dis Colon Rectum 1992; 35: [PMID: DOI: /BF ] 94 Tonelli F, Valanzano R, Monaci I, Mazzoni P, Anastasi A, Ficari F. Restorative proctocolectomy or rectum-preserving surgery in patients with familial adenomatous polyposis: results of a prospective study. World J Surg 1997; 21: ; discussion 659 [PMID: DOI: /s ] 95 Valanzano R, Ficari F, Curia MC, Aceto G, Veschi S, Cama A, Battista P, Tonelli F. Balance between endoscopic and genetic information in the choice of ileorectal anastomosis for familial adenomatous polyposis. J Surg Oncol 2007; 95: [PMID: DOI: /jso.20672] 96 Ishikawa H, Wakabayashi K, Suzuki S, Mutoh M, Hirata K, Nakamura T, Takeyama I, Kawano A, Gondo N, Abe T, Tokudome S, Goto C, Matsuura N, Sakai T. Preventive effects of low-dose aspirin on colorectal adenoma growth in patients with familial adenomatous polyposis: double-blind, randomized clinical trial. Cancer Med 2013; 2: [PMID: DOI: /cam4.46] P- Reviewers Izbicki JR, Leedham SJ S- Editor Song XX L- Editor A E- Editor Zhang DN 6783 October 28, 2013 Volume 19 Issue 40

96 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Clinical applications of next-generation sequencing in colorectal cancers Tae-Min Kim, Sug-Hyung Lee, Yeun-Jun Chung Tae-Min Kim, Sug-Hyung Lee, Yeun-Jun Chung, MRC Cancer Evolution Research Center, College of Medicine, The Catholic University of Korea, Seoul , South Korea Yeun-Jun Chung, Sug-Hyung Lee, Integrated Research Center for Genome Polymorphism, Department of Microbiology, College of Medicine, The Catholic University of Korea, Seoul , South Korea Sug-Hyung Lee, Department of Pathology, College of Medicine, The Catholic University of Korea, Seoul , South Korea Author contributions: Kim TM and Chung YJ collected the materials and wrote the manuscript; Lee SH commented on the contents; Chung YJ supervised the manuscript. Supported by Cancer Evolution Research Center (2012 R1A5A ), South Korea Correspondence to: Yeun-Jun Chung, MD, PhD, Professor, Director, Integrated Research Center for Genome Polymorphism, Department of Microbiology, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Socho-gu, Seoul , South Korea. yejun@catholic.ac.kr Telephone: Fax: Received: April 25, 2013 Revised: July 22, 2013 Accepted: August 20, 2013 Published online: October 28, 2013 Abstract Like other solid tumors, colorectal cancer (CRC) is a genomic disorder in which various types of genomic alterations, such as point mutations, genomic rearrangements, gene fusions, or chromosomal copy number alterations, can contribute to the initiation and progression of the disease. The advent of a new DNA sequencing technology known as next-generation sequencing (NGS) has revolutionized the speed and throughput of cataloguing such cancer-related genomic alterations. Now the challenge is how to exploit this advanced technology to better understand the underlying molecular mechanism of colorectal carcinogenesis and to identify clinically relevant genetic biomarkers for diagnosis and personalized therapeutics. In this review, we will introduce NGS-based cancer genomics studies focusing on those of CRC, including a recent large-scale report from the Cancer Genome Atlas. We will mainly discuss how NGS-based exome-, whole genome- and methylome-sequencing have extended our understanding of colorectal carcinogenesis. We will also introduce the unique genomic features of CRC discovered by NGS technologies, such as the relationship with bacterial pathogens and the massive genomic rearrangements of chromothripsis. Finally, we will discuss the necessary steps prior to development of a clinical application of NGS-related findings for the advanced management of patients with CRC Baishideng. All rights reserved. Key words: Next-generation sequencing; Cancer genomics; Colorectal cancers; Personalized medicine; The cancer genome atlas Core tip: Next-generation sequencing (NGS)-driven genomic analyses are facilitating the genomic dissection of various types of human cancers, including colorectal cancer (CRC). This review contains an up-to-date summary of recent NGS-based CRC studies and an overview of how these efforts have advanced our understanding of colorectal carcinogenesis with novel biomarkers for genome-based cancer diagnosis and personalized cancer therapeutics. Kim TM, Lee SH, Chung YJ. Clinical applications of next-generation sequencing in colorectal cancers. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: org/ /wjg.v19.i INTRODUCTION Colorectal cancers (CRC) are the third most common human malignancy, and are also the leading cause of cancerrelated deaths worldwide [1]. Early detection of premalig October 28, 2013 Volume 19 Issue 40

97 Kim TM et al. NGS-based genomic analyses of CRC Table 1 The next-generation sequencing platforms for cancer genome analysis NGS types Whole genome sequencing Exome sequencing Epigenome sequencing 1 RNA-seq Source Genomic DNA Genomic DNA (targeted) Genomic DNA (targeted) RNA Alteration Point mutations and indels, rearrangements Point mutations and indels DNA methylation and posttran- Gene fusions 3, alternative splicing types 2, DNA copy number changes scriptional histone modifications events, point mutations and indels 1 Epigenome sequencing can be classified into chromatin immunoprecipitation (ChIP)-based methods to detect genomic domains with epigenetic modifications [80] and more direct DNA methylation sequencing such as bisulfite-sequencing [59,60] ; 2 From whole genome sequencing data, the genomic rearrangements and DNA copy number changes are generally detected by paired-end mapping [81] and read-depth based methods [82], respectively; 3 Gene fusions can also be identified by paired-end, high-coverage whole genome sequencing, but the transcription-related events such as exon skipping or other alternative splicing events can only be identified by RNA-seq. NGS: Next-generation sequencing. Table 2 The list of next-generation sequencing-based studies of colorectal cancer genomes Ref. NGS types Major findings Alteration types and software used Bass et al [16] WGS (9 pairs; tumor-matched normal) Oncogenic fusion (VTI1A-TCG7L2) Point mutations (MuTect [83] ) Indels (Indelocator) 1 Rearrangements (dranger) 1 TCGA consortium WGS (97 pairs; low-pass) See main text Point mutations (MuTect) RNA-seq (218 tumors) Recurrent mutations (MutSig) 1 Timmermann et al [84] Zhou et al [85] Kloosterman et al [73] Brannon et al [88] (Proceedings) Exome-seq (254 pairs) DNA copy numbers (BIC-seq [82] ) Rearrangements (BreakDancer [81] ) Exome-seq (2 pairs, one MSI-H and one MSS) Exome-seq (1 series: normal-adenomaadenocarcinoma) WGS (4 pairs; primary-metastasismatched normals) Targeted 1300 genes (4 pairs) Targeted 230 genes (50 pairs: primarymetastasis-matched normals) Comparison of mutation spectrum between MSI-H and MSS CRC genomes Comparison of benign and malignant CRC genomes in the same patient Comparison of primary or metastatic CRC genomes Comparison of primary or metastatic CRC genomes Point mutation and indel (Vendor-provided GS reference mapper, Roche) Point mutation and indel (Samtools [86] ) Chromothripsis and mutations (Burrow- Wheeler aligner [87] based in-house tools) IMPACT (integrated mutation profiling of actionable cancer targets) Yin et al [89] RNA-seq (2 pairs) RNA-seq based mutation study Point mutations and indels (Samtools) 1 Description of the software is available at NGS: Next-generation sequencing; CRC: Colorectal cancer; TCGA: The cancer genome atlas; MSI: Microsatellite instability. nant lesions such as adenomatous polyps has decreased the risk of CRCs [2], however, cases which are initially undetected and progress to advanced CRC with distant metastasis are still unfortunately incurable [3]. The development of CRC is a complex and heterogeneous process arising from an interaction between multiple etiological factors, including genetic factors [4] and environmental factors such as diet and lifestyle [5]. Recently, significant progress has been made in the characterization of genetic and epigenetic alterations in CRC genomes in support of the genomic view of colorectal carcinogenesis. Like other types of human solid tumors, CRC genomes harbor various types of genomic alterations ranging from small-scale changes (i.e., point mutations or small indels) to large-scale chromosomal copy number changes or rearrangements. Some of these alterations may contribute to colorectal carcinogenesis as oncogenic drivers, but the full spectrum of driver genomic alterations in CRC genomes is still incomplete. For decades, the genome-wide profiling of cancer genomes has been mainly conducted using hybridizationbased microarray technologies (i.e., expression microarrays and array-based comparative genomic hybridization) [6,7] or low-throughput Sanger sequencing [8]. Recently, the advancement of DNA sequencing technologies - next-generation sequencing (NGS) - has revolutionized the speed and throughput of DNA sequencing [9,10]. Table 1 lists the NGS platforms widely used in the characterization of cancer genomes. Since the first attempt at cancer genome sequencing using NGS technology [11], successful sequencing by NGS has been accomplished in many major human cancer types [12,13] including gastrointestinal malignancies such as esophageal [14], gastric [15], colorectal [16], and hepatocellular carcinomas [17,18]. The NGS-based studies of CRC genomes are summarized in Table 2. These studies identified the unique mutational spectrum and novel targets of genomic alterations in respective cancer types with biological and clinical significance. SOMATIC MUTATIONS IN CRC GENOMES Like other solid tumors, CRC is thought to initiate and progress through a series of genetic and epigenetic alterations. The progression model of colorectal carcinogenesis (i.e., from adenomatous polyp to benign adenoma, eventually progressing to invasive adenocarcinoma) has been referred to as a classical cancer evolution model in 6785 October 28, 2013 Volume 19 Issue 40

98 Kim TM et al. NGS-based genomic analyses of CRC Normal epithelium Small adenoma Large adenoma APC KRAS BRAF SMAD4 APC/WNT pathway altered in about 90% of CRC [22] Two major loci are APC and CTNNB1 (about 70%) Additional 16 target genes in WNT/APC pathway (about 20%) Confirmed recurrent oncogenic mutations (coding 12, 13, 61) [22] BRAF mutations exclusive in hypermutated CRC [22] Chromosomal deletions more common than mutations [22] Figure 1 A classical progression model of colorectal carcinogenesis. A classical progression model of colorectal carcinogenesis is illustrated with genes whose alterations are responsible for each of the progressive steps. The right panel shows recent next-generation sequencingbased reports of the corresponding genes. CRC: Colorectal cancer; ATM: Ataxia telangiectasia mutated. TP53 Mutual exclusivity with deletions and mutations of ATM [22] Carcinoma Metastasis Unknown Metastatic lesion-specific alterations are relatively rare [73,74], but enriched in cancer-relevant pathways [86] Table 3 The platforms used in the Cancer Genome Atlas consortium Alteration types Glioblastoma multiforme (2008, TCGA) Colorectal cancers (2012, TCGA) Point mutations, indels Sanger sequencing Illumina GA and HiSeq DNA Sequencing 1 ABI SOLiD DNA Sequencing 1 DNA copy numbers Agilent Human CGH Microarray 244 A Agilent CGH Microarray Kit 1 1 M and 244 A Affymetrix Genome-Wide SNP Array 6.0 Affymetrix Genome-Wide SNP Array 6.0 Illumina Human Infinium 550 K BeadChip Illumina Infinium 550 K and 1M-Duo BeadChip DNA Methylation Illumina Infinium DNA Methylation 27 Illumina Infinium DNA Methylation 27 Illumina DNA Methylation Cancer Panel Ⅰ Transcriptome Affymetrix Human Genome U133 Plus 2.0 Illumina GA and HiSeq RNA sequencing 1 Agilent 244 K Custom Array Agilent 244 K Custom Array Affymetrix Human Exon 1.0 ST Array MicroRNA Agilent 8 15 K Human mirna Microarray Illumina GA and HiSeq mirna sequencing 1 Whole-genome sequencing N/A Illumina HiSeq DNA sequencing 1 1 Next-generation sequencing-based platforms are noted. The platforms used in the genomic characterization of glioblastoma multiforme in 2008 (left) and colorectal cancer genomes in 2012 (right) are shown. TCGA: The Cancer Genome Atlas. which the CRC genome acquires somatic alterations in a progressive manner throughout several developmental stages. In this model, dysregulation of the APC/WNT pathway via the inactivation of APC occurs in the normal epithelium as an initiation process, while the loss of TP53 and TGF-β /SMAD4 gives rise to clonal expansion of tumor cells in the invasive adenocarcinoma (Figure 1) [4,19]. However, the genomic alterations associated with colorectal carcinogenesis may be more complicated than previously assumed. A complete and comprehensive catalogue of oncogenic drivers associated with colorectal carcinogenesis remains to be discovered. To extend the mutational spectrum in CRC genomes, the first exome-wide screening of approximately genes was conducted by Sanger sequencing [20]. This analysis identified approximately 800 somatic non-silent mutations in 11 CRC genomes. To distinguish oncogenic drivers from neutral passenger mutations, they identified the mutations whose frequency was significantly higher than random. The analysis revealed 69 potential oncogenic driver mutations in CRC genomes, including several well-known cancer-related genes (i.e., TP53, APC, KRAS, SMAD4, and FBXW7), and a large number of previously uncharacterized genes. Since they examined two distinct tumor types (CRC and breast cancers), they were able to identify the differences in the panel of candidate driver genes as well as identify the differences in the mutation spectrum between CRC and breast cancer genomes. The difference in the mutation spectrum (i.e., the predominance of C:G to T: A transitions over C:G to G:C transversions in CRC genomes) was confirmed by a subsequent kinase sequencing study across various cancer types [21] and by a recent wholegenome sequencing of nine CRC genomes [16]. NGS-BASED CRC STUDIES - LESSONS FROM THE CANCER GENOME ATLAS CRC STUDY The advance in sequencing technologies has facilitated the use of genome sequencing for cancer genome studies, including CRC genomes. The largest NGS-based exome sequencing study of CRC genomes to date (approximately 200 CRC genomes) has recently been published as part of the Cancer Genome Atlas (TCGA) projects [22]. The platforms used in the multidimensional genomic characterization of CRC genomes were compared with those used for glioblastoma multiforme in 2008 (Table 3) [23]. Two important lessons from this large-scale multidimensional TCGA CRC analysis are as follows: First, similar to previous findings [20], most of the significantly recurrent mutations were observed at 6786 October 28, 2013 Volume 19 Issue 40

99 Kim TM et al. NGS-based genomic analyses of CRC Bass et al [16] reported whole-genome sequencing (sequencing coverage about 30-fold) of nine CRC genomes. By comparing them with matched normal genomes, they identified approximately putative somatic mutations per CRC genome, which included approximately 700 non-silent point mutations and indels in coding sequences. One advantage of whole-genome sequencing is that the genome-wide landscape of the mutation spectrum in CRC genomes can be obtained, such as the relative paucity of mutations in exons and higher mutation frequency in intergenic regions than introns. This phenomenon is probably due to the selection pressure and transcription-coupled repair, and is consistent with other types of cancer genomes such as prostate cancers [40] and multiple myelomas [41]. Since most of the nonsynonymous nucleotide substitutions were observed at known cancer genes such as KRAS, APC, and TP53, they focused on novel aspects that can only be identified from paired-end whole-genome sequencing data such as chromosomal rearrangements. Among the approximately 700 candidate rearrangements, 11 events give rise to inframe fusion genes. The extended screening further revealed that VTI11A-TCF7L2 fusion is recurrent (3 out of 97 primary CRC genomes) and the sirna-mediated down-regulation of this fusion transcript reduced the anchorage-independent cell growth in vitro, indicative of their potential oncogenic activity. The low-pass (sequencing coverage approximately 3-4-fold) whole-genome sequencing of 97 TCGA CRC genomes also identified three genomes harboring NAV2- TCF7L1 fusion [22]. The predicted protein structures of fusion proteins lacked the β-catenin binding domain of TCF3 (encoded by TCF7L1), which is similar to the fusion of VTI11A-TCF7L2 that lacks the β-catenin binding domain of TCF4 (encoded by TCF7L2). In addition, the inactivation of TTC28 by genomic rearrangements is of note since this event is recurrent (21 out of 97 cases) and involves multiple partners for rearrangements in TCGA CRC genomes [22]. Gene fusions can also be identified from transcriptome sequencing, so called RNAknown cancer-related genes, such as APC, TP53, KRAS, PIK3CA, FBXW7, SMAD4, and NRAS. The study also revealed frequent coding microsatellite instability (MSI) on ACVR2A, TGFBR2, MSH3, and MSH6 by manual examination of sequencing reads for 30 known MSI loci. Although the majority of recurrent mutations were previously known, a number of novel mutations were also identified, which may have functional implications on colorectal tumorigenesis. For example, the mutations in SOX9 [24], FAM123B [25], and 14 other genes are known to be implicated in the altered WNT/APC pathway. Although the biallelic inactivation of APC and the activating mutation of CTNNB1 encoding β-catenin are two major events that occurred in about 74% of the total CRC genomes studied, the mutations and deletions of an additional 16 (about 18%) genes in the WNT/APC pathway were not negligible, leading to the conclusion that nearly all CRC genomes (about 92%) have an alteration in the WNT/APC pathway [22]. A study which assigned potential molecular functions to rare mutations in CRC genomes using the pathway-level convergence was previously reported [26]. Thus, pathwayor network-level information from available resources (i.e., Gene Ontology [27] ) and other methodologies to predict the functional impacts of non-synonymous point mutations [28,29] may help determine the potential functions of rare mutations and distinguish oncogenic drivers in studies with small-sized cohorts. This issue is also related to the sample-size problem in study design. Due to the limits on sample availability and research budget, many of the cancer mutation studies use a small discovery cohort for the generation of candidate mutations that are subsequently validated in an extended set. Increasing the number of samples in the initial discovery set would be beneficial in identifying events that are not highly recurrent but are still clinically meaningful (i.e., gene fusions involving receptor tyrosine kinases with available inhibitors). For example, the frequency of gene fusions such as ALK [30] and RET [31] in lung adenocarcinomas and FGFR [32] in glioblastoma multiforme are less than 5%. Although the level of recurrence is still the generally accepted functional indicator of genomic alterations [33,34], the incorporation of knowledge from other resources may facilitate the identification of biological or clinically relevant mutations more efficiently in a moderate-sized cohort. Second, the concordant and discordant relationships between alterations examined across the samples may reveal valuable functional insights. The concordant relationship adopts the concepts of co-expressed networks in which the genes with significantly correlated expression levels (measured by Pearson s correlation coefficients or mutual information) across diverse cellular conditions may have a functional relationship [35-37]. Importantly, TC- GA-related studies revealed that the exclusivity between the potential oncogenic drivers may be common. For example, TCGA ovarian cancer study showed that the alterations of BRCA1 and BRCA2 (including germline or somatic mutations and epigenetic silencing via promoter hypermethylation) are mutually exclusive to each other [38]. The method to identify the pairs of exclusive genomic alterations is formulated as a standard analysis pipeline in TCGA projects as Mutual Exclusivity Modules (MEMo) in cancer [39]. In CRC genomes, MEMo analysis revealed that nearly half of the TCGA CRC genomes showed an exclusive relationship between the up-regulation of IGF2 and IRS2, and between the mutation of PIK3 pathway genes (PIK3CA and PIK3R1) and the homozygous deletion of PTEN [22]. This suggests that the IGF2-IRS2 axis is a major signaling pathway upstream of the PI3K pathway in CRC genomes [22]. The mutual exclusivity between the mutations of TP53 and ATM was also identified in the TCGA CRC genomes [22]. GENOMIC REARRANGEMENTS AND GENE FUSIONS IN CRC GENOMES 6787 October 28, 2013 Volume 19 Issue 40

100 Kim TM et al. NGS-based genomic analyses of CRC seq [42,43]. A recent RNA-seq-based study revealed recurrent gene fusions involving R-spondin family members of RSPO2 and RSPO3 [44]. These fusions were exclusive to APC mutations in the observed CRC genomes, suggesting their potential roles in activating the APC/WNT pathway in colorectal carcinogenesis. Cancer-related gene fusion events are gaining attention since there has been no effective gene fusion screening method other than NGS-based paired-end sequencing. More importantly, many of the fusion candidates discovered so far represent oncogenic drivers and clinically actionable events (i.e., the fusion activates potential oncogenes such as tyrosine kinases that can be inhibited by small molecule inhibitors) as shown in recent studies [30-32] including the C2orf44- ALK fusion in CRC [45]. In addition, it was proposed that the genomic rearrangements in individual cancer genomes can be used as personal cancer markers to trace the disease activity (i.e., to detect recurrences or to evaluate the tumor burden of residual diseases) [46]. The proposed method, personalized analysis of rearranged ends, was applied to four cancer genomes, including two CRCs in a pilot test. It was demonstrated that the PCR-based quantification of the rearranged DNA in the plasma correlated well with the treatment course of CRC [46]. MICROSATELLITE INSTABILITY IN CRC GENOMES Microsatellites are short tandem repeat sequences present at millions of sites in the human genome [47]. MSI defined as the length polymorphism of microsatellite repeat sequences, can arise due to a defect in the DNA mismatch repair system [48]. MSI is common in hereditary nonpolyposis colon cancers, also known as Lynch syndrome, where germline mutations of MLH1 and MSH2 are commonly observed [49,50]. About 15% of sporadic CRC are microsatellite-unstable, where transcriptional silencing of MLH1 by promoter hypermethylation is common [51,52]. The microsatellite-unstable sporadic CRC has distinct clinical and genomic features (i.e., common in right-sided colons and elderly females, and nearly diploid, etc.) compared to microsatellite-stable, but aneuploid CRC genomes. The key genes targeted by somatic point mutations and MSI-induced frameshifting mutations are different between the microsatellite-stable and -unstable CRC genomes, as shown in the TCGA CRC study [22]. Since the MSI analysis in the TCGA CRC study was limited to a manual search of exome sequencing reads for about 30 known loci with frequent MSI (i.e., TGFBR2, ACVR2A, BAX, etc.), a question remains as to whether we can fully exploit the NGS technology to screen the locus-level MSI in an exome- or genome-wide scale. One interesting report by Wang et al [53] showed that pancreatic cell lines with a homozygous deletion of MLH1 (which is a frequent target of promoter hypermethylation in MSI CRC genomes) frequently harbors truncating indels in TP53 and TGFBR2. This suggests that whole genome- or exome-sequencing data may be used for large-scale MSI screening to identify novel MSI events targeting tumor suppressor genes in cancer genomes. NGS AND CRC EPIGENETICS For decades, DNA methylation has been studied as one of the major cancer-related epigenetic modifications. Until recently, it was recognized that cancer genomes are undermethylated overall, but some genomic loci have focal DNA hypermethylation [54,55]. Transcriptional silencing by focal hypermethylation, especially at the CpG islands of gene promoters, is among the putative inactivating mechanisms of tumor suppressor genes in cancer genomes and often preferred over the inactivation by irreversible nucleotide substitutions [56]. Yet, the landscape of cancer-associated DNA methylation seems more dynamic than previously anticipated, as revealed by genome-wide CRC methylome studies [57,58]. Two recent CRC methylome studies used NGS-based sequencing of bisulfite-treated genomic DNA for bp-resolution methylome profiling [59,60]. Both studies proposed the presence of large blocks of DNA hypomethylation that occupied almost half of the genomes. Additionally, they reported that such findings as the genome-wide methylation variability of the adenoma genome is an intermediate between those of normal epithelium and CRC [60] and the domains of DNA hypomethylation regionally coincided with those of nuclear lamina attachment [59]. In addition, DNA methylation profiling has been also proposed as a means of early CRC diagnosis using non-invasive resources (i.e., blood- or stool-based) [61,62], which can benefit from NGS technologies. NOVEL ASPECTS OF CRC GENOMES BY NGS STUDIES NGS-based genome analysis may facilitate the identification of previously unrecognized, novel features of CRC cancer genomes. For example, owing to its highthroughput nature, NGS analysis may be able to detect the presence of foreign DNA sequences originating from bacterial or viral pathogens. Although the clear association between pathogens and certain human tumor types has been demonstrated in limited cases such as hepatitis B or C viruses with hepatocellular carcinoma, there have been ongoing efforts to use the sequencing data for pathogen discovery [63,64]. For instance, Kostic et al [65,66] analyzed nine CRC whole genome sequencing data sets [16] using their algorithm of PathSeq to identify microbial sequences enriched in CRC genomes compared to those in matched normal genomes. They observed that the sequences of Fusobacterium are enriched in CRC genomes, which was also shown in transcriptome sequencing results by independent researchers [67]. Although the oncogenic role of Fusobacterium in CRC genomes is only beginning to be elucidated [68], these results highlight the possibility that NGS-driven sequencing data will be a valuable resource to identify novel pathogens associated with human cancers October 28, 2013 Volume 19 Issue 40

101 Kim TM et al. NGS-based genomic analyses of CRC Chromothripsis is a unique cancer genome-associated phenomenon in which tens to hundreds of chromosomal rearrangements occur in a one-off cellular event [69]. This phenomenon involves one or a few chromosomes in which massive chromosomal fragmentation is followed by rejoining of the fragments [70]. This results in unique genomic signatures that can be identified by paired-end sequencing (i.e., massive intrachromosomal rearrangements in the affected chromosome that can be visualized in a Circos diagram [71] ) or from copy number profiles (i.e., frequent oscillations between two copy number states indicative of retained and lost chromosomal fragments). After the first discovery of chromothripsis in one chronic lymphocytic leukemia patient by paired-end sequencing [69], Stephens et al [69] also examined the copy number profiles of 746 cancer cell lines, observing that 2.4% of them (18 cell lines) showed the genomic signatures of chromothripsis. Recently, Kim et al [72] reported the tumor type-specific frequencies of chromothripsis as measured from a large-scale copy number profile of about 8000 cancer genomes including CRCs. Six out of 366 CRC genomes (1.8%) in the database showed the signature of chromothripsis (i.e., significant frequent alternation between different copy number states [72] ) and the frequency was not substantially different from the average across the database (1.5%). Of note, Kloosterman et al [73] reported the paired-end whole-genome sequencing results of four CRC genomes with liver metastases, observing that all cases harbored evidence of chromothripsis. In addition, the comparison between primary and metastatic CRC genomes revealed that most genomic arrangements are shared both by primary and metastatic genomes, indicating that metastasis occurs quite rapidly with few additional mutational events, which was also proposed in mutation-based CRC genome studies [74]. Along with chromothripsis, several unique features of cancer genomes have been reported in breast cancer genomes (kataegis; regional hypermutations near rearrangement breakpoints) [75] and in prostate cancer genomes (chromoplexy; chains of copy-neutral rearrangements across multiple chromosomes) [40], which may expand the mutational categories in CRC genomes. CONCLUSION We have discussed the recent NGS-based CRC studies in various genomic aspects. The progress of CRC genomic analysis (but not exclusive to CRC) can be summarized into three issues: (1) the screening of clinically actionable targets for personalized targeted medicine; (2) the advancement of pathway-level understanding in colorectal carcinogenesis using a large-scale cohort; and (3) the identification of novel features or mutation types in CRC genomes. In terms of the first issue, Roychowdhury et al [76] reported an advanced NGS-based cancer patient management protocol that includes low-pass wholegenome, exome, and transcriptome sequencing of cancer genomes. The notable aspects of the protocol are the timeline (< 4 wk after enrollment) and cost (approximately 3600 USD), as well as the presence of a multidisciplinary sequencing tumor board (STB) to evaluate the mutation profiles of the patients and make a clinical decision. In their pilot study, the STB evaluated the sequencing results from a patient with metastatic CRC harboring NRAS mutation and CDK8 amplification and concluded that BRAF/MEK inhibitors and PI3K and/or CDK inhibitors could be beneficial for the patient. Second, the more complete and comprehensive collection of CRC-related somatic genomic alterations will advance the pathwaylevel understanding of colorectal carcinogenesis and help distinguish the oncogenic drivers from neutral passengers, as seen in large-scale meta-analyses of cancer genome profiles [72,77]. Finally, NGS-driven genomic studies are already reporting novel features of cancer genomes beyond the traditional mutational categories. Besides the MSI and chromothripsis we discussed, some researchers used publicly available genome sequencing data (including those of CRC genomes [16] ) and reported novel mitochondrial mutations [78] and the activity of human retrotranspositions in the cancer genomes [79]. Taken together, NGS technology will advance our understanding of CRC genomes and the obtained knowledge will lead to a better diagnosis and personalized targeted therapeutics for CRC management. REFERENCES 1 Shike M, Winawer SJ, Greenwald PH, Bloch A, Hill MJ, Swaroop SV. Primary prevention of colorectal cancer. The WHO Collaborating Centre for the Prevention of Colorectal Cancer. Bull World Health Organ 1990; 68: [PMID: ] 2 Winawer SJ, Zauber AG, Ho MN, O Brien MJ, Gottlieb LS, Sternberg SS, Waye JD, Schapiro M, Bond JH, Panish JF. Prevention of colorectal cancer by colonoscopic polypectomy. The National Polyp Study Workgroup. N Engl J Med 1993; 329: [PMID: DOI: / NEJM ] 3 O Connell JB, Maggard MA, Ko CY. Colon cancer survival rates with the new American Joint Committee on Cancer sixth edition staging. J Natl Cancer Inst 2004; 96: [PMID: ] 4 Fearon ER. Molecular genetics of colorectal cancer. Annu Rev Pathol 2011; 6: [PMID: DOI: / annurev-pathol ] 5 Huxley RR, Ansary-Moghaddam A, Clifton P, Czernichow S, Parr CL, Woodward M. The impact of dietary and lifestyle risk factors on risk of colorectal cancer: a quantitative overview of the epidemiological evidence. Int J Cancer 2009; 125: [PMID: DOI: /ijc.24343] 6 Kim MY, Yim SH, Kwon MS, Kim TM, Shin SH, Kang HM, Lee C, Chung YJ. Recurrent genomic alterations with impact on survival in colorectal cancer identified by genome-wide array comparative genomic hybridization. Gastroenterology 2006; 131: [PMID: DOI: / j.gastro ] 7 Liotta L, Petricoin E. Molecular profiling of human cancer. Nat Rev Genet 2000; 1: [PMID: DOI: / ] 8 Stratton MR, Campbell PJ, Futreal PA. The cancer genome. Nature 2009; 458: [PMID: DOI: /nature07943] 6789 October 28, 2013 Volume 19 Issue 40

102 Kim TM et al. NGS-based genomic analyses of CRC 9 Kahvejian A, Quackenbush J, Thompson JF. What would you do if you could sequence everything? Nat Biotechnol 2008; 26: [PMID: DOI: /nbt1494] 10 Shendure J, Ji H. Next-generation DNA sequencing. Nat Biotechnol 2008; 26: [PMID: DOI: / nbt1486] 11 Ley TJ, Mardis ER, Ding L, Fulton B, McLellan MD, Chen K, Dooling D, Dunford-Shore BH, McGrath S, Hickenbotham M, Cook L, Abbott R, Larson DE, Koboldt DC, Pohl C, Smith S, Hawkins A, Abbott S, Locke D, Hillier LW, Miner T, Fulton L, Magrini V, Wylie T, Glasscock J, Conyers J, Sander N, Shi X, Osborne JR, Minx P, Gordon D, Chinwalla A, Zhao Y, Ries RE, Payton JE, Westervelt P, Tomasson MH, Watson M, Baty J, Ivanovich J, Heath S, Shannon WD, Nagarajan R, Walter MJ, Link DC, Graubert TA, DiPersio JF, Wilson RK. DNA sequencing of a cytogenetically normal acute myeloid leukaemia genome. Nature 2008; 456: [PMID: DOI: /nature07485] 12 Mardis ER. Genome sequencing and cancer. Curr Opin Genet Dev 2012; 22: [PMID: DOI: / j.gde ] 13 Meyerson M, Gabriel S, Getz G. Advances in understanding cancer genomes through second-generation sequencing. Nat Rev Genet 2010; 11: [PMID: DOI: / nrg2841] 14 Agrawal N, Jiao Y, Bettegowda C, Hutfless SM, Wang Y, David S, Cheng Y, Twaddell WS, Latt NL, Shin EJ, Wang LD, Wang L, Yang W, Velculescu VE, Vogelstein B, Papadopoulos N, Kinzler KW, Meltzer SJ. Comparative genomic analysis of esophageal adenocarcinoma and squamous cell carcinoma. Cancer Discov 2012; 2: [PMID: DOI: / CD ] 15 Zang ZJ, Cutcutache I, Poon SL, Zhang SL, McPherson JR, Tao J, Rajasegaran V, Heng HL, Deng N, Gan A, Lim KH, Ong CK, Huang D, Chin SY, Tan IB, Ng CC, Yu W, Wu Y, Lee M, Wu J, Poh D, Wan WK, Rha SY, So J, Salto-Tellez M, Yeoh KG, Wong WK, Zhu YJ, Futreal PA, Pang B, Ruan Y, Hillmer AM, Bertrand D, Nagarajan N, Rozen S, Teh BT, Tan P. Exome sequencing of gastric adenocarcinoma identifies recurrent somatic mutations in cell adhesion and chromatin remodeling genes. Nat Genet 2012; 44: [PMID: DOI: /ng.2246] 16 Bass AJ, Lawrence MS, Brace LE, Ramos AH, Drier Y, Cibulskis K, Sougnez C, Voet D, Saksena G, Sivachenko A, Jing R, Parkin M, Pugh T, Verhaak RG, Stransky N, Boutin AT, Barretina J, Solit DB, Vakiani E, Shao W, Mishina Y, Warmuth M, Jimenez J, Chiang DY, Signoretti S, Kaelin WG, Spardy N, Hahn WC, Hoshida Y, Ogino S, Depinho RA, Chin L, Garraway LA, Fuchs CS, Baselga J, Tabernero J, Gabriel S, Lander ES, Getz G, Meyerson M. Genomic sequencing of colorectal adenocarcinomas identifies a recurrent VTI1A- TCF7L2 fusion. Nat Genet 2011; 43: [PMID: DOI: /ng.936] 17 Fujimoto A, Totoki Y, Abe T, Boroevich KA, Hosoda F, Nguyen HH, Aoki M, Hosono N, Kubo M, Miya F, Arai Y, Takahashi H, Shirakihara T, Nagasaki M, Shibuya T, Nakano K, Watanabe-Makino K, Tanaka H, Nakamura H, Kusuda J, Ojima H, Shimada K, Okusaka T, Ueno M, Shigekawa Y, Kawakami Y, Arihiro K, Ohdan H, Gotoh K, Ishikawa O, Ariizumi S, Yamamoto M, Yamada T, Chayama K, Kosuge T, Yamaue H, Kamatani N, Miyano S, Nakagama H, Nakamura Y, Tsunoda T, Shibata T, Nakagawa H. Whole-genome sequencing of liver cancers identifies etiological influences on mutation patterns and recurrent mutations in chromatin regulators. Nat Genet 2012; 44: [PMID: DOI: /ng.2291] 18 Li M, Zhao H, Zhang X, Wood LD, Anders RA, Choti MA, Pawlik TM, Daniel HD, Kannangai R, Offerhaus GJ, Velculescu VE, Wang L, Zhou S, Vogelstein B, Hruban RH, Papadopoulos N, Cai J, Torbenson MS, Kinzler KW. Inactivating mutations of the chromatin remodeling gene ARID2 in hepatocellular carcinoma. Nat Genet 2011; 43: [PMID: DOI: /ng.903] 19 Markowitz SD, Bertagnolli MM. Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med 2009; 361: [PMID: DOI: /NEJMra ] 20 Sjöblom T, Jones S, Wood LD, Parsons DW, Lin J, Barber TD, Mandelker D, Leary RJ, Ptak J, Silliman N, Szabo S, Buckhaults P, Farrell C, Meeh P, Markowitz SD, Willis J, Dawson D, Willson JK, Gazdar AF, Hartigan J, Wu L, Liu C, Parmigiani G, Park BH, Bachman KE, Papadopoulos N, Vogelstein B, Kinzler KW, Velculescu VE. The consensus coding sequences of human breast and colorectal cancers. Science 2006; 314: [PMID: DOI: /science ] 21 Greenman C, Stephens P, Smith R, Dalgliesh GL, Hunter C, Bignell G, Davies H, Teague J, Butler A, Stevens C, Edkins S, O Meara S, Vastrik I, Schmidt EE, Avis T, Barthorpe S, Bhamra G, Buck G, Choudhury B, Clements J, Cole J, Dicks E, Forbes S, Gray K, Halliday K, Harrison R, Hills K, Hinton J, Jenkinson A, Jones D, Menzies A, Mironenko T, Perry J, Raine K, Richardson D, Shepherd R, Small A, Tofts C, Varian J, Webb T, West S, Widaa S, Yates A, Cahill DP, Louis DN, Goldstraw P, Nicholson AG, Brasseur F, Looijenga L, Weber BL, Chiew YE, DeFazio A, Greaves MF, Green AR, Campbell P, Birney E, Easton DF, Chenevix-Trench G, Tan MH, Khoo SK, Teh BT, Yuen ST, Leung SY, Wooster R, Futreal PA, Stratton MR. Patterns of somatic mutation in human cancer genomes. Nature 2007; 446: [PMID: DOI: /nature05610] 22 Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012; 487: [PMID: DOI: /nature11252] 23 Cancer Genome Atlas Research Network. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008; 455: [PMID: DOI: /nature07385] 24 Topol L, Chen W, Song H, Day TF, Yang Y. Sox9 inhibits Wnt signaling by promoting beta-catenin phosphorylation in the nucleus. J Biol Chem 2009; 284: [PMID: DOI: /jbc.M ] 25 Major MB, Camp ND, Berndt JD, Yi X, Goldenberg SJ, Hubbert C, Biechele TL, Gingras AC, Zheng N, Maccoss MJ, Angers S, Moon RT. Wilms tumor suppressor WTX negatively regulates WNT/beta-catenin signaling. Science 2007; 316: [PMID: DOI: /science/ ] 26 Torkamani A, Schork NJ. Identification of rare cancer driver mutations by network reconstruction. Genome Res 2009; 19: [PMID: DOI: /gr ] 27 Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000; 25: [PMID: DOI: /75556] 28 Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods 2010; 7: [PMID: DOI: / nmeth ] 29 Ng PC, Henikoff S. Predicting the effects of amino acid substitutions on protein function. Annu Rev Genomics Hum Genet 2006; 7: [PMID: DOI: /annurev. genom ] 30 Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, Bando M, Ohno S, Ishikawa Y, Aburatani H, Niki T, Sohara Y, Sugiyama Y, Mano H. Identification of the transform October 28, 2013 Volume 19 Issue 40

103 Kim TM et al. NGS-based genomic analyses of CRC ing EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007; 448: [PMID: DOI: /nature05945] 31 Kohno T, Ichikawa H, Totoki Y, Yasuda K, Hiramoto M, Nammo T, Sakamoto H, Tsuta K, Furuta K, Shimada Y, Iwakawa R, Ogiwara H, Oike T, Enari M, Schetter AJ, Okayama H, Haugen A, Skaug V, Chiku S, Yamanaka I, Arai Y, Watanabe S, Sekine I, Ogawa S, Harris CC, Tsuda H, Yoshida T, Yokota J, Shibata T. KIF5B-RET fusions in lung adenocarcinoma. Nat Med 2012; 18: [PMID: DOI: /nm.2644] 32 Singh D, Chan JM, Zoppoli P, Niola F, Sullivan R, Castano A, Liu EM, Reichel J, Porrati P, Pellegatta S, Qiu K, Gao Z, Ceccarelli M, Riccardi R, Brat DJ, Guha A, Aldape K, Golfinos JG, Zagzag D, Mikkelsen T, Finocchiaro G, Lasorella A, Rabadan R, Iavarone A. Transforming fusions of FGFR and TACC genes in human glioblastoma. Science 2012; 337: [PMID: DOI: /science ] 33 Banerji S, Cibulskis K, Rangel-Escareno C, Brown KK, Carter SL, Frederick AM, Lawrence MS, Sivachenko AY, Sougnez C, Zou L, Cortes ML, Fernandez-Lopez JC, Peng S, Ardlie KG, Auclair D, Bautista-Piña V, Duke F, Francis J, Jung J, Maffuz- Aziz A, Onofrio RC, Parkin M, Pho NH, Quintanar-Jurado V, Ramos AH, Rebollar-Vega R, Rodriguez-Cuevas S, Romero- Cordoba SL, Schumacher SE, Stransky N, Thompson KM, Uribe-Figueroa L, Baselga J, Beroukhim R, Polyak K, Sgroi DC, Richardson AL, Jimenez-Sanchez G, Lander ES, Gabriel SB, Garraway LA, Golub TR, Melendez-Zajgla J, Toker A, Getz G, Hidalgo-Miranda A, Meyerson M. Sequence analysis of mutations and translocations across breast cancer subtypes. Nature 2012; 486: [PMID: DOI: /nature11154] 34 Beroukhim R, Getz G, Nghiemphu L, Barretina J, Hsueh T, Linhart D, Vivanco I, Lee JC, Huang JH, Alexander S, Du J, Kau T, Thomas RK, Shah K, Soto H, Perner S, Prensner J, Debiasi RM, Demichelis F, Hatton C, Rubin MA, Garraway LA, Nelson SF, Liau L, Mischel PS, Cloughesy TF, Meyerson M, Golub TA, Lander ES, Mellinghoff IK, Sellers WR. Assessing the significance of chromosomal aberrations in cancer: methodology and application to glioma. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: /pnas ] 35 Barabási AL, Oltvai ZN. Network biology: understanding the cell s functional organization. Nat Rev Genet 2004; 5: [PMID: DOI: /nrg1272] 36 Basso K, Margolin AA, Stolovitzky G, Klein U, Dalla-Favera R, Califano A. Reverse engineering of regulatory networks in human B cells. Nat Genet 2005; 37: [PMID: DOI: /ng1532] 37 Carter SL, Brechbühler CM, Griffin M, Bond AT. Gene coexpression network topology provides a framework for molecular characterization of cellular state. Bioinformatics 2004; 20: [PMID: DOI: /bioinformatics/bth234] 38 Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature 2011; 474: [PMID: DOI: /nature10166] 39 Ciriello G, Cerami E, Sander C, Schultz N. Mutual exclusivity analysis identifies oncogenic network modules. Genome Res 2012; 22: [PMID: DOI: / gr ] 40 Berger MF, Lawrence MS, Demichelis F, Drier Y, Cibulskis K, Sivachenko AY, Sboner A, Esgueva R, Pflueger D, Sougnez C, Onofrio R, Carter SL, Park K, Habegger L, Ambrogio L, Fennell T, Parkin M, Saksena G, Voet D, Ramos AH, Pugh TJ, Wilkinson J, Fisher S, Winckler W, Mahan S, Ardlie K, Baldwin J, Simons JW, Kitabayashi N, MacDonald TY, Kantoff PW, Chin L, Gabriel SB, Gerstein MB, Golub TR, Meyerson M, Tewari A, Lander ES, Getz G, Rubin MA, Garraway LA. The genomic complexity of primary human prostate cancer. Nature 2011; 470: [PMID: DOI: /nature09744] 41 Chapman MA, Lawrence MS, Keats JJ, Cibulskis K, Sougnez C, Schinzel AC, Harview CL, Brunet JP, Ahmann GJ, Adli M, Anderson KC, Ardlie KG, Auclair D, Baker A, Bergsagel PL, Bernstein BE, Drier Y, Fonseca R, Gabriel SB, Hofmeister CC, Jagannath S, Jakubowiak AJ, Krishnan A, Levy J, Liefeld T, Lonial S, Mahan S, Mfuko B, Monti S, Perkins LM, Onofrio R, Pugh TJ, Rajkumar SV, Ramos AH, Siegel DS, Sivachenko A, Stewart AK, Trudel S, Vij R, Voet D, Winckler W, Zimmerman T, Carpten J, Trent J, Hahn WC, Garraway LA, Meyerson M, Lander ES, Getz G, Golub TR. Initial genome sequencing and analysis of multiple myeloma. Nature 2011; 471: [PMID: DOI: /nature09837] 42 Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, Sam L, Barrette T, Palanisamy N, Chinnaiyan AM. Transcriptome sequencing to detect gene fusions in cancer. Nature 2009; 458: [PMID: DOI: /nature07638] 43 Zhao Q, Caballero OL, Levy S, Stevenson BJ, Iseli C, de Souza SJ, Galante PA, Busam D, Leversha MA, Chadalavada K, Rogers YH, Venter JC, Simpson AJ, Strausberg RL. Transcriptome-guided characterization of genomic rearrangements in a breast cancer cell line. Proc Natl Acad Sci USA 2009; 106: [PMID: DOI: / pnas ] 44 Seshagiri S, Stawiski EW, Durinck S, Modrusan Z, Storm EE, Conboy CB, Chaudhuri S, Guan Y, Janakiraman V, Jaiswal BS, Guillory J, Ha C, Dijkgraaf GJ, Stinson J, Gnad F, Huntley MA, Degenhardt JD, Haverty PM, Bourgon R, Wang W, Koeppen H, Gentleman R, Starr TK, Zhang Z, Largaespada DA, Wu TD, de Sauvage FJ. Recurrent R-spondin fusions in colon cancer. Nature 2012; 488: [PMID: DOI: /nature11282] 45 Lipson D, Capelletti M, Yelensky R, Otto G, Parker A, Jarosz M, Curran JA, Balasubramanian S, Bloom T, Brennan KW, Donahue A, Downing SR, Frampton GM, Garcia L, Juhn F, Mitchell KC, White E, White J, Zwirko Z, Peretz T, Nechushtan H, Soussan-Gutman L, Kim J, Sasaki H, Kim HR, Park SI, Ercan D, Sheehan CE, Ross JS, Cronin MT, Jänne PA, Stephens PJ. Identification of new ALK and RET gene fusions from colorectal and lung cancer biopsies. Nat Med 2012; 18: [PMID: DOI: /nm.2673] 46 Leary RJ, Kinde I, Diehl F, Schmidt K, Clouser C, Duncan C, Antipova A, Lee C, McKernan K, De La Vega FM, Kinzler KW, Vogelstein B, Diaz LA, Velculescu VE. Development of personalized tumor biomarkers using massively parallel sequencing. Sci Transl Med 2010; 2: 20ra14 [PMID: DOI: /scitranslmed ] 47 Sharma PC, Grover A, Kahl G. Mining microsatellites in eukaryotic genomes. Trends Biotechnol 2007; 25: [PMID: DOI: /j.tibtech ] 48 Boland CR, Goel A. Microsatellite instability in colorectal cancer. Gastroenterology 2010; 138: e3 [PMID: DOI: /j.gastro ] 49 Bronner CE, Baker SM, Morrison PT, Warren G, Smith LG, Lescoe MK, Kane M, Earabino C, Lipford J, Lindblom A. Mutation in the DNA mismatch repair gene homologue hmlh1 is associated with hereditary non-polyposis colon cancer. Nature 1994; 368: [PMID: DOI: /368258a0] 50 Leach FS, Nicolaides NC, Papadopoulos N, Liu B, Jen J, Parsons R, Peltomäki P, Sistonen P, Aaltonen LA, Nyström- Lahti M. Mutations of a muts homolog in hereditary nonpolyposis colorectal cancer. Cell 1993; 75: [PMID: DOI: / (93)90330-S] 51 Herman JG, Umar A, Polyak K, Graff JR, Ahuja N, Issa JP, Markowitz S, Willson JK, Hamilton SR, Kinzler KW, Kane MF, Kolodner RD, Vogelstein B, Kunkel TA, Baylin SB. Incidence and functional consequences of hmlh1 promoter 6791 October 28, 2013 Volume 19 Issue 40

104 Kim TM et al. NGS-based genomic analyses of CRC hypermethylation in colorectal carcinoma. Proc Natl Acad Sci USA 1998; 95: [PMID: DOI: / pnas ] 52 Veigl ML, Kasturi L, Olechnowicz J, Ma AH, Lutterbaugh JD, Periyasamy S, Li GM, Drummond J, Modrich PL, Sedwick WD, Markowitz SD. Biallelic inactivation of hmlh1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers. Proc Natl Acad Sci USA 1998; 95: [PMID: DOI: /pnas ] 53 Wang L, Tsutsumi S, Kawaguchi T, Nagasaki K, Tatsuno K, Yamamoto S, Sang F, Sonoda K, Sugawara M, Saiura A, Hirono S, Yamaue H, Miki Y, Isomura M, Totoki Y, Nagae G, Isagawa T, Ueda H, Murayama-Hosokawa S, Shibata T, Sakamoto H, Kanai Y, Kaneda A, Noda T, Aburatani H. Whole-exome sequencing of human pancreatic cancers and characterization of genomic instability caused by MLH1 haploinsufficiency and complete deficiency. Genome Res 2012; 22: [PMID: DOI: /gr ] 54 Herman JG, Baylin SB. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003; 349: [PMID: DOI: /NEJMra023075] 55 Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet 2002; 3: [PMID: ] 56 Chan TA, Glockner S, Yi JM, Chen W, Van Neste L, Cope L, Herman JG, Velculescu V, Schuebel KE, Ahuja N, Baylin SB. Convergence of mutation and epigenetic alterations identifies common genes in cancer that predict for poor prognosis. PLoS Med 2008; 5: e114 [PMID: DOI: /journal.pmed ] 57 Frigola J, Song J, Stirzaker C, Hinshelwood RA, Peinado MA, Clark SJ. Epigenetic remodeling in colorectal cancer results in coordinate gene suppression across an entire chromosome band. Nat Genet 2006; 38: [PMID: DOI: /ng1781] 58 Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P, Cui H, Gabo K, Rongione M, Webster M, Ji H, Potash JB, Sabunciyan S, Feinberg AP. The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet 2009; 41: [PMID: DOI: /ng.298] 59 Berman BP, Weisenberger DJ, Aman JF, Hinoue T, Ramjan Z, Liu Y, Noushmehr H, Lange CP, van Dijk CM, Tollenaar RA, Van Den Berg D, Laird PW. Regions of focal DNA hypermethylation and long-range hypomethylation in colorectal cancer coincide with nuclear lamina-associated domains. Nat Genet 2012; 44: [PMID: DOI: /ng.969] 60 Hansen KD, Timp W, Bravo HC, Sabunciyan S, Langmead B, McDonald OG, Wen B, Wu H, Liu Y, Diep D, Briem E, Zhang K, Irizarry RA, Feinberg AP. Increased methylation variation in epigenetic domains across cancer types. Nat Genet 2011; 43: [PMID: DOI: /ng.865] 61 Glöckner SC, Dhir M, Yi JM, McGarvey KE, Van Neste L, Louwagie J, Chan TA, Kleeberger W, de Bruïne AP, Smits KM, Khalid-de Bakker CA, Jonkers DM, Stockbrügger RW, Meijer GA, Oort FA, Iacobuzio-Donahue C, Bierau K, Herman JG, Baylin SB, Van Engeland M, Schuebel KE, Ahuja N. Methylation of TFPI2 in stool DNA: a potential novel biomarker for the detection of colorectal cancer. Cancer Res 2009; 69: [PMID: DOI: / CAN ] 62 Warren JD, Xiong W, Bunker AM, Vaughn CP, Furtado LV, Roberts WL, Fang JC, Samowitz WS, Heichman KA. Septin 9 methylated DNA is a sensitive and specific blood test for colorectal cancer. BMC Med 2011; 9: 133 [PMID: DOI: / ] 63 Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 2008; 319: [PMID: DOI: /science ] 64 Weber G, Shendure J, Tanenbaum DM, Church GM, Meyerson M. Identification of foreign gene sequences by transcript filtering against the human genome. Nat Genet 2002; 30: [PMID: ] 65 Kostic AD, Ojesina AI, Pedamallu CS, Jung J, Verhaak RG, Getz G, Meyerson M. PathSeq: software to identify or discover microbes by deep sequencing of human tissue. Nat Biotechnol 2011; 29: [PMID: DOI: / nbt.1868] 66 Kostic AD, Gevers D, Pedamallu CS, Michaud M, Duke F, Earl AM, Ojesina AI, Jung J, Bass AJ, Tabernero J, Baselga J, Liu C, Shivdasani RA, Ogino S, Birren BW, Huttenhower C, Garrett WS, Meyerson M. Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome Res 2012; 22: [PMID: DOI: / gr ] 67 Castellarin M, Warren RL, Freeman JD, Dreolini L, Krzywinski M, Strauss J, Barnes R, Watson P, Allen-Vercoe E, Moore RA, Holt RA. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res 2012; 22: [PMID: DOI: /gr ] 68 McCoy AN, Araújo-Pérez F, Azcárate-Peril A, Yeh JJ, Sandler RS, Keku TO. Fusobacterium is associated with colorectal adenomas. PLoS One 2013; 8: e53653 [PMID: DOI: /journal.pone ] 69 Stephens PJ, Greenman CD, Fu B, Yang F, Bignell GR, Mudie LJ, Pleasance ED, Lau KW, Beare D, Stebbings LA, McLaren S, Lin ML, McBride DJ, Varela I, Nik-Zainal S, Leroy C, Jia M, Menzies A, Butler AP, Teague JW, Quail MA, Burton J, Swerdlow H, Carter NP, Morsberger LA, Iacobuzio-Donahue C, Follows GA, Green AR, Flanagan AM, Stratton MR, Futreal PA, Campbell PJ. Massive genomic rearrangement acquired in a single catastrophic event during cancer development. Cell 2011; 144: [PMID: DOI: / j.cell ] 70 Jones MJ, Jallepalli PV. Chromothripsis: chromosomes in crisis. Dev Cell 2012; 23: [PMID: DOI: /j.devcel ] 71 Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, Horsman D, Jones SJ, Marra MA. Circos: an information aesthetic for comparative genomics. Genome Res 2009; 19: [PMID: DOI: /gr ] 72 Kim TM, Xi R, Luquette LJ, Park RW, Johnson MD, Park PJ. Functional genomic analysis of chromosomal aberrations in a compendium of 8000 cancer genomes. Genome Res 2013; 23: [PMID: DOI: /gr ] 73 Kloosterman WP, Hoogstraat M, Paling O, Tavakoli-Yaraki M, Renkens I, Vermaat JS, van Roosmalen MJ, van Lieshout S, Nijman IJ, Roessingh W, van t Slot R, van de Belt J, Guryev V, Koudijs M, Voest E, Cuppen E. Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer. Genome Biol 2011; 12: R103 [PMID: DOI: /gb r103] 74 Jones S, Chen WD, Parmigiani G, Diehl F, Beerenwinkel N, Antal T, Traulsen A, Nowak MA, Siegel C, Velculescu VE, Kinzler KW, Vogelstein B, Willis J, Markowitz SD. Comparative lesion sequencing provides insights into tumor evolution. Proc Natl Acad Sci USA 2008; 105: [PMID: DOI: /pnas ] 75 Nik-Zainal S, Alexandrov LB, Wedge DC, Van Loo P, Greenman CD, Raine K, Jones D, Hinton J, Marshall J, Stebbings LA, Menzies A, Martin S, Leung K, Chen L, Leroy C, Ramakrishna M, Rance R, Lau KW, Mudie LJ, Varela I, Mc- Bride DJ, Bignell GR, Cooke SL, Shlien A, Gamble J, Whitmore I, Maddison M, Tarpey PS, Davies HR, Papaemmanuil E, Stephens PJ, McLaren S, Butler AP, Teague JW, Jönsson G, Garber JE, Silver D, Miron P, Fatima A, Boyault S, Langerød A, Tutt A, Martens JW, Aparicio SA, Borg Å, Salomon AV, Thomas G, Børresen-Dale AL, Richardson AL, Neuberger 6792 October 28, 2013 Volume 19 Issue 40

105 Kim TM et al. NGS-based genomic analyses of CRC MS, Futreal PA, Campbell PJ, Stratton MR. Mutational processes molding the genomes of 21 breast cancers. Cell 2012; 149: [PMID: DOI: /j.cell ] 76 Roychowdhury S, Iyer MK, Robinson DR, Lonigro RJ, Wu YM, Cao X, Kalyana-Sundaram S, Sam L, Balbin OA, Quist MJ, Barrette T, Everett J, Siddiqui J, Kunju LP, Navone N, Araujo JC, Troncoso P, Logothetis CJ, Innis JW, Smith DC, Lao CD, Kim SY, Roberts JS, Gruber SB, Pienta KJ, Talpaz M, Chinnaiyan AM. Personalized oncology through integrative high-throughput sequencing: a pilot study. Sci Transl Med 2011; 3: 111ra121 [PMID: ] 77 Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, Donovan J, Barretina J, Boehm JS, Dobson J, Urashima M, Mc Henry KT, Pinchback RM, Ligon AH, Cho YJ, Haery L, Greulich H, Reich M, Winckler W, Lawrence MS, Weir BA, Tanaka KE, Chiang DY, Bass AJ, Loo A, Hoffman C, Prensner J, Liefeld T, Gao Q, Yecies D, Signoretti S, Maher E, Kaye FJ, Sasaki H, Tepper JE, Fletcher JA, Tabernero J, Baselga J, Tsao MS, Demichelis F, Rubin MA, Janne PA, Daly MJ, Nucera C, Levine RL, Ebert BL, Gabriel S, Rustgi AK, Antonescu CR, Ladanyi M, Letai A, Garraway LA, Loda M, Beer DG, True LD, Okamoto A, Pomeroy SL, Singer S, Golub TR, Lander ES, Getz G, Sellers WR, Meyerson M. The landscape of somatic copy-number alteration across human cancers. Nature 2010; 463: [PMID: DOI: /nature08822] 78 Larman TC, DePalma SR, Hadjipanayis AG, Protopopov A, Zhang J, Gabriel SB, Chin L, Seidman CE, Kucherlapati R, Seidman JG. Spectrum of somatic mitochondrial mutations in five cancers. Proc Natl Acad Sci USA 2012; 109: [PMID: DOI: /pnas ] 79 Lee E, Iskow R, Yang L, Gokcumen O, Haseley P, Luquette LJ, Lohr JG, Harris CC, Ding L, Wilson RK, Wheeler DA, Gibbs RA, Kucherlapati R, Lee C, Kharchenko PV, Park PJ. Landscape of somatic retrotransposition in human cancers. Science 2012; 337: [PMID: DOI: /science ] 80 Park PJ. ChIP-seq: advantages and challenges of a maturing technology. Nat Rev Genet 2009; 10: [PMID: DOI: /nrg2641] 81 Chen K, Wallis JW, McLellan MD, Larson DE, Kalicki JM, Pohl CS, McGrath SD, Wendl MC, Zhang Q, Locke DP, Shi X, Fulton RS, Ley TJ, Wilson RK, Ding L, Mardis ER. BreakDancer: an algorithm for high-resolution mapping of genomic structural variation. Nat Methods 2009; 6: [PMID: DOI: /nmeth.1363] 82 Xi R, Hadjipanayis AG, Luquette LJ, Kim TM, Lee E, Zhang J, Johnson MD, Muzny DM, Wheeler DA, Gibbs RA, Kucherlapati R, Park PJ. Copy number variation detection in wholegenome sequencing data using the Bayesian information criterion. Proc Natl Acad Sci USA 2011; 108: E1128-E1136 [PMID: DOI: /pnas ] 83 Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C, Gabriel S, Meyerson M, Lander ES, Getz G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotechnol 2013; 31: [PMID: DOI: /nbt.2514] 84 Timmermann B, Kerick M, Roehr C, Fischer A, Isau M, Boerno ST, Wunderlich A, Barmeyer C, Seemann P, Koenig J, Lappe M, Kuss AW, Garshasbi M, Bertram L, Trappe K, Werber M, Herrmann BG, Zatloukal K, Lehrach H, Schweiger MR. Somatic mutation profiles of MSI and MSS colorectal cancer identified by whole exome next generation sequencing and bioinformatics analysis. PLoS One 2010; 5: e15661 [PMID: DOI: /journal.pone ] 85 Zhou D, Yang L, Zheng L, Ge W, Li D, Zhang Y, Hu X, Gao Z, Xu J, Huang Y, Hu H, Zhang H, Zhang H, Liu M, Yang H, Zheng L, Zheng S. Exome capture sequencing of adenoma reveals genetic alterations in multiple cellular pathways at the early stage of colorectal tumorigenesis. PLoS One 2013; 8: e53310 [PMID: DOI: /journal.pone ] 86 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. The Sequence Alignment/ Map format and SAMtools. Bioinformatics 2009; 25: [PMID: DOI: /bioinformatics/btp352] 87 Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009; 25: [PMID: DOI: /bioinformatics/ btp324] 88 Brannon AR, Vakiani E, Scott S, Sylvester B, Kania K, Viale A, Solit D, Berger M. Targeted next-generation sequencing of colorectal cancer identified metastatics specific genetic alterations. BMC Proceedings 2012; 6: P3 89 Yin H, Liang Y, Yan Z, Liu B, Su Q. Mutation spectrum in human colorectal cancers and potential functional relevance. BMC Med Genet 2013; 14: 32 [PMID: ] P- Reviewers Parsak C S- Editor Wen LL L- Editor Webster JR E- Editor Wang CH 6793 October 28, 2013 Volume 19 Issue 40

106 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. REVIEW Gut-lung crosstalk in pulmonary involvement with inflammatory bowel diseases Hui Wang, Jing-Shi Liu, Shao-Hua Peng, Xi-Yun Deng, De-Mao Zhu, Sara Javidiparsijani, Gui-Rong Wang, Dai-Qiang Li, Long-Xuan Li, Yi-Chun Wang, Jun-Ming Luo Hui Wang, Jing-Shi Liu, Shao-Hua Peng, Xi-Yun Deng, De- Mao Zhu, Sara Javidiparsijani, Gui-Rong Wang, Dai-Qiang Li, Long-Xuan Li, Yi-Chun Wang, Jun-Ming Luo, Department of Radiation Oncology, the Affiliated Hunan Provincial Tumor Hospital, Xiangya Medical School, Central South University, Changsha , Hunan Province, China Jun-Ming Luo, Department of Pathology, Qinghai Provincial People's Hospital, Xining , Qinghai Province, China Jing-Shi Liu, Yi-Chun Wang, Department of Anesthesiology, the Affiliated Hunan Provincial Tumor Hospital at Central South University, Changsha , Hunan Province, China Shao-Hua Peng, Xi-Yun Deng, Department of Pathology, Medical College of Hunan Normal University, Changsha , Hunan Province, China De-Mao Zhu, Department of Pathology, Changsha Central Hospital, Changsha , Hunan Province, China Sara Javidiparsijani, Gui-Rong Wang, Department of Surgery, SUNY Upstate Medical University, Syracuse, NY 13210, United States Dai-Qiang Li, Department of Pathology, the Second Affiliated Hospital, Xiangya Medical School, Central South University, Changsha , Hunan Province, China Long-Xuan Li, Department of Neurology, Guangdong Medical College Affiliated Hospital, Zhanjiang , Guangdong Province, China Author contributions: Wang H, Liu JS and Peng SH contributed equally to this work; Luo JM, Wang H, Liu JS, Peng SH, Zhu DM, Deng XY and Wang YC designed the study; Luo JM Wang H, Liu JS and Li LX analyzed data; Luo JM, Wang H and Liu JS wrote the paper; Li DQ, Javidiparsijani S and Wang GR revised the paper and provided important suggestions; all authors have read and approved the final manuscript. Correspondence to: Jun-Ming Luo, MD, Professor of Pathology, Department of Pathology, Qinghai Provincial People's Hospital, 2 Gonghe Road, Xining , Qinghai Province, China. jluo099@163.com Telephone: Fax: Received: May 31, 2013 Revised: July 22, 2013 Accepted: September 4, 2013 Published online: October 28, 2013 Abstract Pulmonary abnormalities, dysfunction or hyper-reactivity occurs in association with inflammatory bowel disease (IBD) more frequently than previously recognized. Emerging evidence suggests that subtle inflammation exists in the airways among IBD patients even in the absence of any bronchopulmonary symptoms, and with normal pulmonary functions. The pulmonary impairment is more pronounced in IBD patients with active disease than in those in remission. A growing number of case reports show that the IBD patients develop rapidly progressive respiratory symptoms after colectomy, with failure to isolate bacterial pathogens on repeated sputum culture, and often request oral corticosteroid therapy. All the above evidence indicates that the inflammatory changes in both the intestine and lung during IBD. Clinical or subclinical pulmonary inflammation accompanies the main inflammation of the bowel. Although there are clinical and epidemiological reports of chronic inflammation of the pulmonary and intestinal mucosa in IBD, the detailed mechanisms of pulmonaryintestinal crosstalk remain unknown. The lung has no anatomical connection with the main inflammatory site of the bowel. Why does the inflammatory process shift from the gastrointestinal tract to the airways? The clinical and subclinical pulmonary abnormalities, dysfunction, or hyper-reactivity among IBD patients need further evaluation. Here, we give an overview of the concordance between chronic inflammatory reactions in the airways and the gastrointestinal tract. A better understanding of the possible mechanism of the crosstalk among the distant organs will be beneficial in identifying therapeutic strategies for mucosal inflammatory diseases such as IBD and allergy Baishideng. All rights reserved October 28, 2013 Volume 19 Issue 40

107 Wang H et al. Gut-lung cross-talk in IBD Key words: Inflammatory bowel disease; Pulmonary symptoms; Gut-lung crosstalk; Biao-Li relationship; Social manner Core tip: According to traditional Chinese medicine, the lung and the intestine are a pair of related organ systems (Biao-Li). The lung has no anatomical connection with the main inflammatory site of the bowel. Why does the inflammatory process shift from the gastrointestinal tract to the airways? We hypothesize that each individual cell or molecule not only plays its local role in its own organ, but also plays a social role to contribute distal communication through the epithelia. Inflammatory bowel disease may be a good example to study crosstalk between the gut and the lungs. Wang H, Liu JS, Peng SH, Deng XY, Zhu DM, Javidiparsijani S, Wang GR, Li DQ, Li LX, Wang YC, Luo JM. Gut-lung crosstalk in pulmonary involvement with inflammatory bowel diseases. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: INTRODUCTION Ulcerative colitis (UC) and Crohn s disease (CD) are the two major forms of chronic relapsing and remitting inflammatory bowel diseases (IBDs) [1-3]. The incidence of UC and CD is increasing [4]. IBDs have become a major gastroenterological problem in developed countries [4-10], and there has been an alarming rise in the traditional low-incidence areas, such as East Asia [11,12], the Indian subcontinent [13], the Middle East [14], Latin America [15], and Eastern Europe [16,17]. Although the gastrointestinal tract is the main affected site, both UC and CD are systemic inflammatory disorders that often involve organs other than those of the gastrointestinal tract [18-23]. Systemic manifestations can present years after the onset of bowel disease and can affect almost all organs [18,19], including the musculoskeletal [18,24-26], mucocutaneous [18,19,27,28], hepatobiliary [18,29,30], cardiovascular [18,31-33], ocular [18,34,35], renal and genitourinary [18,36-38], pancreatic [18,29,39-42], nervous [18,43-45] and bronchopulmonary [18,19,46-48] Systems. The extraintestinal manifestations tend to follow the clinical course of IBD and have a high impact on quality of life, morbidity, and even mortality in these patients [18]. The reported frequency of extraintestinal syndromes in the patients with IBD varies from 6% to 47% [18,46-49]. Pulmonary involvement among IBD patients was first recognized by Kraft et al [50] about 40 years ago. Both UC and CD can affect any part of the respiratory system. The spectrum of respiratory disorders occurring among patients with IBD includes small and large airway dysfunction, as well as obstructive and interstitial pulmonary diseases [18,46-49]. Screening studies using respiratory symptoms, high-resolution computed tomography (HRCT), bronchoscopy, histological examination, and pulmonary function tests (PFTs) document some of the earliest changes in airways among the respiratory asymptomatic IBD patients [18,46-49]. These changes, especially the subclinical alteration of peripheral airways and parenchymal inflammation may not be detected by routine computed tomography (CT) scan and PFTs [18,46-49]. The pulmonary involvements trend to follow the clinical course of IBD [18,49,51]. Pulmonary impairment appears more pronounced in the patients with active disease than those with inactive disease [18,49,51,52]. The airway inflammation affects quality of life, morbidity, and even mortality among these patients [18,49,51,52]. This evidence suggests that local intestinal mucosal inflammation is responsible for the distant airways inflammation [53-57]. In a populationbased cohort study, patients with chronic obstructive pulmonary disease (COPD) had significantly higher risk for both UC and CD [58]. IBD and COPD share many similarities in epidemiological and clinical characteristics, as well as in inflammatory pathology [59,60]. Exposure to air pollution may be an important environmental factor for IBD [61,62]. There appears to be a direct association between increased environmental pollution and hospitalization among adult IBD patients [63]. Inhalation injury is often accompanied by the alimentary tract response [64,65]. The local mucosal inflammation in airways may also be responsible for the intestine inflammation and vice versa. In view of the above phenomena, the lungs and intestine are a pair of interacting organ systems [53-57]. It is most likely that there are similar inflammatory and immune components of these organs that are the cause of the overlap in pathological changes in respiratory and intestinal mucosal diseases [59,60]. Why the inflammatory process shifts from the gastrointestinal tract to the airways or vice versa remains a mystery. Over the years many explanations for the intestine-lung communication have been proposed, however, no definite conclusions have been drawn. The purpose of this article is to update the plausible hypotheses of intestine-lung axis communication underlying the possible mechanism of pulmonary involvement during IBD pathogenesis. PULMONARY INVOLVEMENT IN ASSOCIATION WITH IBD OCCURS MORE FREQUENTLY THAN PREVIOUSLY RECOGNIZED Broad spectrum of respiratory disorders in patients with IBD Kraft et al [50] in 1976 first observed that six patients developed severe, unexplained, chronic bronchopulmonary disease 3-13 years after the onset of nonspecific inflammatory disease of the colon. Since then, various pulmonary manifestations including small and large airway dysfunction or obstruction, inflammation of pulmonary parenchyma and vasculature, as well as bronchopulmonary hyper-reactivity have been reported in IBD [18,46-48,52,66,67] October 28, 2013 Volume 19 Issue 40

108 Wang H et al. Gut-lung cross-talk in IBD The spectrum of respiratory disorders occurring among patients with IBD is broad [18,46-52,68]. Storch et al [69] recommend that primary care physicians must take a broader approach while treating patients with IBD and pulmonary diseases. Epidemiological evidence to support high prevalence of pulmonary involvement in association with IBD Lungs are not generally considered to be involved in IBD. In some studies only a few cases of pulmonary complications have been associated with IBD [59,67], but in others, there is a wide range of pulmonary complications associated with IBD [18,46-52,67,70]. Edwards et al [70] in a study of 624 IBD patients did not find any association with pulmonary complications. Rodgers et al [67] found that there were only three cases of pulmonary complications in their study of 1400 IBD cases. However, other epidemiological investigations and clinical case reports have documented that pulmonary complications occur more frequently in IBD patients than previously recognized [18,46,47,49,51,52]. Recently, a large population-based study from Canada indicated that pulmonary complications were the most common concomitant chronic disorder in patients with CD and the second most common in patients with UC [19]. The increase in incidence of IBD in the past few decades suggests that environmental factors such as air pollution could contribute to disease pathogenesis [51-57]. Association of IBD and polymorphism of many innate immunity genes has been identified [4,18,53,71,72]. The high concordance of extraintestinal manifestations in siblings and firstdegree relatives with IBD suggests that genetic factors also contribute to the link between intestinal and extraintestinal manifestations [73]. The association of pulmonary involvement with IBD appears to be mediated by a complicated interaction of environmental and genetic factors, suggesting there are clear, but undefined, multiple centers of loss of homeostasis in cellular and molecular interactions between the environment and host in both respiratory and gastrointestinal systems. Latent respiratory abnormalities or dysfunction in IBD patients discovered by HRCT, PFTs and bronchoscopy HRCT, sensitive PFTs, bronchoscopy and histological examination have been widely used to discover the earliest pulmonary abnormalities or dysfunction among IBD patients. Many respiratory screening studies using HRCT and PFTs support a high prevalence of clinical and subclinical respiratory abnormalities or dysfunction among IBD patients [18,46-48,51,74]. Three studies of randomly selected IBD patients showed incidence rates of pulmonary involvement in 44%, 48%, and 50%, respectively [47,51,75]. Although overt pulmonary symptoms may be uncommon, abnormalities on PFT have been noted in > 50% of patients with UC and > 60% of those with CD [51,76,77]. Advances in imaging methods over the past decade have led to an increased understanding of anatomical and physiological pulmonary abnormalities in patients with IBD [77]. Even though the majority of patients with pulmonary abnormalities were asymptomatic, the incidence of at least one abnormality on HRCT of the chest was as high as 39% in UC and 92% in CD patients [51]. With the advent of HRCT, it has become obvious that the previously described rarity of pulmonary involvement in IBD is inaccurate [77]. HRCT showed changes like bronchectasis, mosaic perfusion and air trapping, suggestive of obliterative bronchiolitis, and patterns of centrilobular nodules and broncing linear opacities ( tree in bud appearance), suggestive of either cellular bronchiolitis or bronchiolectasis with mucoid secretion [69,78]. HRCT images also indicate that there are multiple centers of airway responses and mucoid secretion. This suggests that airway epithelium (including goblet cells) has been activated. The response of airway epithelium may be a major contributor to IBD-related lung disease. Munck et al [47] investigated 30 IBD patients (12 with CD, 18 with UC), and found dysfunction of small airways and parenchyma in all IBD patients despite their normal pulmonary physiology. It is likely that the earliest changes occur in the peripheral airways and pulmonary parenchyma, which result in reduced small airways and lung diffusion capacity in all the patients [49,51]. Increased disease activity in IBD patients has been shown to be associated with abnormal pulmonary function tests, and suggests a direct pathogenic link [49,51,79]. Bronchoscopy and histological examination from the lung biopsies show changes in the bronchial epithelium, consisting of basal cell hyperplasia, basement membrane thickening, submucosal nonspecific inflammation, small airway fibrosis, and an overall increase in epithelial thickness and granulomatous bronchiolitis [66,68,79]. Although the crosstalk mechanism between the bowel and lung remains unknown, the HRCT and histology evaluation show that there is a shift in the inflammatory process from the bowel to the lungs [49,51,79]. Respiratory hyper-responsiveness among IBD patients Allergic symptoms, abnormal PFTs and positive skin prick test were more common among the IBD patients compared to the normal population [28]. The subclinical nonspecific bronchial hyper-responsiveness, independent of the presence of atopy, in IBD patients who have no other pulmonary symptoms and with normal baseline spirometry, has a high prevalence [48]. Colby et al [80] reported that the bronchial hyper-reactivity occurred in 48% of patients with UC and CD, even in the absence of any clinical, radiological and functional evidence of airway disease. Bronchial hyper-reactivity occurred in 71% of children and adolescents with CD [81]. Allergy is an inappropriate inflammatory reaction to antigen. The allergen triggers an exaggerated immune response, and can aggravate an immediately atopic allergic reaction [82-84]. Combination of HRCT and histological examination revealed multiple centers of pulmonary inflammatory responses, which may share many characteristics with atopic allergic reactions [48,80,81]. The lungs may duplicate the social inflammatory reaction of the intestine (Figure 1) October 28, 2013 Volume 19 Issue 40

109 Wang H et al. Gut-lung cross-talk in IBD Inflammation of intestine Figure 1 Model for inflammatory process in lung and intestine during inflammatory bowel disease. Clinical or subclinical inflammation in small and large airways and the lung parenchyma accompanies the main inflammation in the bowel during inflammatory bowel disease.? Inflammatory nature in both intestine and lung Large airway Abnormalities Small airway Dysfunctions (latent lesion) Clinical or subclinical inflammation of lung Parenchyma Hyperreactivities EPITHELIAL CELLS ARE THE INITIAL AND MAIN TARGET The epithelial cells are considered not only the frontier sentinels and barriers, but also the central participants in innate and adaptive immune responses during mucosal inflammation [71,85-88]. In both the bowel and lungs, these cells provide an important physical barrier to the huge vulnerable biological surface, and are continuously exposed to the external environment. Upon activation, epithelial cells can release large quantities of proinflammatory cytokines, growth factors and chemokines that attract inflammatory cells to initiate and sustain the inflammatory reaction [71,85-88]. Direct or indirect interactions of epithelial cells with mast cells, T and B lymphocytes, dendritic cells (DCs), eosinophils, neutrophils, and basophils help to maintain the balance between the environment and the host [88]. The airway and gut epithelial cells are at the center of the inflammatory response and play the dominant role in initiation and sustaining the inflammatory reaction [88]. Intestinal epithelium is the center of cellular and molecular interaction between host and environment The healthy mutual relationship between the microbiota and host depends on the balanced interaction between the microbiota and innate immune activation [60,71,87,89,90]. The intestinal barrier plays a crucial role in cellular and molecular interactions between the commensal microflora and possible harmful factors in the intestinal lumen and innate immune system [60,71,87,89-92]. The intestinal barrier is composed of a thick mucus layer containing host defense molecules, a monolayer of columnar intestinal epithelial cells, and underlying set of cells (mesenchymal cells, DCs, lymphocytes and macrophages) [60,71,87,89-92]. The intestinal epithelial cells are exactly at the center of the complex system called the intestinal barrier. The intestinal epithelial cells are a single layer of columnar cells consisting of four types of cells: the absorbent enterocytes, goblet cells, Paneth cells, and enteroendocrine cells. It is clear that these four types of epithelial cells present an anatomical and functional barrier to maintain the whole intestinal homeostasis. On the antigen-rich side of the lumen, they secrete and regulate the composition of the thick mucus layer. The intestinal epithelial cells serve as sentinels of innate immunity. The innate immune system is able to recognize bacterial and viral motifs through the toll-like receptors (TLRs) and the nucleotide-binding oligomerization domain families [93-95]. The intestinal epithelial cells express several members of the TLRs [93]. On the basolateral side, these cells interact and continuously crosstalk with inflammatory cell-rich lamina propria. The intestinal epithelial cells are nonprofessional antigen-presenting cells, which are able to process and present antigens directly to lymphocytes by a highly polarized system with apical antigen sorting, processing and exclusively basolateral presentation. They serve as the major participants in innate and adaptive immune responses [60,71,87,89-91]. The intestinal epithelium acts to maintain homeostasis during the steady state, restore the epithelium during insult or injury, and induce inflammatory responses. Airway epithelium is also the center of cellular and molecular interaction between host and environment Although initiation of pulmonary inflammation and its association with IBD remains unknown, it is well established that the airway epithelial cells play an important role in the initiation and maintenance of airway inflammation, as well as being the main target [60,85,88,96-98]. The airway epithelial cells are also at the center of the airway barrier system because of their anatomical and functional position. On the antigen-rich lumen side, they secrete 6797 October 28, 2013 Volume 19 Issue 40

110 Wang H et al. Gut-lung cross-talk in IBD A pair of related organ systems (Biao-Li) Social manner of cells and molecules Intestine Lung Commonalities Huge surface Embryonic origin Epithelia commonwealth Goblet cells and submucosal glands Submucosal lymphoid tissue Innate and acquire immune, etc. Figure 2 Summary model of plausible mechanisms of lung-intestine communication underlying inflammatory bowel disease-associated pulmonary involvement. The lungs and intestines are a pair of mutually affected organs. The airways may intrinsically accompany inflammation of the bowel. This distal intrinsic inflammatory response may relate to the common features between the lung and intestine. According to Traditional Chinese Medicine, the lung and intestine have internal and external relationships (Biao-Li). This distal intrinsic inflammatory response may relate to the social manner of cells and molecules. and regulate the composition of the thick mucus layer, while on the basolateral side, they interact and crosstalk with the inflammatory cell-rich lamina propria [60,85,88,96-98]. Activated airway epithelial cells can induce synthesis and secretion of immune-cell-mediated host defense molecules such as antimicrobial and antiviral proteins that activate other mucosal innate immune cells [60,85,88,96-103]. Activated innate immune responses can secondarily induce the recruitment and activation of DCs and T and B lymphocytes that amplify antigen recognition and antibody production and other adaptive immune responses [60,96-103]. Many studies document that the IBD patients develop rapidly progressive respiratory symptoms after colectomy without any identified bacterial pathogens on repeated sputum culture and require oral corticosteroid therapy [18,66,99, ], which proves that pulmonary impairment in IBD is not a pathogen-induced inflammation. The pulmonary involvement in IBD may be due to aberrant immunity from the bowel that disrupts airway tissue homeostasis. This aberrant airway epithelial injury/repair may be the mechanism of IBD-related pulmonary involvement [53-57,107,108]. Lungs may duplicate atopic inflammation of the bowel. However, the connection between the primary site and the atopic site is unclear. Less attention has been paid to the mechanism of atopic inflammatory reaction that manifests at sites remote from the primary site. The mechanism should be either systemicfactor-mediated cellular and molecular events or some intrinsic connection between the primary and atopic sites. In future, detecting the earliest pulmonary epithelium activation signs or genetic responses during IBD pathogenesis would provide evidence of the linkage between the anatomically disconnected organ systems. AIRWAY MAY DUPLICATE THE BOWEL INFLAMMATORY EVENT Combined HRCT and histological examination have shown that there are multiple centers of airway epithelial (including goblet cells) responses and mucoid secretion in IBD [78-79,104,109]. The lung duplicates the inflammatory process of the bowel (Figures 1 and 2). The linkage between the lungs and intestine is hard to understand in the absence of anatomical connections or systemic neuroendocrine immune mediation. Pulmonary inflammation may intrinsically accompany the main inflammation in the bowel, and this distal intrinsic inflammatory response may be related to the social manner of cells and molecules, similar to the exaggerated allergen-induced multiple centers of allergy inflammatory response on the surface of the skin, conjunctivae, and airway and digestive tracts [83-85,88,99,107,108]. Commonalities between lung and intestine and crosstalk There are many commonalities between the lungs and intestines [18,53,107,108,110,111]. The gastrointestinal tract and bronchial tree share a common embryological origin that arises from the primitive gut [10,74,75,77,78]. Both the lung and intestine possess goblet cells and submucosal glands as part of their luminal structure. In addition, both contain submucosal lymphoid tissue, host defense molecules, and play crucial roles in both innate and acquired immunity [18,107,108,110,111]. In IBD, inflamed bowel mucosa produces many inflammatory mediators and releases them to the circulating system [4,66,71,86,87,90,102,103]. The inflamed bowel mucosa also creates the prospect for systemic absorption of 6798 October 28, 2013 Volume 19 Issue 40

111 Wang H et al. Gut-lung cross-talk in IBD luminal contents, including dietary antigens, digestive enzymes, or specific bacterial products capable of inducing systemic inflammation [66,102,103]. Some investigators hypothesize that the pathogenesis of IBD-related airway disease may be associated with circulating inflammatory mediators, specific bacterial products, dietary antigens, or digestive enzymes [102,103]. Detectable levels of bacterial lipopolysaccharide and antibodies to bacterial lipid A and peptidoglycan in serum of IBD patients support this theory. However, it is less likely to be accurate in the case of IBD-associated lung disease, because it clearly occurs after colectomy in patients who do not have any ongoing bowel inflammation [4,66,105,106]. To the best of our knowledge, none of the circulating inflammatory mediators, dietary antigens, digestive enzymes, or specific bacterial products has been established as being responsible for extraintestinal syndromes during the intestine inflammatory process. In fact, circulating inflammatory mediators are not always enough to drive inflammation from the local mucosa to distal organs. Our previous work suggested that the skin, conjunctivae, airways and digestive tract may join together to fight allergens [107,108]. The atopic lesion may duplicate the primary contact site of cellular and molecular events. The atopic march may be due to the intrinsic social involvement of the positioned epithelial cells, but may not be totally controlled by the anatomic connection or the circulating systemic factors involved in allergy pathogenesis [53-57,107,108,112,113]. Thymic stromal lymphopoietin (TSLP), a general biomarker for skin-barrier defects [85,107,114] is an interleukin-7-like cytokine produced by epithelial cells, has emerged as a potential master regulator of both skin and airway inflammation [85,107, ]. TSLP signaling plays an important role in both airway and skin allergic inflammation. Recently, Zhang et al [114] found that increased TSLP expression in skin keratinocytes not only triggers atopic dermatitislike lesions in skin locally, but also leads to a concomitant ovalbumin (OVA)-induced asthma-like lung inflammation in animals. Furthermore, they elucidated that increased epidermal keratinocyte TSLP expression and subsequent increase in circulating TSLP in a mouse model did not lead to any spontaneous lung inflammation in the absence of OVA sensitization and challenge. High levels of expression of TSLP mrna in bronchial epithelial cells and submucosa of asthmatic patients [115], suggest that locally produced TSLP could be important for the development and maintenance of asthma [85,107, ]. TSLP appears to be a crucial factor in driving both skin and lung into inflammation, but solely increased epidermal keratinocyte TSLP expression and subsequent increase in blood circulating TSLP is not sufficient to drive both skin and lung into inflammation [85,107, ]. The lung inflammation is not triggered by circulating or epidermal TSLP, but requires local TSLP production by pulmonary epithelial cells [85,107, ]. OVA sensitization and challenge is extremely important to drive both skin and lung into inflammation [85,107,114]. The intrinsic connection of skin and lung is through locally produced TSLP after OVA sensitization and challenge [85,107, ]. The plausible mechanism for association of pulmonary involvement with IBD may be the intrinsic airway reactions that accompany the main inflammation in the bowel, as for allergen-triggered, enigmatic, multiple centers of allergic inflammation. There is clearly communication among organs that share a common embryological origin, or similar cellular and molecular structure without any anatomical interaction [53-57,65,107,108,110,111]. Primitive gut has a shared common origin with the gastrointestinal tract, biliary tract, and respiratory system. Our previous work suggested that pulmonary surfactant protein A-like molecule is a frontier host defense protein and that its expression may be associated with some autoimmune diseases [53,65]. Latex-mediated allergy is another example of intrinsic activation of non anatomically related organs. During latex-mediated allergy, the skin allergic reaction occurs anywhere in the body and not necessarily at the site of the direct latex contact [74,75,83]. How does information transfer from the epidermal keratinocytes at latex-contacted sites to those at uncontacted sites [107,108,116]? It is possible that the epidermal keratinocytes at both sites intrinsically communicate because they are close relatives that share common features. In fact, in IBD, the surface of skin, conjunctivae, and airways is involved in fighting inflammation in the gastrointestinal tract. As above mentioned, OVA intrinsically drives skin and lung into allergic inflammation by locally produced TLSP [85,107, ]. Aberrant immune responses to the commensal microbiota in the bowel, which lead to pulmonary inflammation, may be related to some unknown TLSPSlike molecules. Detecting these molecules could provide the mechanism of lung-intestine crosstalk. Pulmonary involvement associated with IBD may be a good example to understand the Biao-Li relationship between lung and intestine According to Chinese Medicine, the lung and the intestine are a pair of related organ systems (Biao-Li). The interaction of lung and intestine is mutually affected by internal and external relationships [47,53-57,107, ]. It means that lung diseases often have colon syndromes and colon diseases may have lung syndromes. The mechanism is complicated, and immunological, environmental and genetic factors should trigger lots cellular and molecular events [107,108]. From the pathological findings, the microscopic hallmark of IBD in the intestine and lung is infiltration of chronic inflammatory cells and response of interstitial cells such as fibrocytes and epithelium. In our previous study, we investigated one type of frontier immune cell (CD68-positive macrophages) and one type of frontier host defense molecule [pulmonary surfactant protein (SP)-A], which reside in the lungs and colon. Both frontier immune cell and frontier host defense molecules are overexpressed in inflammatory areas of CD and UC, and in particular, there are many CD68-positive 6799 October 28, 2013 Volume 19 Issue 40

112 Wang H et al. Gut-lung cross-talk in IBD A B Figure 3 Co-localization of surfactant protein-a and CD68 in normal and inflammatory areas. A: Surfactant protein (SP)-A -positive signal was indicated by fluorescence microscopy (green) fluorescence; CD68-positive signal was identified by rhodamine red-x (red) fluorescence; and the cell nucleus was indicated by Hoechst dye (blue). In the normal area, SP-A was located in the surface of the villi, specific epithelium and submucosae, lamina muscularis, mucosae and lymphoid tissues. CD68-positive cells were mainly found in the submucosae, lamina muscularis, mucosae, and lymphoid tissues and in the epithelium; B: In the inflammatory area, CD68-positive cells were dramatically increased in all levels of the bowel wall; especially CD68-positive macrophages in the epithelia of lamina mucosa. The SP-Apositive macrophages were recruited by activated epithelial cells. Double labeled SP-A and CD68 shows that some CD68-positive macrophages expressed SP-A like molecule in the inflammatory bowel disease tissues (original magnification, 200). Figures reproduced with permission from reference [53]. macrophages among the epithelia of lamina mucosa. The SP-A-positive macrophages are recruited by activated epithelial cells (Figure 3) [53]. The epithelium serves as the central participants in innate and adaptive immune responses as well as mucosal inflammation, laboratory evidence of activation of pulmonary epithelium would provide an insight into the Biao-Li relationship between lung and intestine during the pathogenesis of IBD associated pulmonary disorders. In view of this, association of pulmonary involvement with IBD may be a good example to understand the Biao-Li relationship between lung and intestine [53-57,107, ]. Lung-intestine connection may relate to the social property of cells and molecules To date, there is a lack of evidence for the participation of any circulating inflammatory mediator, dietary antigens, digestive enzymes, or specific bacterial products as a linkage between the gastrointestinal tract and extraintestinal organs. Both gastrointestinal and airway lesions may be epithelium-mediated chronic inflammation. IBDassociated pulmonary involvement, such as epithelial disease with adoption of a chronic wound scenario, could also be a hypothesis about airway wall and gastrointestinal tract remodeling over the course of the disease [60,66,80]. The extraintestinal organs may duplicate social inflammation of the gastrointestinal tract. The inflammation of the gastrointestinal tract as a social factor drives inflammatory reaction to extra-intestinal organs. There is a clear but undefined communication among organs that share a common embryological origin, or similar cellular and molecular structure despite being located at a distance from each other without any anatomical interaction. The human body originates from a single cell, which makes the whole body a social system. A constant molecular and cellular interaction between the environment and host is required for the establishment and maintenance of homeostasis. Disrupted homeostasis in the gastrointestinal tract may also affect the airways. Pulmonary involvement associated with IBD as the social inflammatory reaction, is a plausible hypothesis. Sharing the common embryological origin or similar cellular and molecular structures may be closer relatives in our social body. The social manner of cell and molecules would also help to attain insight into the pathogenesis of enigmatic complications such as IBD, and the cellular and molecular mechanism of Chinese Traditional medicine. CONCLUSION The frequency of pulmonary abnormalities, dysfunction or hyper-reactivity that occurs in association with IBD is more than previously recognized. More evidence shows that latent inflammation exists in the airways of IBD patients, even without any bronchopulmonary symptoms and with normal pulmonary function. The pulmonary impairment is more pronounced in IBD patients with active disease than in those in remission, and the linkage between lung and intestine may not be easily supported by anatomic connection or systemic neuroendocrine immune mediation. The airways may intrinsically accompany the main inflammation in the bowel. Lung and intestine share a lot of common features. The interaction of lung and intestine is mutually affected by internal and external relationships (Biao-Li). The pulmonary abnormalities, dysfunction or hyper-reactivity in IBD patients may be related to the social manner of cells and molecules. Further investigation of epithelium-mediated cellular and molecular events and their interaction in lung and bowel may provide evidence of mutually affected internal and external relationships (Biao-Li) of the lung-intestine axis, and the social property of cells and molecules. A better understanding of the mechanism of crosstalk among the distant organs would be beneficial to the elucidation of the etiology and help in identifying therapeutic strategies for mucosal inflammatory diseases such as IBD and 6800 October 28, 2013 Volume 19 Issue 40

113 Wang H et al. Gut-lung cross-talk in IBD atopic allergic inflammation. REFERENCES 1 Mudter J, Neurath MF. Insight into Crohn s disease pathomorphology. Abdom Imaging 2012; 37: [PMID: ] 2 Liu H, Patel NR, Walter L, Ingersoll S, Sitaraman SV, Garg P. Constitutive expression of MMP9 in intestinal epithelium worsens murine acute colitis and is associated with increased levels of proinflammatory cytokine Kc. Am J Physiol Gastrointest Liver Physiol 2013; 304: G793-G803 [PMID: ] 3 Shen J, Qiao Y, Ran Z, Wang T, Xu J, Feng J. Intestinal protein expression profile identifies inflammatory bowel disease and predicts relapse. Int J Clin Exp Pathol 2013; 6: [PMID: ] 4 Latella G, Fiocchi C, Caprili R. News from the 5th International Meeting on Inflammatory Bowel Diseases CAPRI J Crohns Colitis 2010; 4: [PMID: DOI: /j.crohns ] 5 Kappelman MD, Rifas-Shiman SL, Kleinman K, Ollendorf D, Bousvaros A, Grand RJ, Finkelstein JA. The prevalence and geographic distribution of Crohn s disease and ulcerative colitis in the United States. Clin Gastroenterol Hepatol 2007; 5: [PMID: ] 6 Bernstein CN. Epidemiologic clues to inflammatory bowel disease. Curr Gastroenterol Rep 2010; 12: [PMID: ] 7 Vernier G, Cortot A, Gower-Rousseau C, Salomez JL, Colombel JF. [Epidemiology and risk factors of inflammatory bowel diseases]. Rev Prat 2005; 55: [PMID: ] 8 Podolsky DK. Inflammatory bowel disease (1) N Engl J Med 1991; 325: [PMID: ] 9 Zhulina Y, Hahn-Strömberg V, Shamikh A, Peterson CG, Gustavsson A, Nyhlin N, Wickbom A, Bohr J, Bodin L, Tysk C, Carlson M, Halfvarson J. Subclinical inflammation with increased neutrophil activity in healthy twin siblings reflect environmental influence in the pathogenesis of inflammatory bowel disease. Inflamm Bowel Dis 2013; 19: [PMID: ] 10 Ekbom A. The epidemiology of IBD: a lot of data but little knowledge. How shall we proceed? Inflamm Bowel Dis 2004; 10 Suppl 1: S32-S34 [PMID: ] 11 Thia KT, Loftus EV, Sandborn WJ, Yang SK. An update on the epidemiology of inflammatory bowel disease in Asia. Am J Gastroenterol 2008; 103: [PMID: DOI: /j x] 12 Zheng JJ, Zhu XS, Huangfu Z, Shi XH, Guo ZR. Prevalence and incidence rates of Crohn s disease in mainland China: a meta-analysis of 55 years of research. J Dig Dis 2010; 11: [PMID: DOI: /j x] 13 Sood A, Midha V. Epidemiology of inflammatory bowel disease in Asia. Indian J Gastroenterol 2007; 26: [PMID: ] 14 Al-Mofarreh MA, Al-Mofleh IA. Emerging inflammatory bowel disease in saudi outpatients: a report of 693 cases. Saudi J Gastroenterol 2013; 19: [PMID: ] 15 Barreiro-de Acosta M, Alvarez Castro A, Souto R, Iglesias M, Lorenzo A, Dominguez-Muñoz JE. Emigration to western industrialized countries: A risk factor for developing inflammatory bowel disease. J Crohns Colitis 2011; 5: [PMID: ] 16 Lakatos L, Mester G, Erdelyi Z, Balogh M, Szipocs I, Kamaras G, Lakatos PL. Striking elevation in incidence and prevalence of inflammatory bowel disease in a province of western Hungary between World J Gastroenterol 2004; 10: [PMID: ] 17 Molodecky NA, Soon IS, Rabi DM, Ghali WA, Ferris M, Chernoff G, Benchimol EI, Panaccione R, Ghosh S, Barkema HW, Kaplan GG. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 2012; 142: e42; quiz e30 [PMID: ] 18 Rothfuss KS, Stange EF, Herrlinger KR. Extraintestinal manifestations and complications in inflammatory bowel diseases. World J Gastroenterol 2006; 12: [PMID: ] 19 Bernstein CN, Blanchard JF, Rawsthorne P, Yu N. The prevalence of extraintestinal diseases in inflammatory bowel disease: a population-based study. Am J Gastroenterol 2001; 96: [PMID: ] 20 Patil SA, Cross RK. Update in the management of extraintestinal manifestations of inflammatory bowel disease. Curr Gastroenterol Rep 2013; 15: 314 [PMID: ] 21 Aloi M, Cucchiara S. Extradigestive manifestations of IBD in pediatrics. Eur Rev Med Pharmacol Sci 2009; 13 Suppl 1: [PMID: ] 22 Ricker JM, Harrison SA. Inflammatory bowel disease: thinking outside of the intestines (Part 2). J Miss State Med Assoc 2008; 49: [PMID: ] 23 Jewell D. Do HLA antigens predict the occurrence of extraintestinal manifestations of IBD? Inflamm Bowel Dis 2008; 14 Suppl 2: S28 [PMID: ] 24 Bourikas LA, Papadakis KA. Musculoskeletal manifestations of inflammatory bowel disease. Inflamm Bowel Dis 2009; 15: [PMID: ] 25 Orchard TR, Wordsworth BP, Jewell DP. Peripheral arthropathies in inflammatory bowel disease: their articular distribution and natural history. Gut 1998; 42: [PMID: ] 26 de Vlam K, Mielants H, Cuvelier C, De Keyser F, Veys EM, De Vos M. Spondyloarthropathy is underestimated in inflammatory bowel disease: prevalence and HLA association. J Rheumatol 2000; 27: [PMID: ] 27 Huang BL, Chandra S, Shih DQ. Skin manifestations of inflammatory bowel disease. Front Physiol 2012; 3: 13 [PMID: ] 28 Greenstein AJ, Janowitz HD, Sachar DB. The extra-intestinal complications of Crohn s disease and ulcerative colitis: a study of 700 patients. Medicine (Baltimore) 1976; 55: [PMID: ] 29 Navaneethan U, Shen B. Hepatopancreatobiliary manifestations and complications associated with inflammatory bowel disease. Inflamm Bowel Dis 2010; 16: [PMID: ] 30 Duerr RH, Targan SR, Landers CJ, LaRusso NF, Lindsay KL, Wiesner RH, Shanahan F. Neutrophil cytoplasmic antibodies: a link between primary sclerosing cholangitis and ulcerative colitis. Gastroenterology 1991; 100: [PMID: ] 31 Tabibian JH, Streiff MB. Inflammatory bowel disease-associated thromboembolism: a systematic review of outcomes with anticoagulation versus catheter-directed thrombolysis. Inflamm Bowel Dis 2012; 18: [PMID: ] 32 Bernstein CN, Wajda A, Blanchard JF. The clustering of other chronic inflammatory diseases in inflammatory bowel disease: a population-based study. Gastroenterology 2005; 129: [PMID: ] 33 Solem CA, Loftus EV, Tremaine WJ, Sandborn WJ. Venous thromboembolism in inflammatory bowel disease. Am J Gastroenterol 2004; 99: [PMID: ] 34 Barabino AV, Gandullia P, Calvi A, Vignola S, Arrigo S, Marco RD. Sudden blindness in a child with Crohn s disease. World J Gastroenterol 2011; 17: [PMID: ] 35 Petrelli EA, McKinley M, Troncale FJ. Ocular manifestations of inflammatory bowel disease. Ann Ophthalmol 1982; 14: [PMID: ] 36 Tokuyama H, Wakino S, Konishi K, Hashiguchi A, Hayashi K, Itoh H. Acute interstitial nephritis associated with ulcerative colitis. Clin Exp Nephrol 2010; 14: [PMID: ] 37 Stokke KT, Teisberg PA, Myhre E, Hovig T, Flatmark A, 6801 October 28, 2013 Volume 19 Issue 40

114 Wang H et al. Gut-lung cross-talk in IBD Gjone E. Nephrotic syndrome in ulcerative colitis. Scand J Gastroenterol 1976; 11: [PMID: ] 38 Glassman M, Kaplan M, Spivak W. Immune-complex glomerulonephritis in Crohn s disease. J Pediatr Gastroenterol Nutr 1986; 5: [PMID: ] 39 Broide E, Dotan I, Weiss B, Wilschanski M, Yerushalmi B, Klar A, Levine A. Idiopathic pancreatitis preceding the diagnosis of inflammatory bowel disease is more frequent in pediatric patients. J Pediatr Gastroenterol Nutr 2011; 52: [PMID: ] 40 Weber P, Seibold F, Jenss H. Acute pancreatitis in Crohn s disease. J Clin Gastroenterol 1993; 17: [PMID: ] 41 Hegnhøj J, Hansen CP, Rannem T, Søbirk H, Andersen LB, Andersen JR. Pancreatic function in Crohn s disease. Gut 1990; 31: [PMID: ] 42 Heikius B, Niemelä S, Lehtola J, Karttunen T, Lähde S. Pancreatic duct abnormalities and pancreatic function in patients with chronic inflammatory bowel disease. Scand J Gastroenterol 1996; 31: [PMID: ] 43 Singh S, Kumar N, Loftus EV, Kane SV. Neurologic complications in patients with inflammatory bowel disease: increasing relevance in the era of biologics. Inflamm Bowel Dis 2013; 19: [PMID: ] 44 Lossos A, River Y, Eliakim A, Steiner I. Neurologic aspects of inflammatory bowel disease. Neurology 1995; 45: [PMID: ] 45 Geissler A, Andus T, Roth M, Kullmann F, Caesar I, Held P, Gross V, Feuerbach S, Schölmerich J. Focal white-matter lesions in brain of patients with inflammatory bowel disease. Lancet 1995; 345: [PMID: ] 46 Mendoza JL, Lana R, Taxonera C, Alba C, Izquierdo S, Díaz- Rubio M. [Extraintestinal manifestations in inflammatory bowel disease: differences between Crohn s disease and ulcerative colitis]. Med Clin (Barc) 2005; 125: [PMID: ] 47 Munck A, Murciano D, Pariente R, Cezard JP, Navarro J. Latent pulmonary function abnormalities in children with Crohn s disease. Eur Respir J 1995; 8: [PMID: ] 48 Ceyhan BB, Karakurt S, Cevik H, Sungur M. Bronchial hyperreactivity and allergic status in inflammatory bowel disease. Respiration 2003; 70: [PMID: ] 49 Tzanakis N, Samiou M, Bouros D, Mouzas J, Kouroumalis E, Siafakas NM. Small airways function in patients with inflammatory bowel disease. Am J Respir Crit Care Med 1998; 157: [PMID: ] 50 Kraft SC, Earle RH, Roesler M, Esterly JR. Unexplained bronchopulmonary disease with inflammatory bowel disease. Arch Intern Med 1976; 136: [PMID: ] 51 Songür N, Songür Y, Tüzün M, Doğan I, Tüzün D, Ensari A, Hekimoglu B. Pulmonary function tests and high-resolution CT in the detection of pulmonary involvement in inflammatory bowel disease. J Clin Gastroenterol 2003; 37: [PMID: ] 52 Larsen S, Bendtzen K, Nielsen OH. Extraintestinal manifestations of inflammatory bowel disease: epidemiology, diagnosis, and management. Ann Med 2010; 42: [PMID: DOI: / ] 53 Luo JM, Liu ZQ, Eugene CY. Overexpression of pulmonary surfactant protein A like molecules in inflammatory bowel disease tissues. Zhongnan Daxue Xuebao Yixueban 2008; 33: [PMID: ] 54 Liu Y, Wang XY, Yang X, Jing S, Zhu L, Gao SH. Lung and intestine: a specific link in an ulcerative colitis rat model. Gastroenterol Res Pract 2013; 2013: [PMID: ] 55 Gao L, Wang J, Li F, Gao S, Deng Y. Analysis on clinically drug-used law for lung-intestine related diseases. J Tradit Chin Med 2012; 32: [PMID: ] 56 Liu P, Wang P, Tian D, Liu J, Chen G, Liu S. Study on traditional Chinese medicine theory of lung being connected with large intestine. J Tradit Chin Med 2012; 32: [PMID: ] 57 Ni JX, Gao SH. Understanding the viscera-related theory that the lung and large intestine are exterior-interiorly related. J Tradit Chin Med 2012; 32: [PMID: ] 58 Ekbom A, Brandt L, Granath F, Löfdahl CG, Egesten A. Increased risk of both ulcerative colitis and Crohn s disease in a population suffering from COPD. Lung 2008; 186: [PMID: DOI: /s z] 59 Mortaz E, Adcock IM, Folkerts G, Barnes PJ, Paul Vos A, Garssen J. Probiotics in the management of lung diseases. Mediators Inflamm 2013; 2013: [PMID: ] 60 Keely S, Talley NJ, Hansbro PM. Pulmonary-intestinal crosstalk in mucosal inflammatory disease. Mucosal Immunol 2012; 5: 7-18 [PMID: DOI: /mi ] 61 Kaplan GG, Hubbard J, Korzenik J, Sands BE, Panaccione R, Ghosh S, Wheeler AJ, Villeneuve PJ. The inflammatory bowel diseases and ambient air pollution: a novel association. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 62 Beamish LA, Osornio-Vargas AR, Wine E. Air pollution: An environmental factor contributing to intestinal disease. J Crohns Colitis 2011; 5: [PMID: DOI: / j.crohns ] 63 Ananthakrishnan AN, McGinley EL, Binion DG, Saeian K. Ambient air pollution correlates with hospitalizations for inflammatory bowel disease: an ecologic analysis. Inflamm Bowel Dis 2011; 17: [PMID: DOI: / ibd.21455] 64 Markell KW, Renz EM, White CE, Albrecht ME, Blackbourne LH, Park MS, Barillo DA, Chung KK, Kozar RA, Minei JP, Cohn SM, Herndon DN, Cancio LC, Holcomb JB, Wolf SE. Abdominal complications after severe burns. J Am Coll Surg 2009; 208: ; discussion [PMID: DOI: /j.jamcollsurg ] 65 Luo JM, Wan YS, Liu ZQ, Wang GR, Floros J, Zhou HH. Regularity of distribution of immunoreactive pulmonary surfactant protein A in rat tissues. Int J Mol Med 2004; 14: [PMID: ] 66 Spira A, Grossman R, Balter M. Large airway disease associated with inflammatory bowel disease. Chest 1998; 113: [PMID: ] 67 Rogers BH, Clark LM, Kirsner JB. The epidemiologic and demographic characteristics of inflammatory bowel disease: an analysis of a computerized file of 1400 patients. J Chronic Dis 1971; 24: [PMID: ] 68 Vandenplas O, Casel S, Delos M, Trigaux JP, Melange M, Marchand E. Granulomatous bronchiolitis associated with Crohn s disease. Am J Respir Crit Care Med 1998; 158: [PMID: ] 69 Storch I, Sachar D, Katz S. Pulmonary manifestations of inflammatory bowel disease. Inflamm Bowel Dis 2003; 9: [PMID: ] 70 Edwards FC, Truelove SC. The course and prognosis of ulcerative colitis. III. complications. Gut 1964; 5: 1-22 [PMID: ] 71 Harrison OJ, Maloy KJ. Innate immune activation in intestinal homeostasis. J Innate Immun 2011; 3: [PMID: ] 72 Franke A, McGovern DP, Barrett JC, Wang K, Radford- Smith GL, Ahmad T, Lees CW, Balschun T, Lee J, Roberts R, Anderson CA, Bis JC, Bumpstead S, Ellinghaus D, Festen EM, Georges M, Green T, Haritunians T, Jostins L, Latiano A, Mathew CG, Montgomery GW, Prescott NJ, Raychaudhuri S, Rotter JI, Schumm P, Sharma Y, Simms LA, Taylor KD, Whiteman D, Wijmenga C, Baldassano RN, Barclay M, Bayless TM, Brand S, Büning C, Cohen A, Colombel JF, Cottone M, Stronati L, Denson T, De Vos M, D Inca R, Dubinsky M, Edwards C, Florin T, Franchimont D, Gearry R, Glas J, Van Gossum A, Guthery SL, Halfvarson J, Verspaget HW, Hugot JP, Karban A, Laukens D, Lawrance I, Lemann M, Levine A, 6802 October 28, 2013 Volume 19 Issue 40

115 Wang H et al. Gut-lung cross-talk in IBD Libioulle C, Louis E, Mowat C, Newman W, Panés J, Phillips A, Proctor DD, Regueiro M, Russell R, Rutgeerts P, Sanderson J, Sans M, Seibold F, Steinhart AH, Stokkers PC, Torkvist L, Kullak-Ublick G, Wilson D, Walters T, Targan SR, Brant SR, Rioux JD, D Amato M, Weersma RK, Kugathasan S, Griffiths AM, Mansfield JC, Vermeire S, Duerr RH, Silverberg MS, Satsangi J, Schreiber S, Cho JH, Annese V, Hakonarson H, Daly MJ, Parkes M. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn s disease susceptibility loci. Nat Genet 2010; 42: [PMID: ] 73 Satsangi J, Grootscholten C, Holt H, Jewell DP. Clinical patterns of familial inflammatory bowel disease. Gut 1996; 38: [PMID: ] 74 Herrlinger KR, Noftz MK, Dalhoff K, Ludwig D, Stange EF, Fellermann K. Alterations in pulmonary function in inflammatory bowel disease are frequent and persist during remission. Am J Gastroenterol 2002; 97: [PMID: ] 75 Mohamed-Hussein AA, Mohamed NA, Ibrahim ME. Changes in pulmonary function in patients with ulcerative colitis. Respir Med 2007; 101: [PMID: ] 76 Douglas JG, McDonald CF, Leslie MJ, Gillon J, Crompton GK, McHardy GJ. Respiratory impairment in inflammatory bowel disease: does it vary with disease activity? Respir Med 1989; 83: [PMID: ] 77 Godet PG, Cowie R, Woodman RC, Sutherland LR. Pulmonary function abnormalities in patients with ulcerative colitis. Am J Gastroenterol 1997; 92: [PMID: ] 78 Ozyilmaz E, Yildirim B, Erbas G, Akten S, Oguzulgen IK, Tunc B, Tuncer C, Turktas H. Value of fractional exhaled nitric oxide (FE NO) for the diagnosis of pulmonary involvement due to inflammatory bowel disease. Inflamm Bowel Dis 2010; 16: [PMID: ] 79 Mahadeva R, Walsh G, Flower CD, Shneerson JM. Clinical and radiological characteristics of lung disease in inflammatory bowel disease. Eur Respir J 2000; 15: [PMID: ] 80 Colby TV, Camus P. Pathology of pulmonary involvement in inflammatory bowel disease. ERSJ 2007; 39: Louis E, Louis R, Drion V, Bonnet V, Lamproye A, Radermecker M, Belaiche J. Increased frequency of bronchial hyperresponsiveness in patients with inflammatory bowel disease. Allergy 1995; 50: [PMID: ] 82 Mansi A, Cucchiara S, Greco L, Sarnelli P, Pisanti C, Franco MT, Santamaria F. Bronchial hyperresponsiveness in children and adolescents with Crohn s disease. Am J Respir Crit Care Med 2000; 161: [PMID: ] 83 Yu LC. The epithelial gatekeeper against food allergy. Pediatr Neonatol 2009; 50: [PMID: ] 84 Jaeger D, Kleinhans D, Czuppon AB, Baur X. Latex-specific proteins causing immediate-type cutaneous, nasal, bronchial, and systemic reactions. J Allergy Clin Immunol 1992; 89: [PMID: ] 85 Holgate ST, Roberts G, Arshad HS, Howarth PH, Davies DE. The role of the airway epithelium and its interaction with environmental factors in asthma pathogenesis. Proc Am Thorac Soc 2009; 6: [PMID: ] 86 Abraham C, Medzhitov R. Interactions between the host innate immune system and microbes in inflammatory bowel disease. Gastroenterology 2011; 140: [PMID: ] 87 Gribar SC, Anand RJ, Sodhi CP, Hackam DJ. The role of epithelial Toll-like receptor signaling in the pathogenesis of intestinal inflammation. J Leukoc Biol 2008; 83: [PMID: ] 88 Kato A, Schleimer RP. Beyond inflammation: airway epithelial cells are at the interface of innate and adaptive immunity. Curr Opin Immunol 2007; 19: [PMID: ] 89 Cucchiara S, Stronati L, Aloi M. Interactions between intestinal microbiota and innate immune system in pediatric inflammatory bowel disease. J Clin Gastroenterol 2012; 46 Suppl: S64-S66 [PMID: ] 90 Roda G, Sartini A, Zambon E, Calafiore A, Marocchi M, Caponi A, Belluzzi A, Roda E. Intestinal epithelial cells in inflammatory bowel diseases. World J Gastroenterol 2010; 16: [PMID: ] 91 Laukoetter MG, Nava P, Nusrat A. Role of the intestinal barrier in inflammatory bowel disease. World J Gastroenterol 2008; 14: [PMID: ] 92 Defendenti C, Sarzi-Puttini P, Grosso S, Croce A, Senesi O, Saibeni S, Bollani S, Almasio PL, Bruno S, Atzeni F. B lymphocyte intestinal homing in inflammatory bowel disease. BMC Immunol 2011; 12: 71 [PMID: DOI: / ] 93 Shao L, Kamalu O, Mayer L. Non-classical MHC class I molecules on intestinal epithelial cells: mediators of mucosal crosstalk. Immunol Rev 2005; 206: [PMID: ] 94 Himmel ME, Hardenberg G, Piccirillo CA, Steiner TS, Levings MK. The role of T-regulatory cells and Toll-like receptors in the pathogenesis of human inflammatory bowel disease. Immunology 2008; 125: [PMID: ] 95 Voss E, Wehkamp J, Wehkamp K, Stange EF, Schröder JM, Harder J. NOD2/CARD15 mediates induction of the antimicrobial peptide human beta-defensin-2. J Biol Chem 2006; 281: [PMID: ] 96 Scholz CC, Taylor CT. Targeting the HIF pathway in inflammation and immunity. Curr Opin Pharmacol 2013; 13: [PMID: ] 97 Oh K, Seo MW, Lee GY, Byoun OJ, Kang HR, Cho SH, Lee DS. Airway epithelial cells initiate the allergen response through transglutaminase 2 by inducing IL-33 expression and a subsequent Th2 response. Respir Res 2013; 14: 35 [PMID: ] 98 Martin C, Frija J, Burgel PR. Dysfunctional lung anatomy and small airways degeneration in COPD. Int J Chron Obstruct Pulmon Dis 2013; 8: 7-13 [PMID: ] 99 Schleimer RP, Lane AP, Kim J. Innate and acquired immunity and epithelial cell function in chronic rhinosinusitis. Clin Allergy Immunol 2007; 20: [PMID: ] 100 Upham JW, Stick SM. Interactions between airway epithelial cells and dendritic cells: implications for the regulation of airway inflammation. Curr Drug Targets 2006; 7: [PMID: ] 101 Yilmaz A, Yilmaz Demirci N, Hoşgün D, Uner E, Erdoğan Y, Gökçek A, Cağlar A. Pulmonary involvement in inflammatory bowel disease. World J Gastroenterol 2010; 16: [PMID: ] 102 Sartor RB. Pathogenetic and clinical relevance of cytokines in inflammatory bowel disease. Immunol Res 1991; 10: [PMID: ] 103 Pullman WE, Elsbury S, Kobayashi M, Hapel AJ, Doe WF. Enhanced mucosal cytokine production in inflammatory bowel disease. Gastroenterology 1992; 102: [PMID: ] 104 D Andrea N, Vigliarolo R, Sanguinetti CM. Respiratory involvement in inflammatory bowel diseases. Multidiscip Respir Med 2010; 5: [PMID: DOI: / ] 105 Eaton TE, Lambie N, Wells AU. Bronchiectasis following colectomy for Crohn s disease. Thorax 1998; 53: [PMID: ] 106 Black H, Mendoza M, Murin S. Thoracic manifestations of inflammatory bowel disease. Chest 2007; 131: [PMID: ] 107 Luo J, Li Y, Gong R. The mechanism of atopic march may be the social event of cells and molecules (Review). Int J Mol Med 2010; 26: [PMID: ] 108 Luo J, Wan Y. Tightly regulated distribution of family members of proteins is related to social property in the open body system (Review). Int J Mol Med 2006; 17: [PMID: ] 6803 October 28, 2013 Volume 19 Issue 40

116 Wang H et al. Gut-lung cross-talk in IBD 109 Desai D, Patil S, Udwadia Z, Maheshwari S, Abraham P, Joshi A. Pulmonary manifestations in inflammatory bowel disease: a prospective study. Indian J Gastroenterol 2011; 30: [PMID: DOI: /s ] 110 Bhagat S, Das KM. A shared and unique peptide in the human colon, eye, and joint detected by a monoclonal antibody. Gastroenterology 1994; 107: [PMID: ] 111 Oshitani N, Watanabe K, Nakamura S, Higuchi K, Arakawa T. [Extraintestinal complications in patients with ulcerative colitis]. Nihon Rinsho 2005; 63: [PMID: ] 112 Zhou B, Comeau MR, De Smedt T, Liggitt HD, Dahl ME, Lewis DB, Gyarmati D, Aye T, Campbell DJ, Ziegler SF. Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice. Nat Immunol 2005; 6: [PMID: ] 113 Zhu Z, Oh MH, Yu J, Liu YJ, Zheng T. The Role of TSLP in IL- 13-induced atopic march. Sci Rep 2011; 1: 23 [PMID: ] 114 Zhang Z, Hener P, Frossard N, Kato S, Metzger D, Li M, Chambon P. Thymic stromal lymphopoietin overproduced by keratinocytes in mouse skin aggravates experimental asthma. Proc Natl Acad Sci USA 2009; 106: [PMID: ] 115 Ying S, O Connor B, Ratoff J, Meng Q, Mallett K, Cousins D, Robinson D, Zhang G, Zhao J, Lee TH, Corrigan C. Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity. J Immunol 2005; 174: [PMID: ] 116 Nienhaus A, Kromark K, Raulf-Heimsoth M, van Kampen V, Merget R. Outcome of occupational latex allergy--work ability and quality of life. PLoS One 2008; 3: e3459 [PMID: DOI: /journal.pone ] 117 Zheng X, Yang Y, Zheng X, Zhou X, Ding W, Liu W. Correlation between the lung and large intestine from the microecological changes of lung and intestine flora. ZhongYi Zazhi 2011; 52: Li D, Yang S, Chen R. Experimental study on the mechanism of protective effect of free Fu on gut-derived endotoxinmediated lung damage. J Huazhong Univ Sci Technolog Med Sci 2004; 24: [PMID: ] P- Reviewers Capasso R, Sipos F, Yamamoto T S- Editor Gou SX L- Editor A E- Editor Zhang DN 6804 October 28, 2013 Volume 19 Issue 40

117 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. MINIREVIEWS Ligation of intersphincteric fistula tract: What is the evidence in a review? Omar Vergara-Fernandez, Luis Alberto Espino-Urbina Omar Vergara-Fernandez, Luis Alberto Espino-Urbina, Department of Colorectal Surgery, Instituto Nacional de Ciencias Medicas y Nutricion Salvador Zubiran, Mexico City, Mexico Author contributions: Vergara-Fernandez O and Espino-Urbina LA solely contributed to this paper. Correspondence to: Omar Vergara-Fernandez, MD, Chairman, Department of Colorectal Surgery, Instituto Nacional de Ciencias Medicas y Nutricion Salvador Zubiran, Mexico City, Mexico. omarvergara74@hotmail.com Telephone: Fax: Received: June 25, 2013 Revised: August 13, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 Abstract Broadly, complex fistulas are those that are not low transsphincteric or intersphincteric. The objectives of surgical management are to achieve fistula healing, prevent recurrences and maintain continence. The risk of incontinence associated with treatment ranges from 10% to 57%. The objective of this manuscript is to review the current literature to date on the ligation of the intersphincteric fistula tract procedure (LIFT procedure) as a treatment option in these types of fistula. A search was conducted in Medline, PUBMED, EMBASE and ISI Web of Knowledge, and studies published from January 2009 to May 2013 were included. The primary outcomes were fistula healing rates, mean healing time and patient satisfaction with this surgical technique. Eighteen studies were included in this review. The total number of patients included was 592 (65% male). The median age reported was 42.8 years. The most common type of fistula included was transsphincteric (73.3% of cases). The mean healing rate reported was 74.6%. The risk factors for failure discovered were obesity, smoking, multiple previous surgeries and the length of the fistula tract. The mean healing time was 5.5 wk, and the mean follow-up period was 42.3 wk. The patient satisfaction rates ranged from 72% to 100%. No de novo incontinence developed secondary to the LIFT procedure. There is not enough evidence that variants in the surgical technique achieve better outcomes (Bio-LIFT, LIFT-Plug, LIFT-Plus). This review indicates that the LIFT procedure is primarily effective for transsphincteric fistulas with an overall fistula closure of 74.6% and has a low impact on fecal continence. This procedure produces better outcomes at the first surgical attempt Baishideng. All rights reserved. Key words: Fistula-in-ano; Ligation; Intersphincteric; Fistula tract; Incontinence; Recurrence; Transsphincteric fistula Core tip: We review the current literature published until today about the ligation of intersphincteric fistula tract -procedure. The paper describes the different types of fistulas in which the technique has been used; the cure rates achieved; the reported recurrence rates; types of failures and morbidity related to it. The paper analyzes the prognostic factors for the success; describes the various modifications of the surgical technique and the results obtained with them. The manuscript classifies the types of failures and gives options for their proper treatments. With all these, it sets the achievements and limitations of the technique, with the scientific evidence available today. Vergara-Fernandez O, Espino-Urbina LA. Ligation of intersphincteric fistula tract: What is the evidence in a review? World J Gastroenterol 2013; 19(40): Available from: URL: DOI: INTRODUCTION Perianal abscess and fistulas represent two stages of 6805 October 28, 2013 Volume 19 Issue 40

118 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure the same disease. The main etiology is cryptoglandular. Perianal abscess and fistulas are two of the oldest human surgical entities [1]. The objectives of treatment are to achieve fistula healing, prevent recurrences and maintain continence. The risk of incontinence associated with treatment ranges from 10% to 57% [2]. The disease has an incidence of 8.6 per people and nearly to fistulas are treated annually in the United States [1]. The incidence of fistulae after perianal abscess is 27% to 60% [3]. Traditionally, a complex fistula is defined by a high risk of recurrence or incontinence following treatment. Broadly, complex fistulas are those that are not low trans-sphincteric or intersphincteric fistulas. The surgical options for these fistulas include fibrin application, plug placement, endorectal advancement flap (ERAF), fistulotomy with primary sphincter repair, partial fistulotomy with seton placement, ultra-low anterior resection and coloanal anastomosis, the ligation of the intersphincteric fistula tract (LIFT) procedure and recently, the videoassisted fistula tract procedure (VAAFT). Trans-sphincteric fistulas comprise 20%-25% of all fistula cases [3]. Although plug placement and applying fibrin are still being used, at present, there is a preference for the ERAF and LIFT procedures. The LIFT procedure, which is the topic of this review, involves the following principles: (1) identification of the internal opening; (2) incision at the intersphincteric groove; (3) dissection of the intersphincteric space; (4) identification of the intersphincteric fistula tract; (5) securing ligation and excision of the intersphincteric tract; (6) confirming the removal of correct fistulous tract; (7) opening and curetting the external opening; and (8) closure of the intersphincteric wound. A search was conducted in the Medline, PUBMED, EM- BASE and ISI Web of Knowledge databases, using the following terms: LIFT, anal fistula, perianal fistula, fistulain-ano, rectal fistula, complex anal fistula, ligation of intersphincteric fistula tract, sphincter sparing procedures, clinical trials, outcomes, recurrence, failure, morbidity and incontinence. All of the studies published in the English language from January 2009 to May 2013 were included in this review. We initiated the review from 2009 because the surgical technique was first described in that year. In the studies reported by the same group of authors, the outcomes considered for the analysis were those with a longer follow-up and a larger number of patients [4-7]. REVIEW OF THE LITERATURE In the present review, we included 18 papers: eleven were retrospective, two were retrospective and prospective, four were prospective and one was a randomized controlled trial (Table 1). The total number of patients was 592, and 385 were male (65%). The average age reported was years. Only a few studies included patients with the following characteristics: rectovaginal fistula, 3 studies with 6 patients in total; cigarette smoking, 2 studies with 21 patients; inflammatory bowel disease, 2 studies; diabetes, 3 studies; HIV, 1 study; and using corticosteroids, 1 study. Other special characteristics mentioned but not numerically specified were the presence of obesity, ischemic heart disease, rheumatoid arthritis and cancer. The most common type of fistula included was trans-sphincteric (73.3%). The percentage of low transsphincteric fistulas was 13.5%. The remaining fistulas were classified as horseshoe or hemi horseshoe (48), intersphincteric (11), suprasphincteric (9) and rectovaginal (6). In addition, 34.4% of the population had been previously operated using the same or another surgical technique. The mean operative time reported was min. Only two studies reported the length of hospital stay (2.5 d and 1.4 d, respectively), but most of the surgeries were performed on an outpatient basis. The mean healing rate was 74.6% (range: 40%-95%), and the mean healing time was 5.5 wk. The percentage of the population who had a drainage seton before the LIFT procedure was 56% (226/402). In 2009, Rojanasakul [8] first described the technique and reported a success rate of 94%. They included 18 patients, with a recurrence rate of 5.6%. Bleier et al [4] conducted a retrospective and prospective trial. They included 39 patients, 51.3% of whom were male. The mean age of the population was 49 years. The average number of previous surgeries to treat perianal fistulas was 2. In addition, 74% of the population had at least one previous failed surgical treatment. The average follow-up period was 20 wk. The success rate was 57%. The latency time to recurrence was 10 wk. Of the total recurrences, 4 recurrences were intersphincteric, 3 were transsphincteric and 1 was a horseshoe type. The incontinence rate was 0%. This represents the first experience in the United States. The same group, recently reported on the treatment of 93 patients (61% male), with a mean age of 43 years [5]. A 32% had been previously operated. A drainage seton was placed in 92% of the total patients. The healing rate dropped to 40% with a failure rate of 34%, and 26% of patients suffered a recurrence. The mean recurrence time was 7 mo. Nine patients had a down-staging of the fistula to intersphincteric and were treated with fistulotomy, achieving a secondary healing rate of 57%. The average Wexner score reported was 1. No patient had solid stool incontinence. Shanwani et al [9] performed a prospective study. A total of 45 patients were included. In total, 71.1% of patients were male, and the mean age was 41.5 years. The mean operative time was 67.5 min. The average hospital stay was 2.5 d (range: 2-5 d). During an average follow-up period of 9 mo, the cure rate was 82.2%, with an average healing time of 7 wk. The recurrence rate was 17.8%, and the recurrence occurred between 3 and 8 mo after surgery. There were no reported cases of fecal incontinence or morbidity. There are also variations to the conventional LIFT procedure. Ellis, based on the treatment of rectovaginal fistulas with approximately 92% of success, described the use of a bioprosthetic graft to reinforce the ligation and the closure of the fistula tract, calling it the BioLIFT procedure in a prospective study of 31 patients [10,11]. Twenty October 28, 2013 Volume 19 Issue 40

119 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure Table 1 Summary of the published articles Ref. Year Study design n Age (yr) Gender Fistula classification Preperative evaluation Healing rate Failure or recurrence rate Morbidity Incontinence Follow-up Comments Rojanasakul [8] 2009 Retro 18 NA NA 13 LTS NA 94% R 5.6% NA NA NA Healing time 4 wk 5 HS Bleier et al [4] 2010 Retro/ % male 28 TS, NA 57% 43% 2: Anal fissure and 0 (NAO) 20 wk PS mean 3 (0-9) pros 7 HS pain (0-58) 74% PS 1 SP, R time 10w (2-38) 2 RV Shanwani et al [9] 2010 Pros % male 33 TS 44% colonoscopy 82.20% R 17.7% 0 0 (NAO) 9 mo 11.1% PS (27-56) 48.80% anal USG (2-16) MOT 67.5 min (35-100) LOS 2.5 d (2-5) Healing time 7 wk (4-10) R time 3-8 mo Ellis [11] 2010 Pros male 31 TS NA 94% R 2 (6%) NA NA 15 mo Bio-LIFT (30-68) (12-30) Include: CD, CS, DM patients. 100% previous seton 18 PS (PLUG) Satisfaction 100% Ooi et al [12] 2011 Retro male 6 IS, 18 TS, 1 SP MRI 72% 68% R 28% (all IS) 0 Basal WS 2 22 wk PS 40% (21-67) PostOp Global (3-43) MOT 39 min (17-100) WS 4 Healing time 6 wk (3-17) Heal WS 0 R time 13.5 wk (7-20) Satisfaction 72% Aboulian et al [6] 2011 Retro % male NA NA 68% Fa 32% 2 Vaginal Candidiasis NA 27 wk Previous seton 65% (8-158) PS 27% Sileri et al [13] 2011 Pros male 15 TS 100% MRI or anal USG 83% R 3 1 Thrombosed NA 6 mo EC: CD. (4-62) 1HS Manometry (17%; 1 IS, 2 TS) external hemorrhoid (4-10) Previous seton 100% 2 RV Tan et al [14] 2011 Retro % male 89.2% TS (39 LTS, Anal USG 100% 86% R 6.4% NA NA 23 wk PS 28% (14-71) 44 HTS) Fa 7.5% (1-85) Previous seton 17.2% 4 IS, 22 HS 6 SP (4 IS, 3 sinus) Healing time 4 wk (1-12) R time 22 wk (15-24) Describes types of failures. Wallin et al [5] 2012 Retro / % male 16 HS NA 40% Fa 34% NA WS 1 0%-10% 19 mo (44-55) EC: less 3 mo FU, RV, CD, Pros (21-76) 77 TS Secondary R 26% 57% Abcarian et al [15] 2012 Retro NA TS NA 74% 1st 90% 2nd 75% 3rd 65% Tan et al [16] 2012 Retro 31ERAF ERAF 49 ERAF 87.1% High fistulas 100% anal USG ERAF 93.5%; 24 LIFT (19-74); LIFT 41 (16-75) male; LIFT 87.50% male LIFT 62.5%. P = % RFUVA: obesity, CS, PS ERAF Fa 6.5%; LIFT Fa 37.5%. P = Solid incontinence none (NAO) NA 0 (NAO) 18 wk (2-64) NA NA ERAF 6 mo (2-26); LIFT 13 mo (4-67) IAR, LI, PL. 32% PS 92% Previous seton R time 7 mo (0.8-27) Include: HIV, CD, Obesity, CS, DM. EC: acute abscess PS: 2 (0-12). Previous Seton 100% EC: VIH, CD. ERAF PS: 58.8%; LIFT PS: 25% 6807 October 28, 2013 Volume 19 Issue 40

120 Mushaya et al [17] 2012 RCT 39 LIFT 25 ERAF LIFT 17 males ERAF 10 males HTS 100% Anal USG or MRI. At 1 mo ERAF 85% vs LIFT 68% Finally 93% vs Han et al [18] 2012 Retro (25-56) 19 male NA 100% Anal USG 95% van Onkelen 2012 Retro (17-59) 13 male All LTS 100% MRI 82% et al [21] Secondary van Onkelen 2012 Retro (20-69) 32 male TS NA 51% et al [22] Secondary 92% 100% 71% R ERAF 7% vs LIFT 8%, P = NS LIFT 4% bleeding, 8% dehiscence IS wound. ERAF 7% dehiscence apex NAO Report equal functional outcomes NA 0 Mean WS 0 (5% WS 1). 0 NA 0 Fa 20 (8 IS alone) Liu et al [7] 2013 Retro % male 38 TS NA 61% Fa 15 Lehmann et al [20] 2013 Retro (30-76) 9 male All recurrent fistulas. 15 TS (3 LTS, 12 HTS) 2 RV male 36 TS (3 LTS, 33 NA Complete 47% 12 early type 3 late type 40% R 13% Fa (Rockwood) NA Rockwood PreOp 10 PostOp 7 20 mo Comorbidities: DM, RA, Ca, 14 mo (12-15) 19.5 mo (3-35) 15 mo (7-21) NA 0 (NAO) 26 mo 1 Local Hematoma 1 Subcutaneous infection (3-44) 0 (NAO) 13.5 mo (8-26) IHD (33%) EC: CD MOT LIFT 10 min MOT ERAF 42.5 min Pain less with LIFT Satisfaction LIFT 9.8 vs ERAF 8.1, P < RNA favored LIFT (P = 0.016) LIFT-PLUG PS 0 EC: CD, FI, MT, acute abscess, HIV, Tb. MOT 20 min (15-40) Healing time faster PS 10 patients EC: CD, RV Female all healed with first LIFT ERAF + LIFT PS 48% 3 previous ERAF EC: RV, CD 68% more 12 mo FU. 18% PS. Previous seton 76%. Length of fistula tract correlates with healing rate. Healing time 8 wk (4-36). F time 4 mo Previous Seton 4. Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure Sirikurnpiboon 2013 Pros 41 et al [23] 20 LIFT 21LIFT plus HTS), 4 HS, 1 SP NA 83% LIFT 83% vs LIFT-plus 85% P = Fa 7 LIFT 4 LIFT-plus 3 LIFT-plus 1 Anal fissure, 1 local hemorrhage LIFT 1 Anal fissure MOT 35 min LOS 1.4 d 0 (NAO) 19 wk Healing time 4 wk R time 12 wk Ca: Cancer; CD: Crohn s disease; CS: Cigarette smoking; DM: Diabetes; EC: Exclusion criteria; Fa: Failure; HIV: Human immunodeficiency syndrome; HS: Horseshoe fistula; HTS: High trans-sphincteric; IAR: Ileo anal reservoir; IHD: Ischemic heart disease; IS: Intersphincteric fistula; LI: Loop ileostomy; LOS: Length of stay; LTS: Low trans-sphincteric fistula; MOT: Mean operative time; NAO: Not assessed objectively; NA: Not available; PL: Patients lost; PostOp: Post-operative; Pros: Prospective; PS: Previous surgeries; R: Recurrence; RA: Rheumatoid arthritis; RCT: Randomized controlled trial; RNA: Resumption normal activities; Retro: Retrospective; RFUVA: Risk factor in univariate analysis; RV: Rectovaginal fistula; SP: Supra-sphincteric fistula; Tb: Tuberculosis; TS: Trans-sphincteric fistula; WS: Wexner score October 28, 2013 Volume 19 Issue 40

121 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure two of these patients were men, with an average age of 48 years. The patch was derived from the submucosa of the porcine small intestine with a size of 4 cm 7 cm, which overlaps the fistula tract for 1-2 cm. Fixation was performed to the puborectalis muscle and to the external anal sphincter with absorbable material. BioLIFT achieved a 94% success rate during an average followup period of 15 mo. There were two recurrences (one intersphincteric and one hemi-horseshoe). There was local induration and drainage from the operative wound that resolved without any intervention other than routine postoperative care in 12 patients. The degree of satisfaction reported was 100%. Ooi et al [12] conducted a trial including 25 patients (17 males). The mean age was 40 years. Approximately 40% of the patients had been previously operated on, and the preoperative Wexner score of the cohort was 2. The healing rate was 68% with a mean follow-up period of 22 wk. The mean operative time was 39 min. There was no morbidity. The global postoperative Wexner score was 4. In the subgroup of patients who achieved healing, the Wexner score was 0. The mean healing time was 6 wk. All the recurrences (28%) were in the form of intersphincteric fistulas. The authors achieved a 72% patient satisfaction rate. Aboulian et al [6] treated 25 patients (68% male) with 26 LIFT procedures. The mean age was 39 years. Of those patients, 65% had been previously operated on by drainage seton placement, and 27% of patients had failed to heal after treatment with another previous fistula technique. An average follow-up period of 27 wk was achieved. The healing rate was 68%. The morbidity reported was low and unrelated to the surgical procedure. In a later report of their series with a larger cohort and longer follow-up, patients who healed completely were contacted every 6 mo thereafter to assess for any recurrence of symptoms [7]. This group categorized patients with persistent symptoms or reappearance of symptoms before 6 mo as early failures. Late failures were those with resolution in the early period but return of symptoms after 6 mo. A total number of 38 patients were followed. The mean follow-up period was 26 mo, but 68% of patients had a follow-up period in excess of 12 mo. Only 18% of patients had previous fistula surgery, but 76% had received a drainage seton prior to the LIFT procedure. The study described a 61% healing rate after the first LIFT procedure. A total of 15 patients with failures were reported with a median time to the diagnosis of 4 mo. Of these patients, 12 failures were early type, and 3 failures were late type. Taking into account all failures, 4 were blind infected sinus, 2 occurred in the form of intersphincteric fistula (down-staging effect), and 9 occurred as the same trans-sphincteric fistula. In this series, the median healing time was 8 wk. No incontinence or morbidity was reported. Sileri et al [13], in a prospective study, treated 18 patients (10 of them male), with a mean age of 39 years. All the patients had a history of abscess drainage and seton placement over a period of 6 to 8 wk. The healing rate was 83% with only 3 recurrences (one was intersphincteric treated with fistulotomy, and the others were 2 transsphincteric fistulas treated with seton placement and ERAF). The average follow-up period was 6 mo. The only morbidity reported was a thrombosed external hemorrhoid. In one of the largest series described, Tan et al [14] analyzed the outcomes of 93 patients (82.8% male). The mean age reported was 40 years. Of the patients, 28% had been operated with another surgical technique before, and only 17.2% had a seton drainage for a mean time interval of 11 wk. The average follow-up period was 23 wk. The success rate was 86%, with a mean healing time reported of 4 wk. The recurrence rate was 6.4%, and the failure rate was 7.5%. Of the 7 patients with failure, 4 were down-staged the fistula to intersphincteric and treated with fistulotomy, and 3 patients had a blind sinus treated with silver nitrate and antibiotics. There were 6 recurrent transsphincteric fistulas. The mean time interval between treatment and failure was 22 wk. The authors described three types of failure. Type Ⅰ is a localized failure or blind sinus characterized by secretion or discharge in the intersphincteric wound without evidence of primary opening and adequate granulation of the external orifice. Type 2 is a partial failure with down-staging of the fistula tract (the fistula is now intersphincteric), and type 3 is a total failure with the same previous fistula tract but without involvement of the intersphincteric wound. Abcarian et al [15] reported the results of 40 patients with a mean age of 43 years. The cohort had an average of 2 previous surgeries. The healing rate was 74%, but those patients primarily treated with the LIFT procedure had a healing rate of 90%. In contrast, the patients with one previous surgery had a healing rate of 75%, and the patients with two or more previous surgeries had a success rate of 65%. The mean follow-up period was 18 wk. The authors did not report any functional change in continence. Tan et al [16], in a retrospective study, compared endorectal advancement flap (ERAF) vs the LIFT procedure after all the patients had been operated on with seton placement. A total of 31 ERAF procedures were performed. The mean age of this population was 49 years (87.1% male). In this group, 58.8% of patients had been previously operated on, and the time interval between seton placement and ERAF was 13 wk. The total healing rate was 93.5%, with an average follow-up period of 6 mo. A total of 24 patients were included in the group treated by the LIFT procedure, with 87.5% of the patients being male and a mean age of 41 years. Only 25% of patients had been previously operated on, and the time interval between seton placement and the LIFT procedure was 14 wk. The mean follow-up period was 13 mo. A success rate of 62.5% was reported. The ERAF procedure was more effective in this study [healing: ERAF (93.5%) vs LIFT (62.5%); failure: ERAF (6.5%) vs 6809 October 28, 2013 Volume 19 Issue 40

122 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure LIFT (37.5%), P = 0.006]. Mushaya et al [17], in a randomized and controlled trial, compared the LIFT and ERAF procedures. A total of 39 patients were included with a mean age of 47.8 years. In the LIFT group, there were 25 patients (17 males), and in the ERAF group, there were 14 patients (10 males). The mean follow-up period was 20 mo. The mean operative time of LIFT group was 10 min vs 42.5 min in the ERAF group (P < 0.001). The postoperative pain was greater in the ERAF group (visual analogue scale: ERAF 1 vs LIFT 0, P = 0.017). The satisfaction rate favored the LIFT procedure (9.5 vs 8.1, P < 0.001). The morbidity did not differ between procedures (4% bleeding in LIFT group, 7% partial dehiscence at the apex in ERAF group, and 8% dehiscence at perianal wound in LIFT group). The healing rate at one month was 85% and 68% for the ERAF and LIFT groups, respectively. At the end of the study, the success rates were 93% and 92%, respectively. The recurrence rates were similar (7% in the ERAF group and 8% in the LIFT group, P = NS). The interval between surgery and resumption of daily activities favored the LIFT procedure (P = 0.016). The functional outcomes were equal between both techniques. In another attempt to improve the results, Han et al [18] described a technique using the insertion of a bioprosthetic anal plug in the fistula tract (LIFT-PLUG procedure). They reported their experience in 21 patients (19 of the male gender), and none had previously received an operation. The mean operative time was 20 min. The healing rate achieved was 95% over an average follow-up period of 14 mo. In this series, the mean healing time of the secondary opening was 2 wk, and at the intersphincteric wound, it was 4 wk (faster than previously reported). There was no morbidity. Only 5% of patients reported a Wexner score of 1. A larger randomized, multicenter prospective trial comparing LIFT-Plug with LIFT is in progress, including selected cases without previous surgeries (clinical trial number NCT ) [19]. Lehmann et al [20] reported the efficacy of the LIFT for recurrent anal fistulas exclusively. They included 17 patients, including 9 males, with a mean age of 49 years. In total, 47% of the fistulas were located posteriorly. Eleven patients had more than two previous surgeries, and six patients had more than 3 surgeries. Only 4 patients had been placed a seton drainage previously (the mean time of latency until the LIFT was 15 mo). The healing rate reported was 76.4%, but only 65% of patients presented complete healing during the mean follow-up period of 13.5 mo. The operative time was 35 min. In addition, 41% of patients received an operation on an outpatient basis with a length of stay in the cohort of 1.4 d. Only 2 complications were reported (local hematoma and subcutaneous infections). In the follow-up, 2 patients developed a recurrence, and 1 patient had a sinus. The complete healing rate was 47%, and the incomplete healing rate was 13% (a total of 60%). In addition, 40% of patients had persistence or recurrent fistula. No de novo incontinence was reported. There are two interesting studies that have attempted to expand the existing indications for the procedure. In the first, van Onkelen et al [21] described 22 patients who had low transsphincteric fistula. Thirteen patients were male, and the mean age of the cohort was 45 years. Of the 9 female patients, 8 had an anterior fistula, and 10 patients of the cohort had previously received an operation. The healing rate was 82%, with 4 down-stages to an intersphincteric fistula treated by simple lay open. With these patients, the final success rate was 100%. All of the female patients achieved complete healing using the first LIFT procedure. The mean follow-up period was 19.5 mo. There was no fecal incontinence reported (using the Rockwood fecal incontinence severity index). The same group raises the possibility of use in conjunction the ERAF and LIFT procedure to prevent recurrence due to infection at the residual tissue [22]. The researchers analyzed the results of a series with 41 patients (32 of them male). The mean age was 42 years. In total, 48% had received previous operations (3 ERAF procedures). The LIFT procedure was performed first followed by the ERAF. A healing rate of 51% was reported with a mean follow-up period of 15 mo. Of the failures, 12 of the failures had drainage in the external opening and the intersphincteric wound, and only 8 had drainage in the intersphincteric wound alone. This subgroup of patients was treated by lay open fistulotomy with a secondary healing rate of 71%. With a new modification of the surgical technique, Sirikurnpiboon et al [23] compared the effectiveness of adding a partial fistulotomy until the external sphincter (called the LIFT-PLUS procedure) in a prospective study of 41 patients. A total of 20 patients underwent the LIFT procedure (with only curettage of the tract and widening of the external opening), and 21 underwent the LIFT-plus procedure. The average age of the population was 40.7 years. The healing rate achieved was 83%, with a mean follow-up period of 19 wk. The median wound healing time was 4 wk, and the mean time to recurrence was 12 wk. There was no incontinence reported. Morbidity cases included one anal fissure and one local bleeding in the LIFT-plus group and one anal fissure in the regular procedure group. There were 7 treatment failures: 4 in the LIFT group (3 recurrences and 1 sinus abscess) and 3 in the LIFT-plus group (2 recurrences and 1 intersphincteric fistula). All of these patients were healed using the same technique without morbidity or change in continence status. The healing rate by group was 81% in the LIFTprocedure and 85% in the LIFT-plus group, respectively (P = ). Lastly, a patient who underwent stapled hemorrhoidopexy and subsequently developed a remnant sinus tract that was successfully treated with the LIFT procedure [24]. COMPARISON OF THE RESULTS In 1993, Matos et al [25] described a technique of excision of intersphincteric anal gland infection. They excised the 6810 October 28, 2013 Volume 19 Issue 40

123 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure entire fistula tract, in addition to primary repair, by means of an intersphincteric approach by suturing the internal anal sphincter defect. Their success with 20 patients was only 45%. These poor results were attributed to blood supply issues that resulted in wound breakdown. In the two studies comparing the ERAF against LIFT procedure, the results reported effectiveness of 94% vs 62.5% and 93% vs 92%, respectively [16,17]. In the former study, the follow-up was shorter for the ERAF group [16]. It is also important is the larger proportion of patients with previous fistula surgeries in the ERAF group, a possible selection bias. The reported success rate of the ERAF group was unusually higher than previously reported in other trials [26,27]. In these previous studies, the authors did not objectively evaluate functional outcomes. Nevertheless, there have been reports citing incontinence rates of up to 35% after ERAF [28]. Not all studies specifically stated the types of fistulas treated. Although the procedure is theoretically ideal for high transsphincteric fistulas, the most common type of fistula was transsphincteric. In addition, van Onkelen et al [21] described the results of the procedure in the treatment of low transsphincteric fistulas. They reported a final and secondary healing rate of 100% without effect on continence. Bokhari et al [29] reported that major and minor incontinence after fistulotomy for low fistulas reached up to 5% and 11%, respectively. These authors noted that the other factors taken into account for a greater risk of incontinence are female sex and anterior fistulas or at-risk for obstetric history [29]. Garcia-Aguilar et al [30] reported major and minor incontinence after fistulotomy for low transsphincteric fistulas in 44% of their patients. They also observed that female sex and an internal opening located in the midline anteriorly were predictive factors of impaired continence after fistulotomy [30]. Cavanaugh et al [31] demonstrated that only the amount of external anal sphincter divided correlated with fecal incontinence in severity index scores. It appears possible that the division of the lower part of the external anal sphincter can be avoided in the treatment of transsphincteric fistula using the LIFT procedure. Two studies reported the routine ligation of the primary internal orifice in their application of the LIFT technique [5,6]. During the LIFT procedure, Wallin et al [5] no-touched the primary opening in 87% of cases, ligated them in 8% of cases, performed a partial internal sphincterotomy in 4% of cases, used Alloderm in 5% of cases and created a mucosal flap in 1% of cases. In a univariate analysis, only the use of biologic mesh displayed a tendency for healing, but the proportions of patients were scarce and did not reach statistical significance. In the study written by Aboulain et al [6], the primary internal opening was closed in the mucosal side within the anal canal to prevent the entry of new infective agents. They achieved a healing rate of 68%. Specifically, the use of a bioprosthetic mesh (Bio-LIFT procedure) reported a 94% success rate, and the use of a plug (LIFT-PLUG procedure) resulted in a reported cure rate of 95% [11,18]. The BioLIFT technique has two potential disadvantages. First, it requires a more extensive dissection in the intersphincteric space. The physiologic consequences of this dissection have not been studied and are unknown. The second disadvantage of both techniques is the relatively high cost of the bioprosthetic materials. The healing time in the study that used the PLUG was 2 wk for the secondary external orifice and 4 wk for the intersphincteric wound (faster than previously reported) [18]. These series do not conclusively demonstrate a benefit that would justify the increased cost of the use of a bioprosthetic material. The addition of the partial excision of the fistula tract (partial fistulotomy) until the external anal sphincter is reached (LIFT-plus), or the use of both techniques (LIFT and ERAF procedures) simultaneously in the same patients, did not display any advantage [22,23]. To date, there have been no prospective randomized trials comparing the modifications made to the original technique. Although most studies include a high percentage of previously treated patients, the results in a series of patients with only recurrent fistulas indicated a cure rate of 47%. The scarring following the resolution of the inflammatory post-surgical response can result in fibrosis and obliteration of the intersphincteric space. This makes the dissection in the intersphincteric plane difficult. Tan et al [16] concluded that given the simplicity of the LIFT procedure, clinicians should still perform the LIFT procedure in patients presenting for the first time and recommend the ERAF procedure in patients with multiple previous surgeries and a scarred perianal region. Only one trial classified the therapeutic failures as early (80%) and late (20%) [7]. In this trial, Aboulain et al [6] recommended that in patients with persistent symptoms it may be prudent to observe and manage symptoms with local care up to 6 mo before planning for additional treatment. The researchers affirmed that it is important to individualize all cases because some patients may require earlier intervention if their symptoms worsen or develop significant sepsis [6,7]. Tan et al [16] considered that meticulous dissection along the intersphincteric plane while maintaining the integrity of the internal sphincter and the anal mucosa is critical. Any breach or buttonhole of the anal canal mucosa during the procedure can lead to a higher risk of failure. Taking into account the classification previously described for recurrences and the results of 12 studies, nine cases were type 1 (blind sinus), thirty-two cases were type 2 (intersphincteric fistula) and forty-seven cases were type 3 (transsphincteric fistula) [4-7,12-14,16,17,21-23]. The recommended treatments are local measures for type-1 failures, fistulotomy for type-2 failures, and reperforming the LIFT procedure or ERAF procedures for type-3 recurrences. The risk factors for failure were obesity, smoking, multiple previous surgeries and the length of the fistula track [7,15]. In a retrospective study, the healing rate for patients without previous surgery was 95%, whereas the rate for those with multiple surgeries was 65% [15]. A pre October 28, 2013 Volume 19 Issue 40

124 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure viously unreported finding was that for every one centimeter increase in fistula length, the odds ratio for healing decreased by 0.55 (95%CI: , P = 0.01). In this study, the median length of fistula tract was shorter in the healed group compared with the failed group (4 cm vs 6 cm, P = 0.004). After choosing 3 cm as an arbitrary cutoff point, fistula tracts under three centimeters had significantly higher primary healing (85% vs 48%, P = 0.04). In addition, 66% of this cohort had a tract length of more than 3 cm [7]. van Onkelen et al [22] reported that a past history of previous surgeries, seton placement, lateral localization of primary opening and horseshoe extension showed a trend for recurrence. Sirikurnpiboon et al [23] described that body mass index was the only predictor factor for failure in a univariate analysis. Failure to identify the fistula tract occurred more often in obese patients with a body mass index of more than 30 kg/mt 2 (P = 0.001). There were fourteen complications, which included anal fissures (4), bleeding (3), intersphincteric wound dehiscence (2), vaginal candidiasis (2), chronic anal pain (1), a thrombosed external hemorrhoid (1), and a subcutaneous infection (1). All these were mild and resolved with conservative treatment. It is important to mention that only four trials used a standardized scale to assess functional outcomes [12,18,21,22]. In summary, no de novo incontinence developed secondary to the LIFT procedure with an overall follow-up period of 42.3 wk. Only 10 of 18 studies reported the use of a seton before LIFT procedure [5,7,11,13,14,16,17,20-22]. For the LIFT procedure be effective, an epithelialized well-formed tract is advised. In theory, if the tract is inflamed or in the absence of enough granulation tissue, there may not be adequate tissue strength to permit ligation. However, Mitalas et al [32], found no correlation between prior seton drainage and the presence of epithelium. None of the studies in this review indicated a benefit in using a seton before LIFT procedure. CONCLUSION The currently available information indicates that the LIFT procedure is a feasible and effective surgical technique, with low impact on fecal continence. Its main indication is for transsphincteric fistulas in patients without previous surgery and with short fistula tracts. Patients with more complex fistulas, especially with multiple previous surgeries, should be considered for the ERAF procedure. There is a lack of evidence to recommend the combined use of prosthetic materials or to perform the combined LIFT-ERAF procedure. Further randomized controlled trials are needed to recommend routinely the LIFT procedure against other surgical techniques for anal fistulas. REFERENCES 1 Blumetti J, Abcarian A, Quinteros F, Chaudhry V, Prasad L, Abcarian H. Evolution of treatment of fistula in ano. World J Surg 2012; 36: [PMID: DOI: / s ] 2 Jacob TJ, Perakath B, Keighley MR. Surgical intervention for anorectal fistula. Cochrane Database Syst Rev 2010; (5): CD [PMID: DOI: / CD pub2] 3 Abcarian H. Anorectal infection: abscess-fistula. Clin Colon Rectal Surg 2011; 24: [PMID: DOI: / s ] 4 Bleier JI, Moloo H, Goldberg SM. Ligation of the intersphincteric fistula tract: an effective new technique for complex fistulas. Dis Colon Rectum 2010; 53: [PMID: DOI: /DCR.0b013e3181bb869f] 5 Wallin UG, Mellgren AF, Madoff RD, Goldberg SM. Does ligation of the intersphincteric fistula tract raise the bar in fistula surgery? Dis Colon Rectum 2012; 55: [PMID: DOI: /DCR.0b013e318266edf3] 6 Aboulian A, Kaji AH, Kumar RR. Early result of ligation of the intersphincteric fistula tract for fistula-in-ano. Dis Colon Rectum 2011; 54: [PMID: ] 7 Liu WY, Aboulian A, Kaji AH, Kumar RR. Long-term results of ligation of intersphincteric fistula tract (LIFT) for fistulain-ano. Dis Colon Rectum 2013; 56: [PMID: DOI: /DCR.0b013e c] 8 Rojanasakul A. LIFT procedure: a simplified technique for fistula-in-ano. Tech Coloproctol 2009; 13: [PMID: DOI: /s ] 9 Shanwani A, Nor AM, Amri N. Ligation of the intersphincteric fistula tract (LIFT): a sphincter-saving technique for fistula-in-ano. Dis Colon Rectum 2010; 53: [PMID: DOI: /DCR.0b013e3181c160c4] 10 Ellis CN. Outcomes after repair of rectovaginal fistulas using bioprosthetics. Dis Colon Rectum 2008; 51: [PMID: DOI: /s ] 11 Ellis CN. Outcomes with the use of bioprosthetic grafts to reinforce the ligation of the intersphincteric fistula tract (Bio- LIFT procedure) for the management of complex anal fistulas. Dis Colon Rectum 2010; 53: [PMID: DOI: /DCR.0b013e3181ec4470] 12 Ooi K, Skinner I, Croxford M, Faragher I, McLaughlin S. Managing fistula-in-ano with ligation of the intersphincteric fistula tract procedure: the Western Hospital experience. Colorectal Dis 2012; 14: [PMID: DOI: /j x] 13 Sileri P, Franceschilli L, Angelucci GP, D Ugo S, Milito G, Cadeddu F, Selvaggio I, Lazzaro S, Gaspari AL. Ligation of the intersphincteric fistula tract (LIFT) to treat anal fistula: early results from a prospective observational study. Tech Coloproctol 2011; 15: [PMID: DOI: / s ] 14 Tan KK, Tan IJ, Lim FS, Koh DC, Tsang CB. The anatomy of failures following the ligation of intersphincteric tract technique for anal fistula: a review of 93 patients over 4 years. Dis Colon Rectum 2011; 54: [PMID: DOI: /DCR.0b013e31822bb55e] 15 Abcarian AM, Estrada JJ, Park J, Corning C, Chaudhry V, Cintron J, Prasad L, Abcarian H. Ligation of intersphincteric fistula tract: early results of a pilot study. Dis Colon Rectum 2012; 55: [PMID: DOI: / DCR.0b013e318255ae8a] 16 Tan KK, Alsuwaigh R, Tan AM, Tan IJ, Liu X, Koh DC, Tsang CB. To LIFT or to flap? Which surgery to perform following seton insertion for high anal fistula? Dis Colon Rectum 2012; 55: [PMID: DOI: / DCR.0b013e31826dbff0] 17 Mushaya C, Bartlett L, Schulze B, Ho YH. Ligation of intersphincteric fistula tract compared with advancement flap for complex anorectal fistulas requiring initial seton drainage. Am J Surg 2012; 204: [PMID: DOI: / j.amjsurg ] 6812 October 28, 2013 Volume 19 Issue 40

125 Vergara-Fernandez O et al. Ligation of intersphincteric fistula tract procedure 18 Han JG, Yi BQ, Wang ZJ, Zheng Y, Cui JJ, Yu XQ, Zhao BC, Yang XQ. Ligation of the intersphincteric fistula tract plus a bioprosthetic anal fistula plug (LIFT-Plug): a new technique for fistula-in-ano. Colorectal Dis 2013; 15: [PMID: DOI: /codi.12062] 19 Wang ZJ. Ligation of Intersphincteric Fistula Tract (LIFT) Versus LIFT-plug Procedure for Anal Fistula Repair. Available from: URL: http//clinicaltrials.gov/show/ NCT Lehmann JP, Graf W. Efficacy of LIFT for recurrent anal fistula. Colorectal Dis 2013; 15: [PMID: DOI: /codi.12104] 21 van Onkelen RS, Gosselink MP, Schouten WR. Ligation of the intersphincteric fistula tract in low transsphincteric fistulae: a new technique to avoid fistulotomy. Colorectal Dis 2013; 15: [PMID: DOI: /codi.12030] 22 van Onkelen RS, Gosselink MP, Schouten WR. Is it possible to improve the outcome of transanal advancement flap repair for high transsphincteric fistulas by additional ligation of the intersphincteric fistula tract? Dis Colon Rectum 2012; 55: [PMID: DOI: / DCR.0b013e31823c0f74] 23 Sirikurnpiboon S, Awapittaya B, Jivapaisarnpong P. Ligation of intersphincteric fistula tract and its modification: Results from treatment of complex fistula. World J Gastrointest Surg 2013; 5: [PMID: DOI: /wjgs. v5.i4.123] 24 Baharudin MN, Hassan ZM, Nor AM, Rahman AA. Recurrent infection of a sinus tract at the staple line after hemorrhoidopexy: extending the indications for ligation of the intersphincteric fistula tract (LIFT). Tech Coloproctol 2011; 15: [PMID: DOI: /s ] 25 Matos D, Lunniss PJ, Phillips RK. Total sphincter conservation in high fistula in ano: results of a new approach. Br J Surg 1993; 80: [PMID: DOI: / bjs ] 26 Schouten WR, Zimmerman DD, Briel JW. Transanal advancement flap repair of transsphincteric fistulas. Dis Colon Rectum 1999; 42: ; discussion [PMID: ] 27 Ortíz H, Marzo J. Endorectal flap advancement repair and fistulectomy for high trans-sphincteric and suprasphincteric fistulas. Br J Surg 2000; 87: [PMID: DOI: /j x] 28 van der Hagen SJ, Baeten CG, Soeters PB, van Gemert WG. Long-term outcome following mucosal advancement flap for high perianal fistulas and fistulotomy for low perianal fistulas: recurrent perianal fistulas: failure of treatment or recurrent patient disease? Int J Colorectal Dis 2006; 21: [PMID: DOI: /s ] 29 Bokhari S, Lindsey I. Incontinence following sphincter division for treatment of anal fistula. Colorectal Dis 2010; 12: e135-e139 [PMID: DOI: / j x] 30 Garcia-Aguilar J, Belmonte C, Wong WD, Goldberg SM, Madoff RD. Anal fistula surgery. Factors associated with recurrence and incontinence. Dis Colon Rectum 1996; 39: [PMID: DOI: /BF ] 31 Cavanaugh M, Hyman N, Osler T. Fecal incontinence severity index after fistulotomy: a predictor of quality of life. Dis Colon Rectum 2002; 45: [PMID: DOI: /s ] 32 Mitalas LE, van Onkelen RS, Monkhorst K, Zimmerman DD, Gosselink MP, Schouten WR. Identification of epithelialization in high transsphincteric fistulas. Tech Coloproctol 2012; 16: [PMID: DOI: /s ] P- Reviewer Guo GX, Santoro GA S- Editor Song XX L- Editor A E- Editor Zhang DN 6813 October 28, 2013 Volume 19 Issue 40

126 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. ORIGINAL ARTICLE Curcumin cytotoxicity is enhanced by PTEN disruption in colorectal cancer cells Lin Chen, Wen-Feng Li, Hong-Xiao Wang, Hai-Na Zhao, Jia-Jia Tang, Chang-Jie Wu, Li-Ting Lu, Wan-Qin Liao, Xin-Cheng Lu Lin Chen, Hong-Xiao Wang, Hai-Na Zhao, Jia-Jia Tang, Chang-Jie Wu, Li-Ting Lu, Wan-Qin Liao, Xin-Cheng Lu, Institute of Genomic Medicine, Wenzhou Medical University, Wenzhou , Zhejiang Province, China Wen-Feng Li, Department of Oncology, First Affiliated Hospital of Wenzhou Medical University, Wenzhou , Zhejiang Province, China Author contributions: Chen L and Li WF performed the main experiments, and contributed equally to this work; Tang JJ, Wang HX, Wu CJ and Zhao HN performed part of the experiments; Lu LT provided technical assistance; Liao WQ and Lu XC designed the research and wrote the manuscript. Supported by The National Natural Science Foundation of China, No to Liao WQ; No to Lu XC Correspondence to: Xin-Cheng Lu, Professor, Institute of Genomic Medicine, Wenzhou Medical University, No. 270 Xueyuanxi Road, Wenzhou , Zhejiang Province, China. xinchenglu@yahoo.com Telephone: Fax: Received: July 3, 2013 Revised: September 2, 2013 Accepted: September 15, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the effects of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) deficiency on the cytotoxicity of chemotherapeutic agents toward colorectal cancer cells. METHODS: PTEN-deficient colorectal cancer (CRC) cells were generated by human somatic cell gene targeting using the adeno-associated virus system. The cytotoxic effects of compounds including curcumin, 5-fluorouracil (5-FU), dihydroartemisinin (DHA), irinotecan (CPT-11) and oxaliplatin (OXA) on cancer cells were determined using the MTT assay. Enhanced cytotoxicity of curcumin in PTEN-deficient CRC cells was observed, and this was confirmed using clonogenic assays. Apoptosis and cell cycle progression were analyzed by flow cytometry. Levels of apoptosis and cell cycle-related proteins were examined by Western blotting. RESULTS: We developed an isogenic set of CRC cell lines that differed only in their PTEN status. Using this set of cell lines, we found that disruption of the PTEN gene had no effect on the sensitivity of CRC cells to 5-FU, CPT-11, DHA, or OXA, whereas PTEN disruption increased the sensitivity of CRC cells to curcumin. Loss of PTEN did not alter the curcumin-induced apoptosis in CRC cells. However, PTEN deficiency led to an altered pattern of curcumin-mediated cell cycle arrest. In HCT116 PTEN +/+ cells, curcumin caused a G2/M phase arrest, whereas it caused a G0/G1 phase arrest in HCT116 PTEN -/- cells. Levels of cell cycle-related proteins were consistent with these respective patterns of cell cycle arrest. CONCLUSION: Curcumin shows enhanced cytotoxicity toward PTEN-deficient cancer cells, suggesting that it might be a potential chemotherapeutic agent for cancers harboring PTEN mutations Baishideng. All rights reserved. Key words: Phosphatase and tensin homolog deleted on chromosome 10; Curcumin; Chemotherapeutic agents; Cell cycle; AKT signaling Core tip: Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) mutations lead to cancer progression and drug resistance. Chemotherapeutic agents with enhanced effectiveness against cancers with PTEN mutations are urgently required. In this study, we generated an isogenic set of human colorectal cancer cell lines that differed only in their PTEN status. We found that curcumin showed enhanced cytotoxicity in cancer cells deficient in PTEN. Importantly, PTEN deficiency led to an alteration in the pattern of curcumin-induced cell cycle arrest, which was associated with the PTEN/AKT/p October 28, 2013 Volume 19 Issue 40

127 Chen L et al. PTEN deficiency affects curcumin cytotoxicity pathway. Our findings suggest that curcumin is a potential chemotherapeutic agent for PTEN-mutant cancers. Chen L, Li WF, Wang HX, Zhao HN, Tang JJ, Wu CJ, Lu LT, Liao WQ, Lu XC. Curcumin cytotoxicity is enhanced by PTEN disruption in colorectal cancer cells. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6814.htm DOI: org/ /wjg.v19.i chemotherapeutic agents that could overcome resistance in PTEN-mutant CRC, we developed an isogenic set of human CRC cell lines that differed only in their PTEN status. Cytotoxicity analysis of these cell lines with several anti-cancer agents showed that curcumin had enhanced cytotoxicity towards CRC cells deficient in PTEN. Moreover, loss of PTEN expression led to a change in curcumin-induced cell cycle arrest patterns, which might be associated with PTEN-regulated AKT/p21 signaling. Our findings suggest that curcumin might have potential in the treatment of cancers with PTEN mutations. INTRODUCTION Cancer is a leading cause of death worldwide and increasing attention has been focused on the strategies to reduce its incidence [1]. Chemotherapy is one of the main means of treating cancers; however, resistance to chemotherapeutic drugs remains a major obstacle to effective cancer therapy [2,3]. Therefore, novel intervention strategies to enhance the effectiveness of chemotherapeutic drugs and reduce their resistance are urgently required. Cancer is caused by a series of genetic changes, including mutations in oncogenes and tumor suppressor genes [4]. Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is one of the most frequently mutated tumor suppressor genes in human cancers, after p53 [5]. PTEN is involved in many important biological processes, including cell proliferation, growth, migration and death [6]. Germline mutations of PTEN result in several rare cancer predisposition syndromes, such as Cowden disease, Bannayan-Zonana syndrome, Proteus syndrome and Lhermitte-Duclos disease [7]. Mice heterozygous for PTEN develop spontaneous tumors in a number of organs [8]. Conditional deletion of the murine PTEN gene leads to tissue-specific tumorigenesis [9]. PTEN acts as a lipid phosphatase that antagonizes the phosphatidylinositide 3-kinase (PI3K) signaling by dephosphorylating phosphatidylinositol (3,4,5)-trisphosphate (PIP3) back to phosphatidylinositol (4,5)-bisphosphate (PIP2). Mutations in PTEN lead to constitutive activation of AKT kinase and other downstream effectors, and thus promote tumorigenesis [10]. PTEN mutations are found in a number of human cancers, including cancers of the colon, breast, lung, liver, and lymphatic system [11-15]. The fact that mutated PTEN is present only in the cancer cells makes PTEN an appealing drug target for cancer treatment [16]. However, mutational inactivation of PTEN leads to cancer progression and chemotherapy resistance. Loss of PTEN expression is frequently observed in trastuzumab or tamoxifen-resistant breast cancers [17,18]. Drug resistance induced by PTEN deficiency is also observed in colorectal cancer (CRC). Loss of PTEN occurs in 35% of CRC [19], and PTEN-deficient CRC cells are more resistant to cetuximab than PTEN-expressing cells [20]. In addition, loss of PTEN expression results in poor clinical outcome in CRCs treated with anti-egfr therapy [21]. To identify MATERIALS AND METHODS Cell culture Human colon cancer HCT116 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD, United States). HCT116 p53 -/- cells were kindly provided by Dr. Bert Vogelstein (The Johns Hopkins University, Baltimore, MD, United States). The cells were maintained in McCoy s 5A medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution in a humidified incubator at 37 with 5% CO2. Cells harboring the targeting vector were grown in medium containing 1000 µg/ml G418. Reagents and antibodies Curcumin, 5-fluorouracil (5-FU), dihydroartemisinin (DHA), irinotecan (CPT-11), and oxaliplatin (OXA) were purchased from Sigma-Aldrich. PTEN, AKT (pan), phosphorylated AKT (p-akt), p53, caspase 3, caspase 9, GAPDH, and beta-actin antibodies were obtained from Cell Signaling Technology. Bcl2, p21, p27, Cyclin B1, Cdc2, Cyclin D1, PARP and peroxidase-conjugated secondary antibodies were from Santa Cruz Biotechnology. Gene targeting in HCT116 cells Human somatic cell gene targeting was performed using adeno-associated virus vectors. A PTEN-targeting vector was constructed to delete exon 4 of the PTEN gene in HCT116 cells. To create this vector, homology arms were amplified from a human genomic DNA template by polymerase chain reaction (PCR), sequentially cloned into the pmd18-t vector (TaKaRa) and sequenced. The constructed targeting vector was co-transfected with phelper and paav-rc plasmids into HEK293 cells to obtain a PTEN-AAV viral stock that was used to infect HCT116 cells. After infection with recombinant virus, HCT116 cells were seeded in 96-well plates and selected with 1000 µg/ml G418 for 2 wk. Individual clones were obtained, expanded, cryopreserved, and tested by PCR for the presence of a heterozygous knockout. Heterozygous clones were transfected with the pcx-cre plasmid, and then plated at a density of 200 cells/well in a 96-well plate to obtain single cell-derived clones. These clones were then screened by PCR to identify those in which the PGKneo cassette had been deleted. Then the PTEN +/- cells were re-transfected with the PTEN-AAV virus, to obtain 6815 October 28, 2013 Volume 19 Issue 40

128 Chen L et al. PTEN deficiency affects curcumin cytotoxicity A PTEN genomic locus Exon3 Exon4 Exon5 PTEN targeting vector LA PGK Neo RA RA Homologous recombination P1 P2 P3 P4 PTEN targeted allele (pre-cre) Exon3 PGK Neo RA Exon5 Cre-mediated recombination P5 P6 PTEND (post-cre) Exon3 Exon5 B PTEN +/+ PTEN +/- PTEN -/- 1# PTEN -/- 2# C PTEN +/+ PTEN +/- PTEN -/- 1# PTEN -/- 2# WT PTEN p-akt KO GAPDH D Exon3 Exon5 PTEN null (PTEN -/- ) loxp CTTAATTGCATACACTTAATCG CTGATGGATGAGAGGAGGGA E PTEN +/+ PTEN -/- 1# PTEN -/- 2# 50 mm 50 mm 50 mm 6816 October 28, 2013 Volume 19 Issue 40

129 Chen L et al. PTEN deficiency affects curcumin cytotoxicity F PTEN +/+ PTEN -/- 1# PTEN -/- 2# A 600 nm t /d Figure 1 Gene targeting at the PTEN locus. A: Schematic illustration of the strategy used to inactivate phosphatase and tensin homolog deleted on chromosome 10 (PTEN) by somatic cell gene targeting. The primers (P1, P2, P3, P4, P5, and P6) used for polymerase chain reaction (PCR)-based genotyping are indicated; B: Identification of the desired targeted clones by PCR. Primers P5 and P6 were used to amplify a 1,155-bp product from the wild-type PTEN allele and a 522-bp product from the final knockout allele, respectively; C: Western blotting analysis of PTEN expression; D: Confirmation of PTEN exon 4 deletion in PTEN-deficient cells by sequencing; E: Morphology of PTEN +/+ and PTEN -/- cells. F: Determination of cell viability for PTEN +/+ and PTEN -/- cell lines using the MTT assay. PTEN -/- 1# and PTEN -/- 2# are two PTEN knockout clones. LA: Left arm; RA: Right arm; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. Western blotting analysis Cells were grown to 90% confluence in a 6-well plate. After washing twice with PBS, cells were resuspended and lysed in cold lysis buffer (50 mol/l Tris/HCl, ph 7.4, 5 mol/l EDTA, 0.5% NP-40, 150 mol/l NaCl) supplemented with the Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology). After incubation on ice for 20 min, the lysate was centrifuged at rpm for 20 min at 4, and the supernatant was collected. Protein concentration was determined using the Bradford assay (Bio-Rad, Hercules, CA, United States). Equal amounts of total protein were separated by SDS-PAGE and transclones in which both PTEN alleles had been targeted. MTT assays Cell viability was determined using the MTT assay, as described previously [22]. Briefly, PTEN +/+ and PTEN -/- cells were seeded in 96-well plates in triplicate. At the indicated time points, 10 µl 3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) stock solution (5 mg/ml) was added to each well. Plates were incubated at 37 for another 4 h. The medium was carefully removed and the formazan produced was dissolved in dimethyl sulfoxide (DMSO). The absorbance was measured at a wavelength of 570 nm on a microplate reader (BioRad Model 550). To test the compounds for cytotoxic effects, cells were seeded at a density of cells/well in 96-well plates and cultured for 24 h. Onehundred microliters of medium supplemented with twice the desired concentration of compounds was then added to each well. After incubation for 72 h, MTT solution was added. Four hours later, formazan production was measured as described earlier. The viability was calculated as % viability = (OD of treated cells/od of control cells) 100. Clonogenic assays A total of 1000 cells were plated in 6-well plates, in triplicate, and incubated for 24 h to allow cells to adhere. After treatment with 10-μmol/L curcumin or 0.1% DMSO for 48 h, cells were carefully washed and drug-free medium was added. The plates were incubated at 37 for d and stained with 0.5% (w/v) crystal violet. Colonies containing more than 50 cells were scored as positive. The experiment was performed at least three times using triplicate cultures. Apoptosis analysis Curcumin-induced apoptosis was quantified by flow cy- tometry using the Annexin V-FITC Apoptosis Detection kit according to the manufacturer s instructions. Briefly, cells were seeded in 6-well plates and treated with 10-μmol/L curcumin or 0.1% DMSO for 48 h prior to analysis. Floating and trypsinized adherent cells were collected, washed with PBS, and resuspended in cold binding buffer. After incubation for 15 min in the dark at 4, 10 μl of Annexin V-FITC and 5 μl of propidium iodide (PI) solution were added. Samples were analyzed using an FACS-Calibur cytometer (Becton Dickinson). Cell cycle analysis A total of cells were seeded in 6-well plates and treated with 10-μmol/L curcumin or 0.1% DMSO for 48 h. Then, the cells were harvested by centrifugation at 1000 rpm for 5 min. Cell pellets were washed twice with PBS, fixed with ice-cold 70% ethanol and stored at -20 overnight. Then, the pellets were washed with cold PBS, suspended in 500 ml PBS containing 50 mg/ml PI, 0.1 mg/ml RNase A and 0.05% Triton X-100, and incubated at 37 for 40 min in the dark. The cell cycle distribution was determined by flow cytometry (FACSCalibur; Becton Dickinson). The experiment was repeated thrice under the same conditions October 28, 2013 Volume 19 Issue 40

130 Chen L et al. PTEN deficiency affects curcumin cytotoxicity A PTEN +/+ PTEN -/- 1# PTEN -/- 2# B % viability 60 % viability PTEN +/+ PTEN -/- 1# PTEN -/- 2# CPT-11 (µmol/l) FU (µmol/l) C PTEN +/+ PTEN -/- 1# PTEN -/- 2# D % viability 60 % viability PTEN +/+ PTEN -/- 1# PTEN -/- 2# DHA (µmol/l) OXA (µmol/l) E b F P53 +/+ P53 -/- % viability PTEN +/+ PTEN -/- 1# PTEN -/- 2# b Cur (µmol/l) b b b b % viability Cur (µmol/l) Figure 2 Curcumin shows enhanced cytotoxicity toward PTEN-deficient cells. A-E: Cytotoxic effects of irinotecan (CPT-11), 5-fluorouracil (5-FU), dihydroartemisinin (DHA), oxaliplatin (OXA) and curcumin (Cur) on cell viability of HCT116 phosphatase and tensin homolog deleted on chromosome 10 (PTEN) +/+ and PTEN -/- cells were determined using the MTT assay; F: Cytotoxic effects of curcumin (Cur) on HCT116 p53 +/+ and p53 -/- cells ( b P < 0.01 vs control group). ferred onto polyvinylidene difluoride membranes (Bio- Rad, Hercules, CA, United States). After blocking in 5% milk in TBST [10 mol/l Tris/HCl ph 7.4, 150 mol/l NaCl, and 0.1% (v/v) Tween-20], the membranes were incubated with primary antibodies, followed by secondary antibodies. Protein bands were visualized using an ECL system (Amersham Biosciences, United States). Statistical analysis Data were summarized using means ± SD. Statistical comparisons were made using the Student s t-test. P-values of less than 0.05 were considered statistically significant. RESULTS Targeted deletion of PTEN in colorectal cancer cells Recombinant adeno-associated virus vectors were used to disrupt the endogenous PTEN gene in a near-diploid colon cancer cell line, HCT116, containing two wild-type alleles of PTEN. Targeting was directed to the exon 4 of PTEN, which resulted in a frame-shift mutation and thus a loss of PTEN expression. The detailed strategy is depicted in Figure 1A. The first allele of PTEN was disrupted by homologous recombination with the PTENtargeting vector. The PTEN +/- clones were confirmed 6818 October 28, 2013 Volume 19 Issue 40

131 Chen L et al. PTEN deficiency affects curcumin cytotoxicity A DMSO Cur PTEN +/+ PTEN -/- 1# PTEN -/- 2# B Number of colonies b b PTEN +/+ PTEN -/- 1# PTEN -/- 2# DMSO Cur Figure 3 Curcumin has an increased growth-inhibitory effect on PTEN-deficient cells in clonogenic assays. A: Photographs of clonogenic assay plates; B: Histograms showing clonogenic assay results ( b P < 0.01 vs control group). Cur: Curcumin. by PCR and transiently exposed to Cre recombinase, mediating the excision of the internal neomycin selection cassette flanked by loxp sites. A PTEN +/- clone was then used to generate PTEN -/- cells via a second round of recombination with the PTEN-targeting vector. The absence of PTEN mrna in PTEN -/- clones was verified by PCR (Figure 1B). Western blotting analysis confirmed a decrease in PTEN levels in PTEN +/- cells and a complete loss of PTEN expression in PTEN -/- clones, which was accompanied by increased AKT phosphorylation (Figure 1C). Deletion of exon 4 of the PTEN gene was further verified by sequencing (Figure 1D). The PTEN -/- cells displayed a similar morphology to the parental PTEN +/+ cell line (Figure 1E). The effect of PTEN deficiency on the viability of HCT116 cells was assessed using the MTT assay. However, no significant difference in cell growth characteristics was observed between PTEN +/+ and PTEN -/- cells (Figure 1F). Curcumin shows enhanced cytotoxicity toward PTENdeficient cancer cells PTEN acts as a tumor suppressor and its status is associated with sensitivity to chemotherapeutic agents [23,24]. Therefore, we investigated whether PTEN disruption affected the cytotoxicity of several clinical drugs and natural anti-cancer compounds. The PTEN-deficient cells and isogenic PTEN positive cells were exposed to increasing concentrations of anti-cancer compounds and their viability was determined. Disruption of the PTEN gene had no effect on the sensitivity of HCT116 cells to 5-FU, CPT-11, DHA, or OXA (Figure 2A-D). Surprisingly, PTEN-deficient cells were more sensitive to curcumin as compared with the parental PTEN +/+ cells. The IC50 value of curcumin for HCT116 PTEN -/- cells was approximately 2-fold lower than that for PTEN +/+ cells (Figure 2E). Next, we determined whether curcumin also showed increased cytotoxicity toward HCT116 cells deficient in p53. However, we found that disruption of p53 had no effect on the sensitivity of HCT116 cells to curcumin (Figure 2F). The fact that PTEN deficiency resulted in increased sensitivity of HCT116 cells to curcumin was further confirmed using a clonogenic assay. Following curcumin exposure, a significantly smaller number of colonies was observed with HCT116 PTEN -/ October 28, 2013 Volume 19 Issue 40

132 Chen L et al. PTEN deficiency affects curcumin cytotoxicity A 10 5 PTEN +/ PTEN -/- B PTEN +/+ PTEN -/- DMSO PI-A Q1 Q2 Q3 Q4 PI-A Q1 Q2 Q3 Q4 (Q2 + Q4)% FITC-A FITC-A DMSO Cur 10 4 Q1 Q Q1 Q2 Cur PI-A 10 3 Q3 Q4 PI-A 10 3 Q3 Q FITC-A FITC-A C PTEN +/+ PTEN -/- DMSO Cur DMSO Cur Bcl2 p53 PTEN +/+ PTEN -/- DMSO Cur DMSO Cur PARP Cleaved PARP Pro-caspase3 Pro-caspase9 Actin GAPDH Figure 4 PTEN deficiency does not enhance curcumin-induced apoptosis. A: Images showing flow cytometric analysis of apoptosis. Apoptosis was analyzed by flow cytometry with the Annexin V-FITC kit; B: Histograms showing apoptosis assay results. Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) deletion did not result in increased apoptosis following curcumin treatment; C: Western blotting analysis. Cell lysates were separated on SDS-PAGE, transferred to polyvinylidene difluoride membranes, and incubated with indicated antibodies. Cur: Curcumin; PI: Propidium iodide; FITC: Fluorescein isothiocyanate; GAPDH: Glyceraldehyde-3- phosphate dehydrogenase. cells than with PTEN +/+ cells (Figure 3). Together, these results suggest that curcumin exhibits enhanced cytotoxicity toward HCT116 cells deficient in PTEN. PTEN deficiency does not increase curcumin-induced apoptosis Curcumin treatment induces cell apoptosis [25]. To understand the molecular mechanism underlying the increased cytotoxicity of curcumin toward PTEN-deficient CRC cells, we tested whether PTEN loss resulted in increased curcumin-mediated apoptosis. Using flow cytometric analysis with FITC-labeled annexin V and propidium iodide staining, we observed significantly increased apoptosis in both HCT116 PTEN +/+ and PTEN -/- cells after curcumin exposure. However, the apoptotic index was not affected by disruption of the PTEN gene, being similar in PTEN +/+ and PTEN -/- cells (Figure 4A and B). In accordance with these results, the expression patterns of apoptosis-related proteins, such as Bcl-2, procaspase 3 and 9, p53 and PARP were similar in both cell lines following curcumin exposure (Figure 4C). Therefore, these data suggest that the enhanced cytotoxicity of curcumin toward PTEN -/- colon cancer cells is not due to an increase in curcumin-induced apoptosis. PTEN deficiency results in altered curcumin-induced cell cycle arrest Next, we tested whether the enhanced cytotoxicity of curcumin to PTEN-deficient cells was caused by altered cell cycle progression. Consistent with a previous report [26], we found that curcumin exposure led to a marked G2/M phase cell cycle arrest in HCT116 cells with wildtype PTEN (Figure 5A). Surprisingly, in PTEN -/- cells, curcumin treatment resulted in a significant accumulation of cells in G0/G1 phase, characteristic of a G0/G1 phase arrest (Figure 5A). To explore the mechanism underlying the altered cell cycle arrest pattern, we investigated the expression of proteins related to AKT signaling and the cell cycle. Curcumin exposure marginally reduced AKT phosphorylation and significantly induced p21 ex October 28, 2013 Volume 19 Issue 40

133 Chen L et al. PTEN deficiency affects curcumin cytotoxicity A DMSO PTEN +/+ PTEN -/- Cur DMSO Cur Number Number Number Number Channels Channels Channels Channels b DMSO Cur Percentage of cells (%) b G0/G1 S G2/M G0/G1 S G2/M PTEN +/+ PTEN -/- B p27 PTEN +/+ PTEN -/- DMSO Cur DMSO Cur PTEN +/+ PTEN -/- PTEN +/+ PTEN -/- DMSO Cur DMSO Cur DMSO Cur DMSO Cur p21 Cyclin B1 Total Akt Cyclin D1 Actin Cdc2 Actin p-akt Actin Figure 5 Loss of PTEN alters curcumin-mediated cell cycle arrest. A: Cell cycle distributions of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) +/+ (left) and PTEN -/- (right) cell samples were analyzed by flow cytometry ( b P < 0.01 vs control group); B: Western blotting analysis. Whole cell lysate isolated from PTEN +/+ and PTEN -/- cells were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes, and incubated with the indicated antibodies. Cur: Curcumin. pression in HCT116 cells harboring wild-type PTEN. Interestingly, the opposite results were observed in HCT116 PTEN -/- cells, which showed a significant induction of AKT phosphorylation. Curcumin exposure further elevated this increase in AKT phosphorylation, which was accompanied by a significant reduction in p21 expression (Figure 5B). In agreement with the differential expression of p21 in curcumin-treated PTEN +/+ and PTEN -/- cells, we observed a down-regulation of Cyclin B1 and Cdc2 in PTEN +/+ cells, whereas decreased expression of Cyclin D1 was observed in PTEN -/- cells (Figure 5B), consistent with their respective patterns of cell cycle arrest. p27 is another known regulator of G0/G1 phase; however, we observed no difference in its expression levels between the PTEN +/+ and PTEN -/- cells following curcumin exposure (Figure 5B). Together, these data suggest that the enhanced cytotoxicity of curcumin caused by PTEN deficiency might be due to an altered pattern of cell cycle arrest that is related to the PTEN/AKT/p21 pathway. DISCUSSION PTEN is a tumor suppressor gene that is frequently mutated in human colorectal cancers. PTEN functions as a lipid phosphatase that negatively regulates PI3K/AKT signaling, which is critical for cell proliferation, apoptosis, and cell cycle progression [27]. PTEN mutations result in aberrant activation of the AKT pathway, facilitating cancer progression and causing drug resistance in CRC [28,29]. Therefore, chemotherapeutic agents, such as natural 6821 October 28, 2013 Volume 19 Issue 40

134 Chen L et al. PTEN deficiency affects curcumin cytotoxicity products and synthetic compounds, that can enhance therapeutic efficacy for CRC with PTEN mutations, are urgently needed. In the present study, we found that curcumin showed enhanced cytotoxicity toward CRC cells deficient in PTEN. This intriguing finding indicates that curcumin might be applied alone or in combination with other chemotherapeutic agents for the therapy of PTENmutant cancers. Curcumin is a natural pigment extracted from the roots of the turmeric plant (Curcuma longa). In addition to its anti-oxidative and anti-inflammatory properties, curcumin inhibits cell proliferation in a number of cancer cell lines, including those derived from colon, breast, lung and bladder cancers [30-33]. Moreover, curcumin inhibits tumorigenesis in vivo. It has been shown that curcumin effectively prevents tumor implantation and growth in mice, and suppresses the development of bladder cancer in a rat model [34,35]. Mechanistic studies demonstrated that curcumin targets a number of molecules, including apoptosis-related proteins such as Bcl-2, caspase 3 and 9, as well as cell cycle regulators [36,37]. In this study, we report for the first time that the enhanced cytotoxicity of curcumin toward PTEN-deficient cells is not due to an increase in apoptosis, but rather to altered cell cycle arrest patterns, from the G2/M phase arrest seen in PTEN +/+ cells to a G0/G1 phase arrest in PTEN -/- cells. The PTEN +/+ and PTEN -/- cells used in this study differ only in their PTEN status. Since PTEN is an upstream regulator of AKT signaling, the differential effects of curcumin on cells with and without PTEN might be associated with altered AKT signaling. Consistent with this hypothesis, we observed differences in curcumininduced AKT phosphorylation in PTEN +/+ and PTEN -/- cells. In contrast to the slight decrease observed in p-akt in PTEN +/+ cells, p-akt was significantly increased in PTEN -/- cells after curcumin exposure. p21 is a wellknown downstream effector of AKT signaling. p-akt can phosphorylate p21 and restrict it to the cytoplasm for degradation [38]. In accordance with this, p21 expression was significantly increased in PTEN +/+ cells, but markedly decreased in PTEN -/- cells following curcumin exposure. Consequently, the increased expression of p21 led to a down-regulation of Cyclin B1 and Cdc2 and thus a G2/M phase arrest in PTEN +/+ cells, which is consistent with a previous study [39]. Despite its function as a negative regulator of the cell cycle, p21 can also positively regulate cell cycle progression by serving as an assembly factor for the Cyclin D/Cdk4 complex and facilitating the transition from G1 phase to S phase [40-42]. Consistent with this role, we observed a decrease in p21 expression, accompanied by a reduced level of Cyclin D1 and G0/G1 arrest in PTEN -/- cells after curcumin exposure. Based on our findings, we speculate that PTEN deficiency alters AKT signaling and thus the expression of p21 induced by curcumin, and that this alteration results in an increased G0/G1 phase arrest, which may account for the enhanced curcumin sensitivity of PTEN-deficient cells. Our results suggest that p21 is a potential regulator in the enhanced cytotoxicity of curcumin toward PTENdeficient cells; however, the detailed mechanism remains to be elucidated. In conclusion, we have shown that curcumin exhibits increased cytotoxicity toward PTEN-deficient cancer cells, and the underlying mechanism might involve cell cycle arrest alterations that are associated with the PTEN/AKT/p21 pathway. These findings also suggest that curcumin might potentially contribute to the therapy of PTEN-mutated cancers. ACKNOWLEDGMENTS We thank Dr. Yue-Zhen Deng (Chinese Academy of Sciences) for technical assistance. COMMENTS Background Resistance to chemotherapeutic drugs remains a major obstacle to the effective treatment of cancers. Phosphatase and tensin homolog deleted on chromosome 10 (PTEN) is one of the most frequently mutated tumor suppressor genes in human cancers. Accordingly, mutational inactivation of PTEN leads to cancer progression and chemotherapy resistance. Therefore, chemotherapeutic agents with greater efficacy for cancer with PTEN mutations are urgently required. Research frontiers Curcumin is a major yellow-colored dietary pigment from Curcuma longa. Curcumin has demonstrated anticancer properties in various cancers, including colon cancer. This study analyzes the possible effects of curcumin on colorectal cancer cells with PTEN deficiency. Innovations and breakthroughs By gene targeting PTEN in HCT116 cells we created PTEN null HCT116 cells, which are isogenic to the PTEN positive HCT116 parental cell line. The authors found that PTEN null cells exhibited greater sensitivity to curcumin than PTEN positive cells. The authors further established that this difference was not due to an increase in apoptosis, but the result of altered cell cycle arrest induced by curcumin in PTEN null cells. Applications Curcumin is a potential chemotherapeutic agent for PTEN mutant cancers, and could be used in individualized cancer therapy. The PTEN-deficient cell line might be a useful tool for screening chemotherapeutic agents against PTENmutant cancers. Terminology The PI3K/AktKT pathway is an intracellular signaling pathway important for cell growth, survival, cell cycle progression, and apoptosis. Peer review This is the first report of the effects of PTEN deficiency on the cytotoxicity of curcumin for colorectal cancer cells. The authors found that PTEN deficiency affects the cytotoxicity of curcumin on HCT116 cells. Upon further investigation they found that this effect is related to increased G0/G1 arrest but not to increased apoptosis. The manuscript is consistent and well structured. REFERENCES 1 Kanavos P. The rising burden of cancer in the developing world. Ann Oncol 2006; 17 Suppl 8: viii15-viii23 [PMID: DOI: /annonc/mdl983] 2 De Angelis PM, Svendsrud DH, Kravik KL, Stokke T. Cellular response to 5-fluorouracil (5-FU) in 5-FU-resistant colon cancer cell lines during treatment and recovery. Mol Cancer 2006; 5: 20 [PMID: DOI: / ] 3 Raymond E, Faivre S, Chaney S, Woynarowski J, Cvitkovic E. Cellular and molecular pharmacology of oxaliplatin. Mol Cancer Ther 2002; 1: [PMID: ] 4 You JS, Jones PA. Cancer genetics and epigenetics: two sides of the same coin? Cancer Cell 2012; 22: 9-20 [PMID: October 28, 2013 Volume 19 Issue 40

135 Chen L et al. PTEN deficiency affects curcumin cytotoxicity DOI: /j.ccr ] 5 Keniry M, Parsons R. The role of PTEN signaling perturbations in cancer and in targeted therapy. Oncogene 2008; 27: [PMID: DOI: /onc ] 6 Wang X, Jiang X. PTEN: a default gate-keeping tumor suppressor with a versatile tail. Cell Res 2008; 18: [PMID: DOI: /cr ] 7 Pilarski R, Eng C. Will the real Cowden syndrome please stand up (again)? Expanding mutational and clinical spectra of the PTEN hamartoma tumour syndrome. J Med Genet 2004; 41: [PMID: DOI: /jmg ] 8 Stambolic V, Tsao MS, Macpherson D, Suzuki A, Chapman WB, Mak TW. High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in pten+/- mice. Cancer Res 2000; 60: [PMID: ] 9 Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy-Burman P, Nelson PS, Liu X, Wu H. Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell 2003; 4: [PMID: DOI: / S (03) ] 10 Maehama T, Dixon JE. The tumor suppressor, PTEN/ MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 1998; 273: [PMID: DOI: /jbc ] 11 Wang SI, Puc J, Li J, Bruce JN, Cairns P, Sidransky D, Parsons R. Somatic mutations of PTEN in glioblastoma multiforme. Cancer Res 1997; 57: [PMID: ] 12 Forgacs E, Biesterveld EJ, Sekido Y, Fong K, Muneer S, Wistuba II, Milchgrub S, Brezinschek R, Virmani A, Gazdar AF, Minna JD. Mutation analysis of the PTEN/MMAC1 gene in lung cancer. Oncogene 1998; 17: [PMID: DOI: /sj.onc ] 13 Grønbaek K, Zeuthen J, Guldberg P, Ralfkiaer E, Hou-Jensen K. Alterations of the MMAC1/PTEN gene in lymphoid malignancies. Blood 1998; 91: [PMID: ] 14 Chen ST, Yu SY, Tsai M, Yeh KT, Wang JC, Kao MC, Shih MC, Chang JG. Mutation analysis of the putative tumor suppression gene PTEN/MMAC1 in sporadic breast cancer. Breast Cancer Res Treat 1999; 55: [PMID: DOI: /A: ] 15 Yeh KT, Chang JG, Chen YJ, Chen ST, Yu SY, Shih MC, Perng LI, Wang JC, Tsai M, Chang CP. Mutation analysis of the putative tumor suppressor gene PTEN/MMAC1 in hepatocellular carcinoma. Cancer Invest 2000; 18: [PMID: DOI: / ] 16 Li HF, Keeton A, Vitolo M, Maddox C, Rasmussen L, Hobrath J, White EL, Park BH, Piazza GA, Kim JS, Waldman T. A high-throughput screen with isogenic PTEN+/+ and PTEN-/- cells identifies CID as a novel compound that induces apoptosis in PTEN and PIK3CA mutant human cancer cells. J Biomol Screen 2011; 16: [PMID: DOI: / ] 17 Tanic N, Milovanovic Z, Tanic N, Dzodic R, Juranic Z, Susnjar S, Plesinac-Karapandzic V, Tatic S, Dramicanin T, Davidovic R, Dimitrijevic B. The impact of PTEN tumor suppressor gene on acquiring resistance to tamoxifen treatment in breast cancer patients. Cancer Biol Ther 2012; 13: [PMID: DOI: /cbt.21346] 18 Chandarlapaty S, Sakr RA, Giri D, Patil S, Heguy A, Morrow M, Modi S, Norton L, Rosen N, Hudis C, King TA. Frequent mutational activation of the PI3K-AKT pathway in trastuzumab-resistant breast cancer. Clin Cancer Res 2012; 18: [PMID: DOI: / CCR ] 19 Naguib A, Cooke JC, Happerfield L, Kerr L, Gay LJ, Luben RN, Ball RY, Mitrou PN, McTaggart A, Arends MJ. Alterations in PTEN and PIK3CA in colorectal cancers in the EPIC Norfolk study: associations with clinicopathological and dietary factors. BMC Cancer 2011; 11: 123 [PMID: DOI: / ] 20 Jhawer M, Goel S, Wilson AJ, Montagna C, Ling YH, Byun DS, Nasser S, Arango D, Shin J, Klampfer L, Augenlicht LH, Perez-Soler R, Mariadason JM. PIK3CA mutation/pten expression status predicts response of colon cancer cells to the epidermal growth factor receptor inhibitor cetuximab. Cancer Res 2008; 68: [PMID: DOI: / CAN ] 21 Bohn BA, Mina S, Krohn A, Simon R, Kluth M, Harasimowicz S, Quaas A, Bockhorn M, Izbicki JR, Sauter G, Marx A, Stahl PR. Altered PTEN function caused by deletion or gene disruption is associated with poor prognosis in rectal but not in colon cancer. Hum Pathol 2013; 44: [PMID: DOI: /j.humpath ] 22 Wang O, Liu S, Zou J, Lu L, Chen L, Qiu S, Li H, Lu X. Anticancer activity of 2α, 3α, 19β, 23β-Tetrahydroxyurs-12-en-28- oic acid (THA), a novel triterpenoid isolated from Sinojackia sarcocarpa. PLoS One 2011; 6: e21130 [PMID: DOI: /journal.pone ] 23 Paraiso KH, Xiang Y, Rebecca VW, Abel EV, Chen YA, Munko AC, Wood E, Fedorenko IV, Sondak VK, Anderson AR, Ribas A, Palma MD, Nathanson KL, Koomen JM, Messina JL, Smalley KS. PTEN loss confers BRAF inhibitor resistance to melanoma cells through the suppression of BIM expression. Cancer Res 2011; 71: [PMID: DOI: / AM ] 24 Fabian P, Berkovcová J. [Molecular predictive markers of EGFR-targeted therapy in metastatic colorectal cancer]. Cesk Patol 2011; 47: [PMID: ] 25 Karunagaran D, Rashmi R, Kumar TR. Induction of apoptosis by curcumin and its implications for cancer therapy. Curr Cancer Drug Targets 2005; 5: [PMID: DOI: / ] 26 Lu JJ, Cai YJ, Ding J. Curcumin induces DNA damage and caffeine-insensitive cell cycle arrest in colorectal carcinoma HCT116 cells. Mol Cell Biochem 2011; 354: [PMID: DOI: /s ] 27 Waite KA, Eng C. Protean PTEN: form and function. Am J Hum Genet 2002; 70: [PMID: DOI: /340026] 28 Gottesman MM. Mechanisms of cancer drug resistance. Annu Rev Med 2002; 53: [PMID: DOI: /annurev.med ] 29 Carnero A, Blanco-Aparicio C, Renner O, Link W, Leal JF. The PTEN/PI3K/AKT signalling pathway in cancer, therapeutic implications. Curr Cancer Drug Targets 2008; 8: [PMID: DOI: / ] 30 Lin L, Liu Y, Li H, Li PK, Fuchs J, Shibata H, Iwabuchi Y, Lin J. Targeting colon cancer stem cells using a new curcumin analogue, GO-Y030. Br J Cancer 2011; 105: [PMID: DOI: /bjc ] 31 Kamat AM, Tharakan ST, Sung B, Aggarwal BB. Curcumin potentiates the antitumor effects of Bacillus Calmette-Guerin against bladder cancer through the downregulation of NFkappaB and upregulation of TRAIL receptors. Cancer Res 2009; 69: [PMID: DOI: / CAN ] 32 Yang CL, Liu YY, Ma YG, Xue YX, Liu DG, Ren Y, Liu XB, Li Y, Li Z. Curcumin blocks small cell lung cancer cells migration, invasion, angiogenesis, cell cycle and neoplasia through Janus kinase-stat3 signalling pathway. PLoS One 2012; 7: e37960 [PMID: DOI: /journal.pone ] 33 Huang T, Chen Z, Fang L. Curcumin inhibits LPS-induced EMT through downregulation of NF-κB-Snail signaling in breast cancer cells. Oncol Rep 2013; 29: [PMID: ] 34 Sindhwani P, Hampton JA, Baig MM, Keck R, Selman SH. Curcumin prevents intravesical tumor implantation of the MBT-2 tumor cell line in C3H mice. J Urol 2001; 166: [PMID: DOI: / October 28, 2013 Volume 19 Issue 40

136 Chen L et al. PTEN deficiency affects curcumin cytotoxicity ] 35 Tian B, Wang Z, Zhao Y, Wang D, Li Y, Ma L, Li X, Li J, Xiao N, Tian J, Rodriguez R. Effects of curcumin on bladder cancer cells and development of urothelial tumors in a rat bladder carcinogenesis model. Cancer Lett 2008; 264: [PMID: DOI: /j.canlet ] 36 Shishodia S. Molecular mechanisms of curcumin action: gene expression. Biofactors 2013; 39: [PMID: ] 37 Shishodia S, Amin HM, Lai R, Aggarwal BB. Curcumin (diferuloylmethane) inhibits constitutive NF-kappaB activation, induces G1/S arrest, suppresses proliferation, and induces apoptosis in mantle cell lymphoma. Biochem Pharmacol 2005; 70: [PMID: DOI: / j.bcp ] 38 Han CT, Schoene NW, Lei KY. Influence of zinc deficiency on Akt-Mdm2-p53 and Akt-p21 signaling axes in normal and malignant human prostate cells. Am J Physiol Cell Physiol 2009; 297: C1188-C1199 [PMID: DOI: /ajpcell ] 39 Dvory-Sobol H, Cohen-Noyman E, Kazanov D, Figer A, Birkenfeld S, Madar-Shapiro L, Benamouzig R, Arber N. Celecoxib leads to G2/M arrest by induction of p21 and downregulation of cyclin B1 expression in a p53-independent manner. Eur J Cancer 2006; 42: [PMID: DOI: /j.ejca ] 40 Kavurma MM, Khachigian LM. Sp1 inhibits proliferation and induces apoptosis in vascular smooth muscle cells by repressing p21waf1/cip1 transcription and cyclin D1-Cdk4- p21waf1/cip1 complex formation. J Biol Chem 2003; 278: [PMID: DOI: /jbc.M ] 41 Weiss RH, Joo A, Randour C. p21waf1/cip1 is an assembly factor required for platelet-derived growth factor-induced vascular smooth muscle cell proliferation J Biol Chem 2000; 275: [PMID: DOI: /jbc ] 42 Gartel AL, Radhakrishnan SK. Lost in transcription: p21 repression, mechanisms, and consequences. Cancer Res 2005; 65: [PMID: DOI: / CAN ] P- Reviewers Ceelen W, Wang YP S- Editor Zhai HH L- Editor Webster JR E- Editor Zhang DN 6824 October 28, 2013 Volume 19 Issue 40

137 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Acute arterial mesenteric ischemia and reperfusion: Macroscopic and MRI findings, preliminary report Luca Saba, Daniela Berritto, Francesca Iacobellis, Mariano Scaglione, Sigismondo Castaldo, Santolo Cozzolino, Maria Antonietta Mazzei, Veronica Di Mizio, Roberto Grassi Luca Saba, Department of Radiology, Azienda Ospedaliera Universitaria di Cagliari, Cagliari, Italy Daniela Berritto, Francesca Iacobellis, Roberto Grassi, Institute of Radiology, Second University of Naples, Napoli, Italy Mariano Scaglione, Department of Diagnostic Imaging, Clinical Institute Pineta Grande, Castel Volturno Caserta, Italy Mariano Scaglione, Department of Radiology, The Royal London Hospital, London E1 1BB, United Kingdom Sigismondo Castaldo, Santolo Cozzolino, Biotechnology Centre, Napoli, Italy Maria Antonietta Mazzei, Department of Surgical Sciences, Azienda Ospedaliera Universitaria Senese, University of Siena, Siena, Italy Veronica Di Mizio, Department of Radiology, Santa Maria della Misericordia Hospital, Rovigo, Italy Author contributions: Saba L partecipated to the conception and design of the study and wrote the manuscript; Berritto D and Iacobellis F performed the research, contributed to the conception and design of the study and to the acquisition and interpretation of the data; Castaldo S and Cozzolino S contributed to the acquisition of the data; Scaglione M, Mazzei MA and Di Mizio V critically revised the article for important intellectual content; Grassi R designed the research and approved the final version for publication. Correspondence to: Daniela Berritto, MD, Institute of Radiology, Second University of Naples, P.za Miraglia 2, Napoli, Italy. berritto.daniela@gmail.com Telephone: Fax: Received: June 3, 2013 Revised: July 27, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 Abstract AIM: To explore the physiopathology and magnetic resonance imaging (MRI) findings in an animal model of acute arterial mesenteric ischemia (AAMI) with and without reperfusion. METHODS: In this study, 8 adult Sprague-Dawley rats underwent superior mesenteric artery (SMA) ligation and were then randomly divided in two groups of 4. In group Ⅰ, the ischemia was maintained for 8 h. In group Ⅱ, 1-h after SMA occlusion, the ligation was removed by cutting the thread fixed on the back of the animal, and reperfusion was monitored for 8 h. MRI was performed using a 7-T system. RESULTS: We found that, in the case of AAMI without reperfusion, spastic reflex ileus, hypotonic reflex ileus, free abdominal fluid and bowel wall thinning are present from the second hour, and bowel wall hyperintensity in T2-W sequences are present from the fourth hour. The reperfusion model shows the presence of early bowel wall hyperintensity in T2-W sequences after 1 h and bowel wall thickening from the second hour. CONCLUSION: Our study has shown that MRI can assess pathological changes that occur in the small bowel and distinguish between the presence and absence of reperfusion after induced acute arterial ischemia Baishideng. All rights reserved. Key words: Acute arterial mesenteric ischemia; Reperfusion; Magnetic resonance imaging; Animal model; Superior mesenteric artery; Bowel ischemia Core tip: Diagnosis of acute arterial mesenteric ischemia depends on early detection and findings with regarding the presence or absence of reperfusion events. Distinguishing between these different conditions is crucial to improving outcome for the patient and represents a challenge for radiologists. The results of this preliminary study in an animal model provide for a time-based definition of the radiological findings in ischemia and reperfusion, showing that magnetic resonance imaging can adequately assess the different pathological changes that occur in acute arterial mes October 28, 2013 Volume 19 Issue 40

138 Saba L et al. Acute arterial mesenteric ischemia and reperfusion enteric ischemia with or without reperfusion. Saba L, Berritto D, Iacobellis F, Scaglione M, Castaldo S, Cozzolino S, Mazzei MA, Di Mizio V, Grassi R. Acute arterial mesenteric ischemia and reperfusion: Macroscopic and MRI findings, preliminary report. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6825.htm DOI: org/ /wjg.v19.i INTRODUCTION Mesenteric ischemia can have various causes [1]. One of the most threatening conditions is acute arterial mesenteric ischemia (AAMI), which is characterized by the acute occlusion of the arteries feeding the small bowel [2]. AAMI is considered a vascular emergency with a mortality rate of up to 60%-80% [3]. Mortality of patients with AAMI most likely remains high because ischemic changes of the abdominal organs are most frequently detected and diagnosed at a late stage when therapy is ineffective [4,5]. Multi-detector computed tomography angiography is currently considered the gold-standard for imaging mesenteric and colonic ischemia [6,7]. However, recent papers have shown that magnetic resonance imaging (MRI) has significant potential for detecting subtle changes that may affect the intestinal wall during the ischemic process [8]. Recently, some researchers [9] assessed the evolution of ischemic lesions using 7 Tesla-magnetic resonance imaging (7T-MRI) in an animal model of acute colonic ischemia. This work demonstrated that MRI can be used as a reliable diagnostic and grading technique in acute ischemic colitis, which would allow for the early identification of pathology. The purpose of this study was to explore physiopathology and MRI findings of mesenteric ischemia in an animal model, with and without reperfusion, to define semiological changes of mesenteric ischemia from both a macroscopic and MRI point-of-view. MATERIALS AND METHODS Animal preparation All procedures performed on animals were approved by the Animal Care and Use Committee of the Biotechnology Center of Cardarelli Hospital. Eight adult male Sprague-Dawley rats ( g; Harlan, United States) were randomly divided in two groups of 4 rats each (group Ⅰ and group Ⅱ). The rats were maintained on a 12/12 h light/dark cycle and allowed free access to food and water. They were anesthetized with ketamine hydrochloride 100 mg/kg IM (CU ChemieUetikon GmbH, Lahr, Germany) and Domitor 0.25 mg/kg IM (Medethomidine hydrochloride, Pfizer, NY, United States) injections. Dolorex 0.1 mg/kg sc (Butarphanol, Intervet, Boxmeer, The Netherlands) was used immediately before the procedure to ensure intra-operative analgesia. Further injections of these drugs were provided throughout the operation to maintain a sufficient state of anesthesia. Each rat was allowed to breathe spontaneously. Body temperature was monitored with a rectal probe and maintained at 37.0 ± 0.5 with a heating blanket regulated by a homeothermic blanket control unit (Harvard Apparatus Limited, Edenbridge Kent, United Kingdom). After drug injection, rats were prepared for surgery via abdominal depilation. The area was then washed with povidone iodine and alcohol. Surgical procedures Surgery and drug administration were performed by a board-certified veterinarian with 5 years of experience in microsurgical and vascular techniques (Scaglione M). In all rats, acute SMA occlusion was induced using a twostep surgical procedure (Figure 1). After midline laparotomy, the bowel was exposed in the abdominal cavity and displaced to the left, allowing identification of the SMA. The bowel and the mesentery were drawn out of the abdominal cavity and a snapshot of exposed organs was taken (Nikon Coolpix S210, 8.0 Megapixels resolution, ISO 2000, Japan) as a basal image. A 3/0 silk thread was used to wind a loop around the SMA at the origin, not yet tightening the loop. The tips of the thread were brought into a silicon pipe and, through it, carried out to the back of the animal, between its shoulders. The thread tips were attached to the pipe using medical plaster. Muscles and skin were closed in two layers using a 2/0 Vicryl thread. 10 mg/kg of Baytril 10% (Enrofloxacin 2.5%, Bayer AG, Leverkusen, Germany) was topically applied to the wounds to prevent infections. The animals were returned to their cages after awakening, and water and food were provided ad libitum. Three days after surgery, the rats underwent a second anesthetic treatment according to the same drug protocol, and acute mesenteric ischemia was induced by pulling the threads out of the pipe. In this way, the loop around the SMA was squeezed, and the arterial inflow through this artery was stopped. In group Ⅰ rats, the ischemia was maintained for 8 h and during this time all animals were monitored at predetermined time points. In group Ⅱ rats, the ligation was removed 1 h after SMA occlusion by cutting the thread fixed on the back of the animal; the following reperfusion was monitored for 8 h. 7T-magnetic resonance imaging protocol All animals underwent MRI of the abdomen using a 7-T micro-mri scanner (BioSpec 70/16US, Bruker Medical Systems, Ettlingen, Germany). Two abdominal radiologists (Saba L and Grassi R), with 10 and 15 years of experience, respectively, assessed all 7T MR images by consensus. In all the rats, just before pulling the threads and occluding the vessel, a localizer scan along the three orthogonal planes [repetition time (TR) = 6.0 ms, echo time (TE) = ms, field of view (FOV) = 8, Averages 6826 October 28, 2013 Volume 19 Issue 40

139 Saba L et al. Acute arterial mesenteric ischemia and reperfusion Start Sperimental model Surgical PhaseⅠ In the 8 rats a silk thread was used to bind a loop around the SMA at the origin. In this phase no ischemia was induced Group Ⅰ Ischemia Surgical Phase Ⅱ After 3 d the mesenteric Ischemia was induced by pulling Group Ⅱ In 4 rats the ischemia was maintained for 1 h and reperfusion was observed the threads out of the pipe Rat 1 Rat 2 Rat 3 Rat 4 Rat 1 Rat 2 Rat 3 Rat 4 1 h MRI MRI MRI MRI MRI MRI MRI MRI Macroscopic 1 h 2 h MRI MRI MRI MRI MRI MRI Induced death 2 h 4 h MRI MRI MRI MRI 4 h Histology 8 h MRI MRI 8 h Figure 1 Flow chart. Flow chart shows our procedure to study the 2 different groups of rats. MRI: Magnetic resonance imaging; SMA: Superior mesenteric artery. = 1, Flip Angle 30 deg, Matrix = 128, Slice thickness = 2.00 mm, Scan time = 12 s 800 ms] and a T2-weighted (T2-W) TurboRare sequence (TR = ms, TE = 36 ms; 180 flip angle; 38 slices; slice thickness 1 mm, interslice distance 1 mm, field of view, 6 cm; acquisition matrix, , scan time = 7 min 5 s 156 ms) were performed to serve as baseline images. Before and after the SMA occlusion, to insure the complete lack of flow in the vessels, a FLASH TOF 2D sequence was performed (TR = 12 ms, TE = 3.5 ms; 90 flip angle; 180 slices; slice thickness 0.4 mm, interslice distance 0.25 mm, field of view, 6 cm; acquisition matrix, , averages = 7, acquisition time 48 min 23 s 40 ms). Maximum intensity projection (MIP) images were reconstructed for each series of images to evaluate SMA occlusion. For those rats in which lack of flow in the SMA after occlusion was confirmed, additional T2-W TurboRare sequences were performed at predetermined time-points to identify and characterize signs of bowel necrosis. For group Ⅱ rats, a second FLASH TOF 2D sequence (TR = 12 ms, TE = 3.5 ms; 90 flip angle; 180 slices; slice thickness 0.4 mm, interslice distance 0.25 mm, field of view, 6 cm; acquisition matrix, , averages = 7, acquisition time 48 min 23 s 40 ms) after reperfusion was performed to verify the bloodflow through the SMA. At each time-point in each rat, after opening the preexisting midline laparotomy, the bowel and the mesentery were drawn out of the abdominal cavity, and a picture of the exposed organs was taken (Nikon Coolpix S210, 8.0 Megapixels, ISO 2000, Japan). The rat was then euthanized by an intrapulmonary injection of Tanax 0.5 ml (Enbutramide + Mebenzonium, Iodide + Tetracaine, Intervet/Shering-Plough Animal Healt, Boxmeer; The Netherlands). MR images were assessed for the following parameters: (1) presence of free fluid in the abdomen; (2) gas filled dilated loops, known as hypotonic reflex ileus (HRI); (3) gas-fluid mixed stasis dilated loops (paralytic ileus, PI); (4) bowel wall thinning or thickening; (5) wall signal intensity on T2-W sequences; (6) mesenteric vessels; (7) wall pneumatosis; and (8) presence of free gas in the abdomen. RESULTS Macroscopic analysis Immediately before the SMA ligation the bowel loops presented an average diameter of 1.5 mm (measured with a gauge), uniform serosa and rose-colored mesentery in all segments (Figure 2A). In all rats, 1 h after ischemia 6827 October 28, 2013 Volume 19 Issue 40

140 Saba L et al. Acute arterial mesenteric ischemia and reperfusion A B C Baseline 1 h 2 h D E F * * * 8 h 1 h 2 h G * * 4 h Figure 2 Macroscopic appearance. A-D: Group Ⅰ; at baseline evaluation, the bowel loops presented an average diameter of 1.5 mm, uniform serosa and rosecolored mesentery in all segments (A). Pale mesentery and spasm of the jejunal loops (arrowheads) were evident 1 h after acute superior mesenteric artery occlusion (B). Spastic reflex ileus was replaced by definite hypotonic reflex ileus 2 h after acute ischemia (C). Eight hours from acute superior mesenteric artery occlusion, a chromatic change to charcoal black was extended to a large ileal segment (white stars) (D); E-G: Group Ⅱ; vascular congestion of mesenteric vessels was evident 1 h after reperfusion (E). After 2 h from reperfusion, damaged areas underwent chromatic change from pink to dark red (arrowheads) (F), and became charcoal black after 4 h (stars) (G). (Figure 2B), pale mesentery with thinning of mesenteric vessels and a spasm of the jejunal loops were evident, compared with the baseline assessment. In group Ⅰ rats, 2 h after acute SMA occlusion the spasm was replaced by definite HRI (Figure 2C). The ileal loops underwent the same pathological evolution, but the spasm was observed approximately 2 h after acute SMA occlusion, with transition to definite HRI after approximately 4 h. At this stage, a chromatic change from pink to dark red was observed in the loops of the middle portion of the ileum, then became charcoal black in the rat observed for 8 h, spreading to a cover larger ileal segment - both proximal and distal (Figure 2D). In group Ⅱ rats, vascular congestion of mesenteric vessels was evident 1 hour after reperfusion (Figure 2E). After 2 h of reperfusion, damaged areas underwent chromatic change from pink to dark red, then became charcoal black at 4 h and growing more apparent in subsequent hours (Figure 2F and G). 7T MRI In all cases 7-T micro-mri identified findings of intestinal ischemia. Immediately before inducing acute SMA obstruction, 3 d after laparotomy, no free gas within the abdominal cavity or signs of visceral or mesentery irritation were found. Compared with the baseline acquisition, the MR angiography sequence at 5 min showed that flow in the SMA had stopped (Figure 3). In group Ⅰ (Table 1), 1 h after SMA ligation, T2-W sequences showed minimal change - a thin collection of fluid between the loops compared with control scans (Figure 4A and B). Dilation of numerous bowel loops (HRI) (mean diameter 4 mm, compared with 2.5 mm in baseline acquisition) and reduced wall thickness (average 0.5 mm com October 28, 2013 Volume 19 Issue 40

141 Saba L et al. Acute arterial mesenteric ischemia and reperfusion Table 1 Magnetic resonance imaging findings 1-h 2-h 4-h 8-h Group Ⅰ: Magnetic resonance imaging findings Rat 1 Free fluid Free gas HRI PI Bowel wall thinning Bowel wall thickening Wall signal (T2-W sequences) Wall pneumatosis Rat 2 Free fluid Rat dead Free gas HRI PI Bowel wall thinning Bowel wall thickening Wall signal (T2-W sequences) Wall pneumatosis Rat 3 Free fluid 1 1 Rat dead Free gas 0 0 HRI 0 1 PI 0 0 Bowel wall thinning 0 1 Bowel wall thickening 0 0 Wall signal (T2-W sequences) 0 0 Wall pneumatosis 0 0 Rat 4 Free fluid 1 Rat dead Free gas 0 HRI 0 PI 0 Bowel wall thinning 0 Bowel wall thickening 0 Wall signal (T2-W sequences) 0 Wall pneumatosis 0 Group Ⅱ: Magnetic resonance imaging findings Rat 5 Free fluid Free gas HRI PI Bowel wall thinning Bowel wall thickening Wall signal (T2-W sequences) Wall pneumatosis Rat 6 Free fluid Rat dead Free gas HRI PI Bowel wall thinning Bowel wall thickening Wall signal (T2-W sequences) Wall pneumatosis Rat 7 Free fluid 1 1 Rat dead Free gas 0 0 HRI 0 1 PI 0 0 Bowel wall thinning 0 0 Bowel wall thickening 0 1 Wall signal (T2-W sequences) 1 1 Wall pneumatosis 0 0 Rat 8 Free fluid 1 Rat dead Free gas 0 HRI 0 PI 0 Bowel wall thinning 0 Bowel wall thickening 0 Wall signal (T2-W sequences) 1 Wall pneumatosis 0 HRI: Hypotonic reflex ileus; PI: Paralytic ileus. A B Figure 3 Magnetic resonance imaging angiography. Maximum intensity projection images through origins of renal arteries (arrowheads) and acute superior mesenteric artery (SMA) (arrow) before (A), and after SMA occlusion (B) (FLASH 2D-TOF), no flow is observed in SMA (B). pared with 1 mm in baseline acquisition) were already apparent at approximately 2 h of ischemia (Figure 4C). HRI was followed by PI (gas-liquid stasis) that was clearly evident 4 h after SMA ligation. A hyper-intense signal in the bowel wall was evident after 4 h in some loops (Figure 4D). In group Ⅱ (Table 1), an early hyper-intense signal of the bowel wall in some loops and a thin layer of peritoneal fluid were detected 1 h after reperfusion (Figure 4E). After 2 h, a small amount of peritoneal free fluid, bowel wall thickening (average thickness of 1.5 mm) and hyperintensity of the intestinal wall (Figure 4F) were observed. HRI in some loops and additional free fluid were related to previous findings. At 4 h, a PI (average diameter of intestinal lumen of 4.5 mm) with a larger amount of peritoneal fluid, a mild mesenteric engorgement and a hyper-intense signal of the intestinal wall became evident in many loops (Figure 4G and H). By comparing the different MRI signal characteristics of the rats that underwent the reperfusion versus those that did not undergo the reperfusion (Table 2), we found differences between the appearances of bowel wall thickening and wall signal (in T2-W). DISCUSSION The morbidity and mortality of mesenteric ischemia are quite high [10] ; some authors assert that this high mortality is associated with the low sensitivity of diagnostic tools, which may hinder a correct diagnosis in the early 6829 October 28, 2013 Volume 19 Issue 40

142 Saba L et al. Acute arterial mesenteric ischemia and reperfusion A C Baseline B D 1 h Figure 4 7 Tesla-magnetic resonance imaging appearance. A-D: Group Ⅰ; at baseline evaluation no free gas within the abdominal cavity or signs of visceral or mesentery irritation were found on T2-W sequences (A). One hour after acute superior mesenteric artery (SMA) ligation, T2-W sequences showed a thin collection of fluid between the loops (arrowhead) (B). After 2 h dilation of numerous bowel loops [(hypotonic reflex ileus (HRI)] with reduced wall thickness were evident (star) (C). Four hours from SMA ligation HRI was followed by paralytic ileus (PI) (gas-liquid stasis) (arrow); also bowel wall hyper-intense signal was evident in some loops (arrowhead) (D). E-H: Group Ⅱ; An early hyper-intense signal of bowel wall in some loops (arrow) and a thin layer of peritoneal fluid (arrowheads) were detected 1 h after reperfusion (E). After 2 h, a small amount of peritoneal free fluid, bowel wall thickening, hyper-intense signal of some loops and HRI (star) were observed (F). At 4 h, a paralytic ileus (arrowhead) (G) with a larger amount of peritoneal fluid appeared and a mild mesenteric engorgement (star) became evident beyond a hyperintense signal of intestinal wall in many loops (H). * 2 h 4 h E F * Baseline 1 h G H * 2 h 4 h phase of ischemia [11,12]. Early identification of mesenteric ischemia is critical to plan an appropriate therapeutic approach. Moreover, different characteristics of the bowel corresponding to different pathogenesis are not clearly defined in imaging studies, adding further difficulties to obtaining an early and precise diagnosis [13]. We defined the progress of 2 different mechanisms of mesenteric ischemia - the acute occlusion of SMA and the acute occlusion of SMA followed by reperfusion - and investigated MRI findings in a time course. Most studies about ischemia/reperfusion reported in literature [14] analyze histological or biochemical alteration. In contrast, we focused our research on the development of radiological evidence for intestinal damage because diagnosis by imaging is crucial for the assessment of patients with acute mesenteric ischemia. Thus far, the chronological sequence of early changes that follow mesenteric ischemia and reperfusion has not been described, and the 6830 October 28, 2013 Volume 19 Issue 40

143 Saba L et al. Acute arterial mesenteric ischemia and reperfusion Table 2 Magnetic resonance imaging results and differences between the two groups Time 1-h 2-h 4-h 8-h Group Ⅰ percentages Free fluid 100% 100% 100% 100% Free gas 0% 0% 0% 0% HRI 0% 100% 100% 100% PI 0% 0% 100% 100% Bowel wall thinning 0% 100% 100% 100% Bowel wall thickening 0% 0% 0% 0% Wall signal (T2-W sequences) 0% 0% 100% 100% Wall pneumatosis 0% 0% 0% 0% Group Ⅱ percentages Free fluid 100% 100% 100% 100% Free gas 0% 0% 0% 0% HRI 0% 100% 100% 100% PI 0% 0% 100% 100% Bowel wall thinning 0% 0% 0% 0% Bowel wall thickening 0% 100% 100% 100% Wall signal (T2-W sequences) 100% 100% 100% 100% Wall pneumatosis 0% 0% 0% 0% Differences between the two groups Free fluid No No No No FRee gas No No No No HRI No No No No PI No No No No Bowel wall thinning No Yes Yes Yes Bowel wall thickening No Yes Yes Yes Wall signal (T2-W sequences) Yes Yes No No Wall pneumatosis No No No No HRI: Hypotonic reflex ileus; PI: Paralytic ileus. role of MRI diagnosis is still widely debated. Intestinal ischemia occurs when there is an interruption of the blood supply to the bowel, or when there is inadequate organ perfusion due to conditions of shock or hypovolemia. The initial damage caused by ischemia could be worsened by oxidative damage during reperfusion. This clinical entity is known as ischemia/reperfusion (I/R) injury [15]. Previous studies on mesenteric I/R in felines reported that tissue lesions produced during reperfusion were greater than those produced during ischemia [16]. Despite decades of research in this area, I/R injury remains a clinically challenging problem [17-22]. Patients are particularly susceptible to the damaging effects of increased neutrophil activation following intestinal I/ R [23]. Consequently, many cases of intestinal I/R develop into shock, multiple organ failure, and death [24,25]. The absence of reperfusion after acute SMA occlusion is characterized by clear macroscopic differences compared to AAMI with reperfusion. In the first case, there is a pale mesentery with thinning of mesenteric vessels and spasm of the jejunal loops due to the lack of blood flow and the contraction of the semilunar folds. With reperfusion, there is vascular congestion of the mesentery and bowel wall related to hypoxic damage of endothelial cells and subsequent blood extravasation following restoration of blood flow. These findings are in agreement with results obtained by previous authors [24-26]. Analyzing MRI signal characteristics, we found that the presence of free fluid in the abdomen (from the first hour) and HRI (from the second hour) are common and early findings in AAMI. It has been reported that a small amount of fluid is already visible 30 min after the ischemic event [24] ; however, another study, in a porcine model, reported that free fluid is a late finding (detectable after 12 h) [25]. The presence of ascites is reported in up to 80% of cases [26]. HRI is a condition that occurs before PI, and it is considered an early reaction to the ischemic insult. From the fourth hour, MRI also identified the presence of dilated loops with gas-fluid stasis (PI), reported in the literature in up to 65% of cases [25,27-29], and a hyperintense signal from the bowel wall in some loops in T2-W sequences. These four findings (free fluid, HRI, dilated loops with gas fluids and bowel wall hyper-intensity) were present in all rats with mesenteric ischemia, with or without reperfusion. We found important differences between the 2 mechanisms (mesenteric ischemia with or without reperfusion). First of all, the signal intensity of the wall in T2-W sequences: in those rats without reperfusion the signal intensity is normal at the first and second hour and becomes hyper-intense at the fourth and eighth. On the contrary, when we cause a reperfusion the hyperintense signal is clearly visible form the first hour due to interstitial edema. Another MRI finding is the presence of bowel wall thickening due to blood extravasation and edema, which is visible from the second hour in rats with reperfusion but never found in rats without reperfusion. Bowel wall thickening was previously found in an animal model of mesenteric venous ischemia [30], suggesting that reperfusion produces hemorrhagic damage. The early bowel wall thickening and hyper-intensity of the wall in T2-W sequence images may be considered signs of acute mesenteric ischemia with reperfusion. The presence of hyper-intense signal in T2-W images may be attributed to the edema of the submucosa caused by the release of vasoconstrictor amines that attract fluid from the bowel lumen [24,31]. The absence of mucosal thickening in arterial occlusion without reperfusion is interesting: indeed, the presence of wall thickening has been considered the most important feature of acute mesenteric ischemia [32] (with a prevalence of up to 96%). Nonetheless, we found that the wall thickening was only visible when the occlusion was followed by reperfusion. Further, our results showed that bowel wall thinning, detectable from the second hour after the SMA occlusion, is an extremely specific sign of occlusion without reperfusion. This finding was never detected in the cases with reperfusion. In the literature, bowel wall thinning seems to be heavily underestimated, as it is described in only 5% of cases [33]. The treatment of AAMI without reperfusion is significantly different from treatment of AAMI with reperfusion [34]. Because mesenteric ischemia with and without reperfusion have different therapeutic approaches, the power to distinguish between these conditions may have a great clinical importance [35,36]. Additionally, the radiological findings of mesenteric ischemia have different cours October 28, 2013 Volume 19 Issue 40

144 Saba L et al. Acute arterial mesenteric ischemia and reperfusion es depending on whether the ischemic event followed by reperfusion: bowel wall thickening is a specific sign of reperfusion damage; acute SMA occlusion without reperfusion is characterized by bowel wall thinning. Although computer tomography remains a valid diagnostic tool for the visualization of mesenteric ischemia and for the evaluation of its damage, our study results suggest that MRI, which does not require the use of a contrast medium or ionizing radiation, can play an important role in the early diagnosis of this condition. Because our model has some limitations, further investigation is necessary to verify whether these results can be translated to human beings. The first limitation is that we used a complete acute occlusion of the SMA, but in human beings it is possible to find partial occlusions. Second, the vessel ligation was performed at the vessel origin; this represents a potential bias because distal occlusions can occur. Other limitations include the small number of animals included in this preliminary report and the lack of histological analysis. COMMENTS Background Acute arterial mesenteric ischemia is a life threatening vascular condition caused by the lack of arterial flow to the bowel, which can be occlusive or non-occlusive in origin. The initial damage caused by ischemia could be further worsened by oxidative damage during reperfusion. This entity is known as ischemia/reperfusion (I/R) injury. An early diagnosis of this condition is crucial to ensure a good outcome for the patient. Research frontiers Although computer tomography (CT) remains a valid diagnostic tool for the visualization of mesenteric ischemia and for the evaluation of its damage, magnetic resonance imaging (MRI), which does not require the use of a contrast medium or ionizing radiation, can play an important role in the early diagnosis of this condition. Innovations and breakthroughs Despite decades of research in this area, ischemia/reperfusion injury remains a clinically challenging problem. Patients are particularly susceptible to the damaging effects of increased neutrophil activation following intestinal ischemia/ reperfusion. To ensure a good prognosis to these patients an early diagnosis is requested and the prerequisite to do it consists in the knowledge of the timing of the lesions. Important differences between the 2 mechanisms (mesenteric ischemia with or without reperfusion) were found at MRI, regarding the timing of the following findings: the signal intensity of the wall in T2-W sequences and the presence of bowel wall thickening due to blood extravasation and edema. Although CT remains the gold standard in the evaluation of acute mesenteric ischemia, our results suggest that MRI, which does not require the use of a contrast medium or ionizing radiation, could in future play an important role in the early diagnosis of this condition. Applications This study suggests the following points: (1) The reperfusion of the mesenteric region, after 1 h of induced acute arterial ischemia, is characterized by early bowel wall hyperintensity in T2-W sequences, from the first hour, and bowel wall thickening, from the second hour; (2) Bowel wall thinning is a specific sign of acute superior mesenteric artery occlusion without reperfusion, detectable from the second hour; and (3) MRI can assess the various pathological changes that occur in the small bowel after induced acute arterial mesenteric ischemia with and without reperfusion. Terminology Acute arterial mesenteric ischemia/infarction: lack of blood flow to the small bowel caused by a pathologic constriction or obstruction of its blood vessels, or an absence of blood circulation that can lead to ischemic damage of the bowel (involving part of the wall) or infarction (full thickness necrosis). 7T micromri: Non-invasive preclinical studies method of demonstrating internal anatomy based on the principle that atomic nuclei in a strong magnetic field (7 Tesla) absorb pulses of radiofrequency energy and emit them as radiowaves which can be reconstructed into computerized images. Peer review The paper presents some new methodology concerning the detection of subtle changes that occurs during the acute arterial mesenteric ischemia and ischemiareperfusion pathological process. The paper is well designed and the results are meaningful and conceivable. REFERENCES 1 Furukawa A, Kanasaki S, Kono N, Wakamiya M, Tanaka T, Takahashi M, Murata K. CT diagnosis of acute mesenteric ischemia from various causes. AJR Am J Roentgenol 2009; 192: [PMID: DOI: /AJR ] 2 Barmase M, Kang M, Wig J, Kochhar R, Gupta R, Khandelwal N. Role of multidetector CT angiography in the evaluation of suspected mesenteric ischemia. Eur J Radiol 2011; 80: e582-e587 [PMID: DOI: /j.ejrad ] 3 Debus ES, Müller-Hülsbeck S, Kölbel T, Larena-Avellaneda A. Intestinal ischemia. Int J Colorectal Dis 2011; 26: [PMID: DOI: /s ] 4 Wyers MC. Acute mesenteric ischemia: diagnostic approach and surgical treatment. Semin Vasc Surg 2010; 23: 9-20 [PMID: DOI: /j.semvascsurg ] 5 Herbert GS, Steele SR. Acute and chronic mesenteric ischemia. Surg Clin North Am 2007; 87: , ix [PMID: DOI: /j.suc ] 6 Romano S, Romano L, Grassi R. Multidetector row computed tomography findings from ischemia to infarction of the large bowel. Eur J Radiol 2007; 61: [PMID: DOI: /j.ejrad ] 7 Saba L, Mallarini G. Computed tomographic imaging findings of bowel ischemia. J Comput Assist Tomogr 2008; 32: [PMID: DOI: /RCT.0b013e3180dc8cb1] 8 Lauenstein TC, Ajaj W, Narin B, Göhde SC, Kröger K, Debatin JF, Rühm SG. MR imaging of apparent small-bowel perfusion for diagnosing mesenteric ischemia: feasibility study. Radiology 2005; 234: [PMID: DOI: / radiol ] 9 Iacobellis F, Berritto D, Somma F, Cavaliere C, Corona M, Cozzolino S, Fulciniti F, Cappabianca S, Rotondo A, Grassi R. Magnetic resonance imaging: a new tool for diagnosis of acute ischemic colitis? World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 10 Kaleya RN, Sammartano RJ, Boley SJ. Aggressive approach to acute mesenteric ischemia. Surg Clin North Am 1992; 72: [PMID: ] 11 Boley SJ, Brandt LJ, Veith FJ. Ischemic disorders of the intestines. Curr Probl Surg 1978; 15: 1-85 [PMID: DOI: /S (78) ] 12 Saba L, Mallarini G. Spiral computed tomography imaging of bowel ischemia: a literature review. Panminerva Med 2007; 49: [PMID: ] 13 Paterno F, Longo WE. The etiology and pathogenesis of vascular disorders of the intestine. Radiol Clin North Am 2008; 46: , v [PMID: DOI: /j.rcl ] 14 Boros M, Takaichi S, Hatanaka K. Ischemic time-dependent microvascular changes and reperfusion injury in the rat small intestine. J Surg Res 1995; 59: [PMID: ] 15 Mallick IH, Yang W, Winslet MC, Seifalian AM. Ischemiareperfusion injury of the intestine and protective strategies against injury. Dig Dis Sci 2004; 49: [PMID: ] 16 Parks DA, Granger DN. Contributions of ischemia and reperfusion to mucosal lesion formation. Am J Physiol 1986; 250: G749-G753 [PMID: ] 17 Köksoy C, Kuzu MA, Kuzu I, Ergün H, Gürhan I. Role of 6832 October 28, 2013 Volume 19 Issue 40

145 Saba L et al. Acute arterial mesenteric ischemia and reperfusion tumour necrosis factor in lung injury caused by intestinal ischaemia-reperfusion. Br J Surg 2001; 88: [PMID: DOI: /j x] 18 Souza DG, Cara DC, Cassali GD, Coutinho SF, Silveira MR, Andrade SP, Poole SP, Teixeira MM. Effects of the PAF receptor antagonist UK74505 on local and remote reperfusion injuries following ischaemia of the superior mesenteric artery in the rat. Br J Pharmacol 2000; 131: [PMID: DOI: /sj.bjp ] 19 Hassoun HT, Kone BC, Mercer DW, Moody FG, Weisbrodt NW, Moore FA. Post-injury multiple organ failure: the role of the gut. Shock 2001; 15: 1-10 [PMID: DOI: / ] 20 Pierro A, Eaton S. Intestinal ischemia reperfusion injury and multisystem organ failure. Semin Pediatr Surg 2004; 13: [PMID: DOI: /j.sempedsurg ] 21 Cerqueira NF, Hussni CA, Yoshida WB. Pathophysiology of mesenteric ischemia/reperfusion: a review. Acta Cir Bras 2005; 20: [PMID: DOI: / S ] 22 Kalia N, Brown NJ, Wood RF, Hopkinson K, Fairburn B, Pockley AG. Effects of intestinal ischemia-reperfusion injury on rat peripheral blood neutrophil activation. Dig Dis Sci 2003; 48: [PMID: ] 23 Stallion A, Kou TD, Latifi SQ, Miller KA, Dahms BB, Dudgeon DL, Levine AD. Ischemia/reperfusion: a clinically relevant model of intestinal injury yielding systemic inflammation. J Pediatr Surg 2005; 40: [PMID: DOI: /j.jpedsurg ] 24 Berritto D, Somma F, Landi N, Cavaliere C, Corona M, Russo S, Fulciniti F, Cappabianca S, Rotondo A, Grassi R. Seven-Tesla micro-mri in early detection of acute arterial ischaemia: evolution of findings in an in vivo rat model. Radiol Med 2011; 116: [PMID: DOI: / s ] 25 Klein HM, Klosterhalfen B, Kinzel S, Jansen A, Seggewiss C, Weghaus P, Kamp M, Töns C, Günther RW. CT and MRI of experimentally induced mesenteric ischemia in a porcine model. J Comput Assist Tomogr 1996; 20: [PMID: DOI: / ] 26 Taourel PG, Deneuville M, Pradel JA, Régent D, Bruel JM. Acute mesenteric ischemia: diagnosis with contrastenhanced CT. Radiology 1996; 199: [PMID: ] 27 Mazzei MA, Mazzei FG, Marrelli D, Imbriaco G, Guerrini S, Vindigni C, Civitelli S, Roviello F, Grassi R, Volterrani L. Computed tomographic evaluation of mesentery: diagnostic value in acute mesenteric ischemia. J Comput Assist Tomogr 2012; 36: 1-7 [PMID: DOI: / RCT.0b013e31823b4465] 28 Wiesner W, Khurana B, Ji H, Ros PR. CT of acute bowel ischemia. Radiology 2003; 226: [PMID: DOI: /radiol ] 29 Alpern MB, Glazer GM, Francis IR. Ischemic or infarcted bowel: CT findings. Radiology 1988; 166: [PMID: ] 30 Somma F, Berritto D, Iacobellis F, Landi N, Cavaliere C, Corona M, Russo S, Di Mizio R, Rotondo A, Grassi R. 7T μmri of mesenteric venous ischemia in a rat model: timing of the appearance of findings. Magn Reson Imaging 2013; 31: [PMID: ] 31 Chou CK. CT manifestations of bowel ischemia. AJR Am J Roentgenol 2002; 178: [PMID: DOI: / ajr ] 32 Bartnicke BJ, Balfe DM. CT appearance of intestinal ischemia and intramural hemorrhage. Radiol Clin North Am 1994; 32: [PMID: ] 33 Grassi R, Pinto A, Romano L, Rossi G, de Ritis R, Laporta A, Rotondo A. Twenty-six consecutive patients with acute superior mesenteric infarction. Comparison of conventional radiology, ultrasonography, and computerized tomography. Radiol Med 1997; 93: [PMID: ] 34 Newton WB, Sagransky MJ, Andrews JS, Hansen KJ, Corriere MA, Goodney PP, Edwards MS. Outcomes of revascularized acute mesenteric ischemia in the American College of Surgeons National Surgical Quality Improvement Program database. Am Surg 2011; 77: [PMID: ] 35 Liu S, Sun Q, Tao H, Sun X. Oral administration of mannitol may be an effective treatment for ischemia-reperfusion injury. Med Hypotheses 2010; 75: [PMID: DOI: /j.mehy ] 36 Takizawa Y, Kitazato T, Kishimoto H, Tomita M, Hayashi M. Effects of antioxidants on drug absorption in in vivo intestinal ischemia/reperfusion. Eur J Drug Metab Pharmacokinet 2011; 35: [PMID: DOI: /s y] P- Reviewers Boros M, Camara CR, Han JY, Mallet R S- Editor Zhai HH L- Editor A E- Editor Wu HL 6833 October 28, 2013 Volume 19 Issue 40

146 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Risk factors for hepatocellular carcinoma in patients with drug-resistant chronic hepatitis B Chung Hwan Jun, Hyoung Ju Hong, Min Woo Chung, Seon Young Park, Sung Bum Cho, Chang Hwan Park, Young Eun Joo, Hyun Soo Kim, Sung Kyu Choi, Jong Sun Rew Chung Hwan Jun, Hyoung Ju Hong, Min Woo Chung, Seon Young Park, Sung Bum Cho, Chang Hwan Park, Young Eun Joo, Hyun Soo Kim, Sung Kyu Choi, Jong Sun Rew, Department of Internal Medicine, Chonnam National University Medical School, Gwangju , South Korea Author contributions: Jun CH and Choi SK performed the majority of the study and wrote the manuscript; Cho SB, Park SY, and Park CH were involved in editing the manuscript; and Hong HJ and Chung MW were involved in data acquisition, analysis and interpretation; all authors were involved in revising and approving the final version for publication. Supported by Grants from Chonnam National University Hospital 42, Jaebong-ro, Dong-Ku, Gwangju, , South Korea Correspondence to: Sung Kyu Choi, MD, Division of Gastroenterology, Department of Internal Medicine, Chonnam National University Medical School, 42, Jaebong-ro, Dong-Ku, Gwangju , South Korea. estevanj@naver.com Telephone: Fax: Received: June 18, 2013 Revised: August 10, 2013 Accepted: September 3, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the risk factors and characteristics of hepatocellular carcinoma (HCC) in the patients with drug-resistant chronic hepatitis B (CHB). METHODS: A total of 432 patients with drug-resistant CHB were analyzed retrospectively from January 2004 to December The patients were divided into two groups: the HCC group (n = 57) and the non-hcc group (n = 375). Two groups compared using logistic regression for various patients and viral characteristics in order to identify associated risk factors for HCC. Secondarily, patient and tumor characteristics of HCC patients with naïve CHB (N group, n = 117) were compared to the HCC group (R group, n = 57) to identify any difference in HCC characteristics between them. RESULTS: A significant difference was found for age, platelet count, alpha-fetoprotein (AFP), positivity of HBeAg, seroconversion rate of HBeAg, virologic response, the Child-Pugh score, presence of rtm204i, and the duration of antiviral treatment in non-hcc and HCC group. Cirrhosis, age (> 50 years), HBeAg (+), virologic non-responder status, and rtm204i mutants were independent risk factors for the development of HCC. The R group had lower serum C-reactive protein (CRP) and AFP levels, earlier stage tumors, and a shorter mean tumor surveillance period than the N group. However, the total follow-up duration was not significantly different between the two groups. CONCLUSION: 13.2% of patients with drug-resistant CHB developed HCC. Age, cirrhosis, YIDD status, HBeAg status, and virologic response are associated with risk of HCC. Patients with drug-resistant CHB and these clinical factors may benefit from closer HCC surveillance Baishideng. All rights reserved. Key words: Carcinoma; Hepatocellular; Hepatitis B; Drug resistance; Risk factors; Characteristics Core tip: There are few studies on hepatocarcinogenesis in patients with drug-resistant chronic hepatitis B (CHB) or on the characteristics of tumors arising from drug-resistant CHB. In the present study, the cumulative incidence rate of hepatocellular carcinoma (HCC) in patients with drug-resistant CHB was 4.6%, 6.9%, 8.87%, and 11.8% at the end of 1, 2, 3, and 5 years, respectively. Additionally, cirrhosis, age > 50 years, HBeAg (+), YIDD mutations, and a virologic nonresponder status were independent risk factors for the development of HCC in CHB patients with drug resistance. Furthermore, there was a trend of poorer survival in patients with HCC arising from resistant CHB than in patients with HCC arising from naive CHB. Jun CH, Hong HJ, Chung MW, Park SY, Cho SB, Park CH, Joo 6834 October 28, 2013 Volume 19 Issue 40

147 Jun CH et al. Drug-resistant CHB and HCC YE, Kim HS, Choi SK, Rew JS. Risk factors for hepatocellular carcinoma in patients with drug-resistant chronic hepatitis B. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: INTRODUCTION Chronic hepatitis B (CHB) is an important cause of morbidity and mortality worldwide [1,2]. The main goals of therapy for CHB patients are to prevent disease progression and to avoid the development of liver failure and hepatocellular carcinoma (HCC) [3]. The introduction of oral nucleos(t)ide analogue (NA) therapy during the last two decades has revolutionized the CHB treatment [4,5]. Although nucleoside/nucleotide analogues (NAs) are very effective at inhibiting HBV reverse transcriptase, the long-term use of NAs leads to the development of drug resistance. The risk of developing lamivudine (LAM) resistance is 14%-32% in the first year and up to 70% by the fifth year. For LAM resistance, the signature rtm204v/i and rtl180m mutations occur in more than 70% of CHB patients [6,7]. The rtm204v/i, a mutation located at the catalytic YMDD motif [8-10], and the rtl180m mutations serve as compensatory mutations [10]. The rta181t mutation has also been reported in a substantial proportion of LAM-resistant patients [9]. The risk of developing adefovir (ADV) resistance is 2%-3% and 28%-29% by the second and fifth year of monotherapy treatment in naïve patients, respectively [11,12]. The major ADV-resistant mutants were rtn236t and rta181t/v [13]. Resistance to entecavir (ETV) is rare when being used to treat naïve patients (1.5% by the fifth year) [5]. However, in the presence of the rtm204i/v mutation, ETV resistance can occur if the rti169t, rtt184a/f/g/i/l/s, rts202g/i, or rtm250v mutation also exist [14,15]. It has been demonstrated that in patients with compensated cirrhosis, LAM therapy significantly reduces the risk of liver failure and HCC [16]. However, in patients who have developed LAM resistance, this beneficial effect is drastically compromised [17]. One study reported that old age, male gender, family history of HCC, HBeAg positivity, genotype C, and increased levels of ALT, HBV DNA and HBsAg were risk factors for the development of HCC in chronic hepatitis B patients [18]. However, there are few studies on hepatocarcinogenesis in patients with drug-resistant CHB. Therefore, we determined the risk factors for the development of HCC in patients with drug-resistant CHB. We also compared the tumor characteristics between HCC patients with drug-resistant CHB and HCC patients with CHB who were treated with antivirals. MATERIALS AND METHODS Patients and methods Six hundred and forty-one patients with a documented CHB mutation who had experienced a viral breakthrough at our institution (Chonnam National University Hospital, Gwangju, Korea) between January 2004 and December 2012 were selected for this retrospective study. The 209 patients who were excluded those whose entire set of laboratory data were not available at the end of the follow-up period, those who were co-infected with HIV, hepatitis C or hepatitis D, those who were chronic alcohol drinkers, those who had poor medication compliance and those who had been diagnosed with HCC before the CHB mutation occurred. In total, the data of 432 CHB patients (most of them, genotype C, we did not check the genotype of all patients (n = 90/432), but 100% of the 90 patients whose genotypes were checked were genotype C) with drug resistance were finally evaluated (Figure 1). To determine the risk factors for the development of HCC in patients with drug-resistant CHB, the patients were divided into two groups according to the occurrence of HCC (57 patients with HCC vs 375 patients without HCC). To compare the tumor characteristics between the HCC patients with drug-resistant CHB (R group) and the HCC patients with CHB treated with antivirals, we selected 119 HCC patients who had received first line antiviral treatment without evidence of drug resistance (N group) during the same period (Figure 1). The diagnosis of HCC was based on the following guidelines proposed by the Korea Liver Cancer Study Group and the National Cancer Center [19] : (1) nodules > 2 cm in diameter with a typical pattern of HCC in one imaging study or AFP levels > 200 ng/ml; and (2) nodules between 1 and 2 cm in diameter with a coincidental typical vascular pattern in two imaging studies. If these criteria were not met, biopsies were performed. Clinical staging was based on the modified UICC tumor-nodemetastasis classification and the Cancer of the Liver Italian Program (CLIP) scores [19,20]. Clinicoradiological and virological variables and the occurrence of HCC were compared between the two groups. The clinicoradiological variables were age, sex, the Child-Pugh score, blood chemistry, AFP level, and the duration of the antiviral treatment. The virological variables were positivity of HBeAg, seroconversion of HBeAg, HBV DNA level, virologic response rate, and mutant type. Informed consent was obtained from all patients about the nature and purpose of the treatment modalities. Marker of HBV infection The hepatitis B e antigen (HBeAg) and antibodies to HBeAg (anti-hbe) were determined by commercially available radioimmunoassay systems (Abbott Laboratories, Abbott Park, IL, United States). The serum HBV DNA was quantified by the TaqMan real time polymerase chain reaction (PCR) system (Applied Biosystems, Foster city, CA, United States). The lower limit of detection was 100 copies/ml. Mutations were identified at the baseline using restriction fragment mass polymorphism (RFMP) analysis October 28, 2013 Volume 19 Issue 40

148 Jun CH et al. Drug-resistant CHB and HCC Assessed for eligibility (n = 641) Excluded d/t entire data was not available (n = 209) CHB who received antiviral treatment (n = 1797) A total of patients with drug resistant CHB (n = 432) HCC patients received antiviral treatment (n = 119) Patients with HCC (n = 57) Patients without HCC (n = 375) Surveillance interval 6 mo > 6 mo HCC with naive CHB (n = 39) HCC with naive CHB (n = 80) HCC with resistant CHB (n = 37) HCC with resistant CHB (n = 20) Figure 1 Study patient flow. HCC: Hepatocellular carcinoma; CHB: Chronic hepatitis B. Diagnosis and surveillance of HCC All patients were examined for HCC by abdominal ultrasonography (US) and/or abdominal computed tomography (CT) ± serum alpha-fetoprotein (AFP) examination every 3-12 mo. If HCC was suspected, additional procedures, such as CT, magnetic resonance imaging (MRI), angiography, and US guided biopsy, were performed as necessary to confirm the diagnosis. Definitions A primary non-response was defined as a less than 1 log copy/ml decrease in the HBV DNA level from the baseline at 3 mo of treatment. A partial virologic response was defined as a 1 log copy/ml decline in the HBV DNA level from the baseline, but with a detectable load, at week 24. A complete virologic response was defined as an undetectable HBV DNA level by a sensitive PCR assay [21]. The R group was defined as patients with HCC arising from drug-resistant CHB, and the N group was defined as patients with HCC arising from CHB receiving first line antiviral treatment without evidence of drug resistance. Subgroup analysis according to tumor surveillance interval, the R group was defined as patients with HCC arising from drug-resistant CHB who underwent frequent tumor surveillance ( 6 mo), and the N group was defined as patients with HCC arising from CHB treated with antivirals who underwent frequent tumor surveillance ( 6 mo). Statistical analysis The parametrical data were expressed as the means ± SD when a normal distribution was assumed and were expressed as a median (range) when a normal distribution was not assumed to be present. The group comparisons were performed using the Pearson s χ 2 test and Mann- Whitney U-test. Logistic regression analysis was performed to evaluate the factors for the development of HCC. Factors that were significant in the univariate analysis were entered into a stepwise multivariate analysis to find the most significant risk factors. The hazard function data were estimated using the Kaplan-Meier curve and compared using the log rank test. A P-value of less than 0.05 was considered to be statistically significant. We performed statistical analysis using SPSS 20.0 (SPSS Inc., Chicago, United States). RESULTS Baseline characteristics of patients with drug-resistant CHB The median follow-up duration was 49.3 mo (range: mo). The mean age of the patients was (range 16-81) years. The mean duration of the antiviral treatment was mo (4-120 mo). There were 309 men (71.5%) and 123 women (28.5%) included in the study. Additionally, 127 patients (29.4%) had cirrhosis; 350 patients (81%) were positive for HBeAg; 118 patients (27.3%) were rtm204i-positive; 54 patients (12.5%) were rtm204i/rtl180 M-positive; 39 patients (9.0%) were rtm204i+v/rtl180 M-positive; 125 patients (28.9%) were rtm204 V/rtL180 M-positive; 25 patients (5.8%) were rta181t-positive; 2 patients (0.4%) were rta181t/ V-positive; 12 patients (2.7%) were rtn236t-positive; and 57 patients (13.2%) were positive for other mutations. The clinical characteristics of the two groups (HCCpositive group vs HCC-negative group) are shown in Table 1. There were no significant differences between the two groups for gender, initial HBV DNA level, serum aspartate aminotransferase (AST) level, alanine 6836 October 28, 2013 Volume 19 Issue 40

149 Jun CH et al. Drug-resistant CHB and HCC Table 1 Characteristics of patients with drug-resistant chronic hepatitis B stratified by hepatocellular carcinoma status n (%) Table 2 Multivariate analysis of the clinical and virologic factors associated with hepatocellular carcinoma occurrence Variables Patients with HCC (n = 57) Patients without HCC (n = 375) P -value Gender (male) 42 (73.7) 267 (71.2) Age (mean, yr) ± ± < Presence of cirrhosis 42 (73.7) 85 (22.7) < HBeAg positivity 36 (63.2) 314 (83.7) Seroconversion of 3 (5.3) 78 (20.8) HBeAg Initial HBV DNA (< 2000 IU) 2 (3.5) 27 (7.2) 0.61 Initial HBV DNA 46 (80.7) 314 (83.7) (> IU) Complete virologic 11 (19.3) 135 (36) 0.02 response Partial virologic 31 (54.4) 271 (72.3) response Platelet count (10 3 / 103 (35-380) (34-330) < mm 3 ) (median, range) AST U/L (median, range) 79.5 (22-707) 63 ( ) ALT U/L 86.5 (11-590) 82 (9-2280) (median, range) AFP IU/mL 7.58 ( ) 2.8 ( ) < (median, range) Child-Pugh score 5.51 ± ± Viral mutation rtm204i 25 (43.9) 93 (24.8) rtm204i/rtl180m 4 (7) 50 (13.3) rtm204v/rtl180m 14 (24.6) 111 (29.6) rtm204v + I/rtL180M 3 (5.3) 36 (9.6) rta181t 3 (5.3) 22 (5.9) 1 rta181t/v 1 (1.8) 1 (0.26) Duration of antiviral treatment (mo) ± ± HCC: Hepatocellular carcinoma; ALT: Alanine aminotransferase; AFP: Alpha-fetoprotein; AST: Aspartate aminotransferase; HBV: Hepatitis B virus. aminotransferase (ALT) level, or total bilirubin or albumin. A significant difference was found for age, platelet count, AFP, positivity of HBeAg, seroconversion rate of HBeAg, virologic response, the Child-Pugh score, presence of rtm204i, and the duration of antiviral treatment. Clinical and virologic factors associated with HCC occurrence The univariate analysis showed that cirrhosis, age > 50 years, partial virologic response, complete virologic response, the rtm204i (YIDD) mutation, HBeAg (+), platelet count, the Child-Pugh score, and the duration of antiviral treatment were associated with the development of HCC. The multivariate analysis showed that cirrhosis, age >50 years, negative complete virologic response, HBeAg (+), and the rtm204i (YIDD) mutation were independent risk factors for the development of HCC (Table 2). Cumulative incidence of HCC in patients with drugresistant CHB The cumulative hepatocarcinogenesis rate in patients with Variables HR 95%CI P -value Presence of cirrhosis < 0.01 Age > 50 yr < 0.01 Complete virologic response < 0.01 Positivity of HBeAg < 0.05 Presence of rtm204i mutation < 0.01 drug-resistant CHB was 4.6%, 6.9%, 8.87%, and 11.8% at the end of 1, 2, 3, and 5 years, respectively. Kaplan-Meier analysis for the incidence rate of HCC in patients with drug-resistant CHB stratified by the patient and viral factors identified in multivariate analysis is shown in Figure 2. The cumulative occurrence rate of HCC in cirrhotic patients with drug-resistant CHB was 3.93%, 5.55%, 6.71%, and 9.02% at the end of 1, 2, 3 and 5 years, respectively. The cumulative occurrence rate of HCC in HBeAg (+) patients was 3.0%, 5.09%, 6.01%, and 7.87% at the end of 1, 2, 3 and 5 years, respectively. The cumulative occurrence rate of HCC in rtm204i (YIDD) mutant patients was 2.3%, 3.0%, 4.16%, and 6.01% at the end of 1, 2, 3 and 5 years, respectively. The cumulative occurrence rate of HCC in patients greater than 50 years of age was 6.9%, 11.5%, 20.8%, and 23.1% at the end of 1, 2, 3 and 5 years, respectively. The cumulative occurrence rate of HCC in virologic non-responder patients was 2.3%, 4.6%, 11.5%, and 23.1% at the end of 1, 2, 3 and 5 years, respectively. Tumor characteristics of patients with HCC and drugresistant CHB compared to patients with HCC and naïve CHB To compare the tumor characteristics between HCC patients with drug-resistant CHB (R group) and HCC patients with CHB treated with antivirals, we selected 119 HCC patients with CHB who received antiviral treatment (N group). The clinical characteristics of the two groups (R group vs N group) are shown in Table 3. There were no significant differences between the two groups for sex, age, presence of cirrhosis, tumor type, serum ALT, the Child-Pugh score, or the total follow-up duration. A significant difference was found for portal vein thrombosis, tumor stage (CLIP score, modified UICC), distant metastasis, platelet count, serum AST, C-reactive protein (CRP), AFP, and the mean tumor surveillance interval. The R group had lower serum CRP and AFP levels and earlier stage tumors than the N group. The total followup duration was not significantly different between the two groups. Subgroup analysis according to tumor surveillance interval The R group had tumors of an earlier stage and a lower AFP than the N group because of frequent tumor surveillance. Therefore, we performed a subgroup analysis to 6837 October 28, 2013 Volume 19 Issue 40

150 Jun CH et al. Drug-resistant CHB and HCC A Hazard risk of HCC Cirrhotics 2 Non-cirrhotics 1-Uncensored 2-Uncensored B Hazard risk of HCC HBeAg (-) 2 HBeAg (+) 1-Uncensored 2-Uncensored Follow-up duration (d) Follow-up duration (d) C Hazard risk of HCC YIDD mutant (+) 2 YIDD mutant (-) 1-Uncensored 2-Uncensored D Hazard risk of HCC Age 50 2 Age > 50 1-Uncensored 2-Uncensored Follow-up duration (d) Follow-up duration (d) E Cumulative incidence of HCC Complete virologic response (+) 2 Complete virologic response (-) 1-Uncensored 2-Uncensored Follow-up duration (d) Figure 2 Cumulative risk. A, B: Hepatocellular carcinoma (HCC) in cirrhotic patients and in HBeAg (+) patients with drug-resistant chronic hepatitis B (CHB) (log rank test, P < 0.001, P = 0.008, respectively); C, D: HCC in YIDD patients and in patients > 50 years of age with drug-resistant CHB (log rank test, P =0.007, P = 0.001, respectively); E: HCC in complete virologic responders with drug-resistant CHB (log rank test, P = 0.003). exclude the frequent tumor surveillance effect on tumor prognosis. Patients were divided into two groups (> 6 mo vs 6 mo) according to the interval of their surveillance. Thirty-seven patients with drug-resistant CHB (R group) and 39 patients with naïve CHB who received antiviral treatment (N group) (surveillance interval 6 mo) were selected. The clinical characteristics of the two groups (R group vs N group) are shown in Table 4. There were no significant differences between the two groups for most variables analyzed. A significant difference was found in the serum CRP and AFP levels, the duration of the antiviral treatment, and the total followup duration. The R group had lower serum CRP and AFP levels than the N group at a similar stage. However, the total follow-up duration was shorter in the R group than the N group. In addition, 20 patients with drug-resistant CHB and 80 patients with CHB who received antiviral treatment (surveillance interval > 6 mo) were selected. There were no significant differences between the two groups for most of the variables analyzed, including tumor stage, serum CRP and AFP levels, and total follow-up duration October 28, 2013 Volume 19 Issue 40

151 Jun CH et al. Drug-resistant CHB and HCC Table 3 Comparison of tumor characteristics between patients with hepatocellular carcinoma with resistant chronic hepatitis B (R group) and hepatocellular carcinoma with chronic hepatitis B treated with antivirals (N group) n (%) Variables DISCUSSION R group (n = 57) N group (n = 119) P -value Gender (male) 42 (73.7) 100 (84) Age (mean, yr) ± ± Presence of cirrhosis 55 (96.5) 117 (98.3) 1 Portal vein thrombosis 8 (14) 43 (36.1) Vascular invasion 20 (35.1) 47 (39.5) Multi-nodular tumor type 21 (36.8) 55 (46.2) CLIP score 0.75 ± ± 1.43 < Modified UICC stage (< ⅣA) 50 (87.7) 73 (61.3) < Modified UICC stage (Ⅰ/Ⅱ/Ⅲ/ⅣA/ⅣB) 13/18/19/6/1 18/34/21/28/18 LN involvement 1 (2.1) 14 (11.7) Distant metastasis 0 (0) 13 (10.9) AST U/L (median, range) 48 (20-415) 61 (16-481) ALT U/L (median, range) 39 (8-532) 44 (3-203) Platelet count (10 3 / 103 (23-380) 126 (24-426) mm 3 ), (median, range) CRP (mg/dl) 0.34 ± ± 2.75 < (median, range) AFP IU/mL 48 ( ) 107 ( ) (median, range) Child-Pugh score 5.51 ± ± Duration of anti-viral 20 (0-72) 6 (1-276) Tx. (mo) Mean tumor surveillance period (mo) 6.35 ± ± 2.86 < Total follow-up duration (d) ± ± UICC: Union Internationale Contre le Cancer; CLIP: Cancer of the Liver Italian Program; LN: Lymph node; ALT: Alanine aminotransferase; AFP: Alpha-fetoprotein; AST: Aspartate aminotransferase; HBV: Hepatitis B virus; CRP: C-reactive protein. Antiviral therapy was shown to significantly reduce the risk of liver failure and HCC in patients with compensated cirrhosis and CHB [16]. However, the development of LAM-resistance significantly compromises the effectiveness of this strategy [17]. Until now, there have been few studies about hepatocarcinogenesis in patients with drugresistant CHB. Data regarding the characteristics of HCC that arise in patients with drug-resistant CHB are also lacking. Many countries rely on LAM as first-line antiviral therapy for CHB, and over time many patients will develop drug resistance. Therefore, it is imperative that clinical and virologic factors associated with the development of HCC in this group of patients be delineated. In our study, we demonstrated that the cumulative incidence rate of HCC in patients with drug-resistant CHB was 4.6%, 6.9%, 8.87%, and 11.8% at the end of 1, 2, 3, and 5 years, respectively, and that cirrhosis, age > Table 4 Comparison of tumor characteristics between patients with hepatocellular carcinoma with resistant chronic hepatitis B (R group) and hepatocellular carcinoma with chronic hepatitis B treated with antiviral treatment (N group): subgroup analysis based on tumor surveillance interval ( 6 mo) n (%) Variables R group (n = 37) N group (n = 39) P -value Gender (male) 27 (73) 31 (79.5) Age (mean, yr) ± ± Presence of cirrhosis 36 (97.3) 39 (100) 1 Portal vein thrombosis 5 (13.5) 8 (20.5) Vascular invasion 11 (29.7) 8 (20.5) Multi-nodular tumor type 27 (73) 27 (69.2) CLIP score 0.59 ± ± Modified UICC stage (< ⅣA) 34 (91.9) 35 (89.7) 1.0 Modified UICC stage 11/11/12/3/0 11/15/9/2/2 (Ⅰ/Ⅱ/Ⅲ/ⅣA/ⅣB) LN involvement 0 (0) 2 (5.1) Distant metastasis 0 (0) 1 (2.6) 1 AST U/L (median, range) 48 (20-141) 52 (16-481) ALT U/L (median, range) 38 (8-199) 44 (11-150) 0.14 Platelet count (10 3 /mm 3 ) 101 (23-232) 131 (24-260) (median, range) CRP (mg/dl) (median, range) 0.3 (0-2) 0.5 (0-16) AFP IU/mL (median, range) 27 (2-737) 52 ( ) Child-Pugh score 5.51 ± ± Duration of anti-viral Tx 21.5 (8-72) 7 (1-60) < Total follow-up duration ± ± UICC: Union Internationale Contre le Cancer; CLIP: Cancer of the Liver Italian Program; LN: Lymph node; ALT: Alanine aminotransferase; AFP: Alpha-fetoprotein; AST: Aspartate aminotransferase; HBV: Hepatitis B virus; CRP: C-reactive protein. 50 years, HBeAg (+), the rtm204i (YIDD) mutation, and virologic non-responder status were independent risk factors for the development of HCC in CHB patients with drug resistance. Previous studies primarily identified the rate of hepatocarcinogenesis with varying results. Akuta et al [22] reported a cumulative hepatocarcinogenesis rate in LAM resistant hepatitis B genotype C patients of 2.2%, 5.9%, and 8.1% at the end of 1, 2, and 3 years, respectively, and they indicated that these hepatocarcinogenesis rates were similar to those in cirrhosis patients who had not received antiviral therapy (namely, the high-risk group for HCC development) [23]. Hosaka et al [24] reported that HCC developed in 18 of the 247 (7.3%) patients who had received adefovir add-on lamivudine during a 5-year period. Consistent with the results of other studies, the cumulative incidence rate of HCC in patients with drug-resistant CHB in our study was 4.6%, 6.9%, 8.87%, and 11.8% at the end of 1, 2, 3, and 5 years, respectively; however, our study had a larger number of cases than the other two studies. Regarding the risk factors that influence the development of HCC, Hosaka et al [24] reported that AST > 70 IU/L, the rtm204i (YIDD) mutation, age > 50 years and cirrhosis were independent risk factors for the development of HCC. Additionally, Yeh et al [9] reported 6839 October 28, 2013 Volume 19 Issue 40

152 Jun CH et al. Drug-resistant CHB and HCC that the rta181t mutation, age > 50 years, and liver cirrhosis were significantly associated with the occurrence of HCC. In another study [22], the cumulative HBV DNA non-detectable rate and ALT normalization rate were not significantly different with regards to the development of HCC. Our study showed, distinctly from other studies, that cirrhosis, age > 50 years, a negative complete virologic response, the rtm204i (YIDD) mutation, and HBeAg (+) were independent risk factors for the development of HCC. In our study, the rta181t mutation and HBV DNA level at the time of the documentation of the drug mutation were not associated with the occurrence of HCC. Consistent with other studies on naïve CHB patients [18], HBeAg (+) and a negative complete virologic response were associated with the development of HCC. HCC arising from drug-resistant CHB (R group) had lower serum CRP and AFP levels and earlier stage tumors than HCC arising from naïve CHB (N group). Although the R group had an earlier stage tumors and lower serum CRP and AFP levels, the total follow-up duration was not significantly different between the two groups. We think these differences may be attributed to more frequent tumor surveillance in the R group. The R group may have had the same survival rates even if the R group had better prognostic factors, such as low tumor stage and low AFP and CRP levels compared to the N group. Therefore, we performed a subgroup analysis to exclude the frequent tumor surveillance effect on the tumor prognosis. The subgroup analysis showed that the patients with HCC arising from drug-resistant CHB who underwent frequent tumor surveillance ( 6 mo) (R group) had lower serum CRP and AFP levels than patients with HCC arising from CHB treated with antiviral treatment who underwent frequent tumor surveillance ( 6 mo) (N group) at the same stage. However, the total follow-up duration was shorter in the R group than the N group, paradoxically. Recent studies reported that an increased serum CRP level is associated with poor prognosis (tumor recurrence after a surgical resection, large tumor size, and poorly defined tumor type) of patients with HCC [25,26]. Additionally, serum AFP is well known as a prognostic factor for patients with HCC [27,28]. These finding suggest that HCC patients with naïve CHB may have a better prognosis than HCC patients with resistant CHB, irrespective of the tumor stage or serum CRP or AFP levels in the frequent tumor surveillance group. That is, patients with HCC arising from resistant CHB may have poorer survival than patients with HCC arising from naïve CHB. These findings may be explained by the R group having poorer liver function because of incomplete viral suppression during follow-up. In fact, hepatic failure was the main cause of death in the R group (data not shown). To us, this is the most striking finding. However, in the HCC surveillance group, in which the surveillance exceeded 6 mo, there were no significant differences between the two subgroups for most of the variables analyzed, including tumor stage, serum CRP and AFP levels, and total follow-up duration. The first limitation of our study is that it was a retrospective single center study. Therefore, our results may not be generalizable to other patient populations. The second limitation is a single data point for various viral markers (e.g., viral DNA) and laboratory values is another limitation since these factors are not static over time. Third, the relationship between risk factors, such as nucleotide substitution and the development of HCC, could not be presented. Fourth, we did not check the genotype of all patients (n = 90/432), but 100% of the 90 patients whose genotypes were checked were genotype C. In South Korea, it is well known that the genotype of CHB patients is almost always genotype C. Larger, prospective studies will be needed to confirm these findings. In summary, frequent HCC surveillance may identify early HCC in these high-risk patients, and patients with HCC arising from resistant CHB may have poor survival, irrespective of tumor stage or serum CRP or AFP levels. COMMENTS Background In patients with compensated cirrhosis, antiviral therapy significantly reduces the risk of liver failure and hepatocellular carcinoma (HCC). However, in patients who have developed drug resistance, this beneficial effect is drastically compromised. However, there are few studies on hepatocarcinogenesis in patients with drug-resistant chronic hepatitis B (CHB) or on the characteristics of tumors arising from drug-resistant CHB. Related publication Hosaka et al reported that aspartate aminotransferase > 70 IU/L, the rtm204i (YIDD) mutation, age > 50 years and cirrhosis were independent risk factors for the development of HCC. Yeh et al reported that the rta181t mutation, age > 50 years, and liver cirrhosis were significantly associated with the occurrence of HCC. Innovations and breakthroughs Cirrhosis, age > 50 years, HBeAg (+), YIDD mutants, and virologic nonresponder status were independent risk factors for the development of HCC in CHB patients with drug resistance, and there was a trend of poorer survival in patients with HCC arising from resistant CHB than in patients with HCC arising from naive CHB. Applications Frequent HCC surveillance may identify HCC early in these high-risk patients. Peer review This is a large (n = 432) monocenter study aimed at evaluating the relationship between drug-resistant HBV chronic infection and the development of HCC. It is well written. REFERENCES 1 Lok AS. Chronic hepatitis B. N Engl J Med 2002; 346: [PMID: DOI: /NEJM ] 2 Iloeje UH, Yang HI, Su J, Jen CL, You SL, Chen CJ. Predicting cirrhosis risk based on the level of circulating hepatitis B viral load. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 3 Conjeevaram HS, Lok AS. Management of chronic hepatitis B. J Hepatol 2003; 38 Suppl 1: S [PMID: DOI: /S (02) ] 4 Wright TL. Introduction to chronic hepatitis B infection. Am J Gastroenterol 2006; 101 Suppl 1: S1-S6 [PMID: DOI: /j x] 5 Zoulim F. Antiviral therapy of chronic hepatitis B. Antiviral Res 2006; 71: [PMID: DOI: / j.antiviral ] 6840 October 28, 2013 Volume 19 Issue 40

153 Jun CH et al. Drug-resistant CHB and HCC 6 Lok AS, Lai CL, Leung N, Yao GB, Cui ZY, Schiff ER, Dienstag JL, Heathcote EJ, Little NR, Griffiths DA, Gardner SD, Castiglia M. Long-term safety of lamivudine treatment in patients with chronic hepatitis B. Gastroenterology 2003; 125: [PMID: DOI: /j.gastro ] 7 Holomán J, Glasa J. EASL clinical practice guidelines. J Hepatol 2009; 51: [PMID: DOI: / j.jhep ] 8 Lau DT, Doo E, Park Y, Kleiner DE, Schmid P, Kuhns MC, Hoofnagle JH. Lamivudine for chronic delta hepatitis. Hepatology 1999; 30: [PMID: DOI: / hep ] 9 Yeh CT, Chien RN, Chu CM, Liaw YF. Clearance of the original hepatitis B virus YMDD-motif mutants with emergence of distinct lamivudine-resistant mutants during prolonged lamivudine therapy. Hepatology 2000; 31: [PMID: DOI: /jhep ] 10 Ono SK, Kato N, Shiratori Y, Kato J, Goto T, Schinazi RF, Carrilho FJ, Omata M. The polymerase L528M mutation cooperates with nucleotide binding-site mutations, increasing hepatitis B virus replication and drug resistance. J Clin Invest 2001; 107: [PMID: DOI: /JCI11100] 11 Angus P, Vaughan R, Xiong S, Yang H, Delaney W, Gibbs C, Brosgart C, Colledge D, Edwards R, Ayres A, Bartholomeusz A, Locarnini S. Resistance to adefovir dipivoxil therapy associated with the selection of a novel mutation in the HBV polymerase. Gastroenterology 2003; 125: [PMID: DOI: /S (03) ] 12 Hadziyannis SJ, Tassopoulos NC, Heathcote EJ, Chang TT, Kitis G, Rizzetto M, Marcellin P, Lim SG, Goodman Z, Ma J, Brosgart CL, Borroto-Esoda K, Arterburn S, Chuck SL. Long-term therapy with adefovir dipivoxil for HBeAgnegative chronic hepatitis B for up to 5 years. Gastroenterology 2006; 131: [PMID: DOI: / j.gastro ] 13 Marcellin P, Chang TT, Lim SG, Tong MJ, Sievert W, Shiffman ML, Jeffers L, Goodman Z, Wulfsohn MS, Xiong S, Fry J, Brosgart CL. Adefovir dipivoxil for the treatment of hepatitis B e antigen-positive chronic hepatitis B. N Engl J Med 2003; 348: [PMID: DOI: /NEJMoa020681] 14 Colonno RJ, Rose R, Baldick CJ, Levine S, Pokornowski K, Yu CF, Walsh A, Fang J, Hsu M, Mazzucco C, Eggers B, Zhang S, Plym M, Klesczewski K, Tenney DJ. Entecavir resistance is rare in nucleoside naïve patients with hepatitis B. Hepatology 2006; 44: [PMID: DOI: /hep.21422] 15 Sherman M, Yurdaydin C, Sollano J, Silva M, Liaw YF, Cianciara J, Boron-Kaczmarska A, Martin P, Goodman Z, Colonno R, Cross A, Denisky G, Kreter B, Hindes R. Entecavir for treatment of lamivudine-refractory, HBeAg-positive chronic hepatitis B. Gastroenterology 2006; 130: [PMID: DOI: /j.gastro ] 16 Liaw YF, Sung JJ, Chow WC, Farrell G, Lee CZ, Yuen H, Tanwandee T, Tao QM, Shue K, Keene ON, Dixon JS, Gray DF, Sabbat J. Lamivudine for patients with chronic hepatitis B and advanced liver disease. N Engl J Med 2004; 351: [PMID: DOI: /NEJMoa033364] 17 Elefsiniotis I, Buti M, Jardi R, Vezali E, Esteban R. Clinical outcome of lamivudine-resistant chronic hepatitis B patients with compensated cirrhosis under adefovir salvage treatment. Importance of HCC surveillance. Eur J Intern Med 2009; 20: [PMID: DOI: /j.ejim ] 18 Lee MH, Yang HI, Liu J, Batrla-Utermann R, Jen CL, Iloeje UH, Lu SN, You SL, Wang LY, Chen CJ. Prediction models of long-term cirrhosis and hepatocellular carcinoma risk in chronic hepatitis B patients: risk scores integrating host and virus profiles. Hepatology 2013; 58: [PMID: DOI: /hep.26385] 19 Park JW. [Practice guideline for diagnosis and treatment of hepatocellular carcinoma]. Korean J Hepatol 2004; 10: [PMID: ] 20 A new prognostic system for hepatocellular carcinoma: a retrospective study of 435 patients: the Cancer of the Liver Italian Program (CLIP) investigators. Hepatology 1998; 28: [PMID: DOI: /hep ] 21 European Association For The Study Of The Liver. EASL Clinical Practice Guidelines: management of chronic hepatitis B. J Hepatol 2009; 50: [PMID: DOI: /j.jhep ] 22 Akuta N, Suzuki F, Kawamura Y, Yatsuji H, Sezaki H, Suzuki Y, Hosaka T, Kobayashi M, Kobayashi M, Arase Y, Ikeda K, Kumada H. Virological response and hepatocarcinogenesis in lamivudine-resistant hepatitis B virus genotype C patients treated with lamivudine plus adefovir dipivoxil. Intervirology 2008; 51: [PMID: DOI: / ] 23 Kobayashi M, Ikeda K, Hosaka T, Sezaki H, Someya T, Akuta N, Suzuki F, Suzuki Y, Saitoh S, Arase Y, Miyakawa Y, Kumada H. Natural history of compensated cirrhosis in the Child-Pugh class A compared between 490 patients with hepatitis C and 167 with B virus infections. J Med Virol 2006; 78: [PMID: DOI: /jmv.20562] 24 Hosaka T, Suzuki F, Kobayashi M, Hirakawa M, Kawamura Y, Yastuji H, Sezaki H, Akuta N, Suzuki Y, Saitoh S, Arase Y, Ikeda K, Miyakawa Y, Kumada H. Development of HCC in patients receiving adefovir dipivoxil for lamivudine-resistant hepatitis B virus mutants. Hepatol Res 2010; 40: [PMID: DOI: /j X x] 25 Jun CH, Ki HS, Lee KH, Park KJ, Park SY, Cho SB, Park CH, Joo YE, Kim HS, Choi SK, Rew JS. Impact of serum C-reactive protein level on the prognosis of patients with hepatocellular carcinoma undergoing TACE. Clin Mol Hepatol 2013; 19: [PMID: DOI: /cmh ] 26 Zheng Z, Zhou L, Gao S, Yang Z, Yao J, Zheng S. Prognostic role of C-reactive protein in hepatocellular carcinoma: a systematic review and meta-analysis. Int J Med Sci 2013; 10: [PMID: DOI: /ijms.6050] 27 Chan SL, Mo FK, Johnson PJ, Hui EP, Ma BB, Ho WM, Lam KC, Chan AT, Mok TS, Yeo W. New utility of an old marker: serial alpha-fetoprotein measurement in predicting radiologic response and survival of patients with hepatocellular carcinoma undergoing systemic chemotherapy. J Clin Oncol 2009; 27: [PMID: DOI: / JCO ] 28 Riaz A, Ryu RK, Kulik LM, Mulcahy MF, Lewandowski RJ, Minocha J, Ibrahim SM, Sato KT, Baker T, Miller FH, Newman S, Omary R, Abecassis M, Benson AB, Salem R. Alphafetoprotein response after locoregional therapy for hepatocellular carcinoma: oncologic marker of radiologic response, progression, and survival. J Clin Oncol 2009; 27: [PMID: DOI: /JCO ] P- Reviewers Lai Q, Zhang XL S- Editor Wen LL L- Editor A E- Editor Zhang DN 6841 October 28, 2013 Volume 19 Issue 40

154 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Differential diagnosis of left-sided abdominal pain: Primary epiploic appendagitis vs colonic diverticulitis Jeong Ah Hwang, Sun Moon Kim, Hyun Jung Song, Yu Mi Lee, Kyung Min Moon, Chang Gi Moon, Hoon Sup Koo, Kyung Ho Song, Yong Seok Kim, Tae Hee Lee, Kyu Chan Huh, Young Woo Choi, Young Woo Kang, Woo Suk Chung Jeong Ah Hwang, Sun Moon Kim, Hyun Jung Song, Yu Mi Lee, Kyung Min Moon, Chang Gi Moon, Hoon Sup Koo, Kyung Ho Song, Yong Seok Kim, Tae Hee Lee, Kyu Chan Huh, Young Woo Choi, Young Woo Kang, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Konyang University College of Medicine, Daejeon , South Korea Woo Suk Chung, Department of Diagnostic Radiology, Konyang University College of Medicine, Daejeon , South Korea Author contributions: Hwang JA, Kim SM contributed equally to this work; Hwang JA, Kim SM, Chung WS designed the research; Koo HS, Song KH, Kim YS, Lee TH, Huh KC, Choi YW, Kang YW collected the data; Hwang JA, Song HJ, Lee YM, Moon KM, Moon CG analyzed and interpreted the data; and Hwang JA wrote the paper. Correspondence to: Sun Moon Kim, MD, Division of Gastroenterology and Hepatology, Department of Internal Medicine, Konyang University College of Medicine, 685 Gasuwon-dong, Seo-gu, Daejeon , South Korea. ismkim@kyuh.ac.kr Telephone: Fax: Received: May 6, 2013 Revised: August 1, 2013 Accepted: September 13, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the clinical characteristics of left primary epiploic appendagitis and to compare them with those of left colonic diverticulitis. METHODS: We retrospectively reviewed the clinical records and radiologic images of the patients who presented with left-sided acute abdominal pain and had computer tomography (CT) performed at the time of presentation showing radiological signs of left primary epiploic appendagitis (PEA) or left acute colonic diverticulitis (ACD) between January 2001 and December A total of 53 consecutive patients were enrolled and evaluated. We also compared the clinical characteristics, laboratory findings, treatments, and clinical results of left PEA with those of left ACD. RESULTS: Twenty-eight patients and twenty-five patients were diagnosed with symptomatic left PEA and ACD, respectively. The patients with left PEA had focal abdominal tenderness on the left lower quadrant (82.1%). On CT examination, most (89.3%) of the patients with left PEA were found to have an oval fatty mass with a hyperattenuated ring sign. In cases of left ACD, the patients presented with a more diffuse abdominal tenderness throughout the left side (52.0% vs 14.3%; P = 0.003). The patients with left ACD had fever and rebound tenderness more often than those with left PEA (40.0% vs 7.1%, P = 0.004; 52.0% vs 14.3%, P = 0.003, respectively). Laboratory abnormalities such as leukocytosis were also more frequently observed in left ACD (52.0% vs 15.4%, P = 0.006). CONCLUSION: If patients have left-sided localized abdominal pain without associated symptoms or laboratory abnormalities, clinicians should suspect the diagnosis of PEA and consider a CT scan Baishideng. All rights reserved. Key words: Acute abdomen; Differential diagnosis; Appendix epiploica; Colonic diverticulitis; Multidetector computed tomography Core tip: The clinical symptoms of primary epiploic appendagitis (PEA) and acute colonic diverticulitis (ACD) are similar in patients presenting with left-sided abdominal pain. In our study, the patients with PEA had well-localized abdominal tenderness, whereas those with ACD presented with slightly diffuse abdominal 6842 October 28, 2013 Volume 19 Issue 40

155 Hwang JA et al. Left-sided localized abdominal pain tenderness. The patients with ACD showed fever, rebound tenderness, and leukocytosis more often than those with PEA. When patients have well-localized abdominal tenderness without associated systemic manifestation or laboratory abnormalities, clinicians should suspect a diagnosis of PEA and consider a computer tomography (CT) scan. The characteristic CT findings of PEA may enable clinicians to accurately diagnose the disease. Hwang JA, Kim SM, Song HJ, Lee YM, Moon KM, Moon CG, Koo HS, Song KH, Kim YS, Lee TH, Huh KC, Choi YW, Kang YW, Chung WS. Differential diagnosis of left-sided abdominal pain: Primary epiploic appendagitis vs colonic diverticulitis. World J Gastroenterol 2013; 19(40): Available from: URL: i40/6842.htm DOI: INTRODUCTION Epiploic appendages are small pouches of peritoneum filled with fat and small vessels that protrude from the serosal surface of the colon [1-4]. Primary epiploic appendagitis (PEA) is an inflammation in the epiploic appendage caused by either torsion or spontaneous thrombosis of an appendageal draining vein [5-9]. PEA is a rare cause of localized abdominal pain in otherwise healthy patients. The only clinical feature of PEA is focal abdominal pain and tenderness, without pathognomonic laboratory findings. Clinically, it can be often mistaken for either diverticulitis or appendicitis, and may be treated with antibiotic therapy or even surgical intervention. Historically, the diagnosis of PEA had been made at diagnostic laparotomy, performed for presumed appendicitis or diverticulitis with complications [7,8,10,11]. With advancements in radiologic techniques, such as ultrasonography or computed tomography (CT), PEA can be distinguished preoperatively due to its characteristic radiologic findings, and it is already being diagnosed increasingly [8,12]. Diverticulitis is the disorder most likely to be confused with PEA in a patient presenting with localized abdominal pain. In South Korea, as diverticulitis occurs much less in the left colon and PEA occurs quite frequently in the left colon; both diseases of the left colon remain difficult to differentiate. Given that PEA is a benign and self-limited condition, the recognition of this diagnosis is important to clinicians to avoid unnecessary hospitalizations, antibiotic therapy, surgical interventions, and overuse of medical resources [7,10,13]. However, PEA cases are still infrequent and may often be missed even after imaging studies [8,10]. There are no previous studies specifically designed to compare the clinical characteristics of left PEA with those of left acute colonic diverticulitis (ACD). The present study was carried out to describe the clinical characteristics and characteristic CT findings of left PEA and to compare them with those of left ACD. MATERIALS AND METHODS This study was performed on patients who presented with acute left-sided abdominal pain and diagnosed with left PEA or left ACD on CT findings at Konyang University Hospital from January 2001 to December We retrospectively reviewed the clinical records and CT images of the study patients after obtaining approval from the institutional review board with regard to the clinical characteristics, presumed diagnosis before the imaging studies, laboratory findings, radiologic findings, and treatments. If data for specific findings were missing, they were not included in the final analysis. All official CT scans were retrospectively reviewed by two radiologists to determine whether the imaging findings corresponded to PEA or ACD. We selected patients who were given the same diagnosis by two radiologists. The diagnosis of PEA was based on characteristic CT findings as shown below [10,11,14-16] : (1) ovoid fatty mass; (2) hyperattenuated ring sign; (3) disproportionate fat stranding; (4) bowel wall thickening with or without compression; (5) central hyperdense dot/line; and (6) lobulated appearance. The diagnosis of ACD was based on CT findings such as the presence of inflamed diverticula or thickened colonic wall more than 4 mm [7,16-18]. The left colon was defined as the segment of colon under the splenic flexure, which included the descending and sigmoid colon. The size of PEA was the largest diameter on the radiologic findings. The shapes were oval, semicircular, and triangular. We evaluated symptom recurrence in the patients with PEA by reviewing the records of subsequent visits. One patient with PEA was lost to follow-up. Statistical analysis Statistical analysis was performed with SPSS, Windows version 18.0 (SPSS Inc., Chicago, IL, United States), using the χ 2 test and the Fisher s exact test. The averages were compared by using the t-test. A P-value of less than 0.05 was considered significant. RESULTS Clinical characteristics of patients with left primary epiploic appendagitis There were 28 consecutive patients diagnosed as having left PEA on the CT reports and their clinical characteristics are shown in Table 1. The mean age (mean ± SD) was 45.0 ± 11.6 years (range, years), and they were more common in males (ratio of males to females = 16: 12). All the patients had sudden onset of abdominal pain. Two patients (7.1%) showed nausea and vomiting, and fever up to 38.3 was present in two patients (7.1%). The abdominal tenderness was localized in the left lower 6843 October 28, 2013 Volume 19 Issue 40

156 Hwang JA et al. Left-sided localized abdominal pain Table 1 Clinical characteristics of patients with left primary epiploic appendagitis and left acute colonic diverticulitis Lt. PEA (n = 28) Lt. ACD P -value (n = 25) Mean age (yr) 45.0 ± ± Sex (male/female) 16/12 15/ Body mass index (kg/m 2 ) 24.8 ± ± Underlying disease (+) 6 (21.4) 10 (40.0) Alcohol (+) 14 (50.0) 13 (52.0) Smoking (+) 11 (39.3) 8 (32.0) Sudden onset of abdominal pain (+) 28 (100.0) 25 (100.0) NA Duration of pain (d) 3.8 ± ± Nausea (+) 2 (7.1) 2 (8.0) 1.00 Vomiting (+) 2 (7.1) 2 (8.0) 1.00 Diarrhea (+) 0 (0.0) 3 (12.0) Fever (+) 2 (7.1) 10 (40.0) Location of abdominal tenderness Focal 24 (85.7) 12 (48.0) Lt. lower quadrant 23 (82.1) 11 (44.0) Lt. upper quadrant 1 (3.6) 1 (4.0) Diffuse 4 (14.3) 13 (52.0) Rebound tenderness (+) 4 (14.3) 13 (52.0) Palpable mass (+) 1 (3.6) 0 (0.0) 1.00 Values are presented as mean ± SD or n (%). PEA: Primary epiploic appendagitis; ACD: Acute colonic diverticulitis; NA: Not available. Table 2 Presumptive diagnoses prior to imaging studies n (%) Impression Lt. PEA (n = 28) Lt. ACD (n = 25) PEA 7 (25.0) 0 (0.0) ACD 16 (57.1) 15 (60.0) Pelvic inflammatory disease 0 (0.0) 1 (4.0) Ureter stone 1 (3.6) 0 (0.0) Gastritis 2 (7.1) 0 (0.0) Constipation 1 (3.6) 1 (4.0) Appendicitis 1 (3.6) 1 (4.0) Ischemic colitis 0 (0.0) 1 (4.0) Cancer 0 (0.0) 1 (4.0) Peritonitis 0 (0.0) 2 (8.0) Enteritis (colitis) 0 (0.0) 3 (12.0) PEA: Primary epiploic appendagitis; ACD: Acute colonic diverticulitis. (82.1%) and left upper (3.6%) quadrant. Rebound tenderness was found only in four patients (14.3%), and one patient (3.6%) showed palpable mass. The presumptive clinical diagnoses after medical history and physical examinations were ACD (57.1%), PEA (25.0%), acute gastritis (7.1%), ureter stone (3.6%), constipation (3.6%), and acute appendicitis (3.6%) (Table 2). Table 3 Computer tomography features of left primary epiploic appendagitis Features Value Location Descending colon 18 (64.3) Sigmoid-descending junction 3 (10.7) Sigmoid colon 7 (25.0) Size (mm) 2.3 ± 0.6 Shape Oval 22 (78.6) Semicircular 4 (14.3) Triangular 2 (7.1) Computer tomography features Ovoid fatty mass 28 (100.0) Hyperattenuated ring sign 25 (89.3) Disproportionate fat stranding 4 (14.3) Bowel wall thickening±compression 6 (21.4) Central hyperdense dot/line 5 (17.9) Lobulated appearance 0 (0.0) Values are presented as mean ± SD or n (%). Laboratory and radiologic findings of patients with left primary epiploic appendagitis Elevated white blood cell (WBC) count up to 10000/ mm 3 was noticed in four of the 26 patients (15.4%). The erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) were increased in two of the 13 patients (15.4%) and one of the 14 patients (7.1%), respectively. All patients underwent CT scans, and the average size of the PEA was 2.3 ± 0.6 cm (range, cm). It was detected most frequently in the descending colon (64.3%), the sigmoid colon (25.0%), and the sigmoid-descending junction (10.7%) in that order. The characteristic CT findings (Figure 1A) were demonstrated in all patients; ovoid fatty mass was found in all patients (100%), hyperattenuated ring sign was detected in 25 patients (89.3%), disproportionate fat stranding was noticed in 4 patients (14.3%), bowel wall thickening with or without compression was observed in 6 patients (21.4%), and central hyperdense dot/line (Figure 1B) was detected in 5 patients (17.9%) (Table 3). We performed follow up CT scans in five patients between 1 and 3 wk, and they showed resolution of the inflammation. Treatments and clinical results of patients with left primary epiploic appendagitis Surgical management was not required in any of the cases. Twenty-two patients (78.6%) were hospitalized, and the mean length of hospital stay was 5.4 ± 5.0 d (range, 0-24 d). Twenty-two patients (78.6%) received antibiotic therapy, and 6 patients (21.4%) were managed conservatively with hydration and mild analgesics. The duration of antibiotic therapy was 10.5 ± 8.4 d (range, 3-28 d) (Table 4). All patients had clinical follow up except one. No patient experienced symptoms of recurrence within the follow-up period (range, 21 d-105 mo). Clinical characteristics, laboratory findings, and treatments of patients with left acute colonic diverticulitis During the study period, 25 patients were diagnosed with left ACD. The mean age was 58.8 ± 16.3 years (range, years), and 60.0% (15/25) of them were males. The major symptom was sudden onset of localized abdominal pain. Nausea occurred in two patients (8.0%), vomiting in two patients (8.0%), and fever in ten patients (40.0%). The abdominal tenderness was slightly 6844 October 28, 2013 Volume 19 Issue 40

157 Hwang JA et al. Left-sided localized abdominal pain Table 4 Treatments and clinical results of patients with left primary epiploic appendagitis and left acute colonic diverticulitis Lt. PEA (n = 28) Lt. ACD P -value (n = 25) Hospitalization 22 (78.6) 25 (100.0) Treatment Antibiotics 22 (78.6) 22 (88.0) Conservative management 6 (21.4) 3 (12.0) Duration of hospital stay (d) 5.4 ± ± 4.0 < Duration of abdominal pain (d) 3.3 ± ± Duration of abdominal tenderness (d) 3.3 ± ± 3.8 < Duration of antibiotic therapy (d) 10.5 ± ± Values are presented as mean ± SD or n (%). PEA: Primary epiploic appendagitis; ACD: Acute colonic diverticulitis. diffuse over the left side of the abdomen (52.0%), and definite rebound tenderness was present in thirteen patients (52.0%) (Table 1). Laboratory tests showed that the WBC, ESR, and CRP were increased in thirteen of the 25 patients (52.0%), nine of the 12 patients (75.0%), and fifteen of the 20 patients (75.0%), respectively. All the patients were hospitalized, and the mean hospitalization period was 10.2 ± 4.0 d (range, 4-20 d). Except for three patients, all were treated with antibiotics (88.0%), and the mean duration of antibiotic therapy was 16.2 ± 12.6 d (range, 6-60 d) (Table 4). Comparison of clinical characteristics and laboratory findings: left primary epiploic appendagitis vs left acute colonic diverticulitis The mean age was 13.8 years younger in patients with PEA than in ACD (45.0 ± 11.6 years vs 58.8 ± 16.3 years, P = 0.001). There were no significant differences on sex, body mass index, and underlying disease. All patients showed sudden onset of abdominal pain, but the location of the tenderness was different. In PEA, the pain was more localized (85.7% vs 48.0%, P = 0.003) in the left lower quadrant (LLQ) area (82.1%), whereas the pain was slightly diffuse throughout the left side of the abdomen in ACD (14.3% vs 52.0%, P = 0.003). Fever and rebound tenderness were more frequently noted in ACD, and this was statistically significant (7.1% vs 40.0%, P = 0.004; 14.3% vs 52.0%, P = 0.003; respectively) (Table 1). WBC, ESR, and CRP were more frequently increased in ACD, which were significantly different from those in PEA (15.4% vs 52.0%, P = 0.006; 15.4% vs 75.0%, P = 0.003; 7.1% vs 75.0%, P < 0.001; respectively). Comparison of treatments and clinical results: left primary epiploic appendagitis vs left acute colonic diverticulitis The mean duration of hospital stay was about five days shorter (5.4 ± 5.0 d vs 10.2 ± 4.0 d, P < 0.001), and the mean duration of antibiotic therapy was 6-d shorter (10.5 ± 8.4 d vs 16.5 ± 12.6 d, P < 0.05) in PEA than in ACD (Table 4). Patients with PEA experienced an improvement of the abdominal pain and tenderness after 3.3 d on average, but in ACD, the abdominal pain and tenderness resolved more than 5 d after treatment. The pain duration was shorter in PEA than in ACD (3.3 ± 2.9 d vs 5.6 ± 3.6 d, P = 0.012; 3.3 ± 1.9 d vs 7.2 ± 3.8 d, P < 0.001; respectively) (Table 4). DISCUSSION Epiploic appendages, first described in 1543 by Vesalius, are small (1-2 cm thick, cm long) pouches of fatfilled, serosa-covered structures present on the external surface of the colon [1-4]. These appendages have not been found to demonstrate any physiologic functions, but are presumed to serve as protective cushions during peristalsis or to provide a defensive mechanism against local inflammation like that of the greater omentum [2,9,13]. PEA, first introduced by Dockerty et al [6], is an ischemic inflammatory condition of the epiploic appendages without inflammation of adjacent organs. Each epiploic appendage has one or two small supplying arteries from the colonic vasa recta and has a small draining vein with narrow pedicle [2,9,14,19,20]. These appendages are susceptible to torsion due to their pedunculated shape with excessive mobility and limited blood supply [2,5,9]. PEA occurs usually from torsion of epiploic appendages which can result in ischemia, or spontaneous venous thrombosis of a draining vein [5-9]. PEA can occur at any age (reported range, years [13] ) with a peak incidence in the fourth to fifth decades, and men are slightly more affected than women [3,5,7,12,19,20]. In the current study, the mean age of patients with PEA was 45 years and there was a slight male predominance (16 male vs 12 female). They were younger than patients with ACD, and this is consistent with the results of previous studies [12]. Patients with PEA most commonly present with sudden onset of abdominal pain over the affected area, more often in the LLQ mimicking acute sigmoid diverticulitis [3,15,19,20]. They usually are afebrile and don t have nausea or vomiting [2,7,8,19]. A well-localized abdominal tenderness is present in most patients on physical examination and rebound tenderness is also commonly detected [8,21]. A mass may be palpable in 10%-30% of patients [22]. In the present study, patients with PEA all showed sudden onset of abdominal pain, and the tenderness was well-localized in the LLQ area. Rebound tenderness was found only in 14.3%, and a palpable mass was noted in 3.6%. In ACD, the patients also had sudden onset of abdominal pain, but the tenderness was diffusely distributed throughout the left side of the abdomen. They more frequently presented with nausea, vomiting, fever, and rebound tenderness, which corresponded well with those of an earlier study [19]. There are no pathognomonic diagnostic laboratory findings in PEA. The WBC and ESR are normal or only moderately elevated [3,7,8,19]. In the current study, WBC, ESR, and CRP of the patients with PEA were elevated 6845 October 28, 2013 Volume 19 Issue 40

158 Hwang JA et al. Left-sided localized abdominal pain A B Figure 1 Computer tomography image of a 31-year-old man who presented with acute left lower quadrant pain. A: A 31-year-old man who presented with acute left lower quadrant pain. An oval fatty mass with a hyperattenuated ring and surrounding inflammation adjacent to the sigmoid colon (arrow) is noted. The lesion corresponds to the site of tenderness and is characteristic of primary epiploic appendagitis; B: A 48-year-old female who presented with left lower quadrant pain. An ovoid fat attenuated mass with a central high attenuation area within the inflamed epiploic appendage in the distal descending colon (arrow) is shown. only in 7%-15% of patients. The patients with ACD more often showed elevations of WBC, ESR, and CRP. Normal epiploic appendages are usually not identifiable at CT scan without surrounding intraperitoneal fluid such as ascites or hemoperitoneum [3]. These appendages typically have fat attenuations, but the attenuation is slightly increased when inflamed [2,7]. In the past, PEA has been diagnosed incidentally at laparotomy [7,8,10], but currently it may be possible to make the correct diagnosis with the pathognomonic radiologic findings before operation. PEA can arise on any segment of the colon. The most frequently involved sites of PEA are the sigmoid colon [3,15] and the descending colon followed by the cecum [15,19], where they have more elongated epiploic appendages [23]. The characteristic CT finding of PEA is an ovoid fatty lesion with a hyperattenuated ring sign surrounded by inflammatory changes [9-11,14-16,24]. A highattenuated central dot within the inflamed appendage was found in 42.9% by Ng et al [14], and in 54% by Singh et al [15]. It may be due to a thrombosed vessel in the epiploic appendages [8,10,11,14-16,25], or fibrous septa [26]. In addition, PEA can appear lobulated when two or more contiguous epiploic appendages lying in close proximity are affected [8,14,26], which would help to differentiate a PEA from an omental infarction [14]. In the present study, an ovoid fatty mass with a hyperattenuated ring sign was detected in most PEA patients (89.3%), which is similar to previous studies [8-10,14,15,23]. However, we did not find any lobulated appearing PEA on the CT scans. The common presumptive clinical diagnosis for patients with PEA before radiologic interventions was either diverticulitis or appendicitis. Mollà et al [26] reported that 7.1% of patients investigated to exclude sigmoid diverticulitis had radiologic findings of PEA. Rao et al [10] reported that among eleven PEA found on CT scans, seven patients were initially misdiagnosed as having diverticulitis or appendicitis. In the current study, diverticulitis accounted for 57.1% of the presumptive diagnosis in patients with PEA. Only 25.0% of the patients were suspected of having PEA, most of which were made after the year 2005 when clinicians began to recognize this disease entity. Early radiologic examination with an abdominal CT scan has aided in the differentiation of PEA from other diseases that require antibiotic therapy or surgical management [26]. With the increasing use of CT in the evaluation of an acute abdomen, the incidence of PEA is likely to increase as well [8,11,12]. In the present study, only four patients were diagnosed with PEA before 2005, and the rest were diagnosed after PEA is a benign and self-limited condition with recovery occurring in less than 10 d without antibiotic therapy or surgery [7,10,13,23,26]. In general, patients with PEA can be managed conservatively with oral anti-inflammatory medications [7,8]. However, Sand et al [3] showed 40% recurrence rate in PEA. They believed that conservative treatment may lead to a tendency for recurrence and surgical interventions may be necessary for recurrent cases [3,12]. In the current study, most patients (78.6%) with PEA received antibiotic therapy due to the possibility of a more severe diagnosis. No recurrence was noted during the follow-up period, even in cases that were managed conservatively. The follow up CT scan for five patients showed resolution of PEA. No previous studies were specifically designed to compare the clinical characteristics of patients presenting with left-sided abdominal pain. However, there are some limitations to this study, such as being a relatively small series, retrospective analysis, and no pathologic confirmation of PEA. Further prospective, larger, and comparative studies between left PEA and left ACD are needed. In conclusion, the clinical symptoms of left PEA and left ACD are very similar in that both types of patients present with left-sided abdominal pain. Although PEA is rare, if a patient has a well-localized abdominal tenderness without associated fever, rebound tenderness, or laboratory abnormalities, we should suspect the diagnosis of PEA and early CT scans should be performed October 28, 2013 Volume 19 Issue 40

159 Hwang JA et al. Left-sided localized abdominal pain PEA can show characteristic CT findings that may allow clinicians to diagnose it correctly and avoid unnecessary hospitalization, antibiotic therapy, or even surgical interventions. COMMENTS Background Primary epiploic appendagitis (PEA) is a rare cause of localized abdominal pain. In the past, PEA has been diagnosed incidentally at laparotomy, but currently, it may be possible to make the correct diagnosis with the characteristic radiologic findings before operation. On clinical examination, left PEA can mimic left acute colonic diverticulitis (ACD) owing to the lack of pathognomonic clinical features. No previous studies were specifically designed to compare the clinical characteristics of left PEA with those of left ACD. Research frontiers PEA could be managed conservatively without antibiotic therapy or surgery, but ACD should be treated with antibiotics. Therefore, definitive diagnosis of PEA is important to avoid unnecessary hospitalizations, antibiotic therapy, or even surgical interventions. Early radiological examination with abdominal computer tomography (CT) is useful in obtaining an accurate diagnosis of PEA. The present study was designed to describe the clinical characteristics of left PEA and to compare them with those of left ACD. In addition, authors investigated the characteristic CT findings of PEA. Innovations and breakthroughs The patients with PEA and those with ACD all showed sudden onset of abdominal pain, but the location of the tenderness was different. The patients with PEA had a well-localized abdominal tenderness in the left lower quadrant area, whereas those with ACD presented with slightly diffuse abdominal tenderness throughout the left side of the abdomen. In the ACD cases, fever and rebound tenderness were more often noted, and white blood cell count, erythrocyte sedimentation rate, and C-reactive protein levels were more frequently increased. PEA showed characteristic CT findings like an ovoid fatty lesion with a hyperattenuated ring sign surrounded by inflammatory changes. Applications When patients have well-localized abdominal tenderness without associated systemic manifestation or laboratory abnormalities, clinicians should suspect a diagnosis of PEA and consider performing a CT scan. The data could be useful in obtaining an accurate diagnosis of PEA. The characteristic CT findings and specific clinical features of PEA make it easy to differentiate the disease from diverticulitis. Terminology PEA is an ischemic inflammatory condition of the epiploic appendages without an inflammation of adjacent organs. Peer review The authors demonstrated the clinical features and CT findings of PEA by comparison with those of ACD. The manuscript is well organized and well written. REFERENCES 1 Boardman J, Kaplan KJ, Hollcraft C, Bui-Mansfield LT. Radiologic-pathologic conference of Keller Army Community Hospital at West Point, the United States Military Academy: torsion of the epiploic appendage. AJR Am J Roentgenol 2003; 180: 748 [PMID: DOI: /ajr ] 2 Ghahremani GG, White EM, Hoff FL, Gore RM, Miller JW, Christ ML. Appendices epiploicae of the colon: radiologic and pathologic features. Radiographics 1992; 12: [PMID: ] 3 Sand M, Gelos M, Bechara FG, Sand D, Wiese TH, Steinstraesser L, Mann B. Epiploic appendagitis--clinical characteristics of an uncommon surgical diagnosis. BMC Surg 2007; 7: 11 [PMID: DOI: / ] 4 Subramaniam R. Acute appendagitis: emergency presentation and computed tomographic appearances. Emerg Med J 2006; 23: e53 [PMID: DOI: /emj ] 5 Carmichael DH, Organ CH. Epiploic disorders. Conditions of the epiploic appendages. Arch Surg 1985; 120: [PMID: DOI: /archsurg ] 6 Dockerty MB, Lynn TE, Waugh JM. A clinicopathologic study of the epiploic appendages. Surg Gynecol Obstet 1956; 103: [PMID: ] 7 Legome EL, Belton AL, Murray RE, Rao PM, Novelline RA. Epiploic appendagitis: the emergency department presentation. J Emerg Med 2002; 22: 9-13 [PMID: DOI: /S (01) ] 8 Rioux M, Langis P. Primary epiploic appendagitis: clinical, US, and CT findings in 14 cases. Radiology 1994; 191: [PMID: ] 9 Ross JA. Vascular loops in the appendices epiploicae; their anatomy and surgical significance, with a review of the surgical pathology of appendices epiploicae. Br J Surg 1950; 37: [PMID: DOI: /bjs ] 10 Rao PM, Rhea JT, Wittenberg J, Warshaw AL. Misdiagnosis of primary epiploic appendagitis. Am J Surg 1998; 176: [PMID: DOI: /S (98) ] 11 Rao PM, Wittenberg J, Lawrason JN. Primary epiploic appendagitis: evolutionary changes in CT appearance. Radiology 1997; 204: [PMID: ] 12 Choi YU, Choi PW, Park YH, Kim JI, Heo TG, Park JH, Lee MS, Kim CN, Chang SH, Seo JW. Clinical characteristics of primary epiploic appendagitis. J Korean Soc Coloproctol 2011; 27: [PMID: DOI: / jksc ] 13 Vinson DR. Epiploic appendagitis: a new diagnosis for the emergency physician. Two case reports and a review. J Emerg Med 1999; 17: [PMID: DOI: / S (99) ] 14 Ng KS, Tan AG, Chen KK, Wong SK, Tan HM. CT features of primary epiploic appendagitis. Eur J Radiol 2006; 59: [PMID: DOI: /j.ejrad ] 15 Singh AK, Gervais DA, Hahn PF, Rhea J, Mueller PR. CT appearance of acute appendagitis. AJR Am J Roentgenol 2004; 183: [PMID: DOI: / ajr ] 16 Horton KM, Corl FM, Fishman EK. CT evaluation of the colon: inflammatory disease. Radiographics 2000; 20: [PMID: ] 17 Ferzoco LB, Raptopoulos V, Silen W. Acute diverticulitis. N Engl J Med 1998; 338: [PMID: DOI: /NEJM ] 18 Hulnick DH, Megibow AJ, Balthazar EJ, Naidich DP, Bosniak MA. Computed tomography in the evaluation of diverticulitis. Radiology 1984; 152: [PMID: ] 19 Son HJ, Lee SJ, Lee JH, Kim JS, Kim YH, Rhee PL, Kim JJ, Paik SW, Rhee JC, Choi KW. Clinical diagnosis of primary epiploic appendagitis: differentiation from acute diverticulitis. J Clin Gastroenterol 2002; 34: [PMID: DOI: / ] 20 Legome EL, Sims C, Rao PM. Epiploic appendagitis: adding to the differential of acute abdominal pain. J Emerg Med 1999; 17: [PMID: DOI: /S (99)00089-X] 21 Thomas JH, Rosato FE, Patterson LT. Epiploic appendagitis. Surg Gynecol Obstet 1974; 138: [PMID: ] 22 Shehan JJ, Organ C, Sullivan JF. Infarction of the appendices epiploicae. Am J Gastroenterol 1966; 46: [PMID: ] 23 Singh AK, Gervais DA, Hahn PF, Sagar P, Mueller PR, Novelline RA. Acute epiploic appendagitis and its mimics. Radiographics 2005; 25: [PMID: DOI: / rg ] 24 McClure MJ, Khalili K, Sarrazin J, Hanbidge A. Radiological features of epiploic appendagitis and segmental omental infarction. Clin Radiol 2001; 56: [PMID: October 28, 2013 Volume 19 Issue 40

160 Hwang JA et al. Left-sided localized abdominal pain DOI: /crad ] 25 Rao PM, Novelline RA. Case 6: primary epiploic appendagitis. Radiology 1999; 210: [PMID: ] 26 Mollà E, Ripollés T, Martínez MJ, Morote V, Roselló-Sastre E. Primary epiploic appendagitis: US and CT findings. Eur Radiol 1998; 8: [PMID: ] P- Reviewer Miki K S- Editor Zhai HH L- Editor O Neill M E- Editor Liu XM 6848 October 28, 2013 Volume 19 Issue 40

161 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Antiviral therapy delays esophageal variceal bleeding in hepatitis B virus-related cirrhosis Chang-Zheng Li, Liu-Fang Cheng, Qing-Shan Li, Zhi-Qiang Wang, Jun-Hong Yan Chang-Zheng Li, Qing-Shan Li, Jun-Hong Yan, Department of Gastroenterology and Hepatology, Institute of Hepatobiliary and Gastrointestinal Diseases, Chinese Second Artillery General Hospital, Beijing , China Liu-Fang Cheng, Zhi-Qiang Wang, Department of Gastroenterology and Hepatology, Chinese PLA General Hospital, Beijing , China Author contributions: Li CZ conceived and initiated the research project, conducted clinical and endoscopic treatment and data analysis and wrote the manuscript; Cheng LF, Wang ZQ and Li QS were actively involved in conducting clinical and endoscopic treatment; Yan JH was responsible for database management and data analysis. Correspondence to: Chang-Zheng Li, MD, Department of Gastroenterology and Hepatology, Institute of Hepatobiliary and Gastrointestinal Diseases, Chinese Second Artillery General Hospital, No. 16, Xinjiekouwai Street, Xicheng District, Beijing , China. licz007@aliyun.com Telephone: Fax: Received: May 8, 2013 Revised: August 13, 2013 Accepted: September 13, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the effect of antiviral therapy with nucleoside analogs in hepatitis B virus (HBV)-related cirrhosis and esophageal varices. METHODS: Eligible patients with HBV-related cirrhosis and esophageal varices who consulted two tertiary hospitals in Beijing, China, the Chinese Second Artillery General Hospital and Chinese PLA General Hospital, were enrolled in the study from January 2005 to December Of 117 patients, 79 received treatment with different nucleoside analogs and 38 served as controls. Bleeding rate, change in variceal grade and non-bleeding duration were analyzed. Multivariate Cox proportional hazard regression was used to identify factors related to esophageal variceal bleeding. RESULTS: The bleeding rate was decreased in the antiviral group compared to the control group (29.1% vs 65.8%, P < 0.001). Antiviral therapy was an independent factor related to esophageal bleeding in multivariate analysis (HR = 11.3, P < 0.001). The mean increase in variceal grade per year was lower in the antiviral group (1.0 ± 1.3 vs 1.7 ± 1.2, P = 0.003). Nonbleeding duration in the antiviral group was prolonged in the Kaplan-Meier model. Viral load rebound was observed in 3 cases in the lamivudine group and in 1 case in the adefovir group, all of whom experienced bleeding. Entecavir and adefovir resulted in lower bleeding rates (17.2% and 28.6%, respectively) than the control (P < and P = 0.006, respectively), whereas lamivudine (53.3%) did not (P = 0.531). CONCLUSION: Antiviral therapy delays the progression of esophageal varices and reduces bleeding risk in HBV-related cirrhosis, however, high-resistance agents tend to be ineffective for long-term treatment Baishideng. All rights reserved. Key words: Nucleoside analog; Esophageal variceal bleeding; Hepatitis B virus; Cirrhosis; Resistance; Entecavir; Lamivudine; Adefovir Core tip: Antiviral therapy with nucleoside analogs improves clinical outcome in hepatitis B virus (HBV)-related decompensated cirrhosis. However, the emergence of resistance results in liver injury. The consequences may be worse in patients with esophageal varices (EV), in which bleeding and death often occur. This study evaluated the efficacy of antiviral treatment over 5 years in patients with HBV-related cirrhosis and EV and found that antiviral therapy decreased the risk of bleeding. However, agents with a high rate of virological breakthrough were ineffective in preventing bleeding. These findings provide evidence-based suggestions for the treatment of this special group of patients. Li CZ, Cheng LF, Li QS, Wang ZQ, Yan JH. Antiviral therapy 6849 October 28, 2013 Volume 19 Issue 40

162 Li CZ et al. Antiviral therapy and EV bleeding delays esophageal variceal bleeding in hepatitis B virus-related cirrhosis. World J Gastroenterol 2013; 19(40): Available from: URL: i40/6849.htm DOI: INTRODUCTON Liver cirrhosis is a common disease that poses a serious threat to the health of patients, and hepatitis B virus (HBV) infection is one of the main causes of cirrhosis. The 5-year survival rate of decompensated liver cirrhosis is reported to be only 14%-28% [1,2]. Nucleoside analogs, by inhibiting HBV polymerase and decreasing HBV load, have been widely used in the treatment of hepatitis B. Antiviral therapy with sustained suppression of viral replication has shown benefits in decompensated cirrhotic patients. However, there are no detailed reports of the effects of antiviral therapy in esophageal variceal bleeding, one of the most dangerous and life-threatening complications of cirrhosis. About 30% of patients with cirrhosis and esophageal varices (EV) will experience bleeding during their lifetime [3]. A single episode of uncontrolled variceal bleeding results in immediate death in 5%-8% of patients and has a six-week mortality rate of at least 20% [4]. Therefore, prevention of variceal bleeding is of paramount importance. A number of studies have shown that antiviral therapy with nucleoside analogs is associated with improved clinical outcome in patients with HBV-related decompensated cirrhosis [5,6]. However, the problem of drug resistance has also emerged with the long-term use of these agents [7,8]. The emergence of resistance results in a loss of virological suppression, which in turn causes progressive liver injury and even severe liver failure [9]. The consequences may be worse in patients with EV. Virological breakthrough in patients with EV usually results in EV bleeding or even death. A retrospective study by Koga et al [10] demonstrated an improvement in patients with esophageal varices following lamivudine (LAM) treatment. However, the study consisted of only 12 patients treated with LAM and 6 controls, and there were no data on bleeding rate and the effect of virological breakthrough. As patients usually experience bleeding when virological breakthrough takes place, it is necessary to separate the patients and evaluate the harm of drug resistance and the benefit of HBV suppression in these patients to provide evidence-based treatment suggestions. The aim of the present study was to evaluate the efficacy of antiviral treatment over 5 years in patients with HBV-related cirrhosis and EV. MATERIALS AND METHODS Study design This study evaluated the efficacy of antiviral therapy with different nucleoside analogs in patients with HBV-related cirrhosis and EV. Eligible patients with HBV-related cirrhosis who consulted two tertiary hospitals in Beijing, China, the Chinese Second Artillery General Hospital and Chinese PLA General Hospital, were enrolled in the study from January 2005 to December The study population had HBV-related cirrhosis and EV. All patients had serum HBV DNA > 500 copies/ml as measured by polymerase chain reaction (PCR) (Fluorescence Quantitation kit; Shanghai Kehua Bio-engineering, Shanghai, China). Exclusion criteria included: history of hepatitis C or D, viral hepatitis, evidence of alcoholic cirrhosis, history of surgery for portal hypertension (splenectomy, shunt or devascularization), suspected liver cancer, hepatic encephalopathy or hepatorenal syndrome, or life-threatening diseases. In accordance with clinical practice guidelines [11-13], endoscopic eradication of varices was performed in cases with a history of bleeding. Other treatment modalities, such as polyene phosphatidylcholine, reduced glutathione and diuretics, were administered as required. Propranolol was prescribed to all patients except for those who could not tolerate, or had contraindications to, beta-blocker use. Because no evidence-based suggestions on antiviral therapy in patients with esophageal varices were available, the benefit and potential harm (such as drug resistance and adverse effects) of antiviral therapy were introduced to the patients. Patients received one of the following antiviral treatments immediately after enrollment: lamivudine (LAM) (100 mg/d, Glaxo Wellcome, United Kingdom), adefovir (ADV) (10 mg/d, Tianjin Pharmaceutical, China), entecavir (ETV) (0.5 mg/d, Bristol-Myers Squibb, United States), telbivudine (LdT) (600 mg/d, Novartis, Switzerland), a combination of LAM and ADV (LAM 100 mg/d + ADV 10 mg/d), or no antiviral therapy according to their wishes. As antiviral therapy may have a greater risk in patients with esophageal varices, it was not prescribed if the patients refused it for reasons such as adverse effects and resistance. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the Ethics Committee of both Hospitals. All patients provided written informed consent prior to enrollment in the study. Efficacy assessment Patients were followed up at a 3-mo interval over 5 years, and levels of HBV DNA, glutamic-pyruvic transaminase (GPT), glutamic-oxaloacetic transaminase (GOT), total bilirubin, serum albumin, prothrombin time, platelet count, diameter of portal vein and splenic area on ultrasound scan were recorded. Endoscopic findings were graded according to the criteria of the Japanese Association of Portal Hypertension [14] as Grade Ⅰ, Ⅱ or Ⅲ, and given a score of 1, 2 or 3, respectively. Bleeding was scored as 4. Patients whose varices were eradicated were scored as 0. Those who showed newly visible, small vessels after endoscopic 6850 October 28, 2013 Volume 19 Issue 40

163 Li CZ et al. Antiviral therapy and EV bleeding Table 1 Demography of the patients (mean ± SD) Non- antiviral (n = 38) Antiviral (n = 79) P value Normal range Gender (male/female) 30/8 62/ Age (yr) 51.8 ± ± Median Child-Pugh score Previous grade of EV (0/1/2/3) 21/0/6/11 41/4/18/ Previous copies of HBVDNA (log10) 4.2 ± ± (-) Previous hepatitis B e antigen (+/-) 24/14 46/ (-) Previous diameter of portal vein (mm) 11.8 ± ± < 10 Previous splenic section area (cm 2 ) 35.3 ± ± < 20 GPT (IU/L) 49.7 ± ± GOT (IU/L) 48.1 ± ± TB (mmol/l) 26.7 ± ± ALB (g/l) 24.7 ± ± PT (s) 14.9 ± ± < 12 PLT (10 12 /L) 83.1 ± ± Endoscopic eradication (yes/no) 17/21 37/ Propranolol (yes/no) 30/8 65/ EV: Esophageal varices; HBV DNA: Hepatitis B virus DNA; GPT: Glutamic-pyruvic transaminase; GOT: Glutamic-oxaloacetic transaminase; TB: Total bilirubin; ALB: Serum albumin; PT: Prothrombin time; PLT: Platelet count. eradication, but did not reach grade Ⅰ were scored as 0.5. Patients without a history of bleeding underwent endoscopic examination every 2 follow-up visits (at a 6-mo interval). Cases with a history of bleeding underwent endoscopic eradication of the varices and follow-up at month 3, and then at a 6-mo interval over the remaining study period. Variceal scores were recorded. The end-point of this observational study was bleeding or time to study conclusion (December 2009) if the patient did not experience any bleeding. The duration from study enrollment to bleeding or to study conclusion was defined as non-bleeding duration. Safety The incidence of adverse events, discontinuations and deaths were documented. Complete blood counts, blood urea nitrogen, creatinine, creatine kinase, lactic acid and electrolytes were also monitored. Statistical analysis The software STATA 10.0 (Stata Corporation, United States) was used in the statistical analysis of data. The bleeding rates (defined as the cumulative proportion of patients who experienced an esophageal variceal bleeding episode during the study) in the antiviral and control groups were compared using the χ 2 test. Multivariate Cox proportional hazard regression was used to identify factors related to esophageal variceal bleeding. Non-bleeding duration of the different groups was determined using the Kaplan-Meier model. Increases in variceal score were compared between groups using the Student s t test. The portal vein diameter and splenic area on ultrasound scan, levels of GPT, GOT, total bilirubin, serum albumin, prothrombin time and platelet counts were also compared using the Student s t test. All tests were two-sided and a P value of < 0.05 was considered statistically significant. RESULTS Patient characteristics A total of 117 patients who fulfilled the study criteria were enrolled from January 2005 to December Of these, 79 patients received antiviral therapy, including ETV (n = 29), ADV (n = 28), LAM (n = 15), LdT (n = 4) and combination treatment with LAM and ADV (n = 3). Patients not receiving antiviral therapy (n = 38) were followed up as a control group, and received the same treatment as the antiviral group minus antiviral therapy. Of the total study population, 63 patients (42 in the antiviral group and 21 in the control group) who had a history of bleeding underwent endoscopic eradication of varices, while the other 54 cases (37 in the antiviral group and 17 in the control group) without a history of esophageal variceal bleeding did not undergo endoscopic eradication treatment. Primary prevention was not performed in this study population. In addition, a total of 95 patients (65 patients in the antiviral group and 30 patients in the control group) received propranolol. Both propranolol and endoscopic eradication patterns were not significantly different between the two groups (P = and P = 0.846, respectively). The antiviral treatment and control groups were well matched with regard to gender, age, hepatic function, grade of EV, HBV DNA level, HBeAg status, portal vein diameter and splenic section area on ultrasound (Table 1). Virological response By week 12 of treatment, HBV DNA decreased to undetectable levels (defined as < 500 copies/ml, by PCR) in 58 (73.4%) of the 79 patients in antiviral treatment group. This was observed in 23 (79.3%) patients in the ETV group, 19 (67.8%) patients in the ADV group, 12 (80.0%) patients in the LAM group, 2 patients in the Ldt group (n = 4) and 2 patients in the LAM/ADV treatment group (n = 3). The number of patients achieving undetectable 6851 October 28, 2013 Volume 19 Issue 40

164 Li CZ et al. Antiviral therapy and EV bleeding Table 2 Laboratory examination results, portal diameter and splenic area in antiviral and non-antiviral groups during the study (mean ± SD) Non-antiviral Antiviral P value (n = 38) (n = 79) GPT (IU/L) 19.2 ± ± 58.8 < GOT (IU/L) 19.9 ± ± TB (mmol/l) 3.9 ± ± ALB (g/l) -2.8 ± ± PT (s) 1.4 ± ± PLT (10 12 /L) ± ± Diameter of portal vein (mm) 1.0 ± ± 0.8 < Splenic section area (cm 2 ) 8.6 ± ± GPT: Glutamic-pyruvic transaminase; GOT: Glutamic-oxaloacetic transaminase; TB: Total bilirubin; ALB: Serum albumin; PT: Prothrombin time; PLT: Platelet count. HBV DNA levels increased to 67 at week 24. At week 48, a total of 71 patients in the antiviral group achieved undetectable HBV DNA levels. None of the patients in the control group (n = 38) achieved undetectable HBV DNA during the study. Reduced deterioration of cirrhosis due to antiviral therapy The portal vein diameter and area of splenic section tended to increase at the conclusion of the study compared to baseline. However, there was a smaller mean increase in the diameter of the portal vein and area of splenic section on ultrasound in the antiviral group compared to the control group (Table 2). Analysis of biochemical profiles (alanine aminotransferase, aspartate aminotransferase, serum albumin, total bilirubin and prothrombin time) showed progressive improvements in liver function in the group receiving antiviral treatment (Table 2). Median Child-Pugh score increased from 8 to 10 in control patients (P = 0.018), and decreased from 8 to 7 in the antiviral group (P = 0.686). Reduced bleeding rate and delayed progression of variceal grade due to antiviral therapy By the end of the study, the bleeding rate was significantly decreased in the antiviral group (n = 79) compared to the control group (n = 38) (29.1% vs 65.8%, P < 0.001). The bleeding rate was also statistically different when all the patients were stratified into the endoscopic eradication group and non-endoscopic intervention group (Table 3). The mean ± SD increase in variceal score was reduced in the antiviral treatment group compared with the control group (Table 3). Multivariate Cox regression analysis was performed to identify the factors associated with increased or decreased esophageal bleeding. The results showed that antiviral therapy (OR = 11.3, 95%CI: ; P < 0.001), endoscopic eradication of varices (OR = 15.8, 95%CI: ; P < 0.001), baseline portal vein diameter (OR = 39.1, 95%CI: ; P = 0.025) and baseline serum HBV DNA level (OR = 0.8, 95%CI: ; P = 0.042) Table 3 Increase in score of varices/year in antiviral and nonantiviral therapy Non-antiviral Antiviral P value All the cases (n = 117) 1.7 ± ± Endoscopic eradication (n = 63) 1.8 ± ± No endoscopic intervention (n = 54) 1.6 ± ± were independent factors related to esophageal bleeding. Virological breakthrough hindered the benefit of antiviral therapy Four cases showed undetectable HBV DNA initially, however, viral load rebound was observed during followup, which was defined as virological breakthrough. All 4 cases bled in contrast to other patients who benefited from antiviral therapy. In the LAM group (n = 15), three cases were found to have virological breakthrough during the study. All 3 cases had no history of bleeding and therefore were not treated with endoscopy. In the first case, virological breakthrough was detected at week 48 ( copies/ ml) and ADV was administered immediately, however, the patient exhibited re-bleeding at week 53 and the HBV DNA level reached copies/ml. In the second case, the patient bled at week 192 and eventually died due to bleeding. Examination revealed HBV DNA at copies/ml. In the third case, the patient bled at week 90 and HBV DNA breakthrough was detected on examination ( copies/ml). The patient was treated with vasoactive drugs, endoscopic eradication of varices and switched to ETV after cessation of bleeding. HBV DNA levels were subsequently undetectable at 12 wk after treatment, and the patient was bleed-free for 48 wk by the end of the study. One patient in the ADV group (without a history of bleeding and endoscopic intervention) experienced bleeding at week 130. HBV DNA was copies/ml at examination. The patient was switched to ETV after cessation of bleeding and was bleed-free for 36 wk by the end of the study. As more cases suffered from virological breakthrough and bleeding, the bleeding rate in the LAM group was not statistically different from that in the control group (8/15 vs 25/38, P = 0.531), while the ETV (5/29) and ADV (8/28) groups showed a lower bleeding rate (P < and P = 0.006, respectively) compared to the control group. ETV was statistically better than LAM (P = 0.019), and no significant differences were found between the other agents. There was one case of bleeding in both the LdT (n = 4) and combination treatment (LAM/ADV) groups (n = 3), and due to the small number of cases, they were not included in the statistical analysis. Kaplan-Meier analyses of non-bleeding duration Kaplan-Meier analyses demonstrated that bleeding was 6852 October 28, 2013 Volume 19 Issue 40

165 Li CZ et al. Antiviral therapy and EV bleeding A Percentage of non-bleeding B Percentage of non-bleeding Kaplan-Meier survival estimates, by antiviral Non-antiviral Antiviral Virological breakthrough Analysis time (mo) Kaplan-Meier survival estimates, by agent ETV LAM ADV Analysis time (mo) Figure 1 Kaplan-Meier analysis of non-bleeding duration. A: Non-bleeding duration in antiviral and control cases was compared using the Kaplan-Meier survival model. Bleeding was defined as a failed event. The occurrence of bleeding was reduced and delayed in the antiviral treatment group compared to the control group. The curve of virological breakthrough cases (dashed line) was close to that of the control group, demonstrating reduced efficacy when virological breakthrough occurred; B: Non-bleeding durations for entecavir (ETV), adefovir (ADV) and lamivudine (LAM) therapy were compared using the Kaplan-Meier survival model. Bleeding was defined as a failed event. The non-bleeding durations for ETV, ADV and LAM were similar in the first 2 years, however, differences became clear following long-term treatment, which may have been due to cumulative resistance and bleeding. postponed in the antiviral treatment group compared to the control group (Figure 1A). However, the curve of virological breakthrough cases was close to that of the control group (Figure 1A). The Kaplan-Meier curves of ETV, ADV and LAM crossed each other within the first 2 years, but deviated beyond the 2-year mark (Figure 1B). Safety One patient died of esophageal variceal bleeding as stated above; no other severe adverse events were reported in the study. Most reported side effects were mild such as fatigue (n = 1), headache (n = 1), dyspepsia (n = 2), nausea (n = 1), dizziness (n = 1) and insomnia (n = 1). Discontinuation of treatment due to adverse events was not observed. Overall survival In this study, follow-up ended if the patient bled. Additional follow-up was included to determine the effect of antiviral therapy on patient survival. The cumulative 1-year survival rate was 97.5% (77/79) and 89.5% (34/38) for the antiviral group and control group, respectively (P = 0.086). The cumulative 2-year survival rate was 93.7% (74/79) and 86.3% (29/38) for the antiviral group and control group, respectively (P = 0.012). However, 8 patients in the control group switched to antiviral therapy. When these 8 patients were excluded, the cumulative 2-year survival rate in the control group was 70.0% (21/30), which was also lower than in the antiviral group (P = 0.002). Most of the patients in the control group switched to antiviral therapy during the additional followup period, and a comparison of the 5-year survival rate of the control group and antiviral group was not available. In addition to the patient who died of drug resistance and bleeding, 17 patients died (9 due to bleeding, 3 due to hepatic encephalopathy, 2 due to chronic liver failure and 3 due to liver cancer) and 17 were lost during the additional follow-up in the antiviral group. The overall 5-year survival rate in the antiviral group was 71.0%, which was higher than in the general cirrhotic patients [1]. DISCUSSION Esophageal variceal bleeding is a life-threatening complication of decompensated cirrhosis, and bleeding from varices is a medical emergency which requires immediate treatment. If bleeding is not controlled quickly, the patient may go into shock or die. Aside from the urgent need to stop the bleeding, treatment is also aimed at the prevention of future bleeding. Treating the underlying cause of variceal bleeding can help prevent recurrence and early treatment of liver disease may prevent the development of varices. Propranolol is accepted as the main treatment modality for the prevention of esophageal variceal bleeding in cirrhotic patients [15,16]. Preventive endoscopic intervention is advocated by some medical experts in high-risk cases. For patients who have experienced bleeding, the accepted modalities for the prevention of re-bleeding include endoscopic eradication of varices (secondary prophylaxis) [11-13], continuous administration of propranolol and regular endoscopic follow-up plus supplementary endoscopic intervention [17-19]. The present study examined the role of antiviral therapy as an additional option for the prevention of esophageal variceal bleeding in hepatitis B patients. Nucleoside analog treatment in decompensated cirrhosis has been widely accepted in recent years [20-22], however, there have been no studies on the efficacy of antiviral treatment in patients with both cirrhosis and esophageal varices. In this study, antiviral therapy delayed progression of EV and decreased bleeding rates in cirrhotic patients with actively replicating HBV. Figure 2 shows the model of varices development. The grade of EV increases with time resulting in bleeding. After endoscopic eradication, the variceal score increases again until bleeding recurs. Antiviral therapy delayed both the progression of varices before and after endoscopic therapy 6853 October 28, 2013 Volume 19 Issue 40

166 Li CZ et al. Antiviral therapy and EV bleeding Score of varices Before endo 1.6/yr Bleeding and endoscopic intervention After endo 1.8/yr Re-bleeding Bleeding and endoscopic intervention Before endo 0.8/yr After endo 1.1/yr Non-antiviral Antiviral Time Re-bleeding Figure 2 Sketch of delayed progression of esophageal varices by antiviral therapy. Varices were scored according to the criteria of the Japanese Association of Portal Hypertension: grade Ⅰ, Ⅱ, and Ⅲ and given a score of 1, 2 and 3, respectively. Bleeding was scored as 4. Endoscopic eradication was scored as 0. The dark line shows the development of esophageal varices in hepatitis B virusrelated cirrhosis without antiviral therapy. The dashed line is the development of varices with antiviral therapy. The grade of esophageal varices increases with time and then bleeding occurs. After endoscopic eradication, the varices score increases again until bleeding recurs. Antiviral therapy delayed both the progression of varices before and after endoscopic therapy and postponed esophageal variceal bleeding. Before endo: Before endoscopic intervention; After endo: After endoscopic intervention. and postponed esophageal variceal bleeding (i.e., effective in both primary and secondary prophylaxis). The delayed progression of EV and decreased bleeding rates in patients receiving antiviral therapy may be explained by relief of portal hypertension. Decreased inflammation due to antiviral therapy might contribute to lower pressure of hepatic sinusoids. In addition, it has been reported that long-term antiviral therapy can lead to histological improvement of cirrhosis, slowing the rate of deterioration [23]. Although biopsy of the liver was not performed in this study, the improvement in liver structure was reflected by the delayed dilation of portal veins, delayed increase in spleen size, the reversion of levels of GPT, GOT, bilirubin, prothrombin time, albumin and delayed decrease in platelets count. These clinical benefits, together with delayed bleeding, are the ultimate aims in clinical practice. Recently, an on-line published study reported that ETV therapy reduced the risks of hepatic events in hepatitis B cirrhosis patients within 5 years [24]. The results of our study are in accordance with the findings of this published study. However, drug-resistance was found to be the main obstacle in the benefit of antiviral therapy for the prevention of EV bleeding. All 3 LAM-resistant cases and 1 ADV-resistant case experienced bleeding. As a result, the efficacy of LAM in the prevention of EV bleeding decreased to a level that was not statistically different from that of the control group in the present study. The Kaplan-Meier curves of ETV, ADV and LAM crossed each other within the first 2 years, but deviated beyond the 2-year mark. It is known that drug resistance increases with time. A plausible explanation for this is that the high incidence of virological breakthrough observed with LAM reduced the efficacy of LAM in the prevention of esophageal bleeding. As studies have reported a lower rate of resistance for ETV [25], this agent may be a better choice in the prevention of esophageal bleeding in cirrhotic patients with active viral hepatitis B replication. The LAM/ADV combination has also been reported to have lower drug resistance rates [26]. However, combination therapy may be more expensive and result in more adverse events, and therefore, may not be well received by patients. One limitation of the present study is that genetic screening for emergence of antiviral resistance was not performed. This is an important issue as current treatment guidelines recommend long-term treatment of patients with cirrhosis. Consequently, it is unknown whether the patients who experienced virological breakthrough also had emergence of genotypic resistance. In this study, the levels of HBV DNA, GOT, GPT and other biochemical parameters were tested in all patients at a 3-mo interval, however, only one case was found to have developed virological break through during routine examination. Although rescue treatment with additional ADV was administered immediately, the patient still experienced esophageal bleeding after a few weeks. In the other three patients who experienced bleeding, virological breakthrough had not been previously detected. As all four cases with virological breakthrough were compliant with the antiviral treatment, the most likely explanation for virological breakthrough is antiviral resistance. Investigations of the underlying gene mutations and switching to a more appropriate treatment regimen as early as possible may be useful in enhancing the effectiveness of antiviral therapy. In conclusion, antiviral therapy with nucleoside analogs may delay progression of varices, decrease the risk of bleeding and improve liver function in patients with HBV-related cirrhosis and EV. However, drug resistance usually leads to bleeding in this special group of patients. Agents with a high rate of virological breakthrough may not be effective in the long-term prevention of esophageal variceal bleeding. The major limitation of the present study is the relatively small sample size of heterogeneous use of antiviral agents. These conclusions should be confirmed in further randomized controlled clinical studies. ACKNOWLEDGMENTS Editorial assistance with preparation of the manuscript was provided by MediTech Media Asia Pacific Ltd (Shanghai, China). COMMENTS Background Antiviral therapy with nucleoside analogs improves the clinical outcome of hepatitis B virus (HBV) infection. However, the emergence of resistance results in liver injury. The consequences may be worse in patients with esophageal varices (EV), in which bleeding and death often occur. Research frontiers Recently, an on-line published study demonstrated that entecavir therapy re October 28, 2013 Volume 19 Issue 40

167 Li CZ et al. Antiviral therapy and EV bleeding duced the risks of hepatic events in hepatitis B cirrhosis patients within 5 years. Koga et al reported an improvement in esophageal varices in patients following lamivudine (LAM) treatment in a retrospective study. However, the study only consisted of 12 patients treated with LAM and 6 controls, and there were no data on bleeding rate and the effect of virological breakthrough. As patients usually experience bleeding when virological breakthrough takes place, it is necessary to separate the patients and evaluate the harm of drug resistance and the benefit of HBV suppression in these patients to provide evidence-based treatment suggestions. Innovations and breakthroughs The present study evaluated the efficacy of antiviral treatment over 5 years in patients with HBV-related cirrhosis and EV, and found that antiviral therapy decreased the risk of bleeding; and agents with a high rate of virological breakthrough were ineffective in preventing bleeding. These findings for the first time provide evidence-based treatment suggestions for this special group of patients. Applications Antiviral therapy with nucleoside analogs may delay progression of varices, decrease the risk of bleeding and improve liver function in patients with HBVrelated cirrhosis and EV. Agents with a high rate of virological breakthrough may not be effective in the long-term prevention of esophageal variceal bleeding. Terminology Nucleoside analogs, are molecules that can inhibit HBV polymerase, and therefore decrease HBV load. They have been widely used in the treatment of hepatitis B. Virological breakthrough indicates that the viral load decreased to an undetectable level initially, and rebounded during follow-up. Virological breakthrough often leads to progressive liver injury and even severe liver failure. Peer review The article provides statistical analysis of data from HBV patients who went through antiviral therapy to determine the role of antiviral therapy in esophageal varices and bleeding in HBV-related cirrhosis. This article provides information important to clinicians and HBV patients in general. REFERENCES 1 Fattovich G, Giustina G, Schalm SW, Hadziyannis S, Sanchez-Tapias J, Almasio P, Christensen E, Krogsgaard K, Degos F, Carneiro de Moura M. Occurrence of hepatocellular carcinoma and decompensation in western European patients with cirrhosis type B. The EUROHEP Study Group on Hepatitis B Virus and Cirrhosis. Hepatology 1995; 21: [PMID: DOI: /hep ] 2 Realdi G, Fattovich G, Hadziyannis S, Schalm SW, Almasio P, Sanchez-Tapias J, Christensen E, Giustina G, Noventa F. Survival and prognostic factors in 366 patients with compensated cirrhosis type B: a multicenter study. The Investigators of the European Concerted Action on Viral Hepatitis (EU- ROHEP). J Hepatol 1994; 21: [PMID: DOI: /S (94) ] 3 Shah V, Long KH. Modeling our way toward the optimal management of variceal hemorrhage. Am J Gastroenterol 2004; 99: [PMID: ] 4 Carbonell N, Pauwels A, Serfaty L, Fourdan O, Lévy VG, Poupon R. Improved survival after variceal bleeding in patients with cirrhosis over the past two decades. Hepatology 2004; 40: [PMID: DOI: /hep.20339] 5 Yao FY, Terrault NA, Freise C, Maslow L, Bass NM. Lamivudine treatment is beneficial in patients with severely decompensated cirrhosis and actively replicating hepatitis B infection awaiting liver transplantation: a comparative study using a matched, untreated cohort. Hepatology 2001; 34: [PMID: DOI: /jhep ] 6 Hann HW, Fontana RJ, Wright T, Everson G, Baker A, Schiff ER, Riely C, Anschuetz G, Gardner SD, Brown N, Griffiths D. A United States compassionate use study of lamivudine treatment in nontransplantation candidates with decompensated hepatitis B virus-related cirrhosis. Liver Transpl 2003; 9: [PMID: DOI: /jlts ] 7 Wright TL. Clinical trial results and treatment resistance with lamivudine in hepatitis B. Semin Liver Dis 2004; 24 Suppl 1: [PMID: DOI: /s ] 8 Hadziyannis SJ, Tassopoulos NC, Heathcote EJ, Chang TT, Kitis G, Rizzetto M, Marcellin P, Lim SG, Goodman Z, Ma J, Brosgart CL, Borroto-Esoda K, Arterburn S, Chuck SL. Longterm therapy with adefovir dipivoxil for HBeAg-negative chronic hepatitis B for up to 5 years. Gastroenterology 2006; 131: [PMID: DOI: /j.gastro ] 9 Peters MG, Singer G, Howard T, Jacobsmeyer S, Xiong X, Gibbs CS, Lamy P, Murray A. Fulminant hepatic failure resulting from lamivudine-resistant hepatitis B virus in a renal transplant recipient: durable response after orthotopic liver transplantation on adefovir dipivoxil and hepatitis B immune globulin. Transplantation 1999; 68: [PMID: DOI: / ] 10 Koga H, Ide T, Oho K, Kuwahara R, Hino T, Ogata K, Hisamochi A, Tanaka K, Kumashiro R, Toyonaga A, Sata M. Lamivudine treatment-related morphological changes of esophageal varices in patients with liver cirrhosis. Hepatol Res 2007; 37: [PMID: DOI: /j X x] 11 Qureshi W, Adler DG, Davila R, Egan J, Hirota W, Leighton J, Rajan E, Zuckerman MJ, Fanelli R, Wheeler-Harbaugh J, Baron TH, Faigel DO. ASGE Guideline: the role of endoscopy in the management of variceal hemorrhage, updated July Gastrointest Endosc 2005; 62: [PMID: DOI: /j.gie ] 12 Garcia-Tsao G, Sanyal AJ, Grace ND, Carey W. Prevention and management of gastroesophageal varices and variceal hemorrhage in cirrhosis. Hepatology 2007; 46: [PMID: DOI: /hep.21907] 13 de Franchis R. Evolving consensus in portal hypertension. Report of the Baveno IV consensus workshop on methodology of diagnosis and therapy in portal hypertension. J Hepatol 2005; 43: [PMID: DOI: / j.jhep ] 14 Japanese Association of Portal Hypertension. Criteria for record of endoscopic findings of esophagogastric varices. Kanzo 1980; 21: Turnes J, Garcia-Pagan JC, Abraldes JG, Hernandez-Guerra M, Dell Era A, Bosch J. Pharmacological reduction of portal pressure and long-term risk of first variceal bleeding in patients with cirrhosis. Am J Gastroenterol 2006; 101: [PMID: DOI: /j x] 16 Groszmann RJ, Garcia-Tsao G, Bosch J, Grace ND, Burroughs AK, Planas R, Escorsell A, Garcia-Pagan JC, Patch D, Matloff DS, Gao H, Makuch R. Beta-blockers to prevent gastroesophageal varices in patients with cirrhosis. N Engl J Med 2005; 353: [PMID: DOI: / NEJMoa044456] 17 Woods KL, Qureshi WA. Long-term endoscopic management of variceal bleeding. Gastrointest Endosc Clin N Am 1999; 9: [PMID: ] 18 Krige JE, Kotze UK, Bornman PC, Shaw JM, Klipin M. Variceal recurrence, rebleeding, and survival after endoscopic injection sclerotherapy in 287 alcoholic cirrhotic patients with bleeding esophageal varices. Ann Surg 2006; 244: [PMID: DOI: /01.sla e] 19 Li CZ, Cheng LF, Wang ZQ, Gu Y. Attempt of photodynamic therapy on esophageal varices. Lasers Med Sci 2009; 24: [PMID: DOI: /s ] 20 Lok AS, McMahon BJ. Chronic hepatitis B: update Hepatology 2009; 50: [PMID: DOI: / hep.23190] 21 European Association For The Study Of The Liver. EASL clinical practice guidelines: Management of chronic hepatitis B virus infection. J Hepatol 2012; 57: [PMID: DOI: /j.jhep ] 22 Liaw YF, Leung N, Kao JH, Piratvisuth T, Gane E, Han KH, Guan R, Lau GK, Locarnini S. Asian-Pacific consensus 6855 October 28, 2013 Volume 19 Issue 40

168 Li CZ et al. Antiviral therapy and EV bleeding statement on the management of chronic hepatitis B: a 2008 update. Hepatol Int 2008; 2: [PMID: DOI: /s ] 23 Chang TT, Liaw YF, Wu SS, Schiff E, Han KH, Lai CL, Safadi R, Lee SS, Halota W, Goodman Z, Chi YC, Zhang H, Hindes R, Iloeje U, Beebe S, Kreter B. Long-term entecavir therapy results in the reversal of fibrosis/cirrhosis and continued histological improvement in patients with chronic hepatitis B. Hepatology 2010; 52: [PMID: DOI: /hep.23785] 24 Wong GL, Chan HL, Mak CH, Lee SK, Ip ZM, Lam AT, Iu HW, Leung JM, Lai JW, Lo AO, Chan HY, Wong VW. Entecavir treatment reduces hepatic events and deaths in chronic hepatitis B patients with liver cirrhosis. Hepatology 2013 [Epub ahead of print] [PMID: DOI: /hep.26301] 25 Tenney DJ, Rose RE, Baldick CJ, Pokornowski KA, Eggers BJ, Fang J, Wichroski MJ, Xu D, Yang J, Wilber RB, Colonno RJ. Long-term monitoring shows hepatitis B virus resistance to entecavir in nucleoside-naïve patients is rare through 5 years of therapy. Hepatology 2009; 49: [PMID: DOI: /hep.22841] 26 Yun TJ, Jung JY, Kim CH, Um SH, An H, Seo YS, Kim JD, Yim HJ, Keum B, Kim YS, Jeen YT, Lee HS, Chun HJ, Kim CD, Ryu HS. Treatment strategies using adefovir dipivoxil for individuals with lamivudine-resistant chronic hepatitis B. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] P- Reviewers Husa P, Liu ZW, Mir MA, Wong GLH S- Editor Zhai HH L- Editor A E- Editor Wang CH 6856 October 28, 2013 Volume 19 Issue 40

169 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. Trans-umbilical endoscopic cholecystectomy with a water-jet hybrid-knife: A pilot animal study BRIEF ARTICLE Sheng-Jun Jiang, Hong Shi, Gyanendra Swar, Hai-Xia Wang, Xiao-Jing Liu, Yong-Guang Wang Sheng-Jun Jiang, Gyanendra Swar, Hai-Xia Wang, Xiao-Jing Liu, Yong-Guang Wang, Department of Minimally Invasive Surgery, Beijing Chuiyangliu Hospital, Beijing , China Hong Shi, Department of Gastrointestinal Endoscopy, Fujian Provincial Tumor Hospital, Teaching Hospital of Fujian Medical University, Fuzhou , Fujian Province, China Yong-Guang Wang, Institute of Minimally Invasive Medicine, Tongji University, Beijing , China Author contributions: Shi H, Jiang SJ and Wang YG proposed the study; Jiang SJ and Shi H wrote the first draft; all the authors contributed to the design and interpretation of the study and to final manuscript; Jiang SJ is the guarantor. Correspondence to: Yong-Guang Wang, MD, PhD, Institute of Minimally Invasive Medicine, Tongji University, No.2, Chuiyangliu South Street, Chaoyang District, Beijing , China. endowang@vip.sina.com Telephone: Fax: Received: May 1, 2013 Revised: August 29, 2013 Accepted: September 3, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the feasibility and safety of Natural orifice trans-umbilical endoscopic cholecystectomy with a water-jet hybrid-knife in a non-survival porcine model. METHODS: Pure natural orifice transluminal endoscopic surgery (NOTES) cholecystectomy was performed on three non-survival pigs, by transumbilical approach, using a water-jet hybrid-knife. Under general anesthesia, the following steps detailed the procedure: (1) incision of the umbilicus followed by the passage of a double-channel flexible endsocope through an overtube into the peritoneal cavity; (2) establishment of pneumoperitoneum; (3) abdominal exploration; (4) endoscopic cholecystectomy: dissection of the gallbladder performed using water jet equipment, ligation of the cystic artery and duct conducted using nylon loops; and (5) necropsy with macroscopic evaluation. RESULTS: Transumbilical endoscopic cholecystectomy was successfully completed in the first and third pig, with minor bleedings. The dissection times were 137 and 42 min, respectively. The total operation times were 167 and 69 min, respectively. And the lengths of resected specimen were 6.5 and 6.1 cm, respectively. Instillation of the fluid into the gallbladder bed produced edematous, distended tissue making separation safe and easy. Reliable ligation using double nylon loops insured the safety of cutting between the loops. There were no intraoperative complications or hemodynamic instability. Uncontrolled introperative bleeding occurred in the second case, leading to the operation failure. CONCLUSION: Pure NOTES trans-umbilical cholecystectomy with a water-jet hybrid-knife appears to be feasible and safe. Further investigation of this technique with long-term follow-up in animals is needed to confirm the preliminary observation Baishideng. All rights reserved. Key words: Natural orifice transluminal endoscopic surgery; Cholecystectomy; Water-jet; Hybrid-knife; Triangulation Core tip: Flexibile single-incision surgery (FSIS), one of recent advances in endoscopic surgery, is a promising single-incision approach, which has exploited the advantages of single-incision laparoscopy and narrow sense of natural orifice transluminal endoscopic surgery (NOTES). Compared to NOTES, FSIS uses the navel to facilitate the extraction of the specimen and the umbilical closure is quick and easy. Compared to SILS, FSIS does not need any specialized device for the entry ports. Furthermore, water-jet hybrid knife technology enables a quick switch between blunt and sharp dissection. This study assessed the feasibility and safety of endoscopic cholecystectomy using transumbilical approach and water jet hybrid knife technology October 28, 2013 Volume 19 Issue 40

170 Jiang SJ et al. Water-jet on pure NOTES cholecystectomy Jiang SJ, Shi H, Swar G, Wang HX, Liu XJ, Wang YG. Transumbilical endoscopic cholecystectomy with a water-jet hybridknife: A pilot animal study. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6857.htm DOI: org/ /wjg.v19.i INTRODUCTION Laparoscopic cholecystectomy (LC) [1] remains the gold standard for the treatment of benign gallbladder diseases, showing superiority such as better cosmetic results, less postoperative pain, and shorter recovery time compared with open cholecystectomy. Under the guidance of the Holy Grail of minimal invasive surgery, namely, scarless surgery, natural orifice transluminal endoscopic surgery (NOTES) has made substaintial progress. However, it is also technically difficult due to lack of appropriate devices and loss of triangulation. To achieve both minimal invasiveness and effectiveness, we proposed the following technique for pure NOTES cholecystectomy, by transumbilical approach, using an endoscopic water jet system applied to perform blunt and sharp dissection without accessory switch. MATERIALS AND METHODS Animals Natural Orifice Trans-umbilical Cholecystectomy with a new water-jet dissector Erbejet 2 was performed on three non-survival TiBet experimental pigs (two were female weighing 30 kg, the other was male weighing 35 kg). Experimental site Experimental site: Olympus training center for animal experimental study in Peking, China. Animal preparation and post-operative management Animal preparation and post-operative management: fasting 48 h pre-operation and took polyethylene glycol 4 g/kg orally for intestinal preparation before procedure. Preoperative intramuscular ketamine 20 mg/kg and Xylazine 2 mg/kg mixture induced anesthesia, retaining animal on the operating table in a supine position and performing endotracheal intubation, connecting anaesthesia apparatus following inhalational anesthesia by 4%-5% isoflurane. When the animals entered into complete general anesthesia condition, regulating gas concentration to 1%-2% for anesthesia maintenance and intraoperative intravenous management with 5% glucose-saline. After the operation ended, intravenous pentobarbital sodium 100 mg/kg was injected to the porcine, along with the autopsy to observe the wound and adjacent organs for any damages. Instruments and devices Instruments and devices: forward-looking double channel gastroscope(gif-2tq260m, olympus), non-invasive forceps (FQ-46L-1, olympus), thermal hemostatic forceps (endoscopic hemostatic forceps FD-410LR, olympus), nylon cord snare (MAJ-340, olympus) and ligation device (HX-20L-1, olympus), overtube (overtubemd48618, Sumitomo Bakelite, Tokyo Japan), Trocar, co2 air pump, digestive endoscopic surgery workstation (ERBE VIO- 300D, Germany), T-type Erbejet2 (ERBEjet2; ERBE Elektromedizin, Germany), endoscopic clips and trip gear (endoclips, HX OLYMPUS, olympus), methylene blue, normal saline. Experimental procedure Establishment of pneumoperitoneum: Porcines were placed under supine position, routine preoperative skin disinfection, spread towel, making a 1.5 cm longitudinal incision through the umbilicus, puncturing into abdominal cavity with trocar then overtube was inserted. Surrounding skin was clamped by using towel clamp in order to avoid air leakage, so endoscope can be inserted into peritoneal cavity through overtube, (being unable to gear co2 air pump directly), the latter is connected to endoscopic air supply device to maintain pneumoperitoneum which can be adjusted by endoscopic inspiration button. Abdominal exploration: After the establishment of pneumoperitoneum, exploration of intra-abdominal visceras from epigastrium to hypogastrium was done. Stomach, diaphragm, gallbladder, spleen, small intestine and large intestine can be viewed meanwhile retroperitoneal organs kidney, pancreas for instance cannot be explored. A swollen light blue gallbladder can be seen from endoscope due to abrosia. Sometimes gallbladder is covered by the lobes of liver that requires removing the lobes of liver to reveal cholecyst by operating endoscope. Cholecystectomy: The assistant manipulated overtube to advance the endoscope to the surgery field and to reveal cholecyst and liver bed. High-pressure injection of methylene blue solution dyed normal saline by using T-type ERBEjet2 through endoscopic work channel into fibrous tissue between gallbladder and liver bed. The water-injection pressure was set to bar. Blue cushion formation taking place following the local injection (Figure 1A), demarcates the liver parenchyma. Then the dissection of fibrous tissue was done between gallbladder s serous membrane and liver parenchyma by T-type ERBEjet2 (coagulation-cut hybrid model, power 45w, effect 2) starting from fundus or neck of gallbladder from left to right side. Every separation was done following the cushion formation and was operated in the raised or lift cushion. Once catching the sight of small blood vessels or encountering haemorrhage, prophylactic hemostasis with electrotome or hemostatic forceps would be required. The gallbladder would fall off liver bed while dissected carefully up to the neck or fundus of gallbladder (Figure 1B). Dissected clearly and completely to reveal calot s triangle and cystic duct, cystic artery, hepatic duct and common bile duct has been identified. Ligationof 6858 October 28, 2013 Volume 19 Issue 40

171 Jiang SJ et al. Water-jet on pure NOTES cholecystectomy A B C D E F Figure 1 Picture demonstrating a concept of a novel method of cholecystectomy. A: Methylene blue mixed with normal saline solution injected into fibrous tissues between gallbladder and liver bed; B: The gallbladder falling off liver bed; C: Cystic duct and artery cut using the water-jet hybrid-knife between loops; D: The resected gallbladder grasped by forceps; E: Macroscopic view of the liver fossa on necropsy; F: Clipped gallbladder perforation. cystic duct and cystic artery with nylon cord snare instead of endoclips for fast ligation. During the procedure, noninvasive forceps and ligation device were introduced into abdominal cavity through endoscopic double channels respectively. Cholecyst was clamped and empocketed into nylon cord snare and then ligature of the cystic duct and cystic artery together was done on the distal end of cystic duct, three snares placed in all; the proximal and distal end of cystic duct and then cut in the middle of snares (Figure 1C). Confirmed no active haemorrhage and no biliary fistula. Consequently, cholecyst retracted through overtube applying forceps or basket (Figure1D). Ultimately, autopsy was performed to check the dissection wound and adjacent visceras for injury. RESULTS Transumbilical endoscopic cholecystectomy was successfully completed in the first and third pig, with minor bleedings (Tables 1, 2). The dissection times were 137 and 42 min, respectively. The total operation times were 167 and 69 min, respectively. The time required decreased with experience. And the lengths of resected specimen were 6.5 and 6.1 cm, respectively. Instillation of the fluid into the gallbladder bed produced edematous, distended tissue making separation safe and easy. Reliable ligation using double nylon loops insured the safety of cutting between the loops. There were no intraoperative complications or hemodynamic instability. At necropsy, the loops on the cystic duct and artery were secure and that neither bile nor blood leakage was observed from this site. Both the gallbladder bed and the liver bed were dry (Figure 1E). During the dissection in the second pig (Tables 1 and 2), unexpected gallbladder rupture occurred, and the perforation site was quickly clipped (Figure 1) after being identified. Subsequently, uncontrolled introperative bleeding occurred in the second case, leading to the operation failure. DISCUSSION To date, most of pure NOTES procedures are still performed only in animals [2-4] due to several technical barriers. NOTES cholecystectomy has been successfully introduced into clinical application based on preliminary animal experimental researches. Several approaches has been reported in the literatures such as transgastric. transvaginal and transcolonic route, but most finished cholecystectomy with the assistance of laparoscopic instruments in humans [5-7]. Meanwhile, pure NOTES only has several case reports [8-10]. Transvaginal approach is the most widely used in the clinical practices and is considered [5] to be the best approach for NOTES surgery. However, it only apply to females with underlying complications like dyspareunia infertility and pelvic adhesions [11,12]. Pugliese et al [5] showed no above-mentioned discomfort and incision related complications. Transgastric approach was originally studied [13,14], but rarely applied to clinical practices because of technical difficulties [13,15,16], to overcome these difficulties, the innovation of new technology and use of new devices has been reported in several literatures [9]. Furthermore, Marescaux et al [16] considered this approach for NOTES surgery would be 6859 October 28, 2013 Volume 19 Issue 40

172 Jiang SJ et al. Water-jet on pure NOTES cholecystectomy Table 1 Transumbilical endoscopic cholecystectomy was successfully completed in the first and third pig, with minor bleedings Animal Sex Weight (kg) Time of pneumoperitoneum (min) Time of dissection (min) Time of ligation and resection (min) Total time (min) 1 Female Male (incomplete) Female Table 2 Experimental indicators in transumbilical endoscopic cholecystectomy Animal Blood loss (ml) Perforation Adjacent viscera injury Size of specimen Postoperative management 1 10 No No 6.5 cm 3.4 cm 1.2 cm Autopsy 2 50 Yes Vascular injury - Autopsy 3 5 No No 6.1 cm 3.3 cm 1.8 cm Autopsy the major route in future. Transcolonic NOTES similar to transvaginal approach has an advantage for upper abdominal organs, however, its major problem lies in potential contamination as a result of bacterial colonization. In this study, we performed cholecystectomy through umbilicus similar to single-port laparoscopic surgery. Truely speaking, to some extent it does not follow the true concept of NOTES. This approach compared to other approaches has no blind region in enterocoelia, in the other hand, it cannot support stable platform due to soft abdominal wall resulting in difficulties in manipulating endoscope [17]. Perforation occurred in our study owing to unstable platform. Therefore, experienced surgeon and endoscopist would be needed to cooperate with each other to complete cholecystectomy by using endoscope via umbilical approach. Any surgery require an appropriate and clear operative field vision achieved by manipulating overtube. We realized in practice that overtube was easy to displace because of its smoothness and flexibility which results in the lost operative field and had to re-reveal the gallbladder. So operator and assistant must keep tacit cooperation, the latter also plays a very important role who needs to regulate overtube from time to time in accordance with the procedure to support clear vision for operator which is significant in reducing operation time, avoiding accidental injury involving visceras, blood vessels and smoothly completing surgery. In a sentence, not a single perfect approach for the NOTES has been established till now. The development of endoscopic instruments and the evolution of technology have to be explored. Whether pure NOTES achieves full approval and advocation from clinical practice depends on how the related challenges can be resolved practically. The mechanism of water-jet is to employ highpressure jet of water to cut materials fine, primarily used in manufacture. In 1982, water-jet was firstly introduced to medical application and performed liver resection [18,19]. German RAU firstly introduced professional designed water-jet into clinical application in From then on, its applications gradually extended to maxillofacial surgery, plastic surgery, urinary surgery, ophthalmosurgery, etc [20]. To date, its use is limited to the dissection of mesenchymal tissue and parenchymal organs [21,22]. In this field, German company ERBE is always ahead. Its Helix-Hydro-jet device can perform precise, controllable tissue-selective (indicating water-rich tissue such as liver parenchyma) with minimal injury to the surrounding fibrous structures and has achieved favorable results in open and laparoscopic operations [18,23,24]. However, the above-mentioned Helix-Hydro-jet device cannot be passed through a standard working channel of the current flexible endoscope because its outer-diameter is larger than endoscopic operative channel, so do not match with NOTES procedures. ERBEJet2 water-jet system incorporates high-pressure water-jet with highfrequency electrocautery function with the characteristics of more flexibility, smaller size, easier handling, more precision and less foam formation compared with the precursor model Helix-Hydro-jet [25]. This new technology is mainly used to perform endoscopic submucosal dissection for gastrointestinal tumors. Studies showed that water-jet hybrid-knife could effectively shorten operation time and avoid endoscopic accessory-switch with lower haemorrhage and perforation rate, consequently improve the safety and efficiency of resection compared with conventional endoscopic knife [26-30]. Isayama et al [29] reported that transgastric pure NOTES successfully performed cholecystectomy using injection-dissection technology in the animal experiment with long operation time because the procedure of injection and dissection required the need of different instruments and keeps on frequently changing. The work pressure of water-jet ranges from 30 to 80 bar. If lower than 30 bar, it cannot produce valid cushion, acting on mucous layer when more than 70 bar. While exceeding 100 bar may cause injury to deeper layer such as muscular layer [24,31]. Selective-tissue injection results in a selective deposition of mixed solution in the submucosa followed by mucosal elevation when the dissector placed directly on the mucous layer. High-pressure injection of solution into loose connective tissue between gallbladder and liver bed can produce a fluid lift cushion avoid the thermal damage to surrounding tissues, making dissection easier and safer [29]. In our study, neither uncontrolled hemorrhage of the liver fossa nor perforation of the gallbladder occurred, indicating the superiority of the ER- BEjet2 water-jet system. What is worth mentioning, the lack of surgical triangulation, an important adjunct for 6860 October 28, 2013 Volume 19 Issue 40

173 Jiang SJ et al. Water-jet on pure NOTES cholecystectomy pure NOTES procedure, becomes less important, since the fluid lift cushion produced by the ERBEjet2 water-jet system facilitates dissection even there is no satisfactory traction or countertraction. Refer to the selection of injecting Solution, perfect solution should have following advantages of being nontoxic to health, no injury to the injection site, low dispersion velocity, easy to access and cheap. Currently, normal saline solution is the most commonly employed with the drawback of being fast absorption, other selective solutions include hyaluronic acid, plasma expanders, gelatin, etc. Among them, hyaluronic acid is considered to be the best selection but most expensive [21,31,32]. Adding optimal adrenaline can delay solution absorption speed, prolong elevation time and decrease injection times. In our study, injection solution we used was saline solution that is easy to get and cheap. Furthermore, we had added methylene blue dye into saline solution in order to make the solution blue. Furthermore, it had helped clearing the boundaries between gallbladder s serosal layer and liver parenchyma by using high pressure injection with more precise and safe dissection along with maintaining prophylactic hemostasis. This can be seen from blood loss during the operation in our study. In the functional cholecystectomy performed by Liu et al [33], the cystic duct was isolated and closed with an endoscopic clip. Since standard endoscopic clip may not be safe for use on the cystic duct as it has a hinge gap between the arms of the clip when deployed, in our study, the Olympus ligating device (Polyloop-detachable loop ligating device) was used to tie off the base of the gallbladder once exposed and isolated, and then the gallbladder was cut between the loops using the endoscopic polypectomy snare. Calot s triangle complete exposure is very important for both the ligation of cystic duct, cystic artery and the avoidance of damage to biliary duct. Although doublechannel endoscope has elevator, parallel correlation of double-channel cannot produce surgical triangulation resulting in limited orientation to manipulate. It is still difficult to ligate the cystic duct and cystic artery for pure NOTES that need more attention during the operation. The exposure of CVS (critical view of safety) can decrease the possibility of bile duct injury before ligating the cyst duct and artery [6]. We successfully performed pure NOTES cholecystectomy without laparoscopic support. In conclusion, this study demonstrated the feasibility and safety of trans-umbilical NOTES cholecystectomy using the water-jet hybrid-knife. Due to absence of control study, the advantages of ERBEjet2 cannot be highlighted but possesses potential superiority. Therefore, further study will be designed to compare this new dissector with other endoscopic knife. COMMENTS Background Laparoscopic cholecystectomy remains the gold standard for the treatment of benign gallbladder diseases, showing superiority such as better cosmetic results, less postoperative pain, and shorter recovery time compared with open cholecystectomy. Under the guidance of the Holy Grail of minimal invasive surgery, namely, scarless surgery, natural orifice transluminal endoscopic surgery (NOTES) has made substaintial progress. However, it is also technically difficult due to lack of appropriate devices and loss of triangulation. Research frontiers To achieve a nonvisible scar, transumbilical endoscopic/laparoscopic cholecystectomy, single-incision laparoscopic surgery were proposed early or late. Innovations and breakthroughs This is the first study evaluating feasibility and safety of a new method of cholecystectomy using NOTES transumbilical approach and water jet hybrid knife technology. The study demonstrated that the endoscopic water jet system can create a fine stream of unidirectional high-pressure saline solution to penetrate tissue, and instillation of the fluid into the gallbladder bed can produce edematous, distended tissue making separation safe and easy. Applications Generally, transumbilical endoscopic cholecystectomy using a water-jet hybridknife is feasible and safe. How to avoid the injury of the cystic artery requires further investigation. Terminology Hydraulic energy from pressurized fluid has been widely used in medical procedures. Instillation of fluid under high pressure into closed spaces can produce edematous, distended tissue, and the resulting increased weight and gravity force is enough to separate filmy avascular tissue without sharp dissection (electrosurgery). Peer review This is a very interesting study about the feasibility and safety of Natural orifice trans-umbilical endoscopic cholecystectomy with a water-jet hybrid-knife in a non-survival porcine model. In this study, pure NOTES cholecystectomy was performed on three non-survival pigs, by transumbilical approach, with a double-channel flexible endsocope, and a water-jet hybrid-knife. The authors found that pure NOTES trans-umbilical cholecystectomy with a water-jet hybridknife appear to be feasible and safe. REFERENCES 1 Hu H, Xu AA, Huang A. Towards scarless surgery: a novel laparoscopic cholecystectomy by using 2-mm needle-shape instruments without trocar. J Laparoendosc Adv Surg Tech A 2013; 23: [PMID: ] 2 Linke GR, Tarantino I, Hoetzel R, Warschkow R, Lange J, Lachat R, Zerz A. Transvaginal rigid-hybrid NOTES cholecystectomy: evaluation in routine clinical practice. Endoscopy 2010; 42: [PMID: DOI: /s ] 3 Kantsevoy SV, Jagannath SB, Niiyama H, Isakovich NV, Chung SS, Cotton PB, Gostout CJ, Hawes RH, Pasricha PJ, Kalloo AN. A novel safe approach to the peritoneal cavity for per-oral transgastric endoscopic procedures. Gastrointest Endosc 2007; 65: [PMID: DOI: / j.gie ] 4 Park PO, Bergström M, Ikeda K, Fritscher-Ravens A, Swain P. Experimental studies of transgastric gallbladder surgery: cholecystectomy and cholecystogastric anastomosis (videos). Gastrointest Endosc 2005; 61: [PMID: DOI: /S (04) ] 5 Pugliese R, Forgione A, Sansonna F, Ferrari GC, Di Lernia S, Magistro C. Hybrid NOTES transvaginal cholecystectomy: operative and long-term results after 18 cases. Langenbecks Arch Surg 2010; 395: [PMID: DOI: / s ] 6 Auyang ED, Hungness ES, Vaziri K, Martin JA, Soper NJ. Human NOTES cholecystectomy: transgastric hybrid technique. J Gastrointest Surg 2009; 13: [PMID: DOI: /s y] 7 Zorron R, Maggioni LC, Pombo L, Oliveira AL, Carvalho GL, Filgueiras M. NOTES transvaginal cholecystectomy: preliminary clinical application. Surg Endosc 2008; 22: [PMID: DOI: /s ] 6861 October 28, 2013 Volume 19 Issue 40

174 Jiang SJ et al. Water-jet on pure NOTES cholecystectomy 8 Bessler M, Gumbs AA, Milone L, Evanko JC, Stevens P, Fowler D. Video. Pure natural orifice transluminal endoscopic surgery (NOTES) cholecystectomy. Surg Endosc 2010; 24: [PMID: DOI: /s ] 9 de Sousa LH, de Sousa JA, de Sousa Filho LH, de Sousa MM, de Sousa VM, de Sousa AP, Zorron R. Totally NOTES (T-NOTES) transvaginal cholecystectomy using two endoscopes: preliminary report. Surg Endosc 2009; 23: [PMID: DOI: /s z] 10 Abramov Y, Gandhi S, Botros SM, Goldberg RP, Sherman W, Rurak M, Sand PK. Do alterations in vaginal dimensions after reconstructive pelvic surgeries affect the risk for dyspareunia? Am J Obstet Gynecol 2005; 192: [PMID: DOI: /j.ajog ] 11 Helström L, Nilsson B. Impact of vaginal surgery on sexuality and quality of life in women with urinary incontinence or genital descensus. Acta Obstet Gynecol Scand 2005; 84: [PMID: ] 12 Kalloo AN, Singh VK, Jagannath SB, Niiyama H, Hill SL, Vaughn CA, Magee CA, Kantsevoy SV. Flexible transgastric peritoneoscopy: a novel approach to diagnostic and therapeutic interventions in the peritoneal cavity. Gastrointest Endosc 2004; 60: [PMID: DOI: / S (04) ] 13 Abe N, Takeuchi H, Ueki H, Matsuoka H, Yanagida O, Masaki T, Mori T, Sugiyama M, Atomi Y. Cholecystectomy by a combined transgastric and transparietal approach using two flexible endoscopes. J Hepatobiliary Pancreat Surg 2009; 16: [PMID: DOI: /s ] 14 Astudillo JA, Sporn E, Bachman S, Miedema B, Thaler K. Transgastric cholecystectomy using a prototype endoscope with 2 deflecting working channels (with video). Gastrointest Endosc 2009; 69: [PMID: DOI: / j.gie ] 15 Sumiyama K, Gostout CJ, Rajan E, Bakken TA, Knipschield MA, Chung S, Cotton PB, Hawes RH, Kalloo AN, Kantsevoy SV, Pasricha PJ. Transgastric cholecystectomy: transgastric accessibility to the gallbladder improved with the SEMF method and a novel multibending therapeutic endoscope. Gastrointest Endosc 2007; 65: [PMID: DOI: /j.gie ] 16 Marescaux J, Dallemagne B, Perretta S, Wattiez A, Mutter D, Coumaros D. Surgery without scars: report of transluminal cholecystectomy in a human being. Arch Surg 2007; 142: ; discussion [PMID: DOI: / archsurg ] 17 Shi H, Jiang SJ, Li B, Fu DK, Xin P, Wang YG. Natural orifice transluminal endoscopic wedge hepatic resection with a water-jet hybrid knife in a non-survival porcine model. World J Gastroenterol 2011; 17: [PMID: DOI: /wjg.v17.i7.926] 18 Papachristou DN, Barters R. Resection of the liver with a water jet. Br J Surg 1982; 69: [PMID: DOI: / bjs ] 19 Zheng W, Zhang XZ. Application and Realization of Medical Water-jet. Yiliao Weisheng Zhuangbei 2011; 32: Lesser T. [Atypical lung parenchyma resection with the Hydro-Jet--initial experimental and clinical experiences]. Chirurg 2000; 71: 592 [PMID: ] 21 Sold MG, Grobholz R, Post S, Enderle MD, Kaehler GF. Submucosal cushioning with water jet before endoscopic mucosal resection: Which fluids are effective? Surg Endosc 2008; 22: [PMID: DOI: /s ] 22 Kaehler GF, Sold MG, Fischer K, Post S, Enderle M. Selective fluid cushion in the submucosal layer by water jet: advantage for endoscopic mucosal resection. Eur Surg Res 2007; 39: [PMID: DOI: / ] 23 Tschan CA, Tschan K, Krauss JK, Oertel J. First experimental results with a new waterjet dissector: Erbejet 2. Acta Neurochir (Wien) 2009; 151: [PMID: DOI: / s ] 24 Kähler GF, Sold MS, Post S, Fischer K, Enderle MD. Selective tissue elevation by pressure injection (STEP) facilitates endoscopic mucosal resection (EMR). Surg Technol Int 2007; 16: [PMID: ] 25 Schumacher B, Neuhaus H, Enderle MD. Experimental use of a new device for mucosectomy. Acta Endoscopica 2007; 37: [DOI: /BF ] 26 Takeuchi Y, Uedo N, Ishihara R, Iishi H, Kizu T, Inoue T, Chatani R, Hanaoka N, Taniguchi T, Kawada N, Higashino K, Shimokawa T, Tatsuta M. Efficacy of an endo-knife with a water-jet function (Flushknife) for endoscopic submucosal dissection of superficial colorectal neoplasms. Am J Gastroenterol 2010; 105: [PMID: DOI: / ajg ] 27 Yahagi N, Neuhaus H, Schumacher B, Neugebauer A, Kaehler GF, Schenk M, Fischer K, Fujishiro M, Enderle MD. Comparison of standard endoscopic submucosal dissection (ESD) versus an optimized ESD technique for the colon: an animal study. Endoscopy 2009; 41: [PMID: DOI: /s ] 28 Neuhaus H, Wirths K, Schenk M, Enderle MD, Schumacher B. Randomized controlled study of EMR versus endoscopic submucosal dissection with a water-jet hybrid-knife of esophageal lesions in a porcine model. Gastrointest Endosc 2009; 70: [PMID: DOI: /j.gie ] 29 Isayama H, Kogure H, Koike K. Endoscopic transgastric pure NOTES cholecystectomy with naso-gallbladder drainage tube placement and injection of a hyaluronic acid mixture (with Video). J Hepatobiliary Pancreat Sci 2011; 18: [PMID: DOI: /s z] 30 Lingenfelder T, Fischer K, Sold MG, Post S, Enderle MD, Kaehler GF. Combination of water-jet dissection and needleknife as a hybrid knife simplifies endoscopic submucosal dissection. Surg Endosc 2009; 23: [PMID: DOI: /s ] 31 Fujishiro M, Yahagi N, Kashimura K, Mizushima Y, Oka M, Enomoto S, Kakushima N, Kobayashi K, Hashimoto T, Iguchi M, Shimizu Y, Ichinose M, Omata M. Comparison of various submucosal injection solutions for maintaining mucosal elevation during endoscopic mucosal resection. Endoscopy 2004; 36: [PMID: DOI: /s ] 32 Hyun JJ, Chun HR, Chun HJ, Jeen YT, Baeck CW, Yu SK, Kim YS, Lee HS, Um SH, Lee SW, Choi JH, Kim CD, Ryu HS, Hyun JH. Comparison of the characteristics of submucosal injection solutions used in endoscopic mucosal resection. Scand J Gastroenterol 2006; 41: [PMID: DOI: / ] 33 Liu BR, Kong LJ, Song JT, Liu W, Yu H, Dou QF. Feasibility and safety of functional cholecystectomy by pure NOTES: a pilot animal study. J Laparoendosc Adv Surg Tech A 2012; 22: [PMID: DOI: /lap ] P- Reviewers Aubert A, Nagafuchi Y, Shea JA S- Editor Song XX L- Editor A E- Editor Zhang DN 6862 October 28, 2013 Volume 19 Issue 40

175 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. Estrogen improves the hyperdynamic circulation and hyporeactivity of mesenteric arteries by alleviating oxidative stress in partial portal vein ligated rats BRIEF ARTICLE Bin Zhang, Cheng-Gang Zhang, Quan-Bo Zhou, Wei Chen, Zhi-Yong Wu Bin Zhang, Cheng-Gang Zhang, Quan-Bo Zhou, Wei Chen, Zhi-Yong Wu, Department of General Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai , China Author contributions: Zhang B, Chen W and Wu ZY designed research; Zhang B, Zhang CG and Zhou QB performed research; Zhang B and Zhang CG analyzed data; Zhang B and Zhou QB co-wrote the paper. Correspondence to: Zhi-Yong Wu, MD, PhD, Department of General Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, No Dongfang Road, Shanghai , China. zhiyongwu@gmail.com Telephone: Fax: Received: June 29, 2013 Revised: August 18, 2013 Accepted: September 4, 2013 Published online: October 28, 2013 Abstract AIM: To evaluate the effects of estrogen (E2) on systemic and splanchnic hyperdynamic circulation in portal hypertensive rats. METHODS: Fifty castrated female Sprague-Dawley rats were divided into five groups: sham operation (SO), partial portal vein ligation (PPVL) + placebo (PLAC), PPVL + E2, PPVL + ICI and PPVL + E2 + ICI. Hemodynamic measurements were performed using ultrasonography. Mesenteric arteriole contractility in response to norepinephrine was determined using a vessel perfusion system. Oxidative stress in the mesenteric artery was investigated by in situ detection of the superoxide anion (O2 ) and hydrogen peroxide (H2O2) concentrations. RESULTS: Treatment with E2 resulted in a significant decrease of portal pressure (P < 0.01) and portal venous inflow (P < 0.05), and higher systemic vascular resistance (P < 0.05) and splanchnic arteriolar resistance (P < 0.01) in PPVL + E2 rats compared to PPVL + PLAC rats. In the mesenteric arterioles of PPVL + E2 rats, the dose-response curve was shifted left, and the EC50 was decreased (P < 0.01). E2 reduced O2 production and H2O2 concentration in the mesenteric artery. However, ICI182, 780 reversed the beneficial effects of E2, therefore, the systemic and splanchnic hyperdynamic circulation were more deteriorated in ICI182, 780-treated rats. CONCLUSION: Treatment with estrogen improved the systemic and splanchnic hyperdynamic circulation in PPVL rats, in part due to the alleviation of oxidative stress Baishideng. All rights reserved. Key words: Estrogen; Hyperdynamic circulation; Partial portal vein ligation; Oxidative stress Core tip: Vascular hyporeactivity is affected by gender and estrogen. The aim of the present study was to investigate whether estrogen could attenuate the severity of hyperdynamic circulation and the underlying mechanism in pre-hepatic portal hypertensive rats without cirrhosis, with a focus on oxidative stress. The authors proposed that treatment with estrogen could improve the systemic and splanchnic hyperdynamic circulation in partial portal vein ligation rats, in part due to the alleviation of oxidative stress. Zhang B, Zhang CG, Zhou QB, Chen W, Wu ZY. Estrogen improves the hyperdynamic circulation and hyporeactivity of mesenteric arteries by alleviating oxidative stress in partial portal vein ligated rats. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6863.htm DOI: i October 28, 2013 Volume 19 Issue 40

176 Zhang B et al. Estrogen and PHT INTRODUCTION Portal hypertension (PHT) is a major complication of liver cirrhosis and is associated with the development of hyperdynamic circulation, characterized by elevated portal pressure (PP), increased splanchnic (small intestine) blood flow, increased cardiac output, and development of an extensive network of portosystemic collaterals [1]. PP is determined by extrahepatic factors such as portal blood flow and collateral resistance in addition to intrahepatic resistance. Therefore, it would be triggered by persistent splanchnic vasodilation. Functional changes can be found in the portal hypertensive splanchnic vasculature, including splanchnic vasodilation and decreased responsiveness to vasoconstrictors as a result of endothelial dysfunction and impaired activation of vasoconstrictive mechanisms [2]. Although the levels of vasoconstrictors such as norepinephrine (NE) and angiotensin-Ⅱ (Ang-Ⅱ) are increased in the blood circulation and are accompanied by enhanced sympathetic excitability in PHT, the splanchnic vasculature remains dilated [3]. Hyporeactivity of the artery in response to vasoconstrictors plays a key role in blood vessel dilation and hyperdynamic circulation [4,5]. Vascular hyporeactivity has been observed in PHT animals in both the systemic circulation and in the mesenteric artery, and it is also affected by gender and estrogen [6]. In addition, experimental studies have shown that estradiol (E2) reduces PP and increases hepatic blood flow in castrated and cirrhotic model rats, but the effect is significantly inhibited by the estrogen antagonist ICI182, 780 [7,8]. Both acute and chronic liver diseases are characterized by an increased formation of reactive oxygen species (ROS), as indicated by increased superoxide anion in the whole blood of cirrhotic patients with decompensated liver and increased urinary F2-isoprostanes and lipoperoxidation and decreased superoxide dismutase in experimental PHT models [9]. Increased oxidative stress may lead to impaired endothelium dysfunction and be involved in the pathogenesis of PHT. It has therefore been a subject of interest [10,11]. The aim of the present study was to investigate whether estrogen could attenuate the severity of hyperdynamic circulation and the underlying mechanism in PHT rats without cirrhosis, with a focus on oxidative stress. Thus, to exclude the hepatoprotective and antifibrogenic effects of estrogen, the PHT was induced by partial portal vein ligation (PPVL) but not by the injection of hepatotoxic drugs, such as CCl4 and dimethylnitrosamine, or by bile duct ligation. MATERIALS AND METHODS Animal model and treatment This animal study was approved by the local animal ethics committee of Renji Hospital and performed according to the guidelines of the Laboratory Animal Care and Use Committee at School of Medicine, Shanghai Jiao Tong University (Shanghai, China). Fifty female Sprague- Dawley rats weighing g underwent ovariectomy before the study. Three weeks after the initial surgery, the rats underwent PPVL or sham operation (SO) as previously described by Reiberger et al [1] and were divided into five groups: SO, PPVL + placebo (PLAC), PPVL + E2, PPVL + ICI and PPVL + E2 + ICI. Briefly, under ketamine anesthesia (intramuscular injection of 10 mg/100 g body weight), the portal vein was isolated, and stenosis was induced by a single ligature of 3-0 silk placed around both the portal vein and a 20-gauge blunt-tipped needle. The needle was then removed, leaving a calibrated stenosis of the portal vein. Portal hypertension was considered present at 14 d after surgery. In SO animals, the portal vein was isolated and similarly manipulated but not ligated. Starting on the day of surgery, the PPVL + E2, PPVL + ICI and PPVL + E2 + ICI groups were subcutaneously administered β-estradiol (2 μg/100 g body weight/d, R and D Systems, United States) or/and ICI182, 780 (2 μg/100 g body weight/d, R and D Systems, United States) for 14 d. The SO and PPVL groups were subcutaneously administered the same volume of the placebo (ethanol). Hemodynamic measurements Under anesthesia induced by an intramuscular injection of ketamine (10 mg/100 g body weight), the velocity and inside diameter of the portal vein (PV) proximal to the ligation and stroke volume (SV) were obtained using a Vevo770 High-Resolution Imaging System (Visual Sonics, Canada). A 22 G catheter filled with heparin saline was inserted into the femoral artery to obtain the mean arterial pressure (MAP) and heart rate (HR). Another 22 G catheter was introduced into the portal vein to measure PP, and one was inserted into the inferior vena cava to measure central venous pressure (CVP) after making an incision at the midline of the abdomen. All parameters were recorded using an SP840 pressure transducer and a multichannel recorder (Philips, United States). Cardiac output (CO), cardiac index (CI), PV blood flow, portal venous inflow (PVI), systemic vascular resistance (SVR) and splanchnic arteriolar resistance (SAR) were calculated as follows: CO = SV HR; CI = CO 100/body weight (g); PVI = PV blood flow 100/body weight (g); SVR = (MAP - CVP)/CI; SAR = (MAP - PP)/PVI. PV blood flow and CO were normalized by body weight and presented as CI and PVI. Resistances in the vascular systems were calculated from the ratio between the perfusion pressure (P) and blood flow (Q) of each vascular territory. Determination of mesenteric arteriole reactivity to NE Following the determination of hemodynamic measurements, the mesenteric arteries and the mesentery were removed. Using an SMZ-168 dissecting microscope (Motic, China), the third-order arterioles in the mesentery were carefully dissected and transferred to a vascular perfusion system containing a 3-(N-morpholino) propanesulfonic acid-buffered physiological salt solution (MOPS-PSS, 0-4, ph 7.4; NaCl 145 mmol/l, KCl 5.0 mmol/l, CaCl2 2.0 mmol/l, MgSO4 1.0 mmol/l, NaH2PO October 28, 2013 Volume 19 Issue 40

177 Zhang B et al. Estrogen and PHT Table 1 Hemodynamic data of the five animal groups and maximum contraction and EC50 in the five groups SO PPVL + PLAC PPVL + E2 PPVL + ICI PPVL + E2 + ICI Body weight (g) 248 ± ± ± ± 23 a, c 244 ± 13 HR (bpm) 440 ± ± 25 a 415 ± 35 a 419 ± 21 a 406 ± 28 a MAP (mmhg) 95 ± 6 85 ± 11 a 88 ± 9 a 89 ± 5 a 84 ± 8 a PP (mmhg) 4.6 ± ± 0.9 b 12.2 ± 1.6 b 14.2 ± 1.5 b 13.9 ± 1.3 b PV flow (ml/min) 8.52 ± ± ± ± ± 3.8 PVI (ml/min/100 g) 3.43 ± ± 1.6 a 3.98 ± 1.4 c 5.14 ± 1.8 a 5.34 ± 1.9 a CO (ml min -1 ) ± ± ± ± ± 6.0 CI (Ml/min/100 g) ± ± ± ± ± 2.5 SVR (mmhg min 100 g/ml) 4.08 ± ± 0.35 b 3.95 ± 0.41 c 3.50 ± 0.38 a 3.32 ± 0.33 a SAR (mmhg min 100 g/ml) ± ± 2.2 b ± 1.8 b, d ± 1.7 b ± 1.5 b Emax 75.18% ± 4.52% 50.47% ± 3.48% a 70.65% ± 2.42% a, d 51.37% ± 4.12% b 54.33% ± 4.71% b EC50 (10-6 mol/l) 2.77 ± ± 0.88 b 3.77 ± 0.69 b, d 4.89 ± 0.76 b 3.85 ± 0.52 b, d Significant differences are marked with superscripts showing the P values. a P < 0.05, b P < 0.01 vs sham operation (SO); c P < 0.05, d P < 0.01 vs partial portal vein ligation (PPVL) + placobo (PLAC); E2: Estrogen; HR: Heart rate; MAP: Mean arterial pressure; PP: Portal pressure; PV: Portal vein; CO: Cardiac output; CI: Cardiac index; PVI: Portal venous inflow; SVR: Systemic vascular resistance; SAR: Splanchnic arteriolar resistance. mmol/l, glucose 5.0 mmol/l, pyruvate 2.0 mmol/l, EDTA 0.02 mmol/l and MOPS 3.0 mmol/l). A glass micropipette containing MOPS-PSS (top diameter, 50 μm) was inserted into one end of the arteriole and fixed with 11-0 single strands. Blood was flushed out at a perfusion pressure of 8 mmhg. Another glass micropipette was then inserted into the other end of the arteriole and fixed. The two glass micropipettes were suspended in organ baths containing 60 ml of MOPS-PSS (37, ph 7.4). The arteriole was equilibrated under a pressure of 80 mmhg for 30 min prior to the experiments. After the equilibration period, cumulative NE concentration response curves (10-8 mol/l-10-4 mol/l) were obtained by increasing the concentration in quarter-log increments. The inner diameter was measured using a BA310 microscope camera system (Motic, China). The vasoconstriction rate and the logarithm of the NE concentration were used as the vertical axis and the abscissa, respectively. Superoxide anion detection The oxidative fluorescent dihydroethidium (DHE, Sigma, United States) was used to evaluate in situ production of superoxide anion (O2 ) [12]. Frozen, enzymatically intact, 10-μm-thick sections of the superior mesenteric arteries were incubated with DHE (10 μmol/l) in PBS for 30 min at 37 in a humidified chamber protected from light. DHE is freely permeable to cells and is oxidized in a reaction with O2 to ethidium bromide, which binds to DNA in the nucleus and fluoresces red. Images were obtained with an IX71 fluorescence microscope (Olympus, Japan). Hydrogen peroxide determination The level of hydrogen peroxide (H2O2) was measured using a hydrogen peroxide assay kit (Abcam, United States). In the presence of horseradish peroxidase (HRP), the OxiRed Probe reacts with H2O2 to produce product with color. The superior mesenteric artery was cleaned of connective tissue, precipitated with RIPA (Beyotime, China; 200 μl RIPA/20 mg tissue) for 15 min and then centrifuged for 15 min at 1000 g. A total of 5 μl of the supernatant was diluted with 46 μl of assay buffer, mixed with 50 μl of the Reaction Mix (assay buffer 46 μl, OxiRed Probe 2 μl, HRP 2 μl) and then incubated at room temperature for 10 min. The OD570 nm was read with a Synergy 4 Multi-Mode Microplate Reader (BioTek, United States), and the H2O2 concentration was calculated according to a standard concentration curve. Statistical analysis The change in the reactivity of the mesenteric arteriole in response to NE was presented as a dose-response curve, which was fitted by a nonlinear regression analysis (Graph- Pad Software Inc., San Diego, CA, United States). Maximal responses (Emax) and effective concentrations causing half maximum responses (EC50, calculated by regression analysis) were obtained from concentration response curves. Values are expressed as the means ± SD. Statistical comparisons were performed using one-way ANOVA. P values < 0.05 were considered significant. All statistical analyses were performed using the Statistical Package for the Social Sciences 13.0 (SPSS Inc., United States). RESULTS Hemodynamics Compared to SO, PPVL resulted in a lowered HR (P < 0.05) and MBP (P < 0.05) and significantly increased PP (P < 0.01) in the four groups of prehepatic PHT. However, measurement of MAP and HR revealed no significant differences between the four PPVL groups (P > 0.05). PP significantly decreased by 18.5% in PPVL + E2 rats with a mean PP of 12.2 ± 1.6 mmhg compared to a mean PP of 14.9 ± 1.4 mmhg in PPVL + PLAC rats (P < 0.01) (Table 1). PVI was significantly increased in the four groups of rats that underwent PPVL compared to the corresponding SO group (P < 0.01). Treatment with E2 resulted in a reduction in PVI in PPVL + E2 rats compared to PPVL + PLAC rats (3.98 ± 1.4 ml/min per 100 g vs 4.87 ± 1.6 ml/min per 100 g, P < 0.05) (Table 1). Although CI was slightly increased in the four groups 6865 October 28, 2013 Volume 19 Issue 40

178 Zhang B et al. Estrogen and PHT Contraction rate (%) SO PPVL + PLAC PPVL + E2 PPVL + ICI PPVL + E2 + ICI log[norepinephrine](mol/l) Figure 1 Dose-response curves for isolated rat mesenteric arteriole contractility in response to norepinephrine at different concentrations. The dose-response curves in the four partial portal vein ligation (PPVL) groups were lowered and shifted to the right compared to the sham operation (SO) group. Treatment with estrogen (E2) reversed the curve to left, whereas ICI182, 780 decreased the response to norepinephrine of arterioles treated with E2. PLAC: Placebo. of PPVL rats compared to the SO group, there were no significant differences among the five different groups (P > 0.05). SVR was lower in the four groups of PPVL rats compared to SO rats due to the decreased MBP (P < 0.05), which was increased 16.9% by E2 treatment in PPVL + E2 rats compared to PPVL + PLAC rats (3.95 ± 0.41 mmhg min 100 g/ml vs 3.38 ± 0.35 mmhg min 100 g/ml, P < 0.05) (Table 1). SAR was significantly lower in the four groups of PPVL rats compared to SO rats (P < 0.01). Rats treated with E2 showed significantly higher SAR, with a 34.1% increase compared to PPVL + PLAC rats (19.29 ± 1.8 mmhg min 100 g/ml vs ± 2.2 mmhg min 100 g/ ml, P < 0.01) (Table 1). ICI182, 780 treatment alone did not influence PP, PVI, CI, SVR or SAR compared to PPVL + PLAC rats, except that the body weight was slightly lower (P < 0.05). However, ICI182, 780 reversed the beneficial effects of E2 on PVI, CI, SVR and SAR. Thereby, the systemic circulation and splanchnic hyperdynamic circulation were more deteriorated (Table 1). Contractility of isolated rat mesenteric arterioles in response to NE Compared with the SO group, the dose-response curve of the mesenteric arteriole in response to NE was lower and shifted right, with decreased Emax (P < 0.01) and increased EC50 (P < 0.01, Figure 1; Table 1) in the four PPVL groups. In the mesenteric arterioles of PPVL rats treated with E2, the dose-response curve was shifted left, and the EC50 was decreased (P < 0.01), compared with the PPVL + PLAC rats. ICI182, 780 alone did not influence the dose-response curve or EC50 compared to PPVL rats treated with placebo (P > 0.05). However, ICI182, 780 decreased the response to NE of arterioles treated with E2, thereby the dose-response curve was shifted right. Superoxide anion production Low-intensity fluorescence was observed throughout SO vessels, confirming that all layers of the normal vessel produced low amounts of O2. Fourteen d after the surgery, O2 production was increased in the four groups of PPVL rats (Figure 2). However, the staining was particularly weak in PPVL + E2 rats, and the administration of ICI182, 780 blocked the beneficial effect that E2 provided. Hydrogen peroxide production In the superior mesenteric arteries, H2O2 generation was nearly 2.5-fold higher in PPVL + PLAC rats than in SO rats (8.2 ± 1.5 μmol/l vs 3.3 ± 0.9 μmol/l, P < 0.01; Figure 3). Exogenous E2 reduced H2O2 levels in PPVL + E2 rats when compared with those in PPVL + PLAC rats (4.9 ± 1.0 μmol/l vs 8.2 ± 1.5 μmol/l, P < 0.01). The H2O2 levels in mesenteric arteries treated with ICI182, 780 alone were similar to those found in PPVL + PLAC rats (7.9 ± 1.8 μmol/l vs 3.3 ± 0.9 μmol/l, P < 0.01). However, the administration of ICI182, 780 to PPVL + E2 rats suppressed the antioxidant effect of E2 (6.6 ± 1.3 μmol/l vs 4.9 ± 1.0 μmol/l, P < 0.05). DISCUSSION Recent studies have already provided evidence of the importance of vascular hyporeactivity in the development and maintenance of PHT. Aortic ring hypocontractility has been investigated both in bile duct ligation and CCl4 - induced cirrhotic models [13-15]. Ferlitsch et al [16] have shown that forearm artery responses to NE and Ang-Ⅱ are decreased in patients with cirrhosis. Clear sex differences have also been observed in the vasoconstrictor responsiveness of aortic rings from rats with and without PHT [17]. In contrast to male rats, PHT does not induce vascular hyporesponsiveness in female rats. Estrogen has been shown to be effective in animal models of established PHT with cirrhosis by suppressing hepatic fibrosis and relaxation of the hepatic sinusoid [7,18]. However, the efficacy of estrogen in the setting of de novo PHT and the underlying mechanism had not been characterized in detail. To exclude the effect of cirrhosis on oxidative status and inflammatory cytokines, we established this animal model of prehepatic PHT to further describe both the hemodynamic and anti-oxidant effects of estrogen treatment in the PPVL rat model. The hypothesis of our study was that estrogen could reverse the severity of hyperdynamic circulation and the vascular hyporeactivity of the mesenteric arteries by alleviating oxidative stress in portal hypertensive rats without cirrhosis in which liver function was normal. The results of our study suggested that mesenteric arteriole sensitivity and contractility in response to NE were decreased in PPVL rats, indicating the hyporesponsiveness of the splanchnic vessels to vasoconstrictors, in accordance with deteriorative splanchnic hemodynamics. Treatment with E2 significantly ameliorated the hyperdynamic splanchnic circulation in PPVL rats. The reduction 6866 October 28, 2013 Volume 19 Issue 40

179 Zhang B et al. Estrogen and PHT 600 b b Fluorescence (% vs SO) b, d b, c, f 0 SO PPVL + PLAC PPVL + E2 PPVL + ICI PPVL + E2 + ICI Figure 2 In situ detection of superoxide anion. Fluorescence micrographs of superior mesenteric arteries stained with the O2 -sensitive dye DHE (red fluorescence) were obtained from sham operation (SO) and partial portal vein ligation (PPVL) rats at 14 d after surgery. Images were acquired at identical settings. b P < 0.01 vs SO; c P < 0.05, d P < 0.01 vs PPVL + placobo (PLAC); f P < 0.01 vs PPVL + estrogen (E2). H2O2 concentration (μmol/l) SO b a, d b, f b, c, e PPVL + PLAC PPVL + E2 PPVL + ICI PPVL + E2 + ICI Figure 3 Hydrogen peroxide determination. The hydrogen peroxide concentrations of the superior mesenteric arteries were obtained from sham operation (SO) and partial portal vein ligation (PPVL) rats 14 d after surgery. a P < 0.05, b P < 0.01 vs SO; c P < 0.05, d P < 0.01 vs PPVL + placobo (PLAC); e P < 0.05, f P < 0.01 vs PPVL + estrogen (E2). in splanchnic blood inflow represented by decreased PVI could be explained by an improved contractile reaction of the splanchnic vessels to the vasoconstrictor and a subsequently increased SAR. Additionally, the production of ROS was decreased in PPVL-E2 rats compared to PPVL-SA rats, indicating a profound amelioration of oxidative stress and corresponding to the improvement of systemic and splanchnic hyperdynamic circulation. The fact that PPVL resulted in oxidant injury was first demonstrated by Fernando et al [18], who concluded that the formation of ROS may be important in the pathogenesis of hemodynamic changes and that anti-oxidants can ameliorate oxidant injury and prevent the development of hyperdynamic circulation [19]. Estrogen played a protective role by acting as an antioxidant, which granted it action as a scavenger of free radicals, decreasing the formation of ROS. In castrated rats, significant increases in the activity of antioxidant enzymes were observed, which may have occurred to compensate for the absence of circulating E2 promoted by castration; even then, it was not effective in reducing lipid peroxidase levels [8,20,21]. Estrogen replacement can reverse this effect, reducing lipid peroxidase to the values of control animals [21]. In addition, estrogen stimulates enos expression in SECs and increases NO production, contributing to a reduction in portal pressure in a model of intrahepatic PHT [7]. In summary, we conclude that improvements in oxidative stress after estrogen administration manifest as a functional improvement in the contractile response to vasoconstrictors. Indeed, we observed improvements in both the systemic and splanchnic hyperdynamic circulation. Further studies on the clinical administration of estrogen should be performed. COMMENTS Background Portal hypertension, a major complication of liver cirrhosis, is associated with the development of hyperdynamic circulation and would be triggered by persistent splanchnic vasodilation. Functional changes can be found in the portal hypertensive splanchnic vasculature, including splanchnic vasodilation and decreased responsiveness to vasoconstrictors as a result of endothelial dysfunction and impaired activation of vasoconstrictive mechanisms October 28, 2013 Volume 19 Issue 40

180 Zhang B et al. Estrogen and PHT Research frontiers Increased oxidative stress may lead to impaired endothelium dysfunction and be involved in the pathogenesis of portal hypertension. It has therefore been a subject of interest Innovations and breakthroughs The authors found that improvements in oxidative stress after estrogen administration manifest as a functional improvement in the contractile response of mesenteric arteries to vasoconstrictors in partial portal vein ligation (PPVL) rats. Applications The authors proposed that treatment with estrogen could improve the systemic and splanchnic hyperdynamic circulation in PPVL rats. Peer review The manuscript is an interesting manuscript with novel observations. The authors delineated the effect of estrogen treatment on the systemic and splanchnic hyperdynamic circulation in portal hypertensive rats. The findings are straight forward and manuscript is well written and nicely discussed. REFERENCES 1 Reiberger T, Angermayr B, Schwabl P, Rohr-Udilova N, Mitterhauser M, Gangl A, Peck-Radosavljevic M. Sorafenib attenuates the portal hypertensive syndrome in partial portal vein ligated rats. J Hepatol 2009; 51: [PMID: DOI: /j.jhep ] 2 Hennenberg M, Trebicka J, Sauerbruch T, Heller J. Mechanisms of extrahepatic vasodilation in portal hypertension. Gut 2008; 57: [PMID: DOI: / gut ] 3 Trebicka J, Leifeld L, Hennenberg M, Biecker E, Eckhardt A, Fischer N, Pröbsting AS, Clemens C, Lammert F, Sauerbruch T, Heller J. Hemodynamic effects of urotensin II and its specific receptor antagonist palosuran in cirrhotic rats. Hepatology 2008; 47: [PMID: DOI: / hep.22170] 4 Hadoke PW. Cirrhosis of the liver and receptor-mediated function in vascular smooth muscle. Pharmacol Ther 2001; 89: [PMID: DOI: / S (01) ] 5 Schepke M, Heller J, Paschke S, Thomas J, Wolff M, Neef M, Malago M, Molderings GJ, Spengler U, Sauerbruch T. Contractile hyporesponsiveness of hepatic arteries in humans with cirrhosis: evidence for a receptor-specific mechanism. Hepatology 2001; 34: [PMID: DOI: / jhep ] 6 Tsai MH, Iwakiri Y, Cadelina G, Sessa WC, Groszmann RJ. Mesenteric vasoconstriction triggers nitric oxide overproduction in the superior mesenteric artery of portal hypertensive rats. Gastroenterology 2003; 125: [PMID: DOI: /j.gastro ] 7 Sakamoto M, Ueno T, Nakamura T, Sakata R, Hasimoto O, Torimura T, Sata M. Improvement of portal hypertension and hepatic blood flow in cirrhotic rats by oestrogen. Eur J Clin Invest 2005; 35: [PMID: DOI: / j x] 8 Morgan-Martins MI, Jacques SI, Hartmann RM, Marques CM, Marroni CA, Marroni NP. Protection of estrogen in portal hypertension gastropathy: an experimental model. Arq Gastroenterol 2011; 48: [PMID: DOI: /S ] 9 Dal-Ros S, Oswald-Mammosser M, Pestrikova T, Schott C, Boehm N, Bronner C, Chataigneau T, Gény B, Schini-Kerth VB. Losartan prevents portal hypertension-induced, redoxmediated endothelial dysfunction in the mesenteric artery in rats. Gastroenterology 2010; 138: [PMID: DOI: /j.gastro ] 10 Vuppalanchi R, Juluri R, Bell LN, Ghabril M, Kamendulis L, Klaunig JE, Saxena R, Agarwal D, Johnson MS, Chalasani N. Oxidative stress in chronic liver disease: relationship between peripheral and hepatic measurements. Am J Med Sci 2011; 342: [PMID: DOI: / MAJ.0b013e31821d9905] 11 Vujanac A, Jakovljevic V, Djordjevic D, Zivkovic V, Stojkovic M, Celikovic D, Andjelkovic N, Skevin AJ, Djuric D. Nitroglycerine effects on portal vein mechanics and oxidative stress in portal hypertension. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i4.331] 12 Szöcs K, Lassègue B, Sorescu D, Hilenski LL, Valppu L, Couse TL, Wilcox JN, Quinn MT, Lambeth JD, Griendling KK. Upregulation of Nox-based NAD(P)H oxidases in restenosis after carotid injury. Arterioscler Thromb Vasc Biol 2002; 22: [PMID: DOI: /hq ] 13 Hennenberg M, Trebicka J, Biecker E, Schepke M, Sauerbruch T, Heller J. Vascular dysfunction in human and rat cirrhosis: role of receptor-desensitizing and calcium-sensitizing proteins. Hepatology 2007; 45: [PMID: DOI: /hep.21502] 14 Hennenberg M, Biecker E, Trebicka J, Jochem K, Zhou Q, Schmidt M, Jakobs KH, Sauerbruch T, Heller J. Defective RhoA/Rho-kinase signaling contributes to vascular hypocontractility and vasodilation in cirrhotic rats. Gastroenterology 2006; 130: [PMID: DOI: / j.gastro ] 15 Hennenberg M, Trebicka J, Kohistani AZ, Heller J, Sauerbruch T. Vascular hyporesponsiveness to angiotensin II in rats with CCl(4)-induced liver cirrhosis. Eur J Clin Invest 2009; 39: [PMID: DOI: / j x] 16 Ferlitsch A, Pleiner J, Mittermayer F, Schaller G, Homoncik M, Peck-Radosavljevic M, Wolzt M. Vasoconstrictor hyporeactivity can be reversed by antioxidants in patients with advanced alcoholic cirrhosis of the liver and ascites. Crit Care Med 2005; 33: [PMID: DOI: /01. CCM EB] 17 Robert R, Chagneau-Derrode C, Carretier M, Mauco G, Silvain C. Gender differences in vascular reactivity of aortas from rats with and without portal hypertension. J Gastroenterol Hepatol 2005; 20: [PMID: DOI: /j x] 18 Fernando B, Marley R, Holt S, Anand R, Harry D, Sanderson P, Smith R, Hamilton G, Moore K. N-acetylcysteine prevents development of the hyperdynamic circulation in the portal hypertensive rat. Hepatology 1998; 28: [PMID: DOI: /hep ] 19 Moreira AJ, Fraga C, Alonso M, Collado PS, Zetller C, Marroni C, Marroni N, González-Gallego J. Quercetin prevents oxidative stress and NF-kappaB activation in gastric mucosa of portal hypertensive rats. Biochem Pharmacol 2004; 68: [PMID: DOI: /j.bcp ] 20 Ozgönül M, Oge A, Sezer ED, Bayraktar F, Sözmen EY. The effects of estrogen and raloxifene treatment on antioxidant enzymes in brain and liver of ovarectomized female rats. Endocr Res 2003; 29: [PMID: DOI: / ERC ] 21 Strehlow K, Rotter S, Wassmann S, Adam O, Grohé C, Laufs K, Böhm M, Nickenig G. Modulation of antioxidant enzyme expression and function by estrogen. Circ Res 2003; 93: [PMID: DOI: /01. RES ] P- Reviewers Ozdemir S, Rojas A, Sahu RP S- Editor Gou SX L- Editor A E- Editor Zhang DN 6868 October 28, 2013 Volume 19 Issue 40

181 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Transarterial embolization for massive gastrointestinal hemorrhage following abdominal surgery Chun-Gao Zhou, Hai-Bin Shi, Sheng Liu, Zheng-Qiang Yang, Lin-Bo Zhao, Jin-Guo Xia, Wei-Zhong Zhou, Lin-Sun Li Chun-Gao Zhou, Hai-Bin Shi, Sheng Liu, Zheng-Qiang Yang, Lin-Bo Zhao, Jin-Guo Xia, Wei-Zhong Zhou, Lin-Sun Li, Department of Interventional Radiology, the First Affiliated Hospital of Nanjing Medical University, Nanjing , Jiangsu Province, China Author contributions: Zhou CG and Shi HB designed the study and wrote the manuscript; Liu S and Yang ZQ performed the transarterial embolization procedures; Zhou CG, Zhao LB, Xia JG and Zhou WZ assisted in patient recruitment and interviews; Shi HB and Li LS corrected the manuscript. Correspondence to: Dr. Hai-Bin Shi, Department of Interventional Radiology, the First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing , Jiangsu Province, China. hbshi346@163.com Telephone: Fax: Received: June 12, 2013 Revised: July 29, 2013 Accepted: August 16, 2013 Published online: October 28, 2013 Abstract AIM: To evaluate the clinical results of angiography and embolization for massive gastrointestinal hemorrhage after abdominal surgery. METHODS: This retrospective study included 26 patients with postoperative hemorrhage after abdominal surgery. All patients underwent emergency transarterial angiography, and 21 patients underwent emergency embolization. We retrospectively analyzed the angiographic features and the clinical outcomes of transcatheter arterial embolization. RESULTS: Angiography showed that a discrete bleeding focus was detected in 21 (81%) of 26 patients. Positive angiographic findings included extravasations of contrast medium (n = 9), pseudoaneurysms (n = 9), and fusiform aneurysms (n = 3). Transarterial embolization was technically successful in 21 (95%) of 22 patients. Clinical success was achieved in 18 (82%) of 22 patients. No postembolization complications were observed. Three patients died of rebleeding. CONCLUSION: The positive rate of angiographic findings in 26 patients with postoperative gastrointestinal hemorrhage was 81%. Transcatheter arterial embolization seems to be an effective and safe method in the management of postoperative gastrointestinal hemorrhage Baishideng. All rights reserved. Key words: Transcatheter arterial embolization; Postoperative hemorrhage; Complications; Surgery Core tip: Postoperative gastrointestinal hemorrhage is a potentially fatal complication after abdominal surgery. It is difficult for surgeons to deal with it. Reoperation is often difficult or even unsuccessful in patients with postoperative hemorrhage, especially those with two or more previous abdominal operations, due to the anatomical inaccessibility of the arteries, postoperative adhesions, and inflammatory reactions. This study showed that transcatheter embolization was a useful microinvasive treatment option for the identification and occlusion of a massive bleeding site after abdominal surgery. Zhou CG, Shi HB, Liu S, Yang ZQ, Zhao LB, Xia JG, Zhou WZ, Li LS. Transarterial embolization for massive gastrointestinal hemorrhage following abdominal surgery. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: org/ /wjg.v19.i INTRODUCTION Postoperative gastrointestinal hemorrhage is a potentially 6869 October 28, 2013 Volume 19 Issue 40

182 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage fatal complication after abdominal surgery. It prolongs hospital stay, requires urgent radiological or surgical intervention, and increases mortality after abdominal surgery. The incidence of postoperative gastrointestinal hemorrhage after abdominal surgery is low, but increases with an increase in surgical procedures, severity of illness, and comorbid conditions. The incidence of postoperative gastrointestinal hemorrhage has been reported as 0.4%-4% in a recent series [1-7], and 2%-18% in earlier series [8-14]. Although recent studies have shown that its mortality has decreased, it remains a serious and lifethreatening condition. Traditionally, open ligation or excision has been considered to be the first-line therapeutic option for patients with massive gastrointestinal hemorrhage after abdominal surgery. However, the bleeding site is difficult to establish because of local inflammatory response after abdominal surgery. In addition, patients with postoperative gastrointestinal hemorrhage are reported to be poor candidates for emergency surgery because of cicatrization and friability of postoperative tissues [15]. Transcatheter angiographic embolization is a less invasive procedure that is known to be a safe and effective treatment to control massive gastrointestinal hemorrhage. With the development of endovascular techniques over the past decade, transarterial embolization has been widely used clinically for treatment of postoperative gastrointestinal hemorrhage after abdominal surgery, despite the possibility of gastrointestinal infarction [16-19]. In this study, we retrospectively reviewed and analyzed the angiographic findings and clinical outcomes of transarterial angiography and embolization in 26 patients with postoperative hemorrhage after abdominal surgery. MATERIALS AND METHODS This study was approved by our institutional review board, and all patients gave their informed consent before the procedure. This study included 26 patients (22 male and 4 female) who underwent emergency transarterial angiography and embolization for postoperative hemorrhage after abdominal surgery between August 2007 and April 2012 at our hospital. The mean age was 57.2 years (range, years). The average time of onset of postoperative hemorrhage was 27.7 d (range, 3-65 d). The abdominal surgery included surgery for gastric carcinoma (n = 13), pancreatic head carcinoma (n = 2), common bile duct carcinoma (n = 2), duodenal papilla carcinoma (n = 2), ascending colon carcinoma (n = 1), severe pancreatitis (n = 1), gallbladder carcinoma (n = 1), cholangiolithiasis (n = 1), and intra-abdominal abscess (n = 1), as well as splenomegaly (n = 1), and mesenteric torsion (n = 1). Clinical presentations included hematemesis, hematochezia/melena, and bleeding from surgical drains. The volume of bleeding was > 1 L in 24 h. The diagnostic angiography was performed via transfemoral approach, using a 5-F angiographic catheter (Cook, Bloomington, IN, United States) and a 5-F sheath (Terumo, Tokyo, Japan). In all cases, celiac and superior mesenteric angiography was routinely performed to detect the bleeding points. If this did not detect any bleeding points, inferior mesenteric angiography was performed. Hemorrhage was diagnosed based on the presence of extravasation of contrast agent, a pseudoaneurysm, and a fusiform aneurysm on angiography. Immediately after bleeding points were identified, transarterial embolization was performed with microcoils (Cook) and/or gelatin sponge (gelfoam particles) through a coaxial 2.7-F microcatheter (Terumo). Transarterial embolization was also performed with gelfoam in one patient without positive angiographic findings. Technical success was defined as devascularization of the target vessels on postembolization angiography. Clinical success was defined as cessation of clinical symptoms (including melena, hematemesis, and hematochezia), and no requirement for subsequent hemostatic interventions (such as surgery, endoscopic therapy, and second embolization). The diameter of microcoils we used was from 2 to 6 mm. The length of microcoils was from 3 to 8 cm. The diameter of gelfoam particles was approximately 1 mm. Clinical follow-up period was 3 mo in all patients. RESULTS Fifteen patients presented with hematemesis/melena, and 11 patients presented with bleeding from surgical drains. Twenty-two patients had signs of shock (systolic blood pressure < 100 mmhg and pulse rate > 100 beats/min). The clinical features and angiographic findings are summarized in Table 1. Results of transarterial embolization are summarized in Table 2. Bleeding points near the surgical fields were detected by angiography in 21 (81%) of 26 patients. Positive angiographic findings included extravasation of contrast medium (n = 9) (Figure 1), pseudoaneurysms (n = 9) (Figures 2 and 3), and fusiform aneurysms (n = 3). Extravasation of contrast medium was observed from the jejunal artery (n = 2), gastroduodenal artery (n = 2), right hepatic artery and gastroduodenal artery (n = 1), great pancreatic artery (n = 1), inferior pancreaticoduodenal artery (n = 1), dorsal pancreatic artery (n = 1), and ileocolic artery (n = 1). Pseudoaneurysms were found in the gastroduodenal artery (n = 3), common hepatic artery (n = 1), right hepatic artery (n = 1), inferior pancreaticoduodenal artery (n = 1), splenic artery and right gastroepiploic artery (n = 1), jejunal artery (n = 1), and superior rectal artery (n = 1). The fusiform aneurysms were identified in the gastroduodenal artery (n = 2), and the proper hepatic artery (n = 1). Transarterial embolization was performed in 20 of 21 patients with positive angiographic findings and one patient without positive angiographic findings. The embolized arteries are summarized in Table 2. Transarterial embolization of bleeding arteries was performed using a combination of microcoils and gelatin sponge in six cases, microcoils in 13 cases, and gelatin sponge in two cases. Transarterial embolization was not performed in 6870 October 28, 2013 Volume 19 Issue 40

183 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage Table 1 Clinical features of patients with postoperative hemorrhage after abdominal surgery Case Sex Age (yr) Diseases Surgical procedure Interval from operation to bleeding (d) Clinical presentations 1 Male 61 Gastric carcinoma Gastrectomy 11 Haematemesis/melena 2 Male 72 Pancreatitis Pancreatitis necrosectomy 15 Bleeding from drain 3 Male 46 Duodenal papilla carcinoma Pancreaticoduodenectomy 38 Bleeding from drain 4 Male 64 Gastric carcinoma Gastrectomy 14 Bleeding from drain 5 Male 37 Gastric carcinoma Gastrectomy 27 Haematemesis/melena 6 Female 44 Gastric carcinoma Gastrectomy 18 Bleeding from drain 7 Male 51 Gastric carcinoma Gastrectomy 20 Haematemesis/melena 8 Male 35 Gastric carcinoma Gastrectomy 28 Haematemesis/melena 9 Male 41 Gastric carcinoma Gastrectomy 64 Haematemesis/melena 10 Male 56 Pancreatic carcinoma Pancreaticoduodenectomy 10 Haematemesis/melena 11 Female 45 Gallbladder carcinoma Extended cholecystectomy 25 Haematemesis/melena 12 Male 86 Ascending colon carcinoma Right hemicolectomy 34 Hematochezia/melena 13 Male 59 Gastric carcinoma Gastrectomy 50 Haematemesis/melena 14 Male 69 Gastric carcinoma Gastrectomy 49 Bleeding from drain 15 Male 61 Intra-abdominal abscess Excision of Intra-abdominal abscess 3 Bleeding from drain 16 Male 65 Common Bile duct carcinoma Pancreaticoduodenectomy 29 Bleeding from drain 17 Male 73 Gastric carcinoma Gastrectomy 38 Hematochezia/melena 18 Male 60 Bile duct carcinoma Pancreaticoduodenectomy 29 Bleeding from drain 19 Female 62 Gastric carcinoma Gastrectomy 21 Haematemesis/melena 20 Male 80 Duodenal papilla carcinoma Pancreaticoduodenectomy 8 Bleeding from drain 21 Male 42 Pancreatic carcinoma Pancreaticoduodenectomy 46 Haematemesis/melena 22 Male 45 Splenomegaly Splenectomy 9 Bleeding from drain 23 Male 56 Bile duct stone Choledocholithotomy 26 Bleeding from drain 24 Female 62 Gastric carcinoma Gastrectomy 65 Hematochezia/melena 25 Male 76 Gastric carcinoma Gastrectomy 29 Haematemesis/melena 26 Male 40 Mesenteric torsion Partial intestinal resection 15 Haematemesis/melena one patient with positive angiographic finding, because the bleeding vessels were capillaries and could not be superselected. This patient underwent a second surgery after angiography immediately, and recovered after second surgery. However, there were five patients without positive angiographic findings in our study. Among these five patients, one died of rebleeding after blind embolization; one recovered after conservative treatment; and the other three also recovered after a second operation. In the surgical procedure, we found that the bleeding vessels were the splenic vein, portal vein behind the gastrointestinal anastomotic stoma, and left gastro-omental vein, respectively. Technical success was achieved in 21 (95%) of 22 patients (20 patients with positive angiographic findings and one without positive angiographic findings). Clinical success was achieved in 18 (82%) of 22 patients. Three patients were unsuccessfully treated, including two with rebleeding after embolization, and one with rebleeding after blind embolization. Postembolization complications such as intestinal ischemia and liver infarction did not occur in any patients during the follow-up period. Three patients (two with positive angiographic findings and one without positive angiographic findings) died of rebleeding after embolization. DISCUSSION Postoperative gastrointestinal hemorrhage is a life-threatening complication that occurs after abdominal surgery, particularly in the case of pancreaticoduodenectomy. The incidence of postoperative gastrointestinal hemorrhage after abdominal surgery is not high (0.4%-18%) [1-14]. Early hemorrhagic complications occur during the first 24 h postoperatively, and are usually caused by intraoperative technical failure, such as improper ligation of vessels in the operative area, and damages to small vessels during lymph node dissection. Delayed postoperative hemorrhage has a different pathophysiology of bleeding from early postoperative hemorrhage, and is complicated with intra-abdominal lesions such as marginal ulcer, anastomotic leakage, intra-abdominal abscess, and sepsis. In this study, the interval from surgery to bleeding ranged from 3 to 65 d, and was > 5 d for the majority of patients. The intra-abdominal complications such as pancreatic juice leakage, intestinal juice leakage, and intra-abdominal abscess were the main causes of gastrointestinal bleeding in our study. In order to reduce the rate of postoperative gastrointestinal hemorrhage after abdominal surgery, we must decrease abdominal surgery complications, such as stomal leak, marginal ulcer, and abscess. Early diagnosis and prompt treatment are necessary to decrease the mortality of patients with postoperative hemorrhage after abdominal surgery. Endoscopy is usually served as the first-line diagnostic procedure. However, exact diagnosis via urgent gastrointestinal endoscopy can be severely impaired by excessive blood and clots in the gastrointestinal tract [20,21]. computed tomography angiography, Doppler ultrasound, and radionuclide scanning can also be used in the diagnosis of postoperative hemorrhage [5,22,23]. Compared with these diagnosis 6871 October 28, 2013 Volume 19 Issue 40

184 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage Table 2 Angiographic findings and clinical results of patients with postoperative hemorrhage after abdominal surgery Case Angiography finding Embolized artery Embolic agent Clinical results 1 Negative None None Conservative treatment and clinical success 2 Negative None None Repeat surgery and clinical success 3 Negative None None Repeat surgery and clinical success 4 Negative None None Repeat surgery and clinical success 5 Extravasation None None Conservative treatment and clinical success 6 Extravasation Inferior pancreaticoduodenal artery Microcoil Clinical success 7 Extravasation Jejunal artery Microcoil Clinical success 8 Extravasation Jejunal artery Microcoil Clinical success 9 Extravasation Inferior pancreaticoduodenal artery Microcoil Clinical success 10 Extravasation Great pancreatic artery Gelfoam Clinical success 11 Negative Right hepatic artery and gastroduodenal artery Gelfoam Die of rebleeding 12 Extravasation Ileocolic artery Microcoil Clinical success 13 Pseudoaneurysm Gastroduodenal artery Microcoil Clinical success 14 Extravasation Gastroduodenal artery Microcoil Clinical success 15 Pseudoaneurysm superior rectal artery Microcoil Clinical success 16 Pseudoaneurysm Gastroduodenal artery Microcoil Clinical success 17 Fusiform aneurysm Gastroduodenal artery Microcoil Clinical success 18 Pseudoaneurysm Common hepatic artery Microcoil Clinical success 19 Extravasation Gastroduodenal artery Microcoil Die of rebleeding 20 Pseudoaneurysm Gastroduodenal artery Microcoil Die of rebleeding 21 Fusiform aneurysm Proper hepatic artery Microcoil + gelfoam Clinical success 22 Pseudoaneurysm Splenic artery and Right gastroepiploic artery Microcoil + gelfoam Clinical success 23 Pseudoaneurysm Right hepatic artery Microcoil + gelfoam Clinical success 24 Pseudoaneurysm Inferior pancreaticoduodenal artery Microcoil + gelfoam Clinical success 25 Fusiform aneurysm Gastroduodenal artery Microcoil + gelfoam Clinical success 26 Pseudoaneurysm Jejunal artery Microcoil + gelfoam Clinical success Figure 1 A 35-year-old man with massive upper gastrointestinal bleeding after gastrectomy of gastric carcinoma. Selective superior mesenteric arteriography showed active arterial contrast extravasation (white arrow) from the jejunal artery. ings of postoperative gastrointestinal hemorrhage mainly included extravasation of contrast medium and pseudoaneurysms. In our study, the positive findings were 81% (21 of 26 patients), and the rate of positive findings was higher than that of gastrointestinal hemorrhage without abdominal surgery, and was similar to that of gastrointestinal hemorrhage with surgery. Therefore, angiography should be the first-choice option for postoperative gastrointestinal hemorrhage after abdominal surgery, especially for patients with hemodynamic instability and poor general conditions. If celiac angiography fails to identify a source of bleeding, superselective angiography near the surgical field should be performed. However, angiography also has some limitations. For example, the result of angiography could be negative because the gastrointestinal bleeding is often intermittent or directly comes from veins or has been controlled by vasoactive agents. In this study, angiography demonstrated bleeding points in 21 of 26 patients. Reoperation was performed in three patients with negative angiographic findings. We found that the bleeding vessels were the left gastro-omental vein, portal vein behind the anastomotic stoma, and splenic vein. Reoperation to control postoperative bleeding is the traditional approach to manage gastrointestinal hemorrhage after abdominal surgery. However, emergency surgical exploration has been reported to be associated with a mortality rate of as high as 64% in high-risk patients with hemodynamic instability and poor general conditions [25,26]. In addition, the surgical approach is often difficult or even unsuccessful in patients with postoperative hemorrhage, especially those with two or more previous abdominal operations, due to the anatomical inaccessibilimethods, angiography is quicker, safer, and more accurate to localize the bleeding points. In addition, angiography allows immediate embolization to stop gastrointestinal hemorrhage. Angiographic findings of postoperative gastrointestinal hemorrhage differ slightly from those of gastrointestinal hemorrhage without surgery. Positive angiographic findings of gastrointestinal hemorrhage without surgery mainly included extravasation of contrast medium, tumor staining, and vascular malformation. Charbonnet et al [24] reported that angiography had a positive angiographic rate of 31% in all consecutive patients without abdominal surgery. Kim et al [19] reported a positive angiographic rate of 79% in patients after abdominal surgery. However, positive angiographic find October 28, 2013 Volume 19 Issue 40

185 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage A B Figure 2 A 56-year-old man presented with massive bleeding from surgical drains after choledocholithotomy due to common bile duct stone. A: Selective celiac arteriography showed a pseudoaneurysm (arrow) arising from the right hepatic artery; B: Selective celiac arteriography after embolization with microcoils and gelfoam demonstrated disappearance of the pseudoaneurysm. Embolic agents were inserted proximally (white arrow) and distally (black arrow) to the origin of the pseudoaneurysm. A B Figure 3 A 61-year-old man presented with massive bleeding from surgical drains 3 d after excision of the intra-abdominal abscess. A: Selective inferior mesenteric arteriography shows a pseudoaneurysm (arrow) arising from the superior rectal artery; B: Selective inferior mesenteric arteriography after embolization with microcoils demonstrated complete occlusion (arrow) of the distal end of the superior rectal artery. ty of the arteries, postoperative adhesions, and inflammatory reaction. Endoscopy is another approach to manage postoperative hemorrhage [1-4,27-32]. However, emergency endoscopy for postoperative hemorrhage may be difficult owing to excessive blood and clots in the gastrointestinal tract, and inaccessibility of the bleeding sites in the small intestine. Transarterial embolization is effective for postoperative hemorrhage, especially in patients with hemodynamic instability and poor general condition. However, the safety and clinical results of embolization have not been assessed in a large patient group. Beyer et al [5] reported that embolization had a success rate of 100% in nine patients with delayed hemorrhage after pancreaticoduodenectomy. Miyamoto et al [33] demonstrated a success rate of 80% with superselective embolization in 10 patients with massive upper gastrointestinal hemorrhage after upper abdominal surgery. Compared with these studies, the clinical success rate (82%) of the present study was similar. However, the technical success rate in this study was 95% because we used high-resolution digital angiography and microcatheterization. Three patients died during the follow-up period. The cause of death was rebleeding after embolization, including one blind embolization. The clinical results of blind embolization (defined as embolization without positive angiography) are controversial. Morris et al [34] found that blind embolization of the left gastric artery was effective in preventing rebleeding when an active bleeding site was localized by endoscopy. Kim et al [19] successfully treated four patients with blind embolization after an active bleeding site was identified by endoscopy or scintigraphy, or was suspicious on angiography. In our study, blind embolization was performed only in one patient after the bleeding site was localized by endoscopy. However, the patient died of rebleeding 3 d after the interventional procedure. The most serious complications of postembolization are liver infarction and irreversible bowel ischemia. However, the liver can tolerate considerable arterial embolization without significant liver infarction, because the liver has a dual blood supply by the hepatic artery and portal vein, and the hepatic artery has abundant collateral pathways. Arterial embolization in the upper gastrointestinal tract above the ligament of Treitz is generally considered safe because of the rich collateral supply to the stomach and duodenum [34]. In contrast to the upper gastrointestinal tract, the lower gastrointestinal tract does not have a rich collateral artery, and is susceptible to embolizationinduced ischemia. However, significant ischemia may be avoided if the embolic agent is delivered precisely to the bleeding sites. In our study, postembolization complications such as liver infarction and bowel ischemia were not encountered. Therefore, we believe that transarterial embolization is a safe method to treat postoperative gastrointestinal hemorrhage. In conclusion, we retrospectively analyzed the angiographic findings and clinical outcomes of transarterial angiography and embolization in 26 patients with postoperative hemorrhage after abdominal surgery. Angiography was found to be a sensitive approach to detect the 6873 October 28, 2013 Volume 19 Issue 40

186 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage bleeding site, especially for patients with postoperative gastrointestinal hemorrhage. Transarterial embolization is an effective and safe method for the treatment of postoperative hemorrhage. COMMENTS Background Gastrointestinal hemorrhage after abdominal surgery is an unusual complication. However, when it occurs, it can cause hemorrhagic shock that has a fatal outcome. This complication may occur as a result of anastomotic leakage, localized infection, or intraoperative arterial injury. Traditionally, reoperation is regarded as the first-line therapy. However, its usage is largely limited by the poor condition of patients with postoperative gastrointestinal hemorrhage and the difficulty in indentifying the bleeding sites during surgery. With advances in technology, a newer and less-invasive technique, transcatheter arterial embolization, has been developed and is reported to be safe and effective, especially in high-risk surgical patients. Research frontiers For postoperative gastrointestinal hemorrhage, the first important thing is to localize the bleeding site. Transarterial angiography is considered to be a better tool than endoscopy or noninvasive diagnostic imaging examinations such as computed tomography angiography and ultrasound. Transarterial access not only can provide diagnostic information but also has the advantage of intraarterial embolization of the bleeding site simultaneously. Innovations and breakthroughs The surgical approach to control postoperative bleeding is often difficult or even unsuccessful in patients with postoperative hemorrhage, especially those with two or more previous abdominal operations, due to the anatomical inaccessibility of the arteries, postoperative adhesions, and inflammatory reaction. Therefore, its mortality rate was as high as 64% in high-risk patients with hemodynamic instability and poor general condition. However, with advances in techniques and microcatheters, transcatheter arterial embolization was performed to control postoperative bleeding. In this retrospective study, the technical success rate was 95%, and the clinical success rate was 82%. There were no procedure-related complications. Applications The results of the present study suggest that transcatheter arterial embolization is a safe and effective treatment for massive gastrointestinal hemorrhage following abdominal surgery. Peer review This was a good descriptive study in which the authors evaluated the clinical results of angiography and embolization for massive gastrointestinal hemorrhage after abdominal surgery. The results are interesting and suggest that transcatheter arterial embolization is a safe and effective treatment for massive gastrointestinal hemorrhage following abdominal surgery, especially for patients with hemodynamic instability and poor general condition. REFERENCES 1 Tanizawa Y, Bando E, Kawamura T, Tokunaga M, Ono H, Terashima M. Early postoperative anastomotic hemorrhage after gastrectomy for gastric cancer. Gastric Cancer 2010; 13: [PMID: DOI: /s ] 2 Malik AH, East JE, Buchanan GN, Kennedy RH. Endoscopic haemostasis of staple-line haemorrhage following colorectal resection. Colorectal Dis 2008; 10: [PMID: DOI: /j x] 3 Martínez-Serrano MA, Parés D, Pera M, Pascual M, Courtier R, Egea MJ, Grande L. Management of lower gastrointestinal bleeding after colorectal resection and stapled anastomosis. Tech Coloproctol 2009; 13: [PMID: DOI: /s ] 4 Linn TY, Moran BJ, Cecil TD. Staple line haemorrhage following laparoscopic left-sided colorectal resections may be more common when the inferior mesenteric artery is preserved. Tech Coloproctol 2008; 12: [PMID: DOI: /s ] 5 Beyer L, Bonmardion R, Marciano S, Hartung O, Ramis O, Chabert L, Léone M, Emungania O, Orsoni P, Barthet M, Berdah SV, Brunet C, Moutardier V. Results of non-operative therapy for delayed hemorrhage after pancreaticoduodenectomy. J Gastrointest Surg 2009; 13: [PMID: DOI: /s ] 6 Yekebas EF, Wolfram L, Cataldegirmen G, Habermann CR, Bogoevski D, Koenig AM, Kaifi J, Schurr PG, Bubenheim M, Nolte-Ernsting C, Adam G, Izbicki JR. Postpancreatectomy hemorrhage: diagnosis and treatment: an analysis in 1669 consecutive pancreatic resections. Ann Surg 2007; 246: [PMID: DOI: /01. sla db] 7 Vernadakis S, Christodoulou E, Treckmann J, Saner F, Paul A, Mathe Z. Pseudoaneurysmal rupture of the common hepatic artery into the biliodigestive anastomosis. A rare cause of gastrointestinal bleeding. JOP 2009; 10: [PMID: ] 8 Dixon JM, Armstrong CP, Duffy SW, Elton RA, Davies GC. Upper gastrointestinal bleeding. A significant complication after surgery for relief of obstructive jaundice. Ann Surg 1984; 199: [PMID: DOI: / ] 9 Yeo CJ. Management of complications following pancreaticoduodenectomy. Surg Clin North Am 1995; 75: [PMID: ] 10 Rumstadt B, Schwab M, Korth P, Samman M, Trede M. Hemorrhage after pancreatoduodenectomy. Ann Surg 1998; 227: [PMID: DOI: / ] 11 Welch CE, Rodkey GV, von Ryll Gryska P. A thousand operations for ulcer disease. Ann Surg 1986; 204: [PMID: DOI: / ] 12 Ikeguchi M, Oka S, Gomyo Y, Tsujitani S, Maeta M, Kaibara N. Postoperative morbidity and mortality after gastrectomy for gastric carcinoma. Hepatogastroenterology 2001; 48: [PMID: ] 13 Bokey EL, Chapuis PH, Fung C, Hughes WJ, Koorey SG, Brewer D, Newland RC. Postoperative morbidity and mortality following resection of the colon and rectum for cancer. Dis Colon Rectum 1995; 38: ; discussion [PMID: DOI: /BF ] 14 Tsiotos GG, Munoz Juarez MM, Sarr MG. Intraabdominal hemorrhage complicating surgical management of necrotizing pancreatitis. Pancreas 1996; 12: [PMID: DOI: / ] 15 Reber PU, Baer HU, Patel AG, Triller J, Büchler MW. Lifethreatening upper gastrointestinal tract bleeding caused by ruptured extrahepatic pseudoaneurysm after pancreatoduodenectomy. Surgery 1998; 124: [PMID: DOI: /S (98) ] 16 Radeleff B, Noeldge G, Heye T, Schlieter M, Friess H, Richter GM, Kauffmann GW. Pseudoaneurysms of the common hepatic artery following pancreaticoduodenectomy: successful emergency embolization. Cardiovasc Intervent Radiol 2007; 30: [PMID: DOI: /s x] 17 Miura F, Asano T, Amano H, Yoshida M, Toyota N, Wada K, Kato K, Yamazaki E, Kadowaki S, Shibuya M, Maeno S, Furui S, Takeshita K, Kotake Y, Takada T. Management of postoperative arterial hemorrhage after pancreato-biliary surgery according to the site of bleeding: re-laparotomy or interventional radiology. J Hepatobiliary Pancreat Surg 2009; 16: [PMID: DOI: /s ] 18 Liu C, Qiu YH, Luo XJ, Yi B, Jiang XQ, Tan WF, Yu Y, Wu MC. Treatment of massive pancreaticojejunal anastomotic hemorrhage after pancreatoduodenectomy. World J Gastroenterol 2009; 15: [PMID: DOI: / wjg ] 6874 October 28, 2013 Volume 19 Issue 40

187 Zhou CG et al. Embolization for postoperative gastrointestinal hemorrhage 19 Kim J, Kim JK, Yoon W, Heo SH, Lee EJ, Park JG, Kang HK, Cho CK, Chung SY. Transarterial embolization for postoperative hemorrhage after abdominal surgery. J Gastrointest Surg 2005; 9: [PMID: DOI: / j.gassur ] 20 Vreeburg EM, Snel P, de Bruijne JW, Bartelsman JF, Rauws EA, Tytgat GN. Acute upper gastrointestinal bleeding in the Amsterdam area: incidence, diagnosis, and clinical outcome. Am J Gastroenterol 1997; 92: [PMID: ] 21 Toyoda H, Nakano S, Takeda I, Kumada T, Sugiyama K, Osada T, Kiriyama S, Suga T. Transcatheter arterial embolization for massive bleeding from duodenal ulcers not controlled by endoscopic hemostasis. Endoscopy 1995; 27: [PMID: DOI: /s ] 22 Moran J, Del Grosso E, Wills JS, Hagy JA, Baker R. Laparoscopic cholecystectomy: imaging of complications and normal postoperative CT appearance. Abdom Imaging 1994; 19: [PMID: DOI: /BF ] 23 Walker TG, Salazar GM, Waltman AC. Angiographic evaluation and management of acute gastrointestinal hemorrhage. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i ] 24 Charbonnet P, Toman J, Bühler L, Vermeulen B, Morel P, Becker CD, Terrier F. Treatment of gastrointestinal hemorrhage. Abdom Imaging 2005; 30: [PMID: DOI: /s ] 25 Lerut JP, Gianello PR, Otte JB, Kestens PJ. Pancreaticoduodenal resection. Surgical experience and evaluation of risk factors in 103 patients. Ann Surg 1984; 199: [PMID: DOI: / ] 26 Smith CD, Sarr MG, vanheerden JA. Completion pancreatectomy following pancreaticoduodenectomy: clinical experience. World J Surg 1992; 16: [PMID: DOI: /BF ] 27 Cirocco WC, Golub RW. Endoscopic treatment of postoperative hemorrhage from a stapled colorectal anastomosis. Am Surg 1995; 61: [PMID: ] 28 Lee YC, Wang HP, Yang CS, Yang TH, Chen JH, Lin CC, Tsai CY, Chang LY, Huang SP, Wu MS, Lin JT. Endoscopic hemostasis of a bleeding marginal ulcer: hemoclipping or dual therapy with epinephrine injection and heater probe thermocoagulation. J Gastroenterol Hepatol 2002; 17: [PMID: DOI: /j x] 29 Perez RO, Sousa A, Bresciani C, Proscurshim I, Coser R, Kiss D, Habr-Gama A. Endoscopic management of postoperative stapled colorectal anastomosis hemorrhage. Tech Coloproctol 2007; 11: [PMID: DOI: / s ] 30 Trottier DC, Friedlich M, Rostom A. The use of endoscopic hemoclips for postoperative anastomotic bleeding. Surg Laparosc Endosc Percutan Tech 2008; 18: [PMID: DOI: /SLE.0b013e b] 31 Umano Y, Horiuchi T, Inoue M, Shono Y, Oku Y, Tanishima H, Tsuji T, Tabuse K. Endoscopic microwave coagulation therapy of postoperative hemorrhage from a stapled anastomosis. Hepatogastroenterology 2005; 52: [PMID: ] 32 Wisniewski B, Rautou PE, Drouhin F, Narcy-Lambare B, Chamseddine J, Karaa A, Grange D. Endoscopic hemoclips in postoperative bleeding. Gastroenterol Clin Biol 2005; 29: [PMID: DOI: / S (05) ] 33 Miyamoto N, Kodama Y, Endo H, Shimizu T, Miyasaka K. Hepatic artery embolization for postoperative hemorrhage in upper abdominal surgery. Abdom Imaging 2003; 28: [PMID: DOI: /s ] 34 Morris DC, Nichols DM, Connell DG, Burhenne HJ. Embolization of the left gastric artery in the absence of angiographic extravasation. Cardiovasc Intervent Radiol 1986; 9: [PMID: DOI: /BF ] P- Reviewers Beart R, Caumes E, Takeda R S- Editor Wen LL L- Editor Kerr C E- Editor Zhang DN 6875 October 28, 2013 Volume 19 Issue 40

188 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. Overexpression of nuclear β-catenin in rectal adenocarcinoma is associated with radioresistance BRIEF ARTICLE Lin Wang, Xiao-Mei Zhang, Zhen Li, Xi-Jun Liu, Jie Chai, Guang-Yong Zhang, Yu-Feng Cheng Lin Wang, Xiao-Mei Zhang, Zhen Li, Yu-Feng Cheng, Department of Radiation Oncology, Qilu Hospital, Shandong University, Jinan , Shandong Province, China Xi-Jun Liu, Department of Radiation Oncology, Shandong Tumor Hospital and Institute, Jinan , Shandong Province, China Jie Chai, Department of General Surgery, Shandong Tumor Hospital and Institute, Jinan , Shandong Province, China Guang-Yong Zhang, Department of General Surgery, Qilu Hospital, Shandong University, Jinan , Shandong Province, China Author contributions: Chai J and Zhang GY collected all the human material; Wang L, Zhang XM, Li Z and Liu XJ performed the majority of experiments; Wang L and Cheng YF designed the study and wrote the manuscript. Supported by Natural Science Foundation of Shandong Province, China, No. ZR2012HQ032; and China Postdoctoral Science Foundation funded project, No. 2013M Correspondence to: Yu-Feng Cheng, MD, Department of Radiation Oncology, Qilu Hospital, Shandong University, 107 Wenhua Xi Road, Jinan , Shandong Province, China @qq.com Telephone: Fax: Received: June 14, 2013 Revised: July 29, 2013 Accepted: September 16, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the association between nuclear β-catenin overexpression in rectal adenocarcinoma and radioresistance. METHODS: A retrospective analysis was conducted. The analysis involved 136 patients with locally advanced rectal adenocarcinoma who underwent shortcourse preoperative radiotherapy and radical resection. The expression of β-catenin in both pretreatment biopsy specimens and resected primary tumor tissues was examined by immunohistochemistry. The correlation of β-catenin expression with radioresistance was evaluated using the tumor regression grading (TRG) system. The relationship between β-catenin expression and clinicopathological characteristics was also analyzed. Univariate and logistic multivariate regression analyses were adopted to determine the independent factors of radioresistance. RESULTS: Nuclear β-catenin overexpression was more evident in radioresistant rectal adenocarcinoma than in radiosensitive rectal adenocarcinoma (57.6% vs 16.7%, P < 0.001). Nuclear β-catenin was overexpressed in favor of poor TRG ( 2), whereas membrane β-catenin was expressed in favor of good TRG ( 3). Nuclear β-catenin expression in tumor cell differentiation (P = 0.018), lymph node metastasis (P = 0.022), and TRG (P < 0.001) showed significant differences. Univariate analyses demonstrated that radioresistance is associated with nuclear β-catenin overexpression (P < 0.001). In addition, logistic multivariate regression analysis indicated that only three factors, namely, tumor size (P < 0.001), tumor cell differentiation (P < 0.001), and nuclear β-catenin overexpression (P < 0.001), are associated with radioresistance. By using radioresistance as a prediction target, nuclear β-catenin-based prediction alone achieved 83% accuracy, 65% sensitivity, and 88% specificity. CONCLUSION: Nuclear β-catenin overexpression may be a valuable candidate to predict the response of rectal adenocarcinoma to preoperative radiotherapy Baishideng. All rights reserved. Key words: β-catenin; Rectal cancer; Preoperative radiotherapy; Radioresistance; Colorectal cancer Core tip: In this paper we investigated the relationship between overexpression of nuclear β-catenin in rectal adenocarcinoma and radioresistance. We first confirmed that nuclear β-catenin overexpression in rectal adenocarcinoma is associated with radioresistance. Most importantly, we found that nuclear β-cateninbased prediction achieved a 83% accuracy, 65% sen October 28, 2013 Volume 19 Issue 40

189 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance sitivity and 88% specificity for radioresistance. We provided a novel possible molecular mechanism to explain the radioresistance in rectal adenocarcinoma and thus may provide a new therapeutic target for enhancing radiosensitivity. Wang L, Zhang XM, Li Z, Liu XJ, Chai J, Zhang GY, Cheng YF. Overexpression of nuclear β-catenin in rectal adenocarcinoma is associated with radioresistance. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6876.htm DOI: org/ /wjg.v19.i INTRODUCTION Colorectal cancer (CRC) is the third most common malignancy and the fourth most frequent cause of cancer deaths worldwide. Surgery is the predominant therapy for rectal cancer. However, rectal cancer treatment with surgery alone is insufficient because of the high incidence of local recurrence. During the past decades, preoperative radiotherapy and surgery have been increasingly used together for locally advanced rectal cancer to reduce local treatment failure [1-4]. However, many rectal cancer patients are resistant to preoperative radiotherapy because of the heterogeneity of treatment response. Therefore, predicting neoadjuvant radiotherapy response may allow individualization and more rational selection of patients that will most likely benefit from this therapy. A growing number of studies have investigated molecular markers for the prediction of tumor response to radiotherapy. XIAP [5], human phosphatidylethanolamine-binding protein 4 [6], and epidermal growth factor receptor [7] are the molecular markers associated with tumor response to radiotherapy in rectal cancer. β-catenin, a component of the Wingless/Wnt signaling pathway, can activate target genes linked to the APC gene in CRC. The localization of β-catenin is related to its function in cancer growth [8]. β-catenin in the cytoplasm and membrane binds with the intracellular domain of E-cadherin, a cell-to-cell adhesion molecule, and maintains normal tissue architecture. In the presence of a Wnt signal, β-catenin translocates to the nucleus and interacts with the lymphoid enhancing factor/t-cell factor to promote the transcription of several target genes involved in cell proliferation [9]. A previous study indicated that Wnt/β-catenin mediates the radiation resistance of mouse mammary progenitor cells and Sca1+ progenitors in an immortalized mammary gland cell line [10,11]. Thus, an active interaction probably exists between the radiotherapy response of cancer cells and Wnt/β-catenin signal pathway. However, no direct evidence about the correlation between nuclear β-catenin expression in rectal cancer and radiotherapy sensitivity has been reported to date. In this study, we enrolled 136 rectal adenocarcinoma patients treated with fractionated preoperative radiotherapy and radical resection. We investigated the expression of nuclear β-catenin in rectal adenocarcinoma using biopsy specimens and resected primary tumor tissues to determine whether nuclear β-catenin expression can be a predictive marker of tumor response to preoperative radiotherapy. MATERIALS AND METHODS Study population The study cohort comprised 136 rectal cancer patients who had undergone consecutive preoperative radiotherapy (25 Gy in five fractions for 1 wk) and radical surgery at Qilu Hospital and Shandong Tumor Hospital and Institute from November 2008 to June The subjects included 98 men and 38 women with a mean age of 64 years (range: 35 years to 78 years). First, rectal cancer was diagnosed by contrast computed tomography (CT) and colonoscopy. Afterward, archival paraffin-embedded biopsy tumor specimens and post-surgery resected tumor tissues were histologically identified as rectal adenocarcinoma. The inclusion criteria were as follows: (1) patients histologically diagnosed with rectal adenocarcinoma; and (2) rectal cancer clinically diagnosed as stage Ⅲ. The exclusion criteria were as follows: (1) hereditary nonpolyposis CRC patients and patients with familial adenomatous polyposis; and (2) patients with distant metastasis. All 136 patients met the inclusion criteria and were included in this study. However, 11 cases with distant metastasis and 1 case with familial adenomatous polyposis were excluded. All cancers were clinically diagnosed as stage Ⅲ with no distant metastasis. Tumor stage was based on the American Joint Committee on Cancer (AJCC) TNM staging system (7 th edition, 2009). The TNM stages of the patients in this cohort were as follows: 28 patients with stage ⅢA, 46 patients with stage ⅢB, and 62 patients with stage ⅢC. All patients received preoperative radiotherapy and underwent Miles operation. The distance from distal margin of rectal cancer to anal edge was less than 7 cm in all patients. The interval between preoperative radiotherapy and surgery was 10 d to 14 d. Data collection and design of the study This study was approved by the Ethics Committees of Qilu Hospital, Shandong University, and Shandong Tumor Hospital and Institute. Informed consent was obtained from each patient. Clinical information related to diagnostic procedures and tumor characteristics was collected from medical records. Clinical and pathological data, including sex, age, tumor size, tumor invasion depth, tumor cell differentiation, and lymph node metastasis, were collected. Firstly, the association between expression of nuclear β-catenin in biopsy specimens and respective resected tumor tissues was retrospectively analyzed. Meanwhile, tumor regression grading (TRG) of rectal ad October 28, 2013 Volume 19 Issue 40

190 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance enocarcinoma after radiotherapy was evaluated. Then, the relationship between nuclear β-catenin expression in rectal adenocarcinoma and clinicopathological characteristics was retrospectively analyzed. Finally, univariate analysis and logistic multivariate regression analysis were adopted to discriminate independent factors of radioresistance. Immunohistochemistry Biopsy specimens obtained through colonoscopy and resected tumor tissues collected after surgery were embedded in paraffin and cut into sections for immunohistochemical staining using the streptavidin peroxidase complex method. Tissue sections (4 μm thick) were deparaffinized and microwaved for 15 min, incubated twice in 10 mmol/l citrate buffer at 100 to retrieve the antigens, and then incubated in 3% H2O2 for 10 min to quench endogenous peroxidase. Nonspecific binding of antibodies was inhibited by incubation in 5% normal goat serum for 20 min in a humid chamber. The tissue sections were then incubated with mouse monoclonal anti-β-catenin antibodies (diluted 1:50, mouse IgG1; Cell Signaling Technology, Boston, United States) overnight at 4. The tissue sections were washed three times with PBS and then incubated with biotinylated goat antimouse IgG for 30 min at room temperature. After washing, the slides were incubated in a streptavidin-peroxidase complex for 20 min at 37, washed three times, visualized using 3,3 -diaminobenzidine, and then counterstained with hematoxylin. Sections that were stained without the primary antibodies served as the negative control. β-catenin expression is defined as brown colored staining on the membrane or in the cytoplasm and nucleus. For immunohistochemical assessment, six slides were randomly selected and observed at a magnification of 200 by two pathologists. The immunostained slides were scored as previously described [12]. In brief, the immunostained slides were scored using the sum of the signal intensity (0 = no expression; 1 = weak expression; 2 = moderate expression; 3 = strong expression) and the percentage of positive cells (% tumor cells: 0 = 0%; 1 = 1% to 25%; 2 = 26% to 50%; 3 = 51% to 75%; and 4 = 76% to 100%). Nuclear β-catenin immunoreactivity at the invasive front was considered positive if moderate or strong expression was observed in the nuclei. Nuclear β-catenin overexpression was considered positive when the expression was observed in > 50% of the tumor cells. TRG The response of rectal cancer to preoperative radiotherapy was evaluated in the hematoxylin and eosin-stained slides using the TRG system as previously described [13]. The characteristics of each grade were as follows: TRG 0, no regression; TRG 1, dominant tumor mass with obvious fibrosis in 25% or less of the tumor mass; TRG 2, dominant tumor mass with obvious fibrosis in 26 to 50% of the tumor mass; TRG 3, dominant fibrosis outgrowing the tumor mass; and TRG 4, no viable tumor cells (only a fibrotic mass). Statistical analysis Statistical analysis was performed using SPSS16.0. χ 2 test and Fisher exact test were used to analyze the correlation between nuclear β-catenin expression and clinicopathological characteristics. Univariate and logistic multivariate regression analyses were performed to determine the independent factors of TRG. P < 0.05 was considered statistically significant. RESULTS β-catenin expression in biopsy specimens and in respective resected tumor tissues The expression of β-catenin in the biopsy and respective resected tumor tissues is presented in Figure 1. β-catenin expression was observed in all rectal cancer specimens. β-catenin was expressed mostly in a nuclear-associated staining pattern in patients who exhibited resistance to preoperative radiotherapy (Figure 1A). Conversely, β-catenin was expressed mostly in a membrane-associated staining pattern in patients who exhibited hyper-radiosensitivity (Figure 1B). Nuclear β-catenin overexpression was observed in 68 cases who exhibited radioresistance (57.6%). However, this overexpression was only observed in three patients who exhibited radiosensitivity (16.7%). Therefore, nuclear β-catenin overexpression is more evident in radioresistant patients than in radiosensitive patients (P < 0.001, Table 1). After preoperative radiotherapy, nuclear β-catenin was overexpressed in favor of poor TRG ( 2) (Figure 1C), whereas membrane β-catenin was overexpressed in favor of good TRG ( 3) (Figure 1D). This result suggests that nuclear β-catenin overexpression is a predictive marker of radioresistance. Relationship between nuclear β-catenin expression in rectal adenocarcinoma and clinicopathological characteristics χ 2 test was performed to investigate the relationship between nuclear β-catenin expression and clinicopathological features. The correlations between nuclear β-catenin expression level and clinicopathological variables are shown in Table 1. Nuclear β-catenin expression in tumor cell differentiation (P = 0.018), lymph node metastasis (P = 0.022), and TGR (P < 0.001) showed significant differences. Predictive value of nuclear β-catenin overexpression for radioresistance Clinicopathological characteristics were divided into two groups according to tumor response to radiotherapy to confirm the predictive value of nuclear β-catenin overexpression as a biomarker of radioresistance. Univariate and multivariate analyses were performed to determine the factors related to radioresistance. Univariate analysis results (Table 2) demonstrated that radioresistance was associated with tumor size (P < 0.001), tumor cell differ October 28, 2013 Volume 19 Issue 40

191 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance A B C D Figure 1 β-catenin expression in biopsy specimens and resected tumor tissues ( 200). A: Nuclear β-catenin was overexpressed in biopsy specimens from patients who exhibited resistance to preoperative radiotherapy; B: β-catenin presented mostly in a membrane-associated staining pattern in biopsy specimens from patients who exhibited hyper-radiosensitivity; C: Nuclear β-catenin was overexpressed in specimens with poor tumor regression grading (TRG) ( 2); D: β-catenin presented mostly in a membrane-associated staining pattern in specimens with good TRG ( 3). Table 1 Correlation of nuclear β-catenin expression in rectal adenocarcinoma with clinicopathologic characteristics Characteristics n Nuclear β-catenin expression P value 1 50% > 50% Gender Male Female Age (yr) > Tumor size (cm) > Tumor cell differentiation Well/moderately differentiated Poorly differentiated Tumor invasion depth T1/T T3/T Lymph node metastasis N N TRG TRG < TRG Value is the result of χ 2 test in the same factor, and P < 0.05 is considered significant statistically. TRG: Tumor regression grading. entiation (P < 0.001), tumor invasion depth (P = 0.027), and nuclear β-catenin expression (P < 0.001). However, logistic multivariate regression analysis retained only three factors in the model, namely, tumor size (P < 0.001), tumor cell differentiation (P < 0.001), and nuclear β-catenin overexpression (P < 0.001). By using radioresistance as a prediction target, nuclear β-catenin-based prediction alone achieved 83% accuracy, 65% sensitivity, and 88% specificity (Table 3). DISCUSSION In the present study, the expression of β-catenin in 136 rectal adenocarcinoma patients was detected and its relationship with radioresistance was investigated. Our data demonstrated that overexpression of nuclear β-catenin is associated with radioresistance in rectal adenocarcinoma. To the best of our knowledge, few studies have been done to investigate the prognostic value of nuclear β-catenin overexpression for radioresistance in rectal cancer. The clinical significance of the current study is that we might provide promising biomarkers to predict sensitivity of rectal cancer to radiotherapy. Preoperative radiotherapy has become a standard treatment for locally advanced rectal cancer. Obtaining an accurate prediction of cancer cell response to radiothera October 28, 2013 Volume 19 Issue 40

192 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance Table 2 Univariate and multivariate regression analyses of the association of clinical features with radiotherapy response of rectal adenocarcinoma n (%) Clinicopathological factors Univariate analysis Multivariate analysis Good response 1 P value OR P value Gender Male 15 (13.8) NS Female 3 (10.7) Age (yr) 55 5 (26.3) NS > (11.1) Tumor size (cm) 5 16 (20.5) < < > 5 2 (3.5) Tumor cell differentiation Well/moderately differentiated 4 (4.1) < < Poorly differentiated 14 (36.8) Tumor invasion depth T1/T2 7 (30.4) T3/T4 11 (9.7) Nuclear β-catenin expression 50% 15 (23.1) < < > 50% 3 (4.2) 1 Tumor regression grading 3. NS: Not selected. Table 3 Predictive value of nuclear β-catenin as a marker of radioresistance in 136 patientsof rectal adenocarcinoma Nuclear β-catenin expression Good response Poor response 50% 15% 50% > 50% 3% 68% Accuracy 83% Sensitivity 65% Specificity 88% Positive predictive value 79% Negative predictive value 48% py to determine if a patient would benefit from adjuvant therapy is challenging [14]. Previous studies indicated that molecules involved in signaling pathways are crucial to the sensitivity of cancer cells to radiotherapy [15,16]. Numerous studies have investigated biomarkers to predict rectal cancer sensitivity to radiotherapy [17-19]. However, only a few scholars have focused on the Wnt/β-catenin signaling pathway, which is vital in the progression of rectal cancer. β-catenin is a component of the Wingless/Wnt signaling pathway. Previous studies have demonstrated that β-catenin is associated with the sensitivity of some cancers to radiotherapy. Kim et al [20] found that glioblastoma (GBM) cell lines enriched with cells positive for active β-catenin are increased by in vitro radiation treatment. This finding suggests that the radiation resistance of GBM is partly mediated by the activation of stem cell-associated pathways, including Wnt. Watson et al [21] found that the expression of a kinase dead mutant GSK3β endows Panc1 and BxPC3 pancreatic cancer cells with radioresistance. β-catenin silencing results in radiosensitization, whereas a nondegradable β-catenin construct induces radioresistance. These data support the hypothesis that GSK3β modulates the cellular response to radiation in a β-catenin-dependent mechanism. In the current study, only stage Ⅲ rectal adenocarcinoma patients who accepted preoperative radiotherapy were included to eliminate the effects of different therapeutic methods, such as concurrent chemoradiotherapy. The results indicated that nuclear β-catenin overexpression is more evident in tumor biopsy specimens from patients who exhibited radioresistance. We also found that tumor tissues were relatively intact when nuclear β-catenin was overexpressed in tumor cells after preoperative radiotherapy. These immunohistochemical data indicated that the accumulation of nuclear β-catenin in tumor cells is critical in the radioresistance of rectal adenocarcinoma. Regarding the correlation between nuclear β-catenin expression and clinicopathological characteristics, previous investigators reported contradictory results. Zhang et al [22] believed that nuclear β-catenin accumulation is related to tumor stage and/or metastasis. However, correlations between nuclear β-catenin and pertinent clinicopathological variables were not observed in Baldus s study [23]. Our data demonstrated that nuclear β-catenin overexpression is related to low tumor cell differentiation and lymph node metastasis. Hyper-radiosensitivity is associated with low tumor cell differentiation. In the current study, a relationship was found between nuclear β-catenin overexpression and low tumor cell differentiation. However, tumor tissues in which nuclear β-catenin was overexpressed exhibited resistance to preoperative radiotherapy. This result suggests that nuclear β-catenin overexpression is a potential mechanism by which rectal adenocarcinoma cells avoid the destructive effect of radiotherapy. Univariate and multivariate analyses were used to determine the factors related to radioresistance and thus confirm the predictive value of nuclear β-catenin overex October 28, 2013 Volume 19 Issue 40

193 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance pression for radioresistance. Univariate analysis demonstrated that nuclear β-catenin overexpression is associated with tumor response to radiotherapy. This finding coincides with the immunohistochemical result. A multivariate logistic regression analysis model was constructed to distinguish the independent factors for radioresistance and obtain a more precise estimate of the effect of nuclear β-catenin overexpression on tumor response to radiotherapy. As shown in Table 2, tumor response to radiotherapy is associated with nuclear β-catenin overexpression. This result suggests that nuclear β-catenin overexpression may affect radioresistance independently. When radioresistance was used as a prediction target in this study, nuclear β-catenin overexpression-based prediction alone achieved 83% accuracy, 65% sensitivity, and 88% specificity. These data confirmed that our conclusion is consistent with previous findings and suggested that nuclear β-catenin overexpression in rectal adenocarcinoma is a useful marker of radioresistance. Prediction of rectal cancer patient response is critical in tailoring preoperative radiotherapy to individuals. In addition, the search for predictive markers of radiotherapy is similar to the development of targeted therapy to some extent. We believe that β-catenin is a potential target for reducing radioresistance in rectal adenocarcinoma. In the future, β-catenin-targeting molecular drugs and radiation therapy may be used in combination to improve the efficacy of radiotherapy for rectal adenocarcinoma. There are some potential limitations of this study. First, this is a retrospective study, and the confounding effects associated with a design of this kind are surely present. Second, only those patients who accepted preoperative radiotherapy were included in order to study the prognostic value of nuclear β-catenin overexpression for radioresistance in this study. Having only a small number of patients in the study also prevented us making further analysis about the correlation of nuclear β-catenin overexpression with clinical outcome. We believe that a larger prospective trial and long-term follow up study will allow us to confirm our conclusions. In conclusion, nuclear β-catenin overexpression in rectal adenocarcinoma is associated with radioresistance. Both clinical and pathological data support our conclusion. Therefore, nuclear β-catenin overexpression in rectal adenocarcinoma can be used as a valuable predictor of radioresistance. However, these preliminary findings must be verified in a larger, prospective, controlled clinical study and in a subsequent experimental study. COMMENTS Background Radiotherapy is a major treatment for rectal cancer. During previous decades, preoperative radiotherapy has increasingly been used together with surgery for locally advanced rectal cancer in order to reduce local treatment failures. However, many rectal cancer patients are actually resistant to preoperative radiotherapy due to the heterogeneity of treatment response. Therefore, the ability to predict response for neoadjuvant radiotherapy may allow individualization and more rational selection of patients that will most likely benefit from this therapy. Research frontiers A previous study indicated that Wnt/β-catenin mediates radiation resistance of mouse mammary progenitor cells and Sca1+ progenitors in an immortalized mammary gland cell line. Thus, there seems to be active interaction between the response to radiotherapy of cancer cells and the Wnt/β-catenin signal pathway. However, there is no direct evidence about the correlation between nuclear β-catenin expression in rectal cancer and radiotherapy sensitivity up to now. Innovations and breakthroughs In this paper the authors investigated the relationship between overexpression of nuclear β-catenin in rectal adenocarcinoma and radioresistance. To the best of the knowledge, this is the first study that analyzes the relation between nuclear β-catenin overexpression in rectal adenocarcinoma and radioresistance. The authors provided a novel possible molecular mechanism to explain the radioresistance in rectal adenocarcinoma and thus may provide a new therapeutic target for enhancing radiosensitivity. Applications By studying the relationship between overexpression of nuclear β-catenin in rectal adenocarcinoma and radioresistance, this study may provide a new therapeutic target for enhancing radiosensitivity for rectal adenocarcinoma. Terminology β-catenin is a component of the Wingless/Wnt signaling pathway and can activate target genes linking with the APC gene in colorectal cancer. Its localization relates to its function in cancer growth. β-catenin in the cytoplasm and membrane binds with the intracellular domain of E-cadherin, which is a cell-tocell adhesion molecule, and to play a significant role in maintaining the normal tissue architecture. Peer review The authors studied the clinical significance of β-catenin overexpression and radioresistance in patients with rectal adenocarcinoma. This paper is very interesting and the information is up to date. The study provided a novel possible molecular mechanism to explain radioresistance in rectal adenocarcinoma and thus may provide a new therapeutic target for enhancing radiosensitivity. REFERENCES 1 Sauer R, Becker H, Hohenberger W, Rödel C, Wittekind C, Fietkau R, Martus P, Tschmelitsch J, Hager E, Hess CF, Karstens JH, Liersch T, Schmidberger H, Raab R. Preoperative versus postoperative chemoradiotherapy for rectal cancer. N Engl J Med 2004; 351: [PMID: DOI: /NEJMoa040694] 2 Lim SB, Yu CS, Hong YS, Kim TW, Kim JH, Kim JC. Longterm outcomes in patients with locally advanced rectal cancer treated with preoperative chemoradiation followed by curative surgical resection. J Surg Oncol 2012; 106: [PMID: DOI: /jso.23181] 3 Pacelli F, Sanchez AM, Covino M, Tortorelli AP, Bossola M, Valentini V, Gambacorta MA, Doglietto GB. Improved outcomes for rectal cancer in the era of preoperative chemoradiation and tailored mesorectal excision: a series of 338 consecutive cases. Am Surg 2013; 79: [PMID: ] 4 Bujko K, Richter P, Smith FM, Polkowski W, Szczepkowski M, Rutkowski A, Dziki A, Pietrzak L, Kołodziejczyk M, Kuśnierz J, Gach T, Kulig J, Nawrocki G, Radziszewski J, Wierzbicki R, Kowalska T, Meissner W, Radkowski A, Paprota K, Polkowski M, Rychter A. Preoperative radiotherapy and local excision of rectal cancer with immediate radical re-operation for poor responders: a prospective multicentre study. Radiother Oncol 2013; 106: [PMID: DOI: /j.radonc ] 5 Moussata D, Amara S, Siddeek B, Decaussin M, Hehlgans S, Paul-Bellon R, Mornex F, Gerard JP, Romestaing P, Rödel F, Flourie B, Benahmed M, Mauduit C. XIAP as a radioresistance factor and prognostic marker for radiotherapy in human rectal adenocarcinoma. Am J Pathol 2012; 181: [PMID: DOI: /j.ajpath ] 6 Qiu J, Yang G, Shen Z, Xie Y, Wang L. hpebp4 as a predic October 28, 2013 Volume 19 Issue 40

194 Wang L et al. β-catenin in rectal adenocarcinoma and radioresistance tive marker for the pathological response of rectal cancer to preoperative radiotherapy. Int J Colorectal Dis 2013; 28: [PMID: DOI: /s ] 7 Kuremsky JG, Tepper JE, McLeod HL. Biomarkers for response to neoadjuvant chemoradiation for rectal cancer. Int J Radiat Oncol Biol Phys 2009; 74: [PMID: DOI: /j.ijrobp ] 8 Harris TJ, Peifer M. Decisions, decisions: beta-catenin chooses between adhesion and transcription. Trends Cell Biol 2005; 15: [PMID: ] 9 van Es JH, Barker N, Clevers H. You Wnt some, you lose some: oncogenes in the Wnt signaling pathway. Curr Opin Genet Dev 2003; 13: [PMID: ] 10 Woodward WA, Chen MS, Behbod F, Alfaro MP, Buchholz TA, Rosen JM. WNT/beta-catenin mediates radiation resistance of mouse mammary progenitor cells. Proc Natl Acad Sci USA 2007; 104: [PMID: DOI: / pnas ] 11 Chen MS, Woodward WA, Behbod F, Peddibhotla S, Alfaro MP, Buchholz TA, Rosen JM. Wnt/beta-catenin mediates radiation resistance of Sca1+ progenitors in an immortalized mammary gland cell line. J Cell Sci 2007; 120: [PMID: DOI: /jcs.03348] 12 Horst D, Reu S, Kriegl L, Engel J, Kirchner T, Jung A. The intratumoral distribution of nuclear beta-catenin is a prognostic marker in colon cancer. Cancer 2009; 115: [PMID: DOI: /cncr.24254] 13 Dworak O, Keilholz L, Hoffmann A. Pathological features of rectal cancer after preoperative radiochemotherapy. Int J Colorectal Dis 1997; 12: [PMID: ] 14 Perez RO. Predicting response to neoadjuvant treatment for rectal cancer: a step toward individualized medicine. Dis Colon Rectum 2011; 54: [PMID: DOI: /DCR.0b013e ce] 15 Wang Y, Liu L, Zhou D. Inhibition of p38 MAPK attenuates ionizing radiation-induced hematopoietic cell senescence and residual bone marrow injury. Radiat Res 2011; 176: [PMID: ] 16 Ho SY, Wu WJ, Chiu HW, Chen YA, Ho YS, Guo HR, Wang YJ. Arsenic trioxide and radiation enhance apoptotic effects in HL-60 cells through increased ROS generation and regulation of JNK and p38 MAPK signaling pathways. Chem Biol Interact 2011; 193: [PMID: DOI: / j.cbi ] 17 Shioya M, Takahashi T, Ishikawa H, Sakurai H, Ebara T, Suzuki Y, Saitoh J, Ohno T, Asao T, Kuwano H, Nakano T. Expression of hypoxia-inducible factor 1α predicts clinical outcome after preoperative hyperthermo-chemoradiotherapy for locally advanced rectal cancer. J Radiat Res 2011; 52: [PMID: ] 18 Kim K, Chie EK, Wu HG, Kim SG, Lee SH, Kang GH, Hyun CL, Ha SW. High survivin expression as a predictor of poor response to preoperative chemoradiotherapy in locally advanced rectal cancer. Int J Colorectal Dis 2011; 26: [PMID: DOI: /s ] 19 Shinto E, Hashiguchi Y, Ueno H, Kobayashi H, Ishiguro M, Mochizuki H, Yamamoto J, Hase K. Pretreatment CD133 and cyclooxygenase-2 expression as the predictive markers of the pathological effect of chemoradiotherapy in rectal cancer patients. Dis Colon Rectum 2011; 54: [PMID: DOI: /DCR.0b013e ] 20 Kim Y, Kim KH, Lee J, Lee YA, Kim M, Lee SJ, Park K, Yang H, Jin J, Joo KM, Lee J, Nam DH. Wnt activation is implicated in glioblastoma radioresistance. Lab Invest 2012; 92: [PMID: DOI: /labinvest ] 21 Watson RL, Spalding AC, Zielske SP, Morgan M, Kim AC, Bommer GT, Eldar-Finkelman H, Giordano T, Fearon ER, Hammer GD, Lawrence TS, Ben-Josef E. GSK3beta and betacatenin modulate radiation cytotoxicity in pancreatic cancer. Neoplasia 2010; 12: [PMID: ] 22 Zhang B, Ougolkov A, Yamashita K, Takahashi Y, Mai M, Minamoto T. beta-catenin and ras oncogenes detect most human colorectal cancer. Clin Cancer Res 2003; 9: [PMID: ] 23 Baldus SE, Mönig SP, Huxel S, Landsberg S, Hanisch FG, Engelmann K, Schneider PM, Thiele J, Hölscher AH, Dienes HP. MUC1 and nuclear beta-catenin are coexpressed at the invasion front of colorectal carcinomas and are both correlated with tumor prognosis. Clin Cancer Res 2004; 10: [PMID: DOI: / CCR ] P- Reviewers Braet F, Cichoz-Lach H, Cui G, Triantafyllou K, Yu B S- Editor Gou SX L- Editor O Neill M E- Editor Zhang DN 6882 October 28, 2013 Volume 19 Issue 40

195 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Expression and significance of cyclooxygenase-2 mrna in benign and malignant ascites Jing Lu, Xiao-Feng Li, Li-Xia Kong, Lin Ma, Su-Huan Liao, Chang-You Jiang Jing Lu, Xiao-Feng Li, Li-Xia Kong, Su-Huan Liao, Department of Gastroenterology, the Fifth Affiliated Hospital of Sun Yat-Sen University, Zhuhai , Guangdong Province, China Lin Ma, Department of Oncology, the Fifth Affiliated Hospital of Sun Yat-Sen University, Zhuhai , Guangdong Province, China Chang-You Jiang, Health Bureau of Jinwan District, Zhuhai , Guangdong Province, China Author contributions: Lu J performed the research and drafted the article; Li XF designed the research and revised the article; Kong LX and Ma L critically revised the article; Liao SH and Jiang CY analyzed the data and interpreted the results. Supported by Fund of Science and Technology Plan Project in Zhuhai, No. PC Correspondence to: Dr. Lin Ma, Department of Oncology, the Fifth Affiliated Hospital of Sun Yat-Sen University, No. 52, Meihua East Road, Zhuhai , Guangdong Province, China. linma1227@hotmail.com Telephone: Fax: Received: June 2, 2013 Revised: August 8, 2013 Accepted: September 3, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the mrna expression of cyclooxygensae-2 (COX-2) in benign and malignant ascites, and to explore the difference in COX-2 mrna expression among different diseases. METHODS: A total of 36 samples were collected from the Fifth Affiliated Hospital of Sun Yat-Sen University and divided into two experimental groups: benign ascites (n = 21) and malignant ascites (n = 15). Benign ascites included cirrhotic ascites (n = 10) and tuberculous ascites (n = 5). Malignant ascites included oophoroma (n = 7), cancer of colon (n = 5), cancer of the liver (n = 6), gastric cancer (n = 2), and bladder carcinoma (n = 1). The mrna expression of COX-2 in ascites was examined with reverse transcriptase polymerase chain reaction (RT-PCR) technology, and the positive rate of COX-2 mrna was compared between different diseases. RESULTS: The positive rate of COX-2 mrna in malignant ascites was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15), difference being significant between these two groups (χ 2 = 4.051, P = 0.044). The proportion of the positive rate in the malignant ascites was as follows: ovarian cancers 57.1% (4/7), colon cancer 40.0% (2/5), liver cancer 33.3% (2/6), gastric cancer 50.0% (1/2), and bladder cancer 0.00% (0/1). However, there was no significant difference in COX-2 mrna expression among various tumors with malignant ascites (χ 2 = 1.614, P = 0.806). Among the benign ascites, COX-2 mrna levels were different between the tuberculous ascites (0/5) and cirrhotic ascites (1/10), but there was no significant difference (P = 1.000). CONCLUSION: COX-2 mrna, detected by RT-PCR, is useful in the differential diagnosis of benign and malignant ascites, which also has potential value in the clinical diagnosis of tumors Baishideng. All rights reserved. Key words: Ascites; Cyclooxygensae-2 mrna; Reverse transcriptase polymerase chain reaction; Malignant tumor Core tip: Ascites is a common symptom caused by a variety of diseases, the differential diagnosis between benign ascites and malignant ascites is one of the most important issues in clinical practice. Cytologic examinations and ascites tumor markers can provide important evidence, but their sensitivity and specificity are far from satisfactory. Our study aimed to explore the difference in cyclooxygensae-2 (COX-2) mrna expression among different diseases. Our research suggests that COX-2mRNA can be detected by reverse transcriptase polymerase chain reaction, but there are no significant differences in the expression of COX-2 mrna among 6883 October 28, 2013 Volume 19 Issue 40

196 Lu J et al. Detection of cyclooxygenase-2mrna in ascites various disease types with benign or malignant ascites. Lu J, Li XF, Kong LX, Ma L, Liao SH, Jiang CY. Expression and significance of cyclooxygenase-2 mrna in benign and malignant ascites. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6883.htm DOI: i INTRODUCTION Ascites is a gastroenterological term for an accumulation of fluid in the peritoneal cavity, which might result from cirrhosis, tuberculous peritonitis or a malignant tumor. The detection of exfoliated ascites cells is often used to identify these diseases in the clinic, but there is no economic, practical, or effective index with a high specificity. Therefore, it is important to discriminate benign from malignant ascites for clinical diagnosis and treatment [1,2]. In recent years, cyclooxygensae-2 (COX-2) has been extensively studied as an inducible expression protein, and has been detected in various tumor tissues in epidemiologic and cytologic researches [3,4], such as pancreatic cancer, colorectal carcinoma, non-small lung cancer and so on. Research has found that COX-2 expression is unregulated in precancerous lesions and preinvasive carcinoma and positively correlates with tumor invasion and lymphatic metastasis [5,6]. Therefore, increasing expression of COX-2 might occur in the early stages of the tumor and the detection of COX-2 level is helpful for early diagnosis. However, there are only few studies regarding COX-2 expression in benign and malignant ascites. We employed reverse transcriptase polymerase chain reaction (RT-PCR) technology to detect the expression level of COX-2 in benign and malignant ascites, and analyzed the difference in mrna expression of COX-2 among different diseases. MATERIALS AND METHODS Subjects A total of 36 patients with ascites who underwent abdominocentesis at the Fifth Affiliated Hospital of Sun Yat-Sen University between August 2011 and March 2012 were selected. The subjects were divided into benign and malignant groups according to medical history, physical examination, B ultrasound, computed tomography (CT), pathology and the presence of exfoliated tumor cells. There were 15 patients with benign ascites, including nine males and six females, aged years with an average age of 62.5 ± 1.8 years; the patients consisted of 10 cases of cirrhosis and five cases of tuberculous peritonitis according to disease type. There were 21 patients with malignant ascites, including 11 males and 10 females, aged years with an average age of 58 ± 2.3 years; the Table 1 Primer sequences of cyclooxygensae-2 and glyceraldehyde-3-phosphate dehydrogenase genes Primer Primer sequence Product size COX-2 GAPDH Forward primer Reverse primer Forward primer Reverse primer 5 -CTTGGGTGTCAAAGGTAA-3 5 -AGGGACTTGAGGAGGGTA-3 5 -GTGGGGCGCCAGGCACCA-3 5 -CTCCTATGTCACGCACATTC bp 146 bp COX-2: Cyclooxygensae-2; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. patients consisted of seven cases of ovarian cancer, five cases of colon cancer, six cases of liver cancer, two cases of gastric cancer and one case of bladder cancer according to disease type. The samples were centrifuged at 3000 r/min for 15 min immediately after collection from the patients, and the supernatant was removed. The pellet was stored in -80 refrigerator for total RNA extraction. The sample collection was approved by the Ethics Committee of the hospital and all patients provided written informed consent. RT-PCR Primer design: The gene sequences of the primers were designed with Primer Premier 5.0 software according to the literature [5,6] and mrna sequences for human COX-2 reported by NCBI; GAPDH was selected as the positive control primer for RT-PCR and synthesized by the Shanghai ShengGong Biological Engineering Co., Ltd., China (Table 1). Total RNA extraction: Total RNA was extracted from benign and malignant ascites with RNA extraction reagent (Trizol, Invitrogen, United States), and its content and purity were measured by ultraviolet spectrophotometry [1.9 < D(260)/D(280) < 2.1]. Synthesis of cdna by reverse transcription: Reverse transcription was performed to synthesize cdna with the Avian Myeloblastosis Virus (AMV) Reverse Transcriptase Kit, which contained AMV reverse transcriptase and olig(dt)18 primer. The RT-PCR reaction mixture of 10 μl contained 1 μl extracted total RNA, 2 μl MgCl2, 1 μl 10 RNA PCR buffer, 3.75 μl RNase free dh2o, 1 μl dntp mixture, 0.25 μl RNase inhibitor, 0.5 μl AMV reverse transcriptase and 0.5 μl Oligo dt-adaptor primer. The reaction conditions were set at 30 for 10 min, 50 for 30 min, 99 for 5 min and 5 for 5 min. PCR amplification: After reverse transcription, cdna was used as the template in PCR amplification with primers for COX-2 and glyceraldehyde-3-phosphate dehydro October 28, 2013 Volume 19 Issue 40

197 Lu J et al. Detection of cyclooxygenase-2mrna in ascites Table 2 mrna expression of cyclooxygensae-2 n (%) Group COX-2 mrna expression χ 2 P value genase (GAPDH); a negative control was established. The PCR reaction mixture of 50 μl contained 3 μl MgCl2, 4 μl 10 LA PCR buffer II (Mg² + free), μl sterilized distilled water, 0.25 μl TaKaRa LA Taq and 1 μl the COX-2 or GAPDH primers. The PCR cycle consisted of the following steps: denaturing at 94 for 30 s, annealing at 60 for 30 s and elongation at 72 for 1.5 min, which was repeated for 30 cycles. Amplification products were utilized for electrophoresis in a 1.5% agarose gel, and were observed and photographed under ultraviolet light. Statistical analysis Statistical analysis was performed with SPSS 13.0 software, and qualitative data was described by frequency and rate; the comparison between groups of qualitative data was made using the χ 2 test with Yates continuity correction and Fisher s exact probability test; P < 0.05 was considered significant. RESULTS Positive Negative In benign and malignant ascites Benign ascites 1 (6.7) 14 (93.3) Malignant ascites 9 (42.9) 12 (57.1) Among different disease types in benign group Cirrhosis with ascites 1 (6.7) 9 (60) Tuberculous ascites 0 (0.0) 5 (33.3) Among different disease types in malignant group Ovarian cancer 4 (19.0) 3 (14.3) Colon cancer 2 (9.5) 3 (14.3) Liver cancer 2 (9.5) 4 (19.0) Gastric cancer 1 (4.8) 1 (4.8) Bladder cancer 0 (0.0) 1 (4.8) 1 Comparison was made between groups using Yates continuity correction; 2 Comparison was made between groups using Fisher's exact probability test; 3 Comparison between groups utilized χ 2 test; P > 0.05 was considered not statistically significant. P < 0.05 was considered statistically significant. COX-2: Cyclooxygensae-2. mrna expression of COX-2 in benign and malignant ascites The positive rate of COX-2 mrna in malignant ascites was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15), the difference being significant between the two groups (χ 2 = 4.051, P = 0.044), (Table 2). mrna expression of COX-2 among different disease types in benign group Among the benign ascites, COX-2 mrna levels were different between the tuberculous ascites (0/5) and cirrhotic ascites (1/10), but the difference being not significant (P = 1.000), (Table 2). mrna expression of COX-2 among different disease types in malignant group The proportion of the positive rate in the malignant ascites was as follows: ovarian cancers 57.1% (4/7), colon cancer 40.0% (2/5), liver cancer 33.3% (2/6), gastric cancer 50.0% (1/2), and bladder cancer 0.00% (0/1). However, there was no significant difference in COX-2 mrna expression among various tumors with malignant ascites (χ 2 = 1.614, P = 0.806; P > 0.05), (Table 2). DISCUSSION COX, or prostaglandin-endoperoxide synthase (PGH), is a major rate-limiting enzyme in the synthesis of prostaglandin, which is able to metabolize arachidonic acid into prostaglandin products [7-9]. COX-2, an inducible protein expression, is absent in normal cells and tissues, but is rapidly synthesized and expressed under pathological conditions or after stimulation (such as inflammation, hypoxia, laser radiation, ultraviolet radiation, etc.). COX-2 is involved in a variety of pathophysiological processes, such as the occurrence and development of inflammation and cancer [10]. At present, mrna expression of COX-2 in various tumor tissues has been extensively investigated; increasing numbers of research have demonstrated that COX-2 expression is unregulated in precancerous lesions and preinvasive carcinoma and positively correlates with tumor invasion and lymphatic metastasis [11-14]. Therefore, increased expression of COX-2 might occur in the early stage of the tumor and the detection of COX-2 level is helpful for early diagnosis [15,16]. Ascites is a common symptom of many diseases and the differential diagnosis of benign and malignant ascites is important in clinical practice. So far, smear tests of exfoliated cells from ascites and the detection of tumor markers, such as CA-125, CA19-9 and AFP, have been employed to identify ascites induced by malignant tumors, but these indices are far from satisfactory in terms of sensitivity and specificity, so it is important to search for a new indicator of benign and malignant ascites [17-21] Since COX-2 has a close relationship with tumors, its expression in malignant ascites has become an issue that is worth exploring. We used RT-PCR to assess the mrna expression of COX-2 in 21 cases of malignant ascites. The positive rate of COX-2 mrna was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15) (P < 0.05). This result indicated that the measurement of COX-2 mrna facilitates the identification of benign and malignant ascites and has a potential value for clinical diagnosis and screening of tumors. In previous studies on COX-2, its expression was usually detected in malignant tumor tissues [22-24], but our experiment used ascites as the samples. They were convenient to collect from patients, with less pain and being easy for clinical application. In addition, COX-2 is absent in normal cells and tissues as an inducible expression protein with specificity, so is a 6885 October 28, 2013 Volume 19 Issue 40

198 Lu J et al. Detection of cyclooxygenase-2mrna in ascites potential indicator for the identification of benign and malignant ascites, and an effective supplement to common indices, such as CA125, CA19-9 and AFP. There were no significant differences in the expression of COX-2 mrna among various disease types with benign or malignant ascites (P > 0.05), which was probably associated with the small number of samples and requires further confirmation. We employed one step RT-PCR, which was easy to perform, required little contact with experimental samples and avoided unnecessary contamination, and also facilitated further research and the development of clinical detection kits. In conclusion, differential diagnosis between benign and malignant ascites is of importance and is helpful for designing a treatment plan. We hope our study can provide a new insight to explore this field in the future. COMMENTS Background In recent years, cyclooxygensae-2 (COX-2) has been extensively studied as an inducible expression protein, and has been detected in various tumor tissues in epidemiological and cytological research. Therefore, increased expression of COX-2 might occur in the early stage of the tumor and the detection of COX-2 level is helpful for early diagnosis. Research frontiers At present, mrna expression of COX-2 in various tumor tissues has been extensively investigated; more and more research has demonstrated that COX-2 expression is unregulated in precancerous lesions and preinvasive carcinoma and positively correlates with tumor invasion and lymphatic metastasis. Therefore, increased expression of COX-2 might occur in the early stages of the tumor and the detection of COX-2 level is helpful for early diagnosis. Innovations and breakthroughs This study employed RT-PCR to assess the mrna expression of COX-2 in 21 cases of malignant ascites. The positive rate of COX-2 mrna was 42.9% (9/21), which was significantly higher than in benign ascites, 6.7% (1/15), (P < 0.05). This result indicated that the measurement of COX-2 mrna facilitates the differential diagnosis between benign and malignant ascites and has a potential value for clinical diagnosis and screening of tumors. Applications Differential diagnosis between benign and malignant ascites is of importance and is helpful for designing a treatment plan. The study can provide a new insight to this field in the future. Peer review This is an interesting manuscript about mrna expression of COX-2 in benign and malignant ascites. The authors made a good research on this topic. Differences in COX-2 mrna expression among different diseases were explored. The data is well present and discussed. REFERENCES 1 Metzgeroth G, Kuhn C, Schultheis B, Hehlmann R, Hastka J. Diagnostic accuracy of cytology and immunocytology in carcinomatous effusions. Cytopathology 2008; 19: [PMID: DOI: /j x] 2 Gu H, Deng XY, Yan L, Zhang GY. The diagnosis potential of the ratio for the differentiation between benign and malignant ascites by the combined measurement of ascites and serum tumor markers as well as the F/S ratio. Zhongguo Xiandai Yixue Zazhi 2011; 14: Hill R, Li Y, Tran LM, Dry S, Calvopina JH, Garcia A, Kim C, Wang Y, Donahue TR, Herschman HR, Wu H. Cell intrinsic role of COX-2 in pancreatic cancer development. Mol Cancer Ther 2012; 11: [PMID: DOI: / MCT ] 4 Jiang H, Wang J, Zhao W. Cox-2 in non-small cell lung cancer: a meta-analysis. Clin Chim Acta 2013; 419: [PMID: DOI: /j.cca ] 5 Lurje G, Vallbohmer D, Collet PH, Xi H, Baldus SE, Brabender J, Metzger R, Heitmann M, Neiss S, Drebber U, Holscher AH, Schneider PM. COX-2 mrna expression is significantly increased in acid-exposed compared to nonexposed squamous epithelium in gastroesophageal reflux disease. J Gastrointest Surg 2007; 11: [PMID: DOI: /s ] 6 Strazisar M, Mlakar V, Glavac D. The expression of COX-2, htert, MDM2, LATS2 and S100A2 in different types of nonsmall cell lung cancer (NSCLC). Cell Mol Biol Lett 2009; 14: [PMID: DOI: /s ] 7 Li Q, Liu N, Shen B, Zhou L, Wang Y, Wang Y, Sun J, Fan Z, Liu RH. Helicobacter pylori enhances cyclooxygenase 2 expression via p38mapk/atf-2 signaling pathway in MKN45 cells. Cancer Lett 2009; 278: [PMID: DOI: /j.canlet ] 8 Boutaud O, Oates JA. Study of inhibitors of the PGH synthases for which potency is regulated by the redox state of the enzymes. Methods Mol Biol 2010; 644: [PMID: ] 9 Patrono C. The PGH-synthase system and isozyme-selective inhibition. J Cardiovasc Pharmacol 2006; 47 Suppl 1: S1-S6 [PMID: DOI: / ] 10 Zhang JB, Gu XY, Zhu XH, He S, Zhou JY, Yu L. The clinical significance of PTEN, Survivin and COX-2 protein expressions in breast carcinoma tissues. Zhonghua Zhongliu Fangzhi Zazhi 2010; 17: Zou TN, Hu FD,Chen Y,Tang YY. The expressions and correlation of COX-2 and ERmRNA in breast carcinoma tissues and their relevant research. Zhonghua Zhongliu Fangzhi Zazhi 2008; 15: Xia W, Zhao T, Lv J, Xu S, Shi J, Wang S, Han X, Sun Y. Celecoxib enhanced the sensitivity of cancer cells to anticancer drugs by inhibition of the expression of P-glycoprotein through a COX-2-independent manner. J Cell Biochem 2009; 108: [PMID: DOI: /jcb.22239] 13 Wu ZL, Sun GP, Wu Q, Fan LL, Fu WZ. Expression and its correlation of Cox-2 and Her-2/neu in gastric carcinoma tissues. Anhui Yiyao 2010; 14: Salimi M, Esfahani M, Habibzadeh N, Aslani HR, Amanzadeh A, Esfandiary M, Sedaghati B, Bidgoli SA, Ghahremani MH. Change in nicotine-induced VEGF, PGE2 AND COX-2 expression following COX inhibition in human oral squamous cancer. J Environ Pathol Toxicol Oncol 2012; 31: [PMID: DOI: /JEnvironPatholToxicolOncol ] 15 Hua TB, Meng XY, Wang GY, ZhangQ, Ren J, Jiu J, Chen G. Detection of COX-2, MMP-9, VEGF and RET in thyroid tissues and significances in primary diagnosis of papillary thyroid carcinoma. Jilin Daxue Xuebao 2011; 37: Huang YQ, Song YF, Yi JG. The expression and clinical significance of cyclooxygenase-2 and vascular endothelial growth factor-c in oral squamous cell carcinoma. Linchuang Kouqiang Yixue Zazhi 2011; 27: Chen BP, Ling SJ. Value of Combined Detection of CEA, CA 19-9 and 125 in Differential Diagnosis Between Benign and Malignant Ascites. Linchuang Xiaohuabing Zazhi 2010; 22: Passebosc-Faure K, Li G, Lambert C, Cottier M, Gentil-Perret A, Fournel P, Pérol M, Genin C. Evaluation of a panel of molecular markers for the diagnosis of malignant serous effusions. Clin Cancer Res 2005; 11: [PMID: DOI: / CCR ] 19 Yu JR, Wu YJ, Fu PF, Lv KZ, Gao Y, Xie HY, Zheng SS. The clinical significance of carcinoembryonic antigen mrna detection in the peritoneal washes of stomach neoplasms patients. Zhonghua Putongwaike Zazhi 2004; 19: October 28, 2013 Volume 19 Issue 40

199 Lu J et al. Detection of cyclooxygenase-2mrna in ascites 20 Lin YY, Li JJ, Chang CH, Lu YC, Hwang JJ, Tseng YL, Lin WJ, Ting G, Wang HE. Evaluation of pharmacokinetics of 111In-labeled VNB-PEGylated liposomes after intraperitoneal and intravenous administration in a tumor/ascites mouse model. Cancer Biother Radiopharm 2009; 24: [PMID: DOI: /cbr ] 21 Horton HM, Dorigo O, Hernandez P, Anderson D, Berek JS, Parker SE. IL-2 plasmid therapy of murine ovarian carcinoma inhibits the growth of tumor ascites and alters its cytokine profile. J Immunol 1999; 163: [PMID: ] 22 Zhang Q, Mu YS, Wang ZF, Wang XL, Gao F. Correlation of cyclooxygenase-2 mrna expression with occurrence and development of esophageal carcinoma. Zhonghua Zhongliu Fangzhi Zazhi 2008; 15: Shao N, Feng N, Wang Y, Mi Y, Li T, Hua L. Systematic review and meta-analysis of COX-2 expression and polymorphisms in prostate cancer. Mol Biol Rep 2012; 39: [PMID: DOI: /s ] 24 Dixon DA, Blanco FF, Bruno A, Patrignani P. Mechanistic aspects of COX-2 expression in colorectal neoplasia. Recent Results Cancer Res 2013; 191: 7-37 [PMID: DOI: / _2] P- Reviewers Ehrenpreis ED, Kalambokis G S- Editor Wang JL L- Editor Ma JY E- Editor Zhang DN 6887 October 28, 2013 Volume 19 Issue 40

200 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. Relationship between interleukin-6 polymorphism and susceptibility to chronic hepatitis B virus infection BRIEF ARTICLE Xiao-Miao Zhao, Yu-Feng Gao, Qin Zhou, Fa-Ming Pan, Xu Li Xiao-Miao Zhao, Qin Zhou, Xu Li, Department of Infectious Diseases, The First Affiliated Hospital of Anhui Medical University, Hefei , Anhui Province, China Yu-Feng Gao, Department of Hepatopathy, The Second Affiliated Hospital of Anhui Medical University, Hefei , Anhui Province, China Fa-Ming Pan, Department of Epidemiology and Biostatistics, School of Public Health, Anhui Medical University, Hefei , Anhui Province, China Author contributions: Zhao XM and Gao YF contributed equally to this work; Zhao XM and Gao YF wrote the manuscript; Zhao XM,Gao YF and Zhou Q performed the majority of experiments; Gao YF designed the study; Pan FM did the data analysis; and Li X provided the financial support for this work. Supported by Grants from the National Natural Science Foundation of China, No Correspondence to: Xu Li, Professor, Department of Infectious Diseases, The First Affiliated Hospital of Anhui Medical University, 218 Jixi Road, Hefei , Anhui Province, China. aaylixu@qq.com Telephone: Fax: Received: August 5, 2013 Revised: September 6, 2013 Accepted: September 16, 2013 Published online: October 28, 2013 Abstract AIM: To identify the relationship between tag single nucleotide polymorphisms (tag SNPs) of interleukin-6 (IL-6 ) gene and susceptibility to chronic hepatitis B virus (HBV) infection in a Han Chinese population. METHODS: We performed a case-control study of 501 Chinese patients with chronic HBV infection and 301 self-limiting HBV-infected individuals as controls. Genomic DNA was isolated from the whole blood of all subjects using phenol/chloroform with MaXtract highdensity tubes. Tag SNPs were identified using genotype data from the panel (Han Chinese in Beijing) of the phase II HapMap Project. Four tag SNPs in IL-6 (rs a/t, rs g/t, rs a/g and rs a/g ) were genotyped by the Multiplex Snapshot technique. The genotype and allele frequencies were calculated and analyzed. RESULTS: Five haplotypes were involved in the analysis, with frequencies higher than One of the haplotypes, TTAA, was significantly different between the two groups. Overall haplotype P values were: ATAA, P = 0.605, OR (95%CI) = ( ); TGAG, P = 0.385, OR (95%CI) = ( ); TGGG, P = 0.549, OR (95%CI) = ( ); TTAA, P = 0.004, OR (95%CI) = ( ); TTAG, P = 0.266, OR (95%CI) = ( ). However, the four SNPs showed no significant genotype/allele associations with susceptibility to chronic HBV infection. Overall allele P values were: rs , P = 0.696, OR (95%CI) = ( ); rs , P = 0.460, OR (95%CI) = ( ); rs , P = 0.898, OR (95%CI) = ( ); rs , P = 0.165, OR (95%CI) = ( ). Overall genotype P values were: rs , P = 0.625; rs , P = 0.500; rs , P = 0.853; and rs , P = CONCLUSION: The four tag SNPs of IL-6 gene may be associated with susceptibility to chronic HBV infection in the Han Chinese population Baishideng. All rights reserved. Key words: Chronic hepatitis B virus infection; Interleukin-6; Single nucleotide polymorphism; Genetic susceptibility; Haplotype Core tip: This study included a large number of subjects with a single ethnic background (Chinese). This would further add to the statistical power of the analysis and identify more single nucleotide polymorphisms. We selected self-limiting hepatitis B virus-infected subjects, but not unexposed subjects as controls, therefore, our results may be more reliable than other studies that 6888 October 28, 2013 Volume 19 Issue 40

201 Zhao XM et al. IL-6 polymorphism and hepatitis B virus infection recruited blood donors as controls. In addition, we included only antiviral-naive subjects. Zhao XM, Gao YF, Zhou Q, Pan FM, Li X. Relationship between interleukin-6 polymorphism and susceptibility to chronic hepatitis B virus infection. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6888.htm DOI: i INTRODUCTION The outcome of hepatitis B virus (HBV) infection is mainly influenced by the virus, immune response and genetic diversity [1-3]. Many studies strongly support that host genetic variety plays an important role in determining the outcome of HBV infection [4,5]. Host genetics such as single nucleotide polymorphisms (SNPs) of a variety of genes have been implicated in the diversity of HBV clinical course [6-9]. Recent studies have shown that cytokine genetic polymorphisms are associated with the development of chronic HBV infection and progression of the infection [10]. Interleukin-6 (IL-6) is a pleiotropic cytokine with a pivotal function in regulation of the biological responses of several target cells including hepatocytes [11]. Kuo et al [12] found that IL-6 was able to effectively suppress HBV replication and prevent the accumulation of HBV covalently closed circular DNA (cccdna) in a human hepatoma cell line. Cussigh et al [13] found that IL-6 promoter polymorphisms influence the development of chronic hepatitis C virus infection. Another study suggested that IL-6 gene polymorphisms may be associated with the outcome of allogeneic hematopoietic stem cell transplantation, particularly in patients transplanted from a related donor [14]. However, the exact mechanism involving IL-6 in the outcome of HBV infection is unknown. The present study investigated the association between the tag SNPs of the IL-6 gene and genetic susceptibility to chronic HBV infection. MATERIALS AND METHODS Patients Eight hundred and two Han Chinese with HBV infection were enrolled in this study. Following recruitment, the subjects gave informed consent for genetic analysis. No abnormalities were observed in these subjects based on physical examination, chest radiography, electrocardiogram, urinalysis and routine laboratory blood testing. Liver, renal, endocrine and cardiovascular disorders were excluded. Five hundred and one were chronic HBV infected patients (221 males and 280 females). The remaining 301 were HBV natural clearance individuals and served as the control group (143 females and 158 males). The average age was 44.2 years for HBV chronic carriers and 44.9 years for controls. All patients with chronic HBV infection fulfilled the diagnostic criteria: positive for hepatitis B surface antigen (HBsAg) for a period of at least 6 mo, serum HBV DNA level > 1000 copies/ml, and elevated alanine aminotransferase or aspartate aminotransferase (> 40 IU/mL). The clinical criteria for selflimiting HBV infected patients were: positive for hepatitis B surface antibody and hepatitis B core antibody, but negative for HBsAg, and no history of HBV vaccination. Controls were age- and sex-matched subjects (P > 0.1). All cases and controls were followed for more than 6 mo. None of the patients had received anti-hbv therapy. Isolation of DNA from whole blood Genomic DNA was isolated from the whole blood of all subjects using phenol/chloroform with MaXtract highdensity tubes. Genomic DNA was extracted from the peripheral blood leukocyte pellet using a DNA extraction kit (Yuan Ping-Hao Biotechnology Co., Ltd. Tianjin, China), according to the manufacturer s instructions. The DNA samples were stored at -80 at a concentration of 100 ng/μl. Tag SNP selection We selected SNPs on the basis of the following principal criteria: tag SNPs were identified using genotype data from the panel (Han Chinese in Beijing) of the phase II HapMap Project. The criteria for tag SNPs were r 2 > 0.8, minor allele frequency (MAF) > 0.1, functional relevance and importance, and SNPs significantly associated with diseases in previous studies. Four tag SNPs in the IL-6 gene (rs a/t, rs g/t, rs a/g and rs a/g) were selected, which captured 100% of common SNPs (MAF > 0.1) in the HapMap Chinese database at r 2 > 0.8. Genotyping The four SNPs in IL-6 were genotyped using the Multiplex SNaPshot technique. T he primers and probes were designed by Primer 5.0 software and were rs (5 to 3 ): forward primer: AAAAGGGCAAGGAAGGGAGGTA, reverse primer: CACGA GTCATTTG AGCCATCTTTG, and extension primer: TTTTTTTTTTTTTTTTTTTTTGAGTT CAGTGTCATCAGCAGAAACT; rs (5 to 3 ), forward primer: CTTCCTGCTGGAACATTC- TATGGC, reverse primer: TTTCTGCCAGTGC CTCTTTGC, and extension primer: TTTTTTTTTTT TTTTTTTTTTTTTTTTT TCCTAAAACAAACAC- CACTAGAGGG. rs (5 to 3 ), forward primer: CTTCCTGCT GGAACATTCTATGGC, reverse primer: TTTCTGCCAGTGC CTCTTTGC, and extension primer: TTTTTTTAAATTTGTTTTGAAGATTAG ACACAATATTTAT. rs (5 to 3 ): forward primer: CGTCATTTAACCCCAGCACTTG, reverse primer: GGATTTTCTACATCAT CCCTCAGTTCC, and extension primer: TTTTTT TTTTGCACTTG- CACA CTCCTTTCTG. The polymerase chain reaction 6889 October 28, 2013 Volume 19 Issue 40

202 Zhao XM et al. IL-6 polymorphism and hepatitis B virus infection (PCR) amplification conditions were: a 15-μL final volume containing μl buffer, 0.3 μl dntps (10 mmol/l), 0.9 μl MgCl2 (25 mmol/l), 0.1 μl Taq DNA polymerase (TAKARA Biotechnology Co. Ltd., Dalian, China), 0.5 μl each primer (10 pmol/l), and 1 μl DNA template (20 mg/l). Conditions for the multiplex PCR reaction using Touch-down PCR response procedures included initial denaturation at 95 for 15 min, denaturation at 94 for 40 s, annealing at 63 for 1 min, and recursive-descent at 0.5, followed by extension at 72 for 1.5 min, for a total of 15 cycles. This was followed by 25 cycles of denaturation at 94 for 40 s, annealing at 56 for 40 s, and extension at 72 for 1.5 min, with a final extension at 72 for 8 min. Amplified samples were stored at 4. After amplification, 1.5 μl PCR product was examined on an agarose gel to test for successful amplification. SNaPshot reaction The purified PCR product, each concentration of 0.2 μmol/l SNaPshot primer mixtures, and SNaPshot fluorescent mixtures (containing Taq DNA polymerase and different fluorescently labeled ddntp, TAKARA Biotechnology Co. Ltd., Dalian, China) consisted of a PCR system. SNaPshot response procedures were: initial denaturation at 96 for 10 s; denaturation at 96 for 10 s, annealing at 53 for 5 s, extension at 60 for 30 s, for a total of 25 cycles, and finally extension at 60 for 30 s. Amplified samples were stored at 4. SNaPshot PCR products using SAP purification, in 10 μl SNaPshot PCR product with 1 U SAP or 1 U CIP, were mixed and incubated at 37 for 1 h, and 75 for 15 min to inactivate the enzyme. The samples can be stored at 4 for 24 h or -20 permanently. DNA sequencing The SNaPshot product was diluted 20-fold. In a total volume of 10 μl, we mixed 8.6 μl HiDiFormamide (highpurity formamide), 0.9 μl GeneScan-120 LIZ Size Standard, and 0.5 μl SNaPshot purification product. Samples were incubated at 95 for 5 min, chilled quickly for 4 min, and then loaded on an ABI 3730XL Genetic Analyzer (Applied Biosystems, CA, United States) for capillary electrophoresis, running GeneMapper 4.0 software for analysis of the experimental results. Statistical analysis Allele and genotype frequencies were obtained by direct counting, and the χ 2 test was used to compare allele and genotype distributions. The quality of the genotype data was assessed by Hardy-Weinberg equilibrium in the case and control samples using Fisher s exact test (P > 0.05). OR and 95%CI were calculated according to Woolf s method. RESULTS We investigated the distribution of the four SNPs in 501 Chinese HBV-infected patients (cases) and 301 selflimiting HBV-infected patients (controls). All genotypes of the IL-6 polymorphisms were in Hardy-Weinberg equilibrium in both the cases and controls. The genotype frequencies and allele distributions of the IL-6 polymorphisms in each subgroup of HBVinfected patients are summarized in Table 1. The genotype frequencies for AA, AT, and TT of IL-6 rs were 30.9%, 48.1%, and 21.0% in case samples, and 28.2%, 51.5%, and 20.3% in control samples, respectively, without significant differences between cases and controls (P = 0.625). The genotype frequencies for GG, GT and TT of IL-6 rs were 9.0%, 37.9%, and 53.1% in case samples, and 6.6%, 39.2%, and 54.2% in control samples, respectively, without significant differences between cases and controls (P = 0.510). The genotype frequencies for AA, AG, and GG of IL-6 rs were 66.1%, 30.1%, and 3.8% in case samples, and 67.1%, 28.6%, and 4.3% in control samples, and no significant differences were noted (P = 0.853). The genotype frequencies for AA, AG and GG of IL-6 rs were 41.5%, 445.7%, and 12.8% in case samples, and 45.8%, 43.9%, and 10.3% in control samples, and no significant differences were noted (P = 0.380). In addition, no statistically significant differences were found when the allele frequencies of SNPs rs , rs , rs and rs were compared between patients with chronic HBV infection and controls. Overall allele P values were: rs , P = 0.696, OR (95%CI) = ( ); rs , P = 0.460, OR (95%CI) = ( ); rs , P = 0.898, OR (95%CI) = ( ); rs , P = 0.165, OR (95%CI) = ( ). Haplotype analysis We also estimated the IL-6 haplotype frequencies and evaluated the association among these variants and HBV infection. We observed five haplotype combinations, but found no significant association in the distribution of the haplotype frequencies between cases and controls (P > 0.05) except TTAA where the protective haplotype was associated with lower disease susceptibility. The haplotype TTAA was observed to be significantly associated with control subjects compared with patients [P < 0.05, OR (95%CI) ( )]. Haplotype frequencies lower than 0.03 were ignored in the analysis (Table 2). DISCUSSION Several cytokine polymorphisms are associated with the natural history of HBV infection. Zhang et al [15] proved that persistent HBV infection susceptibility is associated with the gene polymorphism IL GA in the Chinese population and that clearance of HBV is associated with the gene polymorphism IL CA in the Chinese population. IL G/G and IL-12β C/G are associated with early, spontaneous HBeAg seroconversion [16]. Another study indicated that the -148C, 6890 October 28, 2013 Volume 19 Issue 40

203 Zhao XM et al. IL-6 polymorphism and hepatitis B virus infection Table 1 Genotype and allele distributions of interleukin-6 tag single nucleotide polymorphisms in patients with chronic hepatitis B virus infection and those with self- limiting hepatitis B virus infection n (%) IL-6 SNP site Chronic HBV infection Self-limiting HBV infection P value OR (95%CI) rs n = 501 n = 301 AA 155 (0.309) 85 (0.282) 1.0 AT 241 (0.481) 155 (0.515) ( ) TT 105 (0.210) 61 (0.203) ( ) A 551 (0.550) 325 (0.540) ( ) T 451 (0.450) 277 (0.460) rs GG 45 (0.090) 20 (0.066) 1.0 GT 190 (0.379) 118 (0.392) ( ) TT 266 (0.531) 163 (0.542) ( ) G 280 (0.279) 158 (0.262) ( ) T 722 (0.721) 444 (0.738) rs AA 331 (0.661) 202 (0.671) 1.0 AG 151 (0.301) 86 (0.286) ( ) GG 19 (0.038) 13 (0.043) ( ) A 813 (0.811) 490 (0.814) ( ) G 189 (0.189) 112 (0.186) rs AA 208 (0.415) 138 (0.458) 1.0 AG 229 (0.457) 132 (0.439) ( ) GG 64 (0.128) 31 (0.103) ( ) A 645 (0.644) 408 (0.678) ( ) G 357 (0.356) 194 (0.322) IL-6: Interleukin-6; HBV: Hepatitis B virus; SNP: Single nucleotide polymorphism. Table 2 Distribution of haplotypes of interleukin-6 tag single nucleotide polymorphisms in patients with chronic hepatitis B virus infection and those with self-limiting hepatitis B virus infection Haplotypes Frequency (cases) Frequency (controls) χ 2 P value OR (95%CI) ATAA (0.525) (0.510) ( ) TGAG (0.089) (0.076) ( ) TGGG (0.172) (0.160) ( ) TTAA (0.118) (0.168) ( ) TTAG (0.070) 33.8 (0.056) ( ) +8925G and C alleles of the IL-18 gene are likely associated with HBV clearance in a Korean population [17]. However, Lee et al [18] found that the polymorphisms near the IL-28B gene, rs t>g, rs c>t and rs a>g, are not significantly associated with the natural course of chronic HBV infection. IL-6 acts as both a pro-inflammatory and anti-inflammatory cytokine. Hösel et al [19] found that IL-6 ensures early control of the virus, limiting activation of the adaptive immune response and preventing death of HBV-infected hepatocytes. IL-6 may play an extremely important role in determining liver progression [20]. Polymorphism of the IL-6 promoter -572 loci may be associated with HCC occurrence in men [21].Fabris et al [22] found that fewer patients aged < 50 years who carried one of the IL-6 high producer (G/G or G/C) genotypes experienced HBsAg loss in comparison with patients aged > 50 years and/or carriers of the IL-6 low producer C/C genotype. This indicates that possessing an IL-6 low producer phenotype may provide some advantage to older patients with chronic HBV infection. This is consistent with other findings which showed that IL G>C polymorphism may play a role in the clinical evolution of HBV infection at least in European countries where a higher prevalence of the C allele was detected in comparison with patients from the Far East [23]. However, Park et al [24] found that variants in the IL-6 gene are not associated with subsequent HBV outcomes, although IL-6 has been found to be functionally significant in other diseases [25-27]. To identify the relationship between the SNPs of IL-6 gene and genetic susceptibility to chronic hepatitis B virus infection in the Han Chinese population, we selected four SNPs in IL-6 (rs , rs , rs and rs ) using genotype data from the panel (Han Chinese in Beijing) of the phase II HapMap Project. The four tag SNPs captured 100% of common SNPs (minor allele frequency > 0.1) in the HapMap Chinese database at r 2 > 0.8. We analyzed the associations of four SNP alleles with chronic HBV infection compared with selflimiting HBV infection. The results indicated that tag 6891 October 28, 2013 Volume 19 Issue 40

204 Zhao XM et al. IL-6 polymorphism and hepatitis B virus infection SNPs of IL-6 may be a prognostic factor for chronic hepatitis B infection. There are several advantages of this study which strengthen it compared with previous similar studies, and increase the reliability of our results. First, our study included a large number of subjects with a single ethnic background (Chinese). This would further add to the statistical power of the analysis and identify more SNPs. Second, we selected self-limiting HBVinfected subjects, but not unexposed subjects, as controls, therefore, our results may be more reliable than other studies that recruited blood donors as controls. Third, we included only antiviral-naive subjects. In contrast, previous similar studies which investigated the natural course of chronic HBV infection did not set any limitation regarding antiviral treatment. In conclusion, IL-6 is a functional gene which plays a relevant role in the pathogenesis of HBV. Our study demonstrates that the tag SNPs of IL-6 may be related to genetic susceptibility to chronic HBV infection in Chinese patients. Further genetic studies are needed to examine other SNPs in IL-6 and their possible association with disease progression in chronic HBV infection. COMMENTS Background Persistent hepatitis B virus (HBV) infection is considered a multifactorial and polygenic disorder with viral, environmental, and genetic components, as well as contributions from HBV genomic variability, host age, gender, concurrent infection with the hepatitis C virus, hepatitis D virus, and human immune deficiency virus. Interleukin-6 (IL-6) plays an important role in the response of the innate immune system to viral infection. IL-6 polymorphisms affect induction of IL-6 expression. Research frontiers This study is the first to investigate the association between four tag single nucleotide polymorphisms (tag SNPs) (rs a/t, rs g/t, rs a/g and rs a/g) of IL-6 and genetic susceptibility to chronic HBV infection in Chinese patients using the Multiplex SNaPshot technique. Innovations and breakthroughs The four tag SNPs of IL-6 may be related to genetic susceptibility to chronic HBV infection. Applications Based on the results of this study, further genetic studies are needed to examine the roles of other IL-6 SNPs and their association with disease progression in chronic HBV infection. Terminology IL-6 is a pleiotropic cytokine with a pivotal function in regulation of the biological responses of several target cells including hepatocytes. It acts as both a proinflammatory and anti-inflammatory cytokine. Peer review The manuscript analyzed the association between polymorphisms of IL-6 and clinical outcomes of HBV infection. Four SNPs of IL-6 were genotyped using Multiplex SNaPshot technique and compared between chronic HBV infection and self-limiting HBV infection patients. The overall data showed that SNPs of IL-6 may affect the outcome of HBV infection. The data may have a significant clinical implication. REFERENCES 1 Vildózola Gonzales H, Salinas JL. [Natural history of chronic hepatitis B virus infection]. Rev Gastroenterol Peru 2009; 29: [PMID: ] 2 Chu CJ, Lok AS. Clinical significance of hepatitis B virus genotypes. Hepatology 2002; 35: [PMID: DOI: /jhep ] 3 Thursz M. Genetic susceptibility in chronic viral hepatitis. Antiviral Res 2001; 52: [PMID: DOI: /S (01) ] 4 Frodsham AJ. Host genetics and the outcome of hepatitis B viral infection. Transpl Immunol 2005; 14: [PMID: DOI: /j.trim ] 5 Ramezani A, Hasanjani Roshan MR, Kalantar E, Eslamifar A, Banifazl M, Taeb J, Aghakhani A, Gachkar L, Velayati AA. Association of human leukocyte antigen polymorphism with outcomes of hepatitis B virus infection. J Gastroenterol Hepatol 2008; 23: [PMID: DOI: / j x] 6 Deng G, Zhou G, Zhai Y, Li S, Li X, Li Y, Zhang R, Yao Z, Shen Y, Qiang B, Wang Y, He F. Association of estrogen receptor alpha polymorphisms with susceptibility to chronic hepatitis B virus infection. Hepatology 2004; 40: [PMID: ] 7 Kim YJ, Lee HS, Yoon JH, Kim CY, Park MH, Kim LH, Park BL, Shin HD. Association of TNF-alpha promoter polymorphisms with the clearance of hepatitis B virus infection. Hum Mol Genet 2003; 12: [PMID: ] 8 Thio CL, Mosbruger TL, Kaslow RA, Karp CL, Strathdee SA, Vlahov D, O Brien SJ, Astemborski J, Thomas DL. Cytotoxic T-lymphocyte antigen 4 gene and recovery from hepatitis B virus infection. J Virol 2004; 78: [PMID: DOI: /JVI ] 9 Wang C, Tang J, Song W, Lobashevsky E, Wilson CM, Kaslow RA. HLA and cytokine gene polymorphisms are independently associated with responses to hepatitis B vaccination. Hepatology 2004; 39: [PMID: DOI: /hep.20142] 10 Basturk B, Karasu Z, Kilic M, Ulukaya S, Boyacioglu S, Oral B. Association of TNF-alpha -308 polymorphism with the outcome of hepatitis B virus infection in Turkey. Infect Genet Evol 2008; 8: [PMID: DOI: / j.meegid ] 11 Pan CJ, Wu HL, Kuo SF, Kao JH, Tseng TC, Liu CH, Chen PJ, Liu CJ, Chen DS. Serum interleukin 6 level correlates with outcomes of acute exacerbation of chronic hepatitis B. Hepatol Int 2011; Epub ahead of print [PMID: DOI: /s ] 12 Kuo TM, Hu CP, Chen YL, Hong MH, Jeng KS, Liang CC, Chen ML, Chang C. HBV replication is significantly reduced by IL-6. J Biomed Sci 2009; 16: 41 [PMID: ] 13 Cussigh A, Falleti E, Fabris C, Bitetto D, Cmet S, Fontanini E, Bignulin S, Fornasiere E, Fumolo E, Minisini R, Pirisi M, Toniutto P. Interleukin 6 promoter polymorphisms influence the outcome of chronic hepatitis C. Immunogenetics 2011; 63: [PMID: DOI: /s ] 14 Ambruzova Z, Mrazek F, Raida L, Jindra P, Vidan-Jeras B, Faber E, Pretnar J, Indrak K, Petrek M. Association of IL6 and CCL2 gene polymorphisms with the outcome of allogeneic haematopoietic stem cell transplantation. Bone Marrow Transplant 2009; 44: [PMID: DOI: / bmt ] 15 Zhang TC, Pan FM, Zhang LZ, Gao YF, Zhang ZH, Gao J, Ge R, Mei Y, Shen BB, Duan ZH, Li X. A meta-analysis of the relation of polymorphism at sites and -592 of the IL-10 gene promoter with susceptibility and clearance to persistent hepatitis B virus infection in the Chinese population. Infection 2011; 39: [PMID: DOI: / s ] 16 Wu JF, Wu TC, Chen CH, Ni YH, Chen HL, Hsu HY, Chang MH. Serum levels of interleukin-10 and interleukin-12 predict early, spontaneous hepatitis B virus e antigen seroconversion. Gastroenterology 2010; 138: e1-3 [PMID: ] 17 Cheong JY, Cho SW, Oh B, Kimm K, Lee KM, Shin SJ, Lee 6892 October 28, 2013 Volume 19 Issue 40

205 Zhao XM et al. IL-6 polymorphism and hepatitis B virus infection JA, Park BL, Cheong HS, Shin HD, Cho BY, Kim JH. Association of interleukin-18 gene polymorphisms with hepatitis B virus clearance. Dig Dis Sci 2010; 55: [PMID: ] 18 Lee DH, Cho Y, Seo JY, Kwon JH, Cho EJ, Jang ES, Kwak MS, Cheong JY, Cho SW, Lee JH, Yu SJ, Yoon JH, Lee HS, Kim CY, Shin HD, Kim YJ. Polymorphisms near interleukin 28B gene are not associated with hepatitis B virus clearance, hepatitis B e antigen clearance and hepatocellular carcinoma occurrence. Intervirology 2013; 56: [PMID: ] 19 Hösel M, Quasdorff M, Wiegmann K, Webb D, Zedler U, Broxtermann M, Tedjokusumo R, Esser K, Arzberger S, Kirschning CJ, Langenkamp A, Falk C, Büning H, Rose- John S, Protzer U. Not interferon, but interleukin-6 controls early gene expression in hepatitis B virus infection. Hepatology 2009; 50: [PMID: DOI: / hep.23226] 20 Kao JT, Lai HC, Tsai SM, Lin PC, Chuang PH, Yu CJ, Cheng KS, Su WP, Hsu PN, Peng CY, Wu YY. Rather than interleukin-27, interleukin-6 expresses positive correlation with liver severity in naïve hepatitis B infection patients. Liver Int 2012; 32: [PMID: ] 21 Liu S, Qiu XQ, Zeng XY, Bai H, Bei CH, Yang Y. [Relationship between IL6-572G/C polymorphism and hepatocellular carcinoma in men]. Zhonghua Gan Zang Bing Zazhi 2012; 20: [PMID: ] 22 Fabris C, Toniutto P, Bitetto D, Fattovich G, Falleti E, Fontanini E, Cussigh A, Minisini R, Occhino G, Pirisi M. Gene polymorphism at the interleukin G > C locus affects the outcome of chronic hepatitis B. J Infect 2009; 59: [PMID: DOI: /j.jinf ] 23 Fornasiere E, Fattovich G, Bitetto D, Fumolo E, Cussigh A, Fontanini E, Falleti E, Minisini R, Fabris C, Pirisi M, Toniutto P. Interleukin G/C polymorphism influences the outcome of chronic hepatitis B virus infection in humans. J Hepatol 2009; 50: S137 [DOI: /S (09) ] 24 Park BL, Lee HS, Kim YJ, Kim JY, Jung JH, Kim LH, Shin HD. Association between interleukin 6 promoter variants and chronic hepatitis B progression. Exp Mol Med 2003; 35: [PMID: DOI: /emm ] 25 Okada R, Wakai K, Naito M, Morita E, Kawai S, Hamajima N, Hara M, Takashima N, Suzuki S, Takezaki T, Ohnaka K, Arisawa K, Hirohata H, Matsuo K, Mikami H, Kubo M, Tanaka H. Pro-/anti-inflammatory cytokine gene polymorphisms and chronic kidney disease: a cross-sectional study. BMC Nephrol 2012; 13: 2 [PMID: DOI: / ] 26 Timasheva YR, Nasibullin TR, Zakirova AN, Mustafina OE. Association of interleukin-6, interleukin-12, and interleukin-10 gene polymorphisms with essential hypertension in Tatars from Russia. Biochem Genet 2008; 46: [PMID: DOI: /s x] 27 Chen M, Li T, Lin S, Bi D, Zhu D, Shang Q, Ma C, Wang H, Wang L, Zhang Y, He L, Zhu C, Xing Q. Association of Interleukin 6 gene polymorphisms with genetic susceptibilities to spastic tetraplegia in males: a case-control study. Cytokine 2013; 61: [PMID: DOI: / j.cyto ] P- Reviewers Aghakhani A, Ohishi W S- Editor Gou SX L- Editor A E- Editor Zhang DN 6893 October 28, 2013 Volume 19 Issue 40

206 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. BRIEF ARTICLE Abnormal DNA-PKcs and Ku 70/80 expression may promote malignant pathological processes in gastric carcinoma Wei Li, Chuan Xie, Zhen Yang, Jiang Chen, Nong-Hua Lu Wei Li, Chuan Xie, Zhen Yang, Jiang Chen, Nong-Hua Lu, Department of Gastroenterology, the First Affiliated Hospital of Nanchang University, Nanchang , Jiangxi Province, China Author contributions: Li W and Lu NH designed the study; Xie C, Yang Z and Chen J performed the experiments; Li W analyzed the data; Li W and Lu NH drafted the manuscript. Supported by The National natural science foundation of China, No Correspondence to: Nong-Hua Lu, MD, Department of Gastroenterology, the First Affiliated Hospital of Nanchang University, Yongzheng Road, Donghu District, Nanchang , Jiangxi Province, China. lunonghua@ncu.edu.cn Telephone: Fax: Received: May 11, 2013 Revised: September 4, 2013 Accepted: September 15, 2013 Published online: October 28, 2013 Abstract AIM: To determine the expression of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) and the Ku70/Ku80 heterodimer (Ku 70/80) in gastric carcinoma. METHODS: Gastric biopsies were obtained from 146 gastric carcinoma patients [Helicobacter pylori (H. pylori )-negative: 89 and H. pylori -positive: 57] and 34 from normal subjects (H. pylori -negative: 16 and H. pylori -positive: 18) via surgery and endoscopic detection from April 2011 to August 2012 at the First Affiliated Hospital of Nanchang University. Pathological diagnosis and classification were made according to the criteria of the World Health Organization and the updated Sydney system. An in-house rapid urease test and modified Giemsa staining were employed to detect H. pylori infection. The expression of DNA-PKcs and the Ku 70/80 protein was detected by immunohistochemistry. RESULTS: Overall, the positive rates of both DNA-PKcs and Ku 70/80 were significantly increased in gastric cancer (χ 2 = , P < for DNA-PKcs and χ 2 = 13.06, P < 0.01 for Ku) compared with normal gastric mucosa. There was hardly any detectable expression of DNA-PKcs in normal gastric mucosa, and the positive rate of DNA-PKcs protein expression in patients with a normal gastric mucosa was 0% (0/34), whereas the rate in gastric cancer (GC) was 93.8% (137/146). The difference between the two groups was statistically significant. Additionally, the positive rate of Ku 70/80 was 79.4% (27/34) in normal gastric mucosa and 96.6% (141/146) in gastric cancer. The DNA-PKcs protein level was significantly increased in gastric cancer (Mann- Whitney U = 39.00, P < 0.001), compared with normal gastric mucosa. In addition, there was a significant difference in the expression of Ku 70/80 (Mann-Whitney U = , P < 0.001) between gastric cancer and normal gastric mucosa. There was also a significant difference in Ku70/80 protein expression between GC patients with and without H. pylori infection (P < 0.05). Spearman analysis showed a negative correlation between tumor differentiation and DNA-PKcs expression (r = , P < 0.05). Moreover, Ku70/80 expression was negatively correlated with both clinical stage (r = , P < 0.05) and H. pylori colonization (r = , P < 0.05). CONCLUSION: Overall, this research demonstrated that enhanced DNA-PKcs and Ku 70/80 expression may be closely associated with gastric carcinoma Baishideng. All rights reserved. Key words: Helicobacter pylori ; Catalytic subunit of the DNA-dependent protein kinase; Ku70/Ku80 heterodimer; Gastric carcinoma; Immunohistochemistry Core tip: This is the first study to clarify the two key promoters of the non-homologous end joining (NHEJ) pathway, DNA-dependent protein kinase (DNA-PKcs) and Ku 70/80, in human gastric carcinoma tissues. The present study found an upregulated expression of DNA- PKcs and Ku 70/80 in gastric cancer tissues compared 6894 October 28, 2013 Volume 19 Issue 40

207 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma with normal gastric mucosa, which suggests that there is an enhanced function of NHEJ in gastric carcinogenesis. As NHEJ is an error-prone and non-specific repair mechanism and can be induced before homologous recombination, its excessive activation is capable of regulating cell cycle arrest, cell apoptosis, chromosome recombination and genome instability. Li W, Xie C, Yang Z, Chen J, Lu NH. Abnormal DNA-PKcs and Ku 70/80 expression may promote malignant pathological processes in gastric carcinoma. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6894.htm DOI: org/ /wjg.v19.i INTRODUCTION Gastric carcinoma is a worldwide malignant disease with high incidence and mortality, and it is characterized by genome instability through severe DNA damage caused by various factors, including Helicobacter pylori (H. pylori) infection, heredity and living habits [1,2]. The catalytic subunit of the DNA-dependent protein kinase (DNA- PKcs) and the Ku 70/Ku 80 heterodimer (Ku 70/80) can instantly combine into DNA-dependent protein kinase (DNA-PK), which is a crucial promoter of the non-homologous end joining (NHEJ) pathway [3,4]. First, DNA-PKcs receives a DNA damage signal and launches a damage response. Next, Ku 70/80 binds to the damaged DNA ends and then attracts DNA-PKcs to form DNA-PK, which can trigger NHEJ repair activities [4,5]. Accumulating evidence has shown that dysregulation of DNA-PKcs and Ku 70/80 is associated with pathological processes in various tumors [6]. The expression changes and biological function of DNA-PKcs and Ku 70/80 in gastric cancer (GC) are still unclear. It is possible that DNA-PKcs and Ku 70/80 play a dual role in tumorigenicity, as both a rapid repair method and errorprone mechanism. The inability to activate the promoter of this repair pathway could increase the mutation rate within the genome, promoting malignant cellular changes associated with carcinogenesis. Malignant tissues induce unbalanced NHEJ activities to handle metabolic stress and promote tumor infiltration. However, normal repair activities within tumor tissues may also lead to cell death and genome instability, as well as create a microenvironment that is predisposed to cancer. To determine a possible pathological role of DNA-PKcs and Ku 70/80-mediated DNA repair pathways in human gastric cancer tissues and to verify whether H. pylori infection disturbs the regular repair function of gastric mucosal epithelial cells through a series of DNA damage responses and the NHEJ repair pathway, we measured the expression of DNA-PKcs and Ku 70/80 by immunohistochemistry in biopsies or surgical specimens of 180 patients with or without gastric carcinoma. MATERIALS AND METHODS Patient tissue Gastric samples of patients who underwent upper gastroduodenoscopy from January 2007 to September 2009 at The First Affiliated Hospital of Nanchang University were retrospectively reviewed and examined. A total of 180 patients (76 females and 104 males, with a mean age of ± years) were enrolled in this study, including 34 patients with a normal gastric mucosa (NGM, H. pylori-negative: 16 cases and H. pylori-positive: 18 cases), and 146 with gastric carcinoma (GC, H. pylori-negative: 89 cases and H. pylori-positive: 57 cases). There was no significant difference in the age or gender distribution among these groups. None of the patients had been treated with any regimens to eradicate H. pylori infection. This study was approved ethically by the First Affiliated Hospital of Nanchang University. All of the patients gave written informed consent to participate in the study. Detection of H. pylori infection An in-house rapid urease test (RUT) and modified Giemsa staining were employed for detecting H. pylori infection. The effectiveness of RUT is more than 95% (data not shown). The modified Giemsa staining was carried out in a double-blind fashion. An H. pylori infection was diagnosed as positive only if both of the methods produced positive results. An H. pylori-negative diagnosis was confirmed if both of the methods yielded negative results [7]. Histological examinations of gastric samples Gastric samples were obtained from patients who underwent endoscopy of the upper gastrointestinal tract. All of the biopsies were taken from the gastric antrum and the lesions of individual patients. The tissues used for histological analysis were fixed in 10% formaldehyde in Ca 2+ and Mg 2+ free phosphate-buffered saline (PBS) overnight at 4 before paraffin embedding. Paraffin sections of 4 μm were cut with a microtome and stored at room temperature. Pathological diagnosis and classification were performed according to the criteria of the World Health Organization [8,9]. Immunohistochemistry Primary antibodies used in this study were as follows: mouse monoclonal antihuman DNA-PKcs (Abcam, Cambridge, United Kingdom) and rabbit polyclonal antihuman Ku 70/Ku 80 (Anbobio, San Francisco, CA). The anti-human DNA-PKcs antibody was diluted 1:400, and the anti-human Ku70/80 antibody was diluted 1:3500. The paraffin sections were mounted on slides and dewaxed in xylene and sequentially dehydrated in 100%, 95% and 85% ethanol. The sections were stained using the PV-6000 Polymer Detection System (Zhongshan Goldenbridge, Beijing, PRC) staining protocol. The sections were then washed in PBS, and endogenous peroxidase was blocked using 3% H2O2. After the specimens 6895 October 28, 2013 Volume 19 Issue 40

208 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma A B C D Figure 1 Immunohistochemistry assay of DNA-dependent protein kinase and Ku 70/80 protein expression. Immunostaining showing that the expression of DNA-dependent protein kinase was significantly upregulated in gastric cancer (B) compared to normal gastric mucosa (A). Ku 70/80 expression was significantly increased in gastric cancer (D) compared to normal gastric mucosa (C). Scale bar = 40 μm. were incubated with the primary antibody overnight at 4, they were washed with PBS, followed by incubation with polymer helper for 30 min and poly peroxidase-antimouse or rabbit IgG for 30 min. After the sections were washed with PBS, they were incubated with 3,3-diaminobenzidin (DAB, Zhongshan Goldenbridge). The control sections incubated with PBS instead of the primary antibodies were used as negative controls. The sections were counterstained with hematoxylin. The slides were examined under a light microscope. The cells that stained a yellow or brown color in the nucleus and/or cytoplasm were defined as positive. Five randomly selected fields per section were analyzed. In a randomly selected field from representative areas, the immunoreactive cells among 100 cells were assessed and quantified by percentage. Then, the average percentage of the five fields was used to assess the area of immunostaining (0 = 0%-5%; 1 = 6%-25%; 2 = 26%-50%; 3 = 51%-75%; 4 = 76%-100%). In addition, the intensity of immunostaining was also semi-quantitatively assessed (0 = negative, 1 = weak, 2 = moderate, 3 = intense). Then, the integrals of the area intensity were calculated, by which the overall expression levels of the proteins in the section were defined as follows: negative (-): score 0-2; weakly positive (+): score 3-5; moderately positive (++): score 6-8; and strongly positive (+++): score The positive rate was the sum of weakly, moderately and strongly positive staining. The assessment of the sections was performed blindly by two pathologists, and when two views were not consistent, the assessment was judged by a third person. Statistical analysis All of the data are presented as the mean ± SD or percentage. The χ 2 test (SPSS v.16.0 for Windows; SPSS, Inc., Chicago, IL) was used to evaluate the difference in categorical variables, such as the positive rate between groups. The Mann-Whitney U test (SPSS v.16.0) was used to determine the differences in numerical variables between differently defined groups. Correlations were analyzed using Spearman s rank correlation co-efficient (SPSS v.16.0). A P value of less than 0.05 was considered statistically significant. RESULTS Overall expression of DNA-PKcs and Ku 70/80 in gastric mucosa tissues Overall, the positive rates of both DNA-PKcs and Ku 70/80 were significantly increased in GC (χ 2 = , P < for DNA-PKcs and χ 2 = 13.06, P < 0.01 for Ku) compared with NGM. In fact, there was hardly any detectable expression of DNA-PKcs in normal gastric mucosa, and the positive rate of DNA-PKcs protein expression in patients with NGM was 0% (0/34), whereas the rate in GC was 93.8% (137/146). The difference between the two groups is statistically significant. Additionally, the positive rate of Ku 70/80 was 79.4% (27/34) in NGM 6896 October 28, 2013 Volume 19 Issue 40

209 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma A Immunohistochemiscal scores of NHEJ related mediators B NGM GC b b DNA-PKcs Ku 70/80 b b b Table 1 Differential immunohistochemical positive rate of DNA-dependent protein kinase and Ku 70/80 in gastric carcinoma and normal gastric mucosa tissues Group n DNA-PKcs P Ku 70/80 value P value NGM < < 0.01 GC H. pylori positive NGM < < 0.10 GC H. pylori negative NGM < < 0.01 GC H. pylori: Helicobacter pylori; GC: Gastric carcinoma; NGM: Normal gastric mucosa; DNA-PKcs: DNA-dependent protein kinase. Immunohistochemiscal scores of DNA-PKcs C Immunohistochemiscal scores of Ku 70/ NGM GC G1 G2 G3 b NHEJ is a key source of genomic rearrangements, which are typically found in cancer cells [10]. Presently, numerous reports have demonstrated that chromosome translocaand 96.6% (141/146) in GC (Figure 1, Table 1). The average immunohistochemistry scores of the DNA-PKcs protein were significantly increased in GC (Mann-Whitney U = 39.00, P < 0.001), compared with NGM (Figure 2A, Table 1). In addition, there was a sig- GC NGM GC H. pylori + H. pylori - Figure 2 Comparison of the average expression levels of DNA-dependent protein kinase and Ku 70/80 in gastric carcinoma and normal gastric mucosa tissues. A: Immunohistochemistry scores of DNA-dependent protein kinase (DNA-PKcs) and Ku 70/80 in 146 cases of gastric carcinoma (GC) tissues compared with matched normal gastric mucosa; B: Comparison of the average expression level of DNA-PKcs between different differentiation degrees from well-differentiated (G1), moderately differentiated (G2) to poorly differentiated (G3) tumor tissues; C: Relative expression of Ku 70/80 in H. pylori-positive (H. pylori+) and -negative (H. pylori-) GC tissues. The data are shown as the mean values of each group, and the error bars represent SD. Statistical analysis was performed using the Kruskal-Wallis H test and Mann-Whitney U test. a P < 0.05, b P < 0.01 between groups. NGM: Normal gastric mucosa. a GC Table 2 Correlation between clinicopathological parameters and the expression of DNA-dependent protein kinase and Ku 70/80 in gastric carcinoma by Spearman analysis Clinicopathological parameters DNA-PKcs Ku 70/80 nificant difference in the average immunohistochemistry scores of Ku 70/80 (Mann-Whitney U = , P < 0.001) between GC and NGM (Figure 2A, Table 1). Correlation between the expression of DNA-PKcs and Ku 70/80 and different clinical parameters in gastric carcinoma patients Overall, DNA-PKcs expression was negatively correlated with differentiation degree (r = , P < 0.01) in patients with GC (Figure 2B, Table 2). Its expression increased from well differentiated (G1) tumor tissues to moderately differentiated (G2) tissues and from G1 to poorly differentiated (G3) tumor tissues, but there was no significant increase from G2 to G3 (Table 3). Ku 70/80 expression was negatively correlated with H. pylori infection (r = , P = 0.043) and clinical stage (r =-0.189, P = 0.022) in patients with GC (Figure 2C, Table 2). There was no correlation between DNA-PKcs expression and Ku 70/80 expression. DISCUSSION r P value r P value Age (yr) Sex H. pylori infection Lesion location Histological type Local Invasive Differentiation degree < Lymph node metastasis Clinical stages H. pylori: Helicobacter pylori; DNA-PKcs: DNA-dependent protein kinase October 28, 2013 Volume 19 Issue 40

210 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma Table 3 Expression of DNA-dependent protein kinase and Ku 70/80 in relation to the clinicopathological parameters of patients with gastric carcinoma Clinicopathological parameters n DNA-PKcs P value Ku 70/80 P value Age (yr) < Sex Male Female H. pylori infection Positive Negative Lesion location Antrum Others Histological type Protrude Ulcerative Infiltrative ulcer Diffuse infiltration Local invasion Mucosa and submucosa Muscular layer Serosa and subserosa Differentiation degree G G G Lymph node metastasis Positive Negative Clinical stages Ⅰ Ⅱ Ⅲ Ⅳ Distinguish the P value between each histological type. DNA-PKcs: DNA-dependent protein kinase. tions are a common cause of malignancy, and oncogenic fusion genes have been found in many hematological and solid tumors [11-13]. The over-expression of DNA-PKcs and Ku 70/80 has been found in various human tumors, but the pathways that promote translocations in gastric cancer are still unclear [14-16]. It is well-established that H. pylori infection is a definite etiological factor in gastric carcinogenesis [17-19]. However, the mechanism through which H. pylori infection contributes to the development of gastric cancer has not been fully elucidated. Obst et al [20] reported that H. pylori infection could cause DNA damage in gastric epithelial cells. Because Toller et al [21] showed an increased expression of γ-h2ax in H. pylori-infected GES-1 cells and indicated that GC may be associated with DNA double strand breaks (DSBs), we expected to detect increased DNA-PKcs expression in GC to explain the error-prone repair pathway found in the gastric mucosa. In this study, we found that the expression of DNA- PKcs and Ku 70/80 was increased in GC compared with NGM. Spearman analysis indicated a negative correlation between the expression of DNA-PKcs and tumor differentiation degrees. Moreover, Ku 70/80 was increased in H. pylori-positive GC patients compared with the negative group. Analysis of the data from 146 cases of GC did not show an obvious association between DNA-PKcs or Ku 70/80 expression levels and invasive lymph node metastasis or tumor histological type. We hypothesized that the enhanced DNA-PKcs and Ku 70/80 expression in gastric cancer may result from H. pylori-induced DNA damage in gastric epithelial cells. We initially analyzed the relationship between DNA-PKcs and Ku 70/80 protein expression and H. pylori infection status. As shown in the right panel of Figure 1C, the Ku 70/80 protein expression level was higher in H. pylori-positive GC tissues than in the H. pylori-negative tissue. Numerous studies have indicated that genome instability can be induced by NHEJ, which may increase the 6898 October 28, 2013 Volume 19 Issue 40

211 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma DNA double strand breaks Activation of DNA damage response Failed to activate DNA damage response ATM DNA-PKcs Apoptosis Rad 51 Ku 70/80 Homologous recombination Non-homologous end joining Commonly accurate repair Usually error-prone repair Normal DNA replication Chromosome recombination genome instability Gastric carcinogenesis Figure 3 A model depicting the effect of Helicobacter pylori infection on the DNA-dependent protein kinase and Ku 70/80-mediated non-homologous end joining repair pathway in gastric epithelial cells that might ultimately promote carcinogenesis. ATM: Ataxia telangiectasia mutated; DNA-PKcs: DNA-dependent protein kinase. risk of malignant transformation in cells [6]. In line with our results, Hu et al [22] reported that the expression of Ku70 proteins in precancerous lesions and GC tissue was significantly higher than that in normal gastric mucosal tissue. Moreover, the expression of Ku70 proteins in GC tissue was significantly higher than in precancerous lesions. Lee et al [23] verified that DNA-PKcs expression status was increased in consecutive cases of gastric cancer (450/564) by immunohistochemistry. Moreover, they found that DNA-PKcs expression was negative in the foveolar epithelium of normal gastric mucosal tissues but was positive in most H. pylori-associated gastritis, intestinal metaplasia and gastric adenoma tissues. Lim et al [24] found that Ku70 and Ku80 expression is mediated by constitutively activated NF-kappaB and constitutively expressed COX-2 in gastric cancer cells and indicated that Ku70 and Ku80 expression may be related to gastric cell proliferation and carcinogenesis. These data are consistent with our findings. Here, we show that exposure to H. pylori significantly upregulated Ku 70/80 expression but did not influence the expression of DNA-PKcs. We speculated that a lack of effectively activated DNA-PKcs might be responsible for the severe DNA damage and abnormal NHEJ repair activities due to H. pylori infection in gastric epithelial cells. In addition, environmental factors, such as H. pylori infection, stress and behavioral habits, may upset the balance between DNA-PKcs and Ku 70/80, and thus the damaged cells cannot launch the rapid and non-specific repair mechanism, leading to more serious and irreparable damage. To our knowledge, this is the first study to clarify the two key promoters of the NHEJ pathway in human gastric carcinoma tissue, DNA-PKcs and Ku 70/80. The upregulated expression of DNA-PKcs and Ku 70/80 in GC tissues compared with NGM confirms that there is enhanced NHEJ in human gastric carcinoma. As NHEJ is an error-prone and non-specific repair mechanism and can be induced before homologous recombination (HR), its excessive activation is capable of regulating cell cycle arrest, cell apoptosis, chromosome recombination and genome instability [25,26]. Our finding that Ku 70/80 expression is positively correlated with H. pylori colonization suggests that this alteration may be highly relevant for pathological processes during H. pylori infection. Infection with H. pylori can serve as a unique model system to determine the role of Ku 70/80-mediated abnormal NHEJ repair activities in gastric carcinogenesis (Figure 3). We found the following results: (1) gastric carcinogenesis is associated with enhanced non-homologous end joining repair; and (2) H. pylori mainly upregulates the expression of Ku 70/80 as opposed to DNA-PKcs to trigger NHEJ in gastric epithelial cells. Our data contribute to the complexity of the NHEJ function in GC. To illustrate the molecular mechanism underlying DNA-PK function in gastric carcinogenesis, further studies with larger samples in the various stages of gastric carcinoma are needed. In conclusion, the present study provides new perspectives into the role of DNA-PKcs and Ku 70/80 in gastric carcinogenesis. Our data indicated that dysregula October 28, 2013 Volume 19 Issue 40

212 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma tion of DNA-PK occurs frequently in GC and is associated with GC progression, which may be another important mechanism leading to abnormal repair activities in damaged gastric epithelial cells, especially the upregulated Ku 70/80 expression in H. pylori-related GC. In the current study, we found that both DNA-PKcs and Ku 70/80 were over-expressed in GC tissues. These results suggest that altered expression of DNA-PKcs and Ku 70/80 may function as a potential factor that may lead to genome instability in gastric carcinoma. COMMENTS Background Gastric carcinoma (GC) is characterized by genome instability through severe DNA damage caused by various factors, including Helicobacter pylori (H. pylori) infection, heredity and living habits. The incidence of gastric carcinoma is currently rising rapidly throughout the world, especially in developing countries. The exact pathogenesis of this disease is still unknown. Abnormal expression of DNA-dependent protein kinase (DNA-PKcs) and Ku 70/80 is associated with tumor growth, invasion and metastasis and may also play a crucial role in errorprone DNA repair activities in gastric epithelial cells, thus leading to genome instability and gastric carcinogenesis. Research frontiers DNA-PKcs and Ku 70/80 are crucial promoters of the non-homologous end joining (NHEJ) pathway. Accumulating evidence has shown that dysregulation of DNA-PKcs and Ku 70/80 is associated with pathological processes in various tumors. The expression changes and biological function of DNA-PKcs and Ku 70/80 in gastric carcinoma are still unclear. In this study, the authors demonstrate that the overexpression of DNA-PKcs and Ku 70/80 could be a potential mechanism for mediating error-prone DNA repair pathways in human gastric cancer tissues and verified that H. pylori infection may increase the expression of Ku 70/80, disrupting the standard activation of the NHEJ repair pathway, which is associated with gastric epithelial malignancies. Innovations and breakthroughs Recent reports have highlighted the importance of genome instability-related DNA repair promoters, including DNA-PKcs and Ku 70/80, in gastric carcinogenesis. Both DNA-PKcs and Ku 70/80 are over-expressed in gastric carcinoma compared to normal gastric mucosa. This is the first study to explore the change in expression of DNA-PKcs and Ku 70/80 in gastric carcinoma, to analyze the correlation between the expression of DNA-PKcs and Ku 70/80 and to investigate a series of clinical parameters to illustrate the potential pathological mechanism of carcinogenesis. Applications By verifying the changes of DNA-PKcs and Ku 70/80 and their relationship with gastric carcinoma, this study may provide new insights into the pathological mechanism of gastric cancer. Furthermore, the combination of DNA repair molecules and targeting drugs may offer a synergistic effect in the therapeutic treatment of gastric carcinoma. Terminology The catalytic subunit of the DNA-PKcs and the Ku 70/Ku 80 hetero-dimer (Ku 70/80) are crucial promoters of the error-prone NHEJ pathway. First, DNA- PKcs receives a DNA damage signal and launches a damage response. Next, Ku 70/80 binds to the damaged DNA ends and then attracts DNA-PKcs to form DNA-PK, which can trigger NHEJ repair activities. Accumulating evidence has shown that dysregulation of DNA-PKcs and Ku 70/80 is associated with pathological processes in various tumors. Peer review The authors examined the expression of DNA-PKcs and Ku 70/80 in gastric carcinoma. The study revealed that both DNA-PKcs and Ku 70/80 were increased in gastric carcinoma. The increase of DNA-PKcs expression was negatively correlated with differentiation degree, and Ku 70/80 expression was negatively correlated with H. pylori infection and the clinical stage of patients with GC. The results are interesting and may represent a new horizon for exploring the pathological mechanism of gastric carcinoma. REFERENCES 1 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011; 61: [PMID: DOI: /caac.20107] 2 Bosetti C, Bertuccio P, Malvezzi M, Levi F, Chatenoud L, Negri E, La Vecchia C. Cancer mortality in Europe, , and an overview of trends since Ann Oncol 2013; 24: [PMID: DOI: /annonc/mdt301] 3 Shrivastav M, Miller CA, De Haro LP, Durant ST, Chen BP, Chen DJ, Nickoloff JA. DNA-PKcs and ATM co-regulate DNA double-strand break repair. DNA Repair (Amst) 2009; 8: [PMID: DOI: /j.dnarep ] 4 Lieber MR, Gu J, Lu H, Shimazaki N, Tsai AG. Nonhomologous DNA end joining (NHEJ) and chromosomal translocations in humans. Subcell Biochem 2010; 50: [PMID: DOI: / _14] 5 Kloosterman WP, Tavakoli-Yaraki M, van Roosmalen MJ, van Binsbergen E, Renkens I, Duran K, Ballarati L, Vergult S, Giardino D, Hansson K, Ruivenkamp CA, Jager M, van Haeringen A, Ippel EF, Haaf T, Passarge E, Hochstenbach R, Menten B, Larizza L, Guryev V, Poot M, Cuppen E. Constitutional chromothripsis rearrangements involve clustered double-stranded DNA breaks and nonhomologous repair mechanisms. Cell Rep 2012; 1: [PMID: DOI: /j.celrep ] 6 Abe T, Ishiai M, Hosono Y, Yoshimura A, Tada S, Adachi N, Koyama H, Takata M, Takeda S, Enomoto T, Seki M. KU70/80, DNA-PKcs, and Artemis are essential for the rapid induction of apoptosis after massive DSB formation. Cell Signal 2008; 20: [PMID: DOI: / j.cellsig ] 7 Yang Z, Shu X, Chen L, Chen J, Xie Y, Lu NH. Expression of p53-mdm2 feedback loop related proteins in different gastric pathologies in relation to Helicobacter pylori infection: implications in gastric carcinogenesis. Clin Res Hepatol Gastroenterol 2012; 36: [PMID: DOI: / j.clinre ] 8 Hamilton SRAL. Pathology and genetics of tumours of the digestive system. In: World Health Organization classification of tumors. Lyon: IARCP, Fléjou JF. [WHO Classification of digestive tumors: the fourth edition]. Ann Pathol 2011; 31: S27-S31 [PMID: DOI: /j.annpat ] 10 Bunting SF, Nussenzweig A. End-joining, translocations and cancer. Nat Rev Cancer 2013; 13: [PMID: DOI: /nrc3537] 11 Bee L, Fabris S, Cherubini R, Mognato M, Celotti L. The efficiency of homologous recombination and non-homologous end joining systems in repairing double-strand breaks during cell cycle progression. PLoS One 2013; 8: e69061 [PMID: DOI: /journal.pone ] 12 Jackson SP, Bartek J. The DNA-damage response in human biology and disease. Nature 2009; 461: [PMID: DOI: /nature08467] 13 Furusawa Y, Fujiwara Y, Hassan MA, Tabuchi Y, Morita A, Enomoto A, Kondo T. Inhibition of DNA-dependent protein kinase promotes ultrasound-induced cell death including apoptosis in human leukemia cells. Cancer Lett 2012; 322: [PMID: DOI: /j.canlet ] 14 Gibaud A, Vogt N, Brison O, Debatisse M, Malfoy B. Characterization at nucleotide resolution of the homogeneously staining region sites of insertion in two cancer cell lines. Nucleic Acids Res 2013; 41: [PMID: DOI: /nar/gkt566] 15 Alshareeda AT, Negm OH, Albarakati N, Green AR, Nolan C, Sultana R, Madhusudan S, Benhasouna A, Tighe P, Ellis IO, Rakha EA. Clinicopathological significance of KU70/KU80, a key DNA damage repair protein in breast cancer. Breast 6900 October 28, 2013 Volume 19 Issue 40

213 Li W et al. DNA-PKcs and Ku70/80 in gastric carcinoma Cancer Res Treat 2013; 139: [PMID: DOI: /s x] 16 Kang MJ, Jung SM, Kim MJ, Bae JH, Kim HB, Kim JY, Park SJ, Song HS, Kim DW, Kang CD, Kim SH. DNA-dependent protein kinase is involved in heat shock protein-mediated accumulation of hypoxia-inducible factor-1alpha in hypoxic preconditioned HepG2 cells. FEBS J 2008; 275: [PMID: DOI: /j x] 17 Schistosomes, liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7-14 June IARC Monogr Eval Carcinog Risks Hum 1994; 61: [PMID: ] 18 Amaro HM, Barros R, Guedes AC, Sousa-Pinto I, Malcata FX. Microalgal compounds modulate carcinogenesis in the gastrointestinal tract. Trends Biotechnol 2013; 31: [PMID: DOI: /j.tibtech ] 19 Kato M, Asaka M. Recent development of gastric cancer prevention. Jpn J Clin Oncol 2012; 42: [PMID: DOI: /jjco/hys151] 20 Obst B, Wagner S, Sewing KF, Beil W. Helicobacter pylori causes DNA damage in gastric epithelial cells. Carcinogenesis 2000; 21: [PMID: ] 21 Toller IM, Neelsen KJ, Steger M, Hartung ML, Hottiger MO, Stucki M, Kalali B, Gerhard M, Sartori AA, Lopes M, Müller A. Carcinogenic bacterial pathogen Helicobacter pylori triggers DNA double-strand breaks and a DNA damage response in its host cells. Proc Natl Acad Sci USA 2011; 108: [PMID: DOI: /pnas ] 22 Hu H, Zhang Y, Zou M, Yang S, Liang XQ. Expression of TRF1, TRF2, TIN2, TERT, KU70, and BRCA1 proteins is associated with telomere shortening and may contribute to multistage carcinogenesis of gastric cancer. J Cancer Res Clin Oncol 2010; 136: [PMID: DOI: /s x] 23 Lee HS, Choe G, Park KU, Park do J, Yang HK, Lee BL, Kim WH. Altered expression of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) during gastric carcinogenesis and its clinical implications on gastric cancer. Int J Oncol 2007; 31: [PMID: ] 24 Lim JW, Kim H, Kim KH. Expression of Ku70 and Ku80 mediated by NF-kappa B and cyclooxygenase-2 is related to proliferation of human gastric cancer cells. J Biol Chem 2002; 277: [PMID: ] 25 Chapman JR, Taylor MR, Boulton SJ. Playing the end game: DNA double-strand break repair pathway choice. Mol Cell 2012; 47: [PMID: DOI: / j.molcel ] 26 Shrivastav M, De Haro LP, Nickoloff JA. Regulation of DNA double-strand break repair pathway choice. Cell Res 2008; 18: [PMID: DOI: /cr ] P- Reviewer Ricci V S- Editor Zhai HH L- Editor A E- Editor Zhang DN 6901 October 28, 2013 Volume 19 Issue 40

214 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. META-ANALYSIS Diabetes mellitus carries a risk of gastric cancer: A metaanalysis Shouji Shimoyama Shouji Shimoyama, Gastrointestinal Unit, Settlement Clinic, Tokyo , Japan Author contributions: Shimoyama S solely contributed to this paper. Correspondence to: Shouji Shimoyama, MD, Gastrointestinal Unit, Settlement Clinic, , Towa, Adachi-ku, Tokyo , Japan. shimoyama@apost.plala.or.jp Telephone: Fax: Received: May 14, 2013 Revised: June 27, 2013 Accepted: July 30, 2013 Published online: October 28, 2013 Abstract AIM: To investigate the association and quantify the relationship between diabetes mellitus (DM) and gastric cancer (GC) by an updated meta-analysis. METHODS: The initial PubMed search identified 1233 publications. Studies not reporting GC or those not reporting actual number of GC were excluded. Twelve pertinent studies were retrieved from the PubMed database or from a manual search and considered for the meta-analysis. Pooled risk ratios and 95%CI were estimated by a random-effects model. Subgroup analysis was performed according to gender or geographical regions. Heterogeneity and publication bias were evaluated by I 2 and funnel plot analysis, respectively. RESULTS: DM was significantly associated with GC with a RR of 1.41 (P = 0.006) (95%CI: ). Subgroup analyses revealed that both sexes showed a significant association with GC, with a greater magnitude of risk in females (RR = 1.90; 95%CI: ; P = 0.002) than in males (RR = 1.24; 95%CI: ; P = 0.002). In addition, the link between DM and GC was significant in East Asian DM patients (RR = 1.77; 95%CI: ; P < ) but not in Western DM patients (RR = 1.23; 95%CI: ; P = 0.2). There was no evidence of publication bias, but the re- sults indicated significant heterogeneity. CONCLUSION: This updated meta-analysis has provided evidence of positive DM-GC associations. The limited information on potentially important clinical confounding factors in each study deserves further investigation Baishideng. All rights reserved. Key words: Gastric cancer; Diabetes mellitus; Metaanalysis; Hyperglycemia; Hyperinsulinemia Core tip: Diabetes mellitus (DM) was significantly associated with gastric cancer (GC) with a risk ratio of This positive DM-GC association was also observed in both sexes with a greater magnitude of risk in females than male, and in East Asian patients but not in Western patients. This study could provide one answer to current inconsistent knowledge across trials concerning a positive/inverse DM-GC association. Since DM patients are less likely to be screened for cancers, clinicians caring for DM patients should remain alert to detect GC especially in females, since there are fewer female than male GC patients in the general population. Shimoyama S. Diabetes mellitus carries a risk of gastric cancer: A meta-analysis. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6902.htm DOI: i INTRODUCTION A growing body of evidence, derived largely from casecontrol studies, cohort studies, and meta-analyses, suggests that diabetes mellitus (DM) is associated with an increased risk of a number of cancers. The risk increases 2-fold for cancers of the liver, pancreas, and endome October 28, 2013 Volume 19 Issue 40

215 Shimoyama S. Diabetes mellitus and gastric cancer trium, and fold for cancers of the colon and rectum, breast, bladder, and kidney [1], while prostate cancer shows a positive [2] or inverse [1] association with DM. In fact, DM is a disease of global epidemic proportions. The DM population has increased from 171 million in 2000 to 366 million in 2011, a figure projected to increase to 552 million by 2030 [3,4]. This increasing prevalence of DM with its anticipated 200 million more patients over the next two decades suggests that even a small increase in cancer risk will have an undeniable impact on the health of the general population. Therefore, in addition to the dramatic increase in the prevalence of DM and the consequences of its complications, a DM-cancer association may greatly affect worldwide health levels. Despite the heightening clinical awareness of the DM-cancer association, however, the risk of gastric cancer (GC) in DM patients has seemingly attracted little attention among diabetes researchers and healthcare providers, and this topic has been scarcely addressed in the English literature with contradictory findings. This dearth of data may be attributable to the fact that the disease per se has been paid little attention in the West, with fewer established regular screening programs for GC. Consequently, the risk of GC in DM patients is still overshadowed by the more common acute and chronic DM complications such as cardiovascular and renal diseases, which largely account for the 2-fold increase in mortality associated with DM [5]. Under these circumstances, the reported risks of GC in DM patients have been inconsistent, being high [6,7], neutral [8], or inverse [9] with an odds ratio or incidence RR of 1.14 (95%CI: ) to 2.07 (95%CI: ), 1.2 (95%CI: ) to 1.6 (95%CI: ), and 0.67 (95%CI: ), respectively. Mixed results were also observed while evaluating the association between fasting glucose and GC risk; the Japanese Hisayama study [10] showed a positive association, but European [11] and Korean [12] studies did not. Furthermore, the studies investigating DM-GC associations comprised heterogeneous participants without distinguishing between type 1 DM (T1DM) and type 2 DM (T2DM) [13], or were based on different DM criteria such as treatment [14,15], fasting blood glucose [11], or self-report [16,17]. Even three recent meta-analyses have provided mixed results with neutral [18], marginal [19], and positive [20] DM-GC associations. This article aims to update the DM-GC association by including several of the most recent articles as well as others investigating the actual number of GC patients in DM and non DM cohorts. MATERIALS AND METHODS All publications concerning the DM-GC association were retrieved from the English literature. A computerized literature search between the years 1950 and January 2013 was conducted in PubMed using Boolean operators, with ( cancer or carcinoma ) and diabetes as keywords. Additional studies that were considered pertinent were sought by a manual search through reference lists in the retrieved publications. The reference retrieval was additionally complemented by a manual search of references from previous meta-analyses [18-20]. When more than one analysis of the same cohort was published, the most recent was selected. Articles which apparently reported cancers other than GC in their title/abstract were excluded. Afterwards, following a thorough review of the selected articles, 12 studies reporting comparisons on actual numbers of GC patients between DM and non DM subjects were finally judged to qualify [11,15-17,21-28]. The reference lists of the identified meta-analyses were searched to identify original research reports on this topic. Reports from Japan [16,21,22] and Taiwan [15,23] were defined as East Asian studies, and those from the United States [17,24,25] and Europe [11,26,27] defined as Western studies. Statistical analysis Each GC incidence in each publication was treated as a dichotomous variable. Data from all relevant studies were combined to estimate the pooled RR with a 95%CI using the random effects model [29] provided by the Cochrane Library software Review Manager 5. An RR less than or greater than 1.0 meant respectively a negative or positive DM-GC association. Heterogeneity was quantified using the I 2 measure, in which I 2 < 30% indicated mild heterogeneity, 30%-70% moderate heterogeneity, and > 70% severe heterogeneity [30]. Publication bias was evaluated by funnel plot analysis using Comprehensive Meta Analysis version 2 software. P < 0.05 was considered significant. RESULTS The initial PubMed search identified 1233 publications. After the title and abstract review, studies reporting cancers other than GC in DM patients were excluded, and 152 articles deemed potentially relevant were retrieved for further evaluation. Excluding studies not reporting the actual number of GC patients in DM and nondm cohorts, 12 publications were ultimately selected (Figure 1), yielding a total of GC patients: 2150 DM and non-dm. T1DM and T2DM were not differentiated in these publications except for two in which only T2DM patients were investigated. Five [15,16,21-23] studies were from East Asia, 6 [11,17,24-27] were from the West, and one [28] was from Israel. Each publication provided mixed results concerning the DM-GC association with adjustment of confounders (Table 1). The pooled results showed a significant increase in GC risk in the DM cohort (RR = 1.41; 95%CI: ; P = 0.006) with significant statistical heterogeneity (I 2 = 95%; P < ) (Figure 2A). The subgroup analyses stratified by gender or geographical regions revealed positive GC associations in both sexes, with a larger magnitude of correlation in females (RR = 1.90; 95%CI: ; P = 0.002) than in males (RR = 1.24; 95%CI: ; P = 0.002) (Figure 2B and C). East Asian subjects showed a 77% increased risk of GC (RR = 1.77; 95%CI: ; P < ) but Western subjects did not (RR = 1.23; 95%CI: ; P = 0.2) (Figure 2D 6903 October 28, 2013 Volume 19 Issue 40

216 Shimoyama S. Diabetes mellitus and gastric cancer Records identified through electronic database searching (Search performed on 31 January 2013) n = 1233 Records screened n = 1233 Records excluded after review of title and abstract n = 1081 Full text articles assessed n = 152 Additional full-text articles included after hand searching of reference lists n = 3 Full text articles included after review n = 9 Excluded after full text review n = 143 Studies included in this meta analysis n = 12 Figure 1 Flow chart of the publication selection process. and E). The visual inspection of the funnel plots seemed basically symmetric, and Egger s test did not indicate statistically significant asymmetry for all included studies (intercept = 0.70, one-tailed P = 0.37), indicating no evidence of publication bias (Figure 3). DISCUSSION This updated meta-analysis, with GC as the disease in focus in articles published up to January 2013, has elucidated a positive DM-GC association, the findings being consistent with one previous meta-analysis [20]. A subgroup analysis has provided the first evidence of a significantly increased risk of GC in both sexes, with a more prominent association in females than in males. Furthermore, the DM-GC association was positive for East Asians but not for Western subjects. This meta-analysis focused on GC incidence rather than GC mortality, because GC mortality could be mainly influenced by the treatment modalities for GC such as extent of surgery and chemotherapy regimens, which differ markedly between countries. These are the reasons for the relatively fewer number of papers included in this meta-analysis compared with the previous ones [19,20]. However, against the background of controversial findings [18-20] in this matter in the literature, this study provided data supporting a positive DM-GC association. There is a consensus that T2DM is associated with a spectrum of cancers. Although the exact underlying mechanisms linking DM and cancers remain unknown, several possible mechanisms have been debated and proposed: (1) the association between DM and cancer is direct through hyperglycemia; (2) diabetes is preceded by hyperinsulinemia and insulin resistance that alter cancer risk; and (3) the DM-cancer association is due to common risk factors such as obesity. Each of these represents a hallmark metabolic abnormality identified in T2DM and can potentially underlie the association between DM and GC. First, Swedish T1DM patients had more than twice the relative risk of GC than the general population [31,32], suggesting that the associations between GC and hyperglycemia are biologically plausible since T1DM is an autoimmune disease manifesting as hyperglycemia due to pancreatic beta-cell destruction and insulin deficiency. Several mechanisms have been proposed that could explain the relationship between hyperglycemia and cancer. Hyperglycemia causes oxidative stress which promotes the formation of advanced glycation products (AGEs) and the expression of their receptor (RAGE); the AGE/RAGE interaction in turn stimulates oxidative stress. Furthermore, the crosstalk between the AGE/ RAGE system and oxidative stress has been known to 6904 October 28, 2013 Volume 19 Issue 40

217 Shimoyama S. Diabetes mellitus and gastric cancer A DM nondm Risk ratio Risk ratio Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Atchison % 1.08 [1.01, 1.15] Chen % 1.08 [0.64, 1.19] Chodick % 1.00 [0.74, 1.35] Hsieh % 2.12 [1.93, 2.33] Ikeda % 2.44 [1.60, 3.73] Inoue % 1.73 [1.42, 2.11] Kuriki % 2.10 [1.78, 2.47] La Vecchia % 0.82 [0.58, 1.16] Lin % 1.64 [1.33, 2.02] O'Mara % 1.03 [0.56, 1.88] Ogunleye % 0.70 [0.39, 1.23] Rapp % 2.91 [1.90, 4.45] Total (95%CI) % 1.41 [1.10, 1.81] Total events Heterogeneity: Tau 2 = 0.16; χ 2 = , df = 11 (P < ); I 2 = 95% Test for overall effect: Z = 2.74 (P = 0.006) B DM nondm Risk ratio Risk ratio Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Inoue % 1.37 [1.10, 1.70] Kuriki % 1.28 [1.06, 1.53] La Vecchia % 0.77 [0.48, 1.21] Lin % 1.27 [1.01, 1.59] O'Mara % 0.85 [0.36, 1.98] Rapp % 1.60 [0.75, 3.45] Total (95%CI) % 1.24 [1.08, 1.43] Total events Heterogeneity: Tau 2 = 0.01; χ 2 = 6.33, df = 5 (P = 0.28); I 2 = 21% Test for overall effect: Z = 3.05 (P = 0.002) C DM nondm Risk ratio Risk ratio Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Inoue % 1.85 [1.18, 2.89] Kuriki % 2.24 [1.58, 3.18] La Vecchia % 0.93 [0.55, 1.57] Lin % 1.62 [0.98, 2.68] O'Mara % 1.53 [0.64, 3.66] Rapp % 4.47 [2.65, 7.53] Total (95%CI) % 1.90 [1.27, 2.85] Total events Heterogeneity: Tau 2 = 0.18; χ 2 = 19.35, df = 5 (P = 0.002); I 2 = 74% Test for overall effect: Z = 3.12 (P = 0.002) D DM nondm Risk ratio Risk ratio Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Chen % 0.87 [0.64, 1.19] Hsieh % 2.12 [1.93, 2.33] Ikeda % 2.44 [1.60, 3.73] Inoue % 1.73 [1.42, 2.11] Kuriki % 2.10 [1.78, 2.47] Total (95%CI) % 1.77 [1.38, 2.26] Total events Heterogeneity: Tau 2 = 0.06; χ 2 = 31.82, df = 4 (P < ); I 2 = 87% Test for overall effect: Z = 4.53 (P < ) October 28, 2013 Volume 19 Issue 40

218 Shimoyama S. Diabetes mellitus and gastric cancer E DM nondm Risk ratio Risk ratio Study or subgroup Events Total Events Total Weight M-H, Random, 95%CI M-H, Random, 95%CI Atchison % 1.08 [1.01, 1.15] La Vecchia % 0.82 [0.58, 1.16] Lin % 1.64 [1.33, 2.02] O'Mara % 1.03 [0.56, 1.88] Ogunleye % 0.70 [0.39, 1.23] Rapp % 2.91 [1.90, 4.45] Total (95%CI) % 1.23 [0.90, 1.68] Total events Heterogeneity: Tau 2 = 0.12; χ 2 = 39.01, df = 5 (P < ); I 2 = 87% Test for overall effect: Z = 1.29 (P = 0.20) Figure 2 Forest plot representation-random-effects model. A: All included publications. Stratified by sex; B: Male; C: Female, and stratified by geographical area; D: East Asia; E: The West. The individual block squares denote the RR for each study of gastric cancer risk among diabetes mellitus (DM) patients, with an area proportional to the amount of statistical information in each study. The horizontal line denotes a 95%CI, ending with an arrowhead when CI extends beyond the scale. The pooled estimate and its 95%CI are represented by a diamond. Squares or diamonds plotted in the right half indicate increased gastric cancer risk. The risk is considered significant only if the horizontal line or diamond does not overlap the solid vertical line. Table 1 Summary of included studies Ref. Country Study population Diagnosis of DM RR of GC (95%CI) Confounders or Adjusted factors Atchison et al [24] United States Veteran men Hospital disease record Chen et al [15] Taiwan National Health Insurance database Antidiabetic drug 0.95 ( ) Age, time, latency, race, number of visits, alcohol, obesity, chronic obstructive pulmonary diseases 0.90 ( ) Age, gastric polyp, partial gastrectomy, gastric ulcer, pneumoconiosis Chodick et al [28] Israel Healthcare service registry Antidiabetic drug Hsieh et al [23] Taiwan National Health Insurance database Ambulatory or inpatient care Men 1.44 ( ) Women 0.99 ( ) Age, region, use of healthcare service, BMI, cardiovascular disease 0.92 ( ) age, sex Ikeda et al [21] Japan Hisayama, population-based Oral glucose tolerance test, fasting plasma glucose Inoue et al [16] Japan Public Health Center-based prospective study Kuriki et al [22] Japan Hospital-based epidemiologic research program Questionnaire Men 1.23 ( ) Women 1.61 ( ) Questionnaire Men 1.16 ( ) Women 1.70 ( ) 2.13 ( ) 1 Age, sex, Helicobacter pylori peptic ulcer, 2.69 ( ) 2 BMI, total cholesterol, alcohol, smoking, dietary factors Age, study area, cerebrovascular disease, ischemic heart disease, smoking, alcohol, BMI, physical activity, green vegetable intake, coffee intake Age, BMI, drinking and smoking, physical activity, bowel movement, family history of cancer or diabetes, dietary restriction, raw vegetable intake, greasy food intake La Vecchia et al [26] Italy Case-control study Questionnaire 0.6 ( ) age, sex Ge et al [19] United States National Institutes of Health American Association of Retired Persons diet and health study Questionnaire Cardia 1.89 ( ) Noncardia 0.98 ( ) Age, sex, calories, alcohol, smoking, fruit intake, vegetable intake, ethnicity, education, physical activity O'Mara et al [25] United States Case-control study Questionnaire Men 0.7 (ND) Age Women 1.2 (ND) Ogunleye et al [27] United Kingdom Health Informatics Center Registry 0.73 ( ) Deprivation decile Rapp et al [11] Austria Vorarlberg Health Monitoring and Promotion Programme Fasting blood glucose Men 0.84 ( ) 3 Women 1.16 ( ) 4 Age, smoking, occupational group, BMI 1 Hemoglobin A1c, 6.0%-6.9%; 2 Hemoglobin A1c, 7.0%; 3 Fasting blood glucose, 7 mmol/l; 4 Fasting blood glucose, mmol/l. GC: Gastric cancer; ND: Not described; BMI: Body mass index; DM: Diabetes mellitus. activate numerous cell signaling pathways related to cell growth and apoptosis [33] that could eventually promote carcinogenesis and cell invasion [34]. Indeed, in vitro analyses have revealed the AGE/RAGE interaction positively correlating with the invasion and metastasis of gastric [35], pancreatic [36], and biliary [37] cancers. However, considering that epidemiological studies failed to find any increased risk of pancreatic, breast, colorectal, kidney, liver, or bladder cancers in T1DM patients [31,32], which in turn are associated with cases of T2DM, and that the association 6906 October 28, 2013 Volume 19 Issue 40

219 Shimoyama S. Diabetes mellitus and gastric cancer SE (log [RR]) RR Figure 3 Funnel plot analysis of all the included publications. between T1DM and a greater risk of developing cancer is equivocal [38], factors other than glucose may play an important role. Besides hyperglycemia, a second hallmark of T2DM is hyperinsulinemia, resulting from insulin resistance in peripheral tissues for many years both before and after diagnosis; in fact, hyperinsulinemia may be the main culprit for cancer development. Insulin is capable of activating insulin-like growth factor (IGF)-Ⅰ by enhancing hepatic IGF-Ⅰ synthesis and is also capable of increasing the bioavailability of IGF-Ⅰ by reducing hepatic production of the IGF-binding proteins [39,40]. Enhanced insulin and IGF-Ⅰ signals through insulin and IGF-Ⅰ receptors, respectively, promote cell proliferation and growth via multiple cellular signaling cascades [39-41]. Indeed, the overexpression of IGFs and the IGF-Ⅰ receptor was observed in GC tissues [42,43], and increased expression of the IGF-Ⅰ receptor was correlated with cancer aggressiveness [44] or poor survival [45], suggesting a functional insulin-igf axis in GC. Third, the etiology of GC is multifactorial and may be associated with several confounding factors such as increased body mass index and Helicobacter pylori (H. pylori) infection. Visceral fat per se contributes to cancer risk [46], and possible underlying molecular mechanisms linking with obesity that foster cancer development have been demonstrated [39,46,47]. Accordingly, one recent metaanalysis has revealed that overweight and obesity correlated with GC [48], findings which are consistent with other types of cancer [39,46,47]. Regarding H. pylori infection, DM patients showed a higher frequency than non DM subjects both in the West [49] and in the East [50], and H. pylori infection was in turn correlated with insulin resistance [51], suggesting that DM is liable to cause H. pylori infection and vice versa. Accordingly, GC risk was dramatically increased when DM and H. pylori infection coexisted [21]. One novel finding in this study is a positive DM-GC association in both sexes with a more prominent association in females than in males, which contrasts with the male preponderance of GC in the general population. Such a seemingly inverse sex distribution of GC in DM subjects may be attributable to the decreased sex hormone-binding globulin under increased IGF- Ⅰ and hyperinsulinemia [52], leading to increased bioavailability of estrogen in both sexes and increased levels of bioavailable testosterone in women but not in men [53]. These mechanisms are plausible explanations for an increased risk of hormone-dependent cancers such as breast cancer in female DM patients. Therefore, it can be speculated that the alterations of sex hormones may influence the magnitude of GC risk by gender in DM patients. On the other hand, the present study revealed the increased risk of GC in populations in East Asia but not in the West, findings which are consistent with one previous study [20]. These results can be explained partly by the geographical difference in GC risk [54], and partly by the more established screening program in East Asian countries than in the Western countries. This speculation is supported by similar findings of a greater gastric cardia cancer risk in East Asia than in the West among the H. pylori-infected patients [55]. Interestingly, a similar geographic difference was also observed in the DM-prostate cancer association [1,2]. There are several limitations to this meta-analysis. First, besides obesity and H. pylori infection, GC development appear to be confounded by the possible presence of shared cancer-promoting or -preventing factors such as an unhealthy diet (e.g., high salt intake [56] or heavy alcohol drinking [57] ), sedentary lifestyle with lack of physical activity, duration of the DM state, and the consumption of vegetables, fruit [58], and green tea [59]. In addition, some diabetes treatments may increase or decrease cancer risk. These confounding factors make it difficult to accurately assess GC risk in DM patients. Therefore, investigation into the actual GC risk in DM patients requires adjustment based on these confounding factors. This is reflected by the significant heterogeneity, which has been also observed in the previous three meta-analyses; thus, further analyses are warranted. A second limitation is that most studies included in this study reported a DM and GC risk without distinction between T1DM and T2DM. Since T1DM is less prevalent than T2DM [38], most patients in this meta-analysis can be regarded as T2DM. However, the DM-GC association should be further elucidated with distinction between the two types since they differ considerably in their metabolic characteristics. The diversity of DM conditions and cancer biology, as well as the complexity of the potentially contributory mechanisms, preclude a definitive description of the association between DM and cancer risk at present. Although the precise biological mechanisms that might link DM to cancer remain a matter of debate, the recent surge in attempts to explore the relationship between the two diseases has motivated considerable investigation among the clinical and research communities. This metaanalysis suggests that newer, comprehensive approaches must be developed for the treatment of DM patients as a whole rather than as a single disease. However, it is also true that DM patients are less likely to be screened for several types of cancers [60-62], which may be attributable to the patient preference to focus on the treatment of DM 6907 October 28, 2013 Volume 19 Issue 40

220 Shimoyama S. Diabetes mellitus and gastric cancer rather than prevention of cancer [62], when DM consumes his/her attention. Clinicians caring for patients with DM should remain alert to GC and minimize the number of missed opportunities for its treatment. COMMENTS Background Besides cardiovascular complications, evidence has accumulated that diabetes mellitus (DM) patients are highly predisposed to many types of cancer. Among the cancer subtypes investigated, however, knowledge on the link between gastric cancer (GC) and DM has been insufficient and inconsistent even in previous meta-analyses. Research frontiers Several meta-analyses have been published to investigate the association between DM and GC, however, the results have been inconsistent and varied, from inverse to positive DM-GC associations, indicating that the link between the two diseases has been unclear. Innovations and breakthroughs DM exhibited significantly increased GC risk by 41% overall, and by 90% in females, 24% in males, and 77% in East Asians in subgroup analyses. These findings provide evidence in the current debate concerning the DM-GC association. Furthermore, a larger GC risk in female DM patients than in males was found to be marked. Applications Evidence of a positive DM-GC association, together with the positive link between DM and many other types of cancer, suggest a need for development of newer, comprehensive approaches for the treatment of DM patients as a whole rather than as a single disease. Clinicians caring for DM patients should remain alert to GC and minimize the number of missed opportunities for its treatment. Terminology Advanced glycation end products (AGEs) are proteins or lipids that become glycated after exposure to sugars. AGEs contribute to a variety of microvascular and macrovascular complications by engaging the receptor for advanced glycation end products. Peer review This meta-analysis provides useful information to clinical and research field for establishing comprehensive management to DM patients. REFERENCES 1 Vigneri P, Frasca F, Sciacca L, Pandini G, Vigneri R. Diabetes and cancer. Endocr Relat Cancer 2009; 16: [PMID: DOI: /ERC ] 2 Tseng CH. Diabetes and risk of prostate cancer: a study using the National Health Insurance. Diabetes Care 2011; 34: [PMID: DOI: /dc ] 3 Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabetes: estimates for the year 2000 and projections for Diabetes Care 2004; 27: [PMID: ] 4 IDF diabetes atlas. Available from: URL: org/diabetesatlas/5e/diabetes 5 Seshasai SR, Kaptoge S, Thompson A, Di Angelantonio E, Gao P, Sarwar N, Whincup PH, Mukamal KJ, Gillum RF, Holme I, Njølstad I, Fletcher A, Nilsson P, Lewington S, Collins R, Gudnason V, Thompson SG, Sattar N, Selvin E, Hu FB, Danesh J. Diabetes mellitus, fasting glucose, and risk of cause-specific death. N Engl J Med 2011; 364: [PMID: DOI: /NEJMoa ] 6 Gong Y, Yang YS, Zhang XM, Su M, Wang J, Han JD, Guo MZ. ABO blood type, diabetes and risk of gastrointestinal cancer in northern China. World J Gastroenterol 2012; 18: [PMID: DOI: /wjg.v18.i6.563] 7 Tseng CH. Diabetes, insulin use, and gastric cancer: a population-based analysis of the Taiwanese. J Clin Gastroenterol 2013; 47: e60-e64 [PMID: ] 8 Zhang PH, Chen ZW, Lv D, Xu YY, Gu WL, Zhang XH, Le YL, Zhu HH, Zhu YM. Increased risk of cancer in patients with type 2 diabetes mellitus: a retrospective cohort study in China. BMC Public Health 2012; 12: 567 [PMID: DOI: / ] 9 Khan M, Mori M, Fujino Y, Shibata A, Sakauchi F, Washio M, Tamakoshi A. Site-specific cancer risk due to diabetes mellitus history: evidence from the Japan Collaborative Cohort (JACC) Study. Asian Pac J Cancer Prev 2006; 7: [PMID: ] 10 Yamagata H, Kiyohara Y, Nakamura S, Kubo M, Tanizaki Y, Matsumoto T, Tanaka K, Kato I, Shirota T, Iida M. Impact of fasting plasma glucose levels on gastric cancer incidence in a general Japanese population: the Hisayama study. Diabetes Care 2005; 28: [PMID: ] 11 Rapp K, Schroeder J, Klenk J, Ulmer H, Concin H, Diem G, Oberaigner W, Weiland SK. Fasting blood glucose and cancer risk in a cohort of more than 140,000 adults in Austria. Diabetologia 2006; 49: [PMID: ] 12 Jee SH, Ohrr H, Sull JW, Yun JE, Ji M, Samet JM. Fasting serum glucose level and cancer risk in Korean men and women. JAMA 2005; 293: [PMID: ] 13 Lo SF, Chang SN, Muo CH, Chen SY, Liao FY, Dee SW, Chen PC, Sung FC. Modest increase in risk of specific types of cancer types in type 2 diabetes mellitus patients. Int J Cancer 2013; 132: [PMID: DOI: / ijc.27597] 14 Swerdlow AJ, Laing SP, Qiao Z, Slater SD, Burden AC, Botha JL, Waugh NR, Morris AD, Gatling W, Gale EA, Patterson CC, Keen H. Cancer incidence and mortality in patients with insulin-treated diabetes: a UK cohort study. Br J Cancer 2005; 92: [PMID: ] 15 Chen YL, Cheng KC, Lai SW, Tsai IJ, Lin CC, Sung FC, Lin CC, Chen PC. Diabetes and risk of subsequent gastric cancer: a population-based cohort study in Taiwan. Gastric Cancer 2013; 16: [PMID: ] 16 Inoue M, Iwasaki M, Otani T, Sasazuki S, Noda M, Tsugane S. Diabetes mellitus and the risk of cancer: results from a large-scale population-based cohort study in Japan. Arch Intern Med 2006; 166: [PMID: ] 17 Szerlip HM, Heeger P, Feldman GM. Comparison between acetate and bicarbonate dialysis for the treatment of lithium intoxication. Am J Nephrol 1992; 12: [PMID: DOI: / EPI ] 18 Marimuthu SP, Vijayaragavan P, Moysich KB, Jayaprakash V. Diabetes mellitus and gastric carcinoma: Is there an association? J Carcinog 2011; 10: 30 [PMID: DOI: / ] 19 Ge Z, Ben Q, Qian J, Wang Y, Li Y. Diabetes mellitus and risk of gastric cancer: a systematic review and metaanalysis of observational studies. Eur J Gastroenterol Hepatol 2011; 23: [PMID: DOI: / MEG.0b013e32834b8d73] 20 Tian T, Zhang LQ, Ma XH, Zhou JN, Shen J. Diabetes mellitus and incidence and mortality of gastric cancer: a metaanalysis. Exp Clin Endocrinol Diabetes 2012; 120: [PMID: DOI: /s ] 21 Ikeda F, Doi Y, Yonemoto K, Ninomiya T, Kubo M, Shikata K, Hata J, Tanizaki Y, Matsumoto T, Iida M, Kiyohara Y. Hyperglycemia increases risk of gastric cancer posed by Helicobacter pylori infection: a population-based cohort study. Gastroenterology 2009; 136: [PMID: DOI: /j.gastro ] 22 Kuriki K, Hirose K, Tajima K. Diabetes and cancer risk for all and specific sites among Japanese men and women. Eur J Cancer Prev 2007; 16: [PMID: ] 23 Hsieh MC, Lee TC, Cheng SM, Tu ST, Yen MH, Tseng CH. The influence of type 2 diabetes and glucose-lowering therapies on cancer risk in the Taiwanese. Exp Diabetes Res 2012; 2012: [PMID: DOI: /2012/413782] 24 Atchison EA, Gridley G, Carreon JD, Leitzmann MF, Mc October 28, 2013 Volume 19 Issue 40

221 Shimoyama S. Diabetes mellitus and gastric cancer Glynn KA. Risk of cancer in a large cohort of U.S. veterans with diabetes. Int J Cancer 2011; 128: [PMID: DOI: /ijc.25362] 25 O'Mara BA, Byers T, Schoenfeld E. Diabetes mellitus and cancer risk: a multisite case-control study. J Chronic Dis 1985; 38: [PMID: ] 26 La Vecchia C, Negri E, Franceschi S, D Avanzo B, Boyle P. A case-control study of diabetes mellitus and cancer risk. Br J Cancer 1994; 70: [PMID: ] 27 Ogunleye AA, Ogston SA, Morris AD, Evans JM. A cohort study of the risk of cancer associated with type 2 diabetes. Br J Cancer 2009; 101: [PMID: DOI: /sj.bjc ] 28 Chodick G, Heymann AD, Rosenmann L, Green MS, Flash S, Porath A, Kokia E, Shalev V. Diabetes and risk of incident cancer: a large population-based cohort study in Israel. Cancer Causes Control 2010; 21: [PMID: DOI: /s ] 29 DerSimonian R, Laird N. Meta-analysis in clinical trials. Control Clin Trials 1986; 7: [PMID: ] 30 Higgins JP, Thompson SG. Quantifying heterogeneity in a meta-analysis. Stat Med 2002; 21: [PMID: ] 31 Zendehdel K, Nyrén O, Ostenson CG, Adami HO, Ekbom A, Ye W. Cancer incidence in patients with type 1 diabetes mellitus: a population-based cohort study in Sweden. J Natl Cancer Inst 2003; 95: [PMID: ] 32 Shu X, Ji J, Li X, Sundquist J, Sundquist K, Hemminki K. Cancer risk among patients hospitalized for Type 1 diabetes mellitus: a population-based cohort study in Sweden. Diabet Med 2010; 27: [PMID: DOI: / j x] 33 Rojas A, González I, Morales E, Pérez-Castro R, Romero J, Figueroa H. Diabetes and cancer: Looking at the multiligand/rage axis. World J Diabetes 2011; 2: [PMID: DOI: /wjd.v2.i7.108] 34 Abe R, Yamagishi S. AGE-RAGE system and carcinogenesis. Curr Pharm Des 2008; 14: [PMID: ] 35 Yamada K, Urisu A, Komada H, Inagaki Y, Yamada M, Nakamura R, Torii S. [The involvement of rice protein 16KD in cross-allergenicity between antigens in rice, wheat, corn, Japanese millet, Italian millet]. Arerugi 1991; 40: [PMID: ] 36 Takada M, Koizumi T, Toyama H, Suzuki Y, Kuroda Y. Differential expression of RAGE in human pancreatic carcinoma cells. Hepatogastroenterology 2001; 48: [PMID: ] 37 Hirata K, Takada M, Suzuki Y, Kuroda Y. Expression of receptor for advanced glycation end products (RAGE) in human biliary cancer cells. Hepatogastroenterology 2003; 50: [PMID: ] 38 Gordon-Dseagu VL, Shelton N, Mindell JS. Epidemiological evidence of a relationship between type-1 diabetes mellitus and cancer: a review of the existing literature. Int J Cancer 2013; 132: [PMID: ] 39 Cowey S, Hardy RW. The metabolic syndrome: A high-risk state for cancer? Am J Pathol 2006; 169: [PMID: ] 40 Adachi Y, Yamamoto H, Ohashi H, Endo T, Carbone DP, Imai K, Shinomura Y. A candidate targeting molecule of insulin-like growth factor-i receptor for gastrointestinal cancers. World J Gastroenterol 2010; 16: [PMID: ] 41 Rozengurt E, Sinnett-Smith J, Kisfalvi K. Crosstalk between insulin/insulin-like growth factor-1 receptors and G protein-coupled receptor signaling systems: a novel target for the antidiabetic drug metformin in pancreatic cancer. Clin Cancer Res 2010; 16: [PMID: DOI: / CCR ] 42 Zhao MD, Hu XM, Sun DJ, Zhang Q, Zhang YH, Meng W. Expression of some tumor associated factors in human carcinogenesis and development of gastric carcinoma. World J Gastroenterol 2005; 11: [PMID: ] 43 Pavelić K, Kolak T, Kapitanović S, Radosević S, Spaventi S, Kruslin B, Pavelić J. Gastric cancer: the role of insulin-like growth factor 2 (IGF 2) and its receptors (IGF 1R and M6-P/ IGF 2R). J Pathol 2003; 201: [PMID: ] 44 Jiang Y, Wang L, Gong W, Wei D, Le X, Yao J, Ajani J, Abbruzzese JL, Huang S, Xie K. A high expression level of insulin-like growth factor I receptor is associated with increased expression of transcription factor Sp1 and regional lymph node metastasis of human gastric cancer. Clin Exp Metastasis 2004; 21: [PMID: ] 45 Matsubara J, Yamada Y, Hirashima Y, Takahari D, Okita NT, Kato K, Hamaguchi T, Shirao K, Shimada Y, Shimoda T. Impact of insulin-like growth factor type 1 receptor, epidermal growth factor receptor, and HER2 expressions on outcomes of patients with gastric cancer. Clin Cancer Res 2008; 14: [PMID: DOI: / CCR ] 46 Hillon P, Guiu B, Vincent J, Petit JM. Obesity, type 2 diabetes and risk of digestive cancer. Gastroenterol Clin Biol 2010; 34: [PMID: DOI: /j.gcb ] 47 Khandekar MJ, Cohen P, Spiegelman BM. Molecular mechanisms of cancer development in obesity. Nat Rev Cancer 2011; 11: [PMID: DOI: /nrc3174] 48 Yang P, Zhou Y, Chen B, Wan HW, Jia GQ, Bai HL, Wu XT. Overweight, obesity and gastric cancer risk: results from a meta-analysis of cohort studies. Eur J Cancer 2009; 45: [PMID: DOI: /j.ejca ] 49 Oldenburg B, Diepersloot RJ, Hoekstra JB. High seroprevalence of Helicobacter pylori in diabetes mellitus patients. Dig Dis Sci 1996; 41: [PMID: ] 50 Tseng CH. Diabetes, insulin use and Helicobacter pylori eradication: a retrospective cohort study. BMC Gastroenterol 2012; 12: 46 [PMID: DOI: / X-12-46] 51 Aydemir S, Bayraktaroglu T, Sert M, Sokmen C, Atmaca H, Mungan G, Gun BD, Borazan A, Ustundag Y. The effect of Helicobacter pylori on insulin resistance. Dig Dis Sci 2005; 50: [PMID: ] 52 Kaaks R, Lukanova A. Energy balance and cancer: the role of insulin and insulin-like growth factor-i. Proc Nutr Soc 2001; 60: [PMID: ] 53 Calle EE, Kaaks R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer 2004; 4: [PMID: ] 54 Crew KD, Neugut AI. Epidemiology of gastric cancer. World J Gastroenterol 2006; 12: [PMID: ] 55 Dawsey SM, Mark SD, Taylor PR, Limburg PJ. Gastric cancer and H pylori. Gut 2002; 51: [PMID: ] 56 Tsugane S, Sasazuki S, Kobayashi M, Sasaki S. Salt and salted food intake and subsequent risk of gastric cancer among middle-aged Japanese men and women. Br J Cancer 2004; 90: [PMID: ] 57 Tramacere I, Negri E, Pelucchi C, Bagnardi V, Rota M, Scotti L, Islami F, Corrao G, La Vecchia C, Boffetta P. A meta-analysis on alcohol drinking and gastric cancer risk. Ann Oncol 2012; 23: [PMID: DOI: / annonc/mdr135] 58 Kobayashi M, Tsubono Y, Sasazuki S, Sasaki S, Tsugane S. Vegetables, fruit and risk of gastric cancer in Japan: a 10-year follow-up of the JPHC Study Cohort I. Int J Cancer 2002; 102: [PMID: ] 59 Inoue M, Sasazuki S, Wakai K, Suzuki T, Matsuo K, Shimazu T, Tsuji I, Tanaka K, Mizoue T, Nagata C, Tamakoshi A, Sawada N, Tsugane S. Green tea consumption and gastric cancer in Japanese: a pooled analysis of six cohort studies. Gut 2009; 58: [PMID: DOI: / gut ] 60 Zhao G, Ford ES, Ahluwalia IB, Li C, Mokdad AH. Preva October 28, 2013 Volume 19 Issue 40

222 Shimoyama S. Diabetes mellitus and gastric cancer lence and trends of receipt of cancer screenings among US women with diagnosed diabetes. J Gen Intern Med 2009; 24: [PMID: DOI: /s ] 61 Lipscombe LL, Hux JE, Booth GL. Reduced screening mammography among women with diabetes. Arch Intern Med 2005; 165: [PMID: ] 62 Fontana SA, Baumann LC, Helberg C, Love RR. The delivery of preventive services in primary care practices according to chronic disease status. Am J Public Health 1997; 87: [PMID: ] P- Reviewer Hajifathalian K S- Editor Zhai HH L- Editor Cant MR E- Editor Ma S 6910 October 28, 2013 Volume 19 Issue 40

223 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. META-ANALYSIS Effects of probiotics on nonalcoholic fatty liver disease: A meta-analysis Yan-Yan Ma, Lin Li, Chao-Hui Yu, Zhe Shen, Li-Hua Chen, You-Ming Li Yan-Yan Ma, Lin Li, Chao-Hui Yu, Zhe Shen, Li-Hua Chen, You-Ming Li, Department of Gastroenterology, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou , Zhejiang Province, China Author contributions: Li YM proposed the study; Ma YY, Lin L, Yu CH, Shen Z, Chen LH collected data; Ma YY, Lin L, Yu CH, Shen Z, Chen LH, Li YM analyzed and interpreted the data; Ma YY drafted the manuscript; Li YM revised the manuscript; all the authors contributed to the design and interpretation of the study, read and approved the final version to be published. Supported by National Natural Science Foundation of China, No ; Zhejiang Provincial Laboratory Animal Science Technology Program of China, No. 2011C37088; Natural Science Foundation of Zhejiang Province, China, No. Y13H Correspondence to: You-Ming Li, MD, Department of Gastroenterology, the First Affiliated Hospital, Zhejiang University School of Medicine, 79 Qingchun Road, Hangzhou , Zhejiang Province, China. zlym@zju.edu.cn Telephone: Fax: Received: June 30, 2013 Revised: August 24, 2013 Accepted: September 3, 2013 Published online: October 28, 2013 total-cholesterol (T-chol), high density lipoprotein (HDL), tumor necrosis factor (TNF)-α and homeostasis model assessment of insulin resistance (HOMA- IR) [ALT: weighted mean difference (WMD) , 95%CI: , P < ; AST: WMD , 95%CI: , P = 0.002; T-chol: WMD -0.28, 95%CI: , P = 0.04; HDL: WMD -0.09, 95%CI: , P = 0.03; TNF-α: WMD -0.32, 95%CI: , P < ; HOMA-IR: WMD -0.46, 95%CI: , P = ]. However, the use of probiotics was not associated with changes in body mass index (BMI), glucose (GLU) and low density lipoprotein (LDL) (BMI: WMD 0.05, 95%CI: , P = 0.64; GLU: WMD 0.05, 95%CI: , P = 0.76; LDL: WMD -0.38, 95%CI: , P = 0.06). CONCLUSION:Probiotic therapies can reduce liver aminotransferases, total-cholesterol, TNF-α and improve insulin resistance in NAFLD patients. Modulation of the gut microbiota represents a new treatment for NAFLD Baishideng. All rights reserved. Abstract AIM: To investigate the relationship between the gutliver axis and nonalcoholic fatty liver disease (NAFLD), we performed a meta-analysis to evaluate the effects of probiotic therapy in NAFLD. METHODS: We searched PubMed, Medline, Embase, Web of Science, the Cochrane Library and Chinese Biomedicine Database for all relevant randomized controlled trials on probiotics in patients with NAFLD/nonalcoholic steatohepatitis (NASH). A statistical analysis was performed using RevMan 5.0 software. RESULTS: Four randomized trials involving 134 NAFLD/ NASH patients were included. The results showed that probiotic therapy significantly decreased alanine aminotransferase (ALT), aspartate transaminase (AST), Key words: Probiotics; Nonalcoholic fatty liver disease; Nonalcoholic steatohepatitis; Liver function; Insulin resistance; Meta-analysis Core tip: For many decades, researchers have carried out studies on the treatment of nonalcoholic fatty liver disease (NAFLD). However, no firm conclusions have been made regarding the efficacy of various treatments for NAFLD. Here we conducted a meta-analysis of the pooled data from randomized controlled trials to assess the efficacy of probiotic therapies and showed that probiotic therapy significantly decreased alanine aminotransferase, aspartate transaminase, total-cholesterol, high density lipoprotein, tumor necrosis factor-α and homeostasis model assessment of insulin resistance. Thus, probiotics may help to improve liver function, fat metabolism and insulin resistance in NAFLD patients October 28, 2013 Volume 19 Issue 40

224 Ma YY et al. Probiotics and NAFLD Ma YY, Li L, Yu CH, Shen Z, Chen LH, Li YM. Effects of probiotics on nonalcoholic fatty liver disease: A meta-analysis. World J Gastroenterol 2013; 19(40): Available from: URL: i40/6911.htm DOI: INTRODUCTION Nonalcoholic fatty liver disease (NAFLD) is characterized by large vacuoles of triglyceride which accumulate in liver cells via the process of steatosis in non-alcohol users. The condition can progress into more serious liver diseases, such as nonalcoholic steatohepatitis (NASH), liver fibrosis, cirrhosis, and more rarely, liver carcinoma [1]. It is increasingly recognized as a major cause of liver-related morbidity and mortality. NAFLD is common in Western countries. However, an increase in the prevalence of NAFLD has been observed in China. The underlying mechanisms of disease progression are poorly understood. Diet and lifestyle changes are primary therapies in the management of these patients. Specific pharmacologic treatments for NAFLD/NASH are progressing, such as insulin-sensitizers [2-4], lipid-lowering drugs [5-6], antioxidants [7-8], and anti-tumor necrosis factor (TNF)-α agents [9-11]. However, most of these are not licensed therapies for NAFLD, despite the abundance of clinical trials. Recently, a new treatment strategy using probiotics was proposed. A probiotic is a live microbial culture or cultured dairy product, which plays a fundamentally important role in health and disease [12-14]. The human intestinal microbiota is composed of microorganisms whose collective genome contains at least 100 times as many genes as our own genome, representing species in total [15-16]. Miele et al [17] provided the first evidence that NAFLD in humans was associated with increased intestine permeability, and that this abnormality was related to the increased prevalence of small bowel bacterial overgrowth (SIBO) in these patients. The increased permeability appears to be caused by disruption of intercellular tight junctions in the intestine, and it may play an important role in the pathogenesis of NAFLD. Loguercio et al [18] have shown that probiotics may reduce NAFLD liver injury and may improve liver function. Probiotics can inhibit the proliferation of harmful bacteria, reduce SIBO, restore gastrointestinal barrier function and modulate the immune system [19-21], all of which contribute to the improvement of NAFLD. Therefore, the aim of this study was to conduct a meta-analysis of the pooled data from RCTs to assess the efficacy of probiotic therapies in modifying liver function, fat metabolism and insulin resistance. MATERIALS AND METHODS Search strategy We searched Medline, Embase, Web of Science, Chinese Biomedicine Database and the China Journal Full Text Database with no language restriction. The search terms were: (NASH or NAFLD or nonalcoholic steatohepatitis or nonalcoholic fatty liver disease or fatty liver ) and (probiotic* or prebiotic* or synbiocit* or bifidobacter* or Lactobacill* or flora) and [ Fatty Liver (Mesh)] AND Probiotics (Mesh). We also searched the reference lists of each selected study by hand. Inclusion and exclusion criteria Inclusion criteria were as follows: randomized controlled trials (RCTs) with participants of any sex or ethnic origin with NAFLD/NASH, diagnosed on the basis of radiological/histological evidence of fatty liver. Exclusion criteria were as follows: other causes of hepatic steatosis or steatofibrosis such as hepatitis B, hepatitis C, autoimmune hepatitis, liver decompensation or malignancy, and genetic liver disease such as Wilson s disease and hemochromatosis. The trials should have measured at least one of the following items: BMI, ALT, AST, total-cholesterol, LDL, HDL, GLU, TNF-α and HOMA-IR. Studies must have objective outcome measures, otherwise they were excluded from this review. Data extraction and methodological quality Data were abstracted independently by two reviewers and included: author, publication year, study design, population, intervention, duration and outcome. Disagreement was resolved by discussion. Scored using the Jadad scale, we assessed the quality of the studies by the randomization method, allocation concealment, blinding of outcome assessment and follow-up. All included studies scored 4. Statistical analysis We analyzed the data using Review Manager 5.0. Dichotomous data were presented as odds ratio with 95%CI. Statistical heterogeneity was measured using the χ 2 test and the I 2. A χ 2 P value < 0.05 was considered to indicate statistically significant heterogeneity. If there was obvious heterogeneity, the random effects model was chosen; otherwise, the fixed effects model was adopted. RESULTS The electronic searches yielded 475 items from Medline, Embase, Web of Science, Chinese Biomedicine Database and the China Journal Full Text Database. Publication dates ranged from 1996 to After reviewing each publication, we selected 4 original studies (Figure 1). Table 1 contains specific information on study design, randomization methods, sample size, intervention, duration of treatment and follow-up. Allocation concealment was adequate in three studies. All the studies were double-blind and included a follow-up period. The diagnosis of NAFLD/NASH was confirmed by percutaneous liver biopsy in three studies. All gave detailed 6912 October 28, 2013 Volume 19 Issue 40

225 Ma YY et al. Probiotics and NAFLD 475 potentially relevant publications identified and screened for retrieval Figure 1 Selection of studies. Not randomized controlled trials Editorial, Letter, Review, Case Reports, News, Comment Repetition 21 potentially relevant papers retrieved for more detailed assessment Papers excluded because: Not relative Other disease Other intervention Incomplete information on outcomes 4 studies Table 1 Methodological characteristics of the included studies in this meta-analysis Ref. Sample size Randomization Blinding Diagnostic method Intervention Duration Follow-up Aller et al [22] 28 (14/14) Table of numbers Double-blind Histological Lactobacillus bulgaricus and 3 mo Yes Streptococcus thermophilus vs placebo Vajro et al [23] 20 (10/10) Yes Double-blind Radiological Lactobacillus GG vs placebo 8 wk Yes Malaguarnera et al [24] 66 (34/32) Computer generated Double-blind Histological Bifidobacterium longum + Fos vs placebo 24 wk Yes Wong et al [25] 20 (10/10) Computer generated Double-blind Histological Lepicol probiotic and prebiotic formula vs nothing 6 mo Yes baseline information. The main characteristics of the patients included in the two groups were well matched in all RCTs. All four RCTs [22-25] reported on BMI, but did not show a significant difference in the experimental group compared with the control group [weighted mean difference (WMD) 0.05, 95%CI: , P = 0.64]. Significant homogeneity was observed among the studies (I 2 = 0%, P = 0.77) (Figure 2A). Four RCTs [22-25] assessed the effect of probiotics on the level of serum ALT and showed a significant difference between patients treated with probiotics compared with those treated with placebo (WMD , 95%CI: , P < ). The included studies were homogeneous (I 2 = 0%, P = 0.72) (Figure 2B). Three RCTs [22,24,25] analyzed the effect of probiotics on AST and T-chol in NAFLD/NASH patients compared with placebo. Probiotics had a significantly better effect on normalizing AST and T-chol (AST: WMD , 95%CI: , P = 0.002; T-chol: WMD -0.28, 95%CI: , P = 0.04). The included studies on AST were not homogeneous (I 2 = 56%, P = 0.1), while the studies on T-chol were significantly homogeneous (I 2 = 0%, P = 0.75) (Figure 2C, D). Three RCTs [22,24,25] reported the effects of probiotics on LDL, HDL and GLU in patients with NAFLD/ NASH compared with placebo. Probiotics had a significantly better effect in reducing HDL (WMD -0.09, 95%CI: , P = 0.03), but no significant difference in reducing LDL and GLU (LDL: WMD -0.38, 95%CI: , P =0.06; GLU: WMD 0.05, 95%CI: , P = 0.76). The included studies were homogeneous (LDL: I 2 = 47%, P = 0.15; HDL: I 2 = 0%, P = 0.53; GLU: I 2 = 0%, P = 0.84) (Figure 2E, F, G). Three RCTs [22-24] provided sufficient data to compare the effects of probiotics with those of placebo and showed a statistically significant effect for TNF-α in NAFLD/NASH patients (WMD -0.32, 95%CI: , P < ). Significant homogeneity was observed among the studies (I 2 = 0%, P = 0.56) (Figure 2H). Only two RCTs [22,24] reported the effects of probiotics on HOMA-IR in NAFLD/NASH patients. There was a significant reduction in HOMA-IR in NAFLD/NASH patients in the experimental group compared with the control group (WMD -0.46, 95%CI: , P = 6913 October 28, 2013 Volume 19 Issue 40

226 Ma YY et al. Probiotics and NAFLD A Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % 0.40 (-0.46, 1.26) Pietro Vajro % 0.04 (-0.20, 0.28) R. ALLER % 0.30 (-3.65, 4.25) Wong % 0.50 (-2.08, 1.08) Total (95%CI) % 0.05 (-0.18, 0.29) Heterogeneity: χ 2 = 1.11, df = 3 (P = 0.77); I 2 = 0% Test for overall effect: Z = 0.47 (P = 0.64) B BMI Favours experimental Favours control Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % (-37.79, ) Pietro Vajro % (-55.53, -0.87) R. ALLER % (-34.71, 11.91) Wong % (-89.86, 33.86) Total (95%CI) % (-33.46, ) Heterogeneity: χ 2 = 1.32, df = 3 (P = 0.72); I 2 = 0% Test for overall effect: Z = 4.76 (P < ) C Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, random, 95%CI Malaguarnera % (-35.88, ) R. ALLER % (-20.75, -0.05) Wong % (-63.61, -8.39) Total (95%CI) % (-32.55, -7.00) Heterogeneity: Tau 2 = 68.10, χ 2 = 4.53, df = 2 (P = 0.10); I 2 = 56% Test for overall effect: Z = 3.03 (P = 0.002) D Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % (-0.81, 0.01) R. ALLER % (-0.99, 0.69) Wong % (-0.60, 0.20) Total (95%CI) % (-0.55, -0.01) Heterogeneity: χ 2 = 0.57, df = 2 (P = 0.75); I 2 = 0% Test for overall effect: Z = 2.03 (P = 0.04) E Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, random, 95%CI Malaguarnera % (-0.99, -0.33) R. ALLER % 0.00 (-0.80, 0.80) Wong % (-0.68, 0.28) Total (95%CI) % (-0.78, 0.02) Heterogeneity: Tau 2 = 0.06, χ 2 = 3.78, df = 2 (P = 0.15); I 2 = 47% Test for overall effect: Z = 1.88 (P = 0.06) F Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % 0.11 (-0.24, 0.46) R. ALLER % (-0.27, 0.11) Wong % (-0.19, -0.01) Total (95%CI) % (-0.16, -0.01) Heterogeneity: χ 2 = 1.27, df = 2 (P = 0.53); I 2 = 0% Test for overall effect: Z = 2.19 (P = 0.03) G The level of serum ALT The level of serum AST The level of serum T-chol The level of serum LDL The level of serum HDL The level of serum GLU Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % 0.03 (-0.29, 0.35) R. ALLER % 0.06 (-1.09, 1.21) Wong % 0.60 (-1.25, 2.45) Total (95%CI) % 0.05 (-0.25, -0.35) Heterogeneity: χ 2 = 0.36, df = 2 (P = 0.84); I 2 = 0% Test for overall effect: Z = 0.31 (P = 0.76) Favours experimental Favours control Favours experimental Favours control Favours experimental Favours control Favours experimental Favours control Favours experimental Favours control Favours experimental Favours control 6914 October 28, 2013 Volume 19 Issue 40

227 Ma YY et al. Probiotics and NAFLD H Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % (-0.48, -0.18) Pietro Vajro % (-5.81, 3.97) R. ALLER % 0.76 (-1.28, 2.80) Total (95%CI) % (-0.48, -0.17) Heterogeneity: χ 2 = 1.15, df = 2 (P = 0.56); I 2 = 0% Test for overall effect: Z = 4.19 (P < ) I The level of serum TNF-α HOMA Favours experimental Favours control Experimental Control Mean difference Mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI IV, fixed, 95%CI Malaguarnera % (-0.73, -0.19) R. ALLER % (-2.58, 1.78) Total (95%CI) % (-0.73, -0.19) Heterogeneity: χ 2 = 0.00, df = 1 (P = 0.96); I 2 = 0% Test for overall effect: Z = 3.34 (P = ) Favours experimental Favours control Figure 2 Forest plot of the effects of probiotics in patients with nonalcoholic fatty liver disease. A: BMI; B: The level of serum ALT; C: The level of serum AST; D:The level of serum T-chol; E: The level of serum LDL; F: The level of serum HDL; G: The level of serum GLU; H: The level of serum TNF-α; I: HOMA. BMI: Body mass index; ALT: Alanine aminotransferase; AST: Aspartate transaminase; T-chol: total-cholesterol; LDL: Low density lipoprotein; HDL: High density lipoprotein; GLU: Glucose; HOMA: Homeostasis model assessment ). Significant homogeneity was observed among the studies (I 2 = 0%, P = 0.96) (Figure 2I). DISCUSSION NAFLD is a relevant issue in public health due to its epidemiologic burden. The prevalence of NAFLD has apparently increased in proportion to the increasing incidence of obesity in both adults and children [26]. NAFLD is closely associated with obesity and insulin resistance, and is now recognized to represent the hepatic manifestation of the metabolic syndrome. At present, there is no registered drug for the treatment of NAFLD. Although lifestyle intervention is often advocated [27-28], it is difficult to maintain. In 2009, Socha et al [29] performed a meta-analysis of the pharmacological interventions for NAFLD in adults and children, including pioglitazone, vitamin E, ursodeoxycholic acid, probucol, N-acetylcysteine, and low-dose carnitine. However, he was unable to draw firm conclusions on the efficacy of the various treatments for NAFLD. In 2011, Musso et al [30] found that weight loss improved liver histology and the cardiometabolic profile, as did pioglitazone. It is also important to explore new treatment strategies. It is well known that liver and intestine have the same origin in embryology the foregut. In addition, the liver continuously receives blood from the gut through the portal system. Therefore, there is a close relationship between the intestine and liver. Evidence has shown that SIBO is present in 50% of patients with non-alcoholic steatosis [17,31]. High-fat diet-induced obesity is associated with changes in the composition of intestinal bacteria in rats [32-33] and in humans [34]. Therefore, changes in the composition of the intestinal bacterial content may be associated with NAFLD or obesity. Intestinal bacteria may be involved in the etiology of NAFLD by enhancing intestinal permeability [35], direct activation of inflammatory cytokines via release of lipopolysaccharide (LPS) and favoring absorption of endotoxins [36]. Endotoxins activate Kupffer cells in the liver and increase the production of TNF-α and IL-6, which contributes to the onset of liver fibrosis [31,37-38]. Furthermore, a complex mechanism involving extensive lipid accumulation, systemic inflammation, oxidative stress, and insulin resistance causes cytotoxicity and exacerbated hepatopathy [39-40]. Serum ALT and AST levels are well-recognized clinical markers of liver damage and may be involved in the pathogenesis of NAFLD. Cholesterol is also a risk factor for NAFLD. Liver damage can lead to elevated cholesterol or reduced HDL in the blood. TNF-α is secreted directly by hepatocytes and Kupffer cells in the liver [41]. Many studies have shown a relationship between TNF-α expression and NAFLD [42-43]. Assessment of insulin resistance by HOMA-IR has been widely utilized in clinical studies of NAFLD [44-45]. In four RCTs, ALLER, Wong et al [25] reported that probiotics improved liver aminotransferase levels in patients with NAFLD, while Malaguarnera concluded that probiotics reduced TNF-α, serum AST levels and HOMA-IR. Our meta-analysis showed that probiotics significantly reduced ALT, AST, T-chol, TNF-α and HOMA-IR, which are all related to the process, development and consequences of NAFLD. However, the level of HDL was significantly increased in the placebo treatment compared with probiotic treatment, which was contrary to expectation. It is possible that the elevation in HDL requires long-term treatment or there are other mechanisms which have not been explored. The change in cholesterol level in our study should be emphasized, as Gilliland et al [46] in the early 1990s found that regular consumption of probiotics reduced cholesterol levels. Over several decades, more and more researchers confirmed that probiotics can lead to a de October 28, 2013 Volume 19 Issue 40

228 Ma YY et al. Probiotics and NAFLD crease in serum cholesterol in animals and humans [47-50]. However, these RCTs did not report the positive effects of probiotics on reducing cholesterol in NAFLD/NASH patients, while the findings of the present meta-analysis supported the reduction of cholesterol in NAFLD/ NASH patients. From this meta-analysis, we can conclude that probiotics have positive effects in patients with NAFLD/NASH. Of the four RCTs included in this meta-analysis, the studied probiotics included lactobacillus, bifidobacterium and streptococcus. Two studies also determined the effect of probiotics combined with fructo-oligosaccharides in NAFLD [24,25]. Bifidobacteria colonize the intestinal tract soon after birth and are the major components of the microbial barrier in healthy humans. Bifidobacteria produce a range of beneficial effects on host health [51-52]. Lactobacilli and streptococcus are also beneficial, although they are present at much lower levels in the human colon [52]. Probiotics have been shown to enhance the barrier function of epithelial cells [53] and decrease intestinal permeability and endotoxemia in patients with liver disease [54]. At the same time, probiotics can also influence host metabolism in several other ways, such as regulation of energy extraction from nutrients and modulation of genes involved in substrate metabolism [55]. A prebiotic is a nondigestible food ingredient. Due to the general properties of prebiotics, they can influence the growth, activity and metabolites of probiotics [56]. Fructo-oligosaccharides are now becoming increasingly popular due to their prebiotic effects. They can be fermented by bifidobacteria and lactobacilli [57]. Fructooligosaccharides can lead to bifidobacteria becoming the dominant species in the large bowel [58] and may help to control or reduce the growth of harmful bacteria [59]. In animal models, treatment with oligofructose reduced adipose tissue inflammation, oxidative stress and led to an improvement in glucose tolerance and to a reduction in body weight, which were beneficial in patients with NAFLD [60]. In conclusion, probiotics and prebiotics are important mediators of diet-induced metabolic disturbances in NAFLD. There are several limitations to this review. It is well known that liver histology is the gold standard for NAFLD/NASH. Although ultrasonography is reasonably accurate, it cannot identify fatty infiltration of the liver below a threshold of 30%. In our review, three RCTs used liver histological response as an outcome index evaluating the effectiveness of probiotics in the treatment of NAFLD. Regretfully, only one RCT had post-treatment histology results. The diagnostic criteria for NAFLD in another trial included increased ultrasonographic bright liver. Three trials included patients aged years, while one trial included children. The researchers ignored the dietary restrictions, exercise and physical activities as in almost all studies they were not described. The sample sizes in some trials, as well as the number of trials for some comparisons, were small. Existing data are difficult to reconcile, given the use of different strains, dosages and duration of treatment. COMMENTS Background The prevalence of and mortality due to nonalcoholic fatty liver disease (NAFLD) are increasing worldwide. Diet and lifestyle changes are primary therapies in the management of NAFLD patients. However, most drug therapies are not licensed for NAFLD. Recent evidence suggests that malfunction of the gutliver axis contributes to hepatic damage in rats and humans with NAFLD, and probiotics play a fundamentally important role in health and disease. Thus, it was necessary to conduct a meta-analysis to assess the effects of probiotics on liver function, fat metabolism and insulin resistance in NAFLD patients. Research frontiers A probiotic is a live microbial culture or cultured dairy product and the human intestinal microbiota is composed of microorganisms. The gut-liver axis indicates that changes in the composition of the intestinal bacterial content are associated with NAFLD. Most therapies are not licensed for the prevention of NAFLD. Therefore, a research hotspot is whether treatment with probiotics is effective in patients with NAFLD. Innovations and breakthroughs In 2009, Socha et al performed a meta-analysis of pharmacological interventions for NAFLD in adults and children, including pioglitazone, vitamin E, ursodeoxycholic acid, probucol, N-acetylcysteine, and low-dose carnitine. However, he was unable to draw firm conclusions on the efficacy of various treatments for NAFLD and he did not study the effect of probiotics. Research on probiotics in rats is popular. However, there have only been a few large randomized controlled trials (RCTs), and the results were inconsistent. Therefore, the aim of this study was to conduct a meta-analysis of the pooled data from RCTs to assess the efficacy of probiotic therapies in modifying liver function, fat metabolism and insulin resistance in patients with NAFLD/nonalcoholic steatohepatitis. Applications Probiotic therapies can reduce liver aminotransferase levels, serum cholesterol and tumor necrosis factor-α and improve insulin resistance in patients with NAFLD. Thus, modulation of the gut microbiota using probiotics may represent a new method of treating or preventing NAFLD. Terminology NAFLD is characterized by large vacuoles of triglyceride which accumulate in liver cells via the process of steatosis in non-alcohol users. The condition can progress into more serious liver diseases, such as nonalcoholic steatohepatitis, liver fibrosis, cirrhosis, and more rarely, liver carcinoma. A probiotic is a live microbial culture or cultured dairy product, which plays a fundamentally important role in health and disease. The human intestinal microbiota is composed of microorganisms whose collective genome contains at least 100 times as many genes as our own genome, representing species in total. Peer review This meta-analysis is an interesting revision on the present knowledge on probiotics and NAFLD but again introduces the difficulty in obtaining unequivocal correlations between biochemical changes and pharmacological treatment or lifestyle modifications, including the inclusion of probiotics in diet. This metaanalysis suggests that liver inflammatory markers become significantly reduced with the use of probiotics and this has been interpreted as indirect evidence of the effect on inflammation and liver damage by the intervention. Nevertheless, the meta-analysis concludes that many of the data analyzed remain without modification on pooled analysis with the inclusion of probiotics. All of these data make it difficult to assess the real effect of probiotics on NAFLD. Nevertheless, the data obtained by this meta-analysis are interesting since they demonstrate the complexity of the factors which may influence the development of NAFLD. REFERENCES 1 Adams LA, Angulo P. Recent concepts in non-alcoholic fatty liver disease. Diabet Med 2005; 22: [PMID: DOI: /j x] 2 Marchesini G, Brizi M, Bianchi G, Tomassetti S, Zoli M, Melchionda N. Metformin in non-alcoholic steatohepatitis. Lancet 2001; 358: [PMID: DOI: / 6916 October 28, 2013 Volume 19 Issue 40

229 Ma YY et al. Probiotics and NAFLD S (01) ] 3 Uygun A, Kadayifci A, Isik AT, Ozgurtas T, Deveci S, Tuzun A, Yesilova Z, Gulsen M, Dagalp K. Metformin in the treatment of patients with non-alcoholic steatohepatitis. Aliment Pharmacol Ther 2004; 19: [PMID: DOI: /j x] 4 Promrat K, Lutchman G, Uwaifo GI, Freedman RJ, Soza A, Heller T, Doo E, Ghany M, Premkumar A, Park Y, Liang TJ, Yanovski JA, Kleiner DE, Hoofnagle JH. A pilot study of pioglitazone treatment for nonalcoholic steatohepatitis. Hepatology 2004; 39: [PMID: DOI: / hep.20012] 5 Basaranoglu M, Acbay O, Sonsuz A. A controlled trial of gemfibrozil in the treatment of patients with nonalcoholic steatohepatitis. J Hepatol 1999; 31: 384 [PMID: ] 6 Rallidis LS, Drakoulis CK, Parasi AS. Pravastatin in patients with nonalcoholic steatohepatitis: results of a pilot study. Atherosclerosis 2004; 174: [PMID: DOI: /j.atherosclerosis ] 7 Nobili V, Manco M, Devito R, Di Ciommo V, Comparcola D, Sartorelli MR, Piemonte F, Marcellini M, Angulo P. Lifestyle intervention and antioxidant therapy in children with nonalcoholic fatty liver disease: a randomized, controlled trial. Hepatology 2008; 48: [PMID: DOI: / hep.22336] 8 Pamuk GE, Sonsuz A. N-acetylcysteine in the treatment of nonalcoholic steatohepatitis. J Gastroenterol Hepatol 2003; 18: [PMID: DOI: /j x] 9 Georgescu EF, Georgescu M. Therapeutic options in nonalcoholic steatohepatitis (NASH). Are all agents alike? Results of a preliminary study. J Gastrointestin Liver Dis 2007; 16: [PMID: ] 10 Lee YM, Sutedja DS, Wai CT, Dan YY, Aung MO, Zhou L, Cheng CL, Wee A, Lim SG. A randomized controlled pilot study of Pentoxifylline in patients with non-alcoholic steatohepatitis (NASH). Hepatol Int 2008; 2: [PMID: DOI: /s ] 11 Rinella ME, Koppe S, Brunt EM, Elias M, Gottstein J, Green RM. Pentoxifylline improves ALT and histology in patients with NASH: a double-blind placebo controlled trial. Gastroenterology 2009; 136 Suppl 1: [DOI: /S (09)60398-X] 12 Salminen S. Uniqueness of probiotic strains. IDF Nutr Newsletter 1996; 5: Gill HS, Guarner F. Probiotics and human health: a clinical perspective. Postgrad Med J 2004; 80: [PMID: DOI: /pgmj ] 14 Lilly DM, Stillwell RH. Probiotics: Growth-Promoting Factors Produced by Microorganisms. Science 1965; 147: [PMID: DOI: /science ] 15 Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE, Relman DA. Diversity of the human intestinal microbial flora. Science 2005; 308: [PMID: DOI: /science ] 16 Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, Gordon JI, Relman DA, Fraser-Liggett CM, Nelson KE. Metagenomic analysis of the human distal gut microbiome. Science 2006; 312: [PMID: DOI: /science ] 17 Miele L, Valenza V, La Torre G, Montalto M, Cammarota G, Ricci R, Mascianà R, Forgione A, Gabrieli ML, Perotti G, Vecchio FM, Rapaccini G, Gasbarrini G, Day CP, Grieco A. Increased intestinal permeability and tight junction alterations in nonalcoholic fatty liver disease. Hepatology 2009; 49: [PMID: DOI: /hep.22848] 18 Loguercio C, Federico A, Tuccillo C, Terracciano F, D Auria MV, De Simone C, Del Vecchio Blanco C. Beneficial effects of a probiotic VSL#3 on parameters of liver dysfunction in chronic liver diseases. J Clin Gastroenterol 2005; 39: [PMID: DOI: /01.mcg f] 19 Macfarlane GT, Cummings JH. Probiotics, infection and immunity. Curr Opin Infect Dis 2002; 15: [PMID: ] 20 Madsen K, Cornish A, Soper P, McKaigney C, Jijon H, Yachimec C, Doyle J, Jewell L, De Simone C. Probiotic bacteria enhance murine and human intestinal epithelial barrier function. Gastroenterology 2001; 121: [PMID: DOI: /gast ] 21 Guarner F, Malagelada JR. Gut flora in health and disease. Lancet 2003; 361: [PMID: DOI: / S (03) ] 22 Aller R, De Luis DA, Izaola O, Conde R, Gonzalez Sagrado M, Primo D, De La Fuente B, Gonzalez J. Effect of a probiotic on liver aminotransferases in nonalcoholic fatty liver disease patients: a double blind randomized clinical trial. Eur Rev Med Pharmacol Sci 2011; 15: [PMID: ] 23 Vajro P, Mandato C, Licenziati MR, Franzese A, Vitale DF, Lenta S, Caropreso M, Vallone G, Meli R. Effects of Lactobacillus rhamnosus strain GG in pediatric obesity-related liver disease. J Pediatr Gastroenterol Nutr 2011; 52: [PMID: DOI: /MPG.0b013e31821f9b85] 24 Malaguarnera M, Vacante M, Antic T, Giordano M, Chisari G, Acquaviva R, Mastrojeni S, Malaguarnera G, Mistretta A, Li Volti G, Galvano F. Bifidobacterium longum with fructooligosaccharides in patients with non alcoholic steatohepatitis. Dig Dis Sci 2012; 57: [PMID: DOI: /s ] 25 Wong VW, Won GL, Chim AM, Chu WC, Yeung DK, Li KC, Chan HL. Treatment of nonalcoholic steatohepatitis with probiotics. A proof-of-concept study. Ann Hepatol 2013; 12: [PMID: ] 26 Clark JM. The epidemiology of nonalcoholic fatty liver disease in adults. J Clin Gastroenterol 2006; 40 Suppl 1: S5-10 [PMID: DOI: /01.mcg ff] 27 Rodríguez-Hernández H, Cervantes-Huerta M, Rodríguez- Moran M, Guerrero-Romero F. Decrease of aminotransferase levels in obese women is related to body weight reduction, irrespective of type of diet. A nn Hepatol 2011; 10: [PMID: ] 28 Clark JM. Weight loss as a treatment for nonalcoholic fatty liver disease. J Clin Gastroenterol 2006; 40 Suppl 1: S39-S43 [PMID: DOI: /01.mcg fa] 29 Socha P, Horvath A, Vajro P, Dziechciarz P, Dhawan A, Szajewska H. Pharmacological interventions for nonalcoholic fatty liver disease in adults and in children: a systematic review. J Pediatr Gastroenterol Nutr 2009; 48: [PMID: DOI: /MPG.0b013e31818e04d1] 30 Musso G, Cassader M, Rosina F, Gambino R. Impact of current treatments on liver disease, glucose metabolism and cardiovascular risk in non-alcoholic fatty liver disease (NAFLD): a systematic review and meta-analysis of randomised trials. Diabetologia 2012; 55: [PMID: DOI: / s ] 31 Wigg AJ, Roberts-Thomson IC, Dymock RB, McCarthy PJ, Grose RH, Cummins AG. The role of small intestinal bacterial overgrowth, intestinal permeability, endotoxaemia, and tumour necrosis factor α in the pathogenesis of non-alcoholic steatohepatitis. Gut 2001; 48: [PMID: DOI: /gut ] 32 Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature 2006; 444: [PMID: DOI: /nature05414] 33 Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Microbial ecology: human gut microbes associated with obesity. Nature 2006; 444: [PMID: DOI: / a] 34 Zhang H, DiBaise JK, Zuccolo A, Kudrna D, Braidotti M, Yu Y, Parameswaran P, Crowell MD, Wing R, Rittmann BE, Krajmalnik-Brown R. Human gut microbiota in obesity and after gastric bypass. Proc Natl Acad Sci USA 2009; 106: 6917 October 28, 2013 Volume 19 Issue 40

230 Ma YY et al. Probiotics and NAFLD [PMID: DOI: /pnas ] 35 Brun P, Castagliuolo I, Di Leo V, Buda A, Pinzani M, Palù G, Martines D. Increased intestinal permeability in obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis. Am J Physiol Gastrointest Liver Physiol 2007; 292: G518-G525 [PMID: DOI: /ajpgi ] 36 Szabo G, Bala S, Petrasek J, Gattu A. Gut-liver axis and sensing microbes. Dig Dis 2010; 28: [PMID: DOI: / ] 37 Solga SF, Diehl AM. Non-alcoholic fatty liver disease: lumenliver interactions and possible role for probiotics. J Hepatol 2003; 38: [PMID: ] 38 Kaplowitz N. Mechanisms of liver cell injury. J Hepatol 2000; 32: [PMID: DOI: /S (00) ] 39 Henao-Mejia J, Elinav E, Jin C, Hao L, Mehal WZ, Strowig T, Thaiss CA, Kau AL, Eisenbarth SC, Jurczak MJ, Camporez JP, Shulman GI, Gordon JI, Hoffman HM, Flavell RA. Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 2012; 482: [PMID: DOI: /nature10809] 40 Tilg H, Moschen AR. Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology 2010; 52: [PMID: DOI: /hep.24001] 41 Montecucco F, Mach F. Does non-alcoholic fatty liver disease (NAFLD) increase cardiovascular risk? Endocr Metab Immune Disord Drug Targets 2008; 8: [PMID: DOI: / ] 42 Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. Increased adipose tissue expression of tumor necrosis factor-α in human obesity and insulin resistance. J Clin Invest 1995; 95: [PMID: DOI: /JCI117936] 43 Pinto Lde F, Compri CM, Fornari JV, Bartchewsky W, Cintra DE, Trevisan M, Carvalho Pde O, Ribeiro ML, Velloso LA, Saad MJ, Pedrazzoli J, Gambero A. The immunosuppressant drug, thalidomide, improves hepatic alterations induced by a high-fat diet in mice. Liver Int 2010; 30: [PMID: DOI: /j x] 44 Katz A, Nambi SS, Mather K, Baron AD, Follmann DA, Sullivan G, Quon MJ. Quantitative insulin sensitivity check index: a simple, accurate method for assessing insulin sensitivity in humans. J Clin Endocrinol Metab 2000; 85: [PMID: DOI: /jc ] 45 Aguilera E, Recasens M, Flores L, Ricart MJ, Casamitjana R, Fernández-Cruz L, Esmatjes E. HOMA test in diabetic patients with simultaneous pancreas and kidney transplantation. Transplant Proc 2002; 34: [PMID: DOI: /S (01) ] 46 Gilliland SE, Walker DK. Factors to consider when selecting a culture of Lactobacillus acidophilus as a dietary adjunct to produce a hypocholesterolemic effect in humans. J Dairy Sci 1990; 73: [PMID: DOI: /jds. S (90) ] 47 De Rodas BZ, Gilliland SE, Maxwell CV. Hypocholesterolemic action of Lactobacillus acidophilus ATCC and calcium in swine with hypercholesterolemia induced by diet. J Dairy Sci 1996; 79: [PMID: DOI: /jds.S (96) ] 48 Usman A. Effect of administration of Lactobacillus gasseri on serum lipids and fecal steroids in hypercholesterolemic rats. J Dairy Sci 2000; 83: [PMID: DOI: /jds.S (00) ] 49 Pereira DI, Gibson GR. Effects of consumption of probiotics and prebiotics on serum lipid levels in humans. Crit Rev Biochem Mol Biol 2002; 37: [PMID: DOI: / ] 50 Ibnou-Zekri N, Blum S, Schiffrin EJ, von der Weid T. Divergent patterns of colonization and immune response elicited from two intestinal Lactobacillus strains that display similar properties in vitro. Infect Immun 2003; 71: [PMID: DOI: /IAI ] 51 Gibson GR, Wang X. Regulatory effects of bifidobacteria on the growth of other colonic bacteria. J Appl Bacteriol 1994; 77: [PMID: DOI: /j tb03443.x] 52 McCartney AL, Wenzhi W, Tannock GW. Molecular analysis of the composition of the bifidobacterial and lactobacillus microflora of humans. Appl Environ Microbiol 1996; 62: [PMID: ] 53 Malasanos TH, Stacpoole PW. Biological effects of omega-3 fatty acids in diabetes mellitus. Diabetes Care 1991; 14: [PMID: DOI: /gut ] 54 Malaguarnera M, Gargante MP, Malaguarnera G, Salmeri M, Mastrojeni S, Rampello L, Pennisi G, Li Volti G, Galvano F. Bifidobacterium combined with fructo-oligosaccharide versus lactulose in the treatment of patients with hepatic encephalopathy. Eur J Gastroenterol Hepatol 2010; 22: [PMID: DOI: /MEG.0b013e328330a8d3] 55 Vanni E, Bugianesi E. The gut-liver axis in nonalcoholic fatty liver disease: Another pathway to insulin resistance? Hepatology 2009; 49: [PMID: DOI: /hep.23036] 56 Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 1995; 125: [PMID: ] 57 Tannock GW, Wilson CM, Loach D, Cook GM, Eason J, O Toole PW, Holtrop G, Lawley B. Resource partitioning in relation to cohabitation of Lactobacillus species in the mouse forestomach. ISME J 2012; 6: [PMID: DOI: /ismej ] 58 Gibson GR, Beatty ER, Wang X, Cummings JH. Selective stimulation of bifidobacteria in the human colon by oligofructose and inulin. Gastroenterology 1995; 108: [PMID: DOI: / (95) ] 59 Hofacre CL, Mathis GF, Quiroz MA. Natural alternatives to prevent necrotic enteritis. Int Poult Prod 2005; 13: Cani PD, Neyrinck AM, Fava F, Knauf C, Burcelin RG, Tuohy KM, Gibson GR, Delzenne NM. Selective increases of bifidobacteria in gut microflora improve high-fat-dietinduced diabetes in mice through a mechanism associated with endotoxaemia. Diabetologia 2007; 50: [PMID: DOI: /s ] P- Reviewers Bordas JM, Herrerias-Gutierrez JM, Petr H S- Editor Qi Y L- Editor A E- Editor Liu XM 6918 October 28, 2013 Volume 19 Issue 40

231 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. META-ANALYSIS Restrictive vs liberal transfusion for upper gastrointestinal bleeding: A meta-analysis of randomized controlled trials Juan Wang, Yong-Xin Bao, Ming Bai, Yong-Guo Zhang, Wen-Da Xu, Xing-Shun Qi Juan Wang, Xing-Shun Qi, Department of Gastroenterology, No. 463 Hospital of Chinese PLA, Shenyang , Liaoning Province, China Yong-Xin Bao, Post-doctoral Research Station, Shenyang General Hospital of Chinese PLA, Shenyang , Liaoning Province, China Ming Bai, Xing-Shun Qi, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi an , Shaanxi Province, China Yong-Guo Zhang, Wen-Da Xu, Department of Gastroenterology, Shenyang General Hospital of Chinese PLA, Shenyang , Liaoning Province, China Author contributions: Qi XS is the guarantor of the study; Wang J and Qi XS designed the study and performed literature retrieval and data collection; Wang J, Bao YX, Bai M, Zhang YG, Xu WD and Qi XS analyzed the data and interpreted the results; Wang J and Qi XS drafted the paper; Wang J, Bao YX, Bai M, Zhang YG, Xu WD and Qi XS revised the paper. Correspondence to: Xing-Shun Qi, MD, Department of Gastroenterology, No. 463 Hospital of Chinese PLA, Dadong Xiaohe Yan Road 46, Shenyang , China. xingshunqi@126.com Telephone: Fax: Received: July 9, 2013 Revised: August 16, 2013 Accepted: September 4, 2013 Published online: October 28, 2013 Abstract AIM: To compare the outcome of upper gastrointestinal bleeding (UGIB) between patients receiving restrictive and liberal transfusion. METHODS: PubMed, EMBASE, and Cochrane Library databases were employed to identify all relevant randomized controlled trials regarding the outcome of UGIB after restrictive or liberal transfusion. Primary outcomes were death and rebleeding. Secondary outcomes were length of hospitalization, amount of blood transfused, and hematocrit and hemoglobin at discharge or after expansion. RESULTS: Overall, 4 papers were included in this meta-analysis. The incidence of death was significantly lower in patients receiving restrictive transfusion than those receiving liberal transfusion (OR: 0.52, 95%CI: , P = 0.01). The incidence of rebleeding was lower in patients receiving restrictive transfusion than those receiving liberal transfusion, but this difference did not reach any statistical significance (OR: 0.26, 95%CI: , P = 0.21). Compared with those receiving liberal transfusion, patients receiving restrictive transfusion had a significantly shorter length of hospitalization (standard mean difference: -0.17, 95%CI: , P = 0.009) and a significantly smaller amount of blood transfused (standard mean difference: -0.74, 95%CI: , P = ) with a lower hematocrit and hemoglobin level at discharge or after expansion. CONCLUSION: Restrictive transfusion should be employed in patients with UGIB Baishideng. All rights reserved. Key words: Upper gastrointestinal bleeding; Blood transfusion; Meta-analysis; Randomized controlled trial Core tip: Current international consensus recommends restrictive transfusion for upper gastrointestinal bleeding. However, this recommendation is largely based on expert opinions. We have performed the present metaanalysis of randomized controlled trials, which potentially supported the superiority of restrictive over liberal transfusion for upper gastrointestinal bleeding. Wang J, Bao YX, Bai M, Zhang YG, Xu WD, Qi XS. Restrictive vs liberal transfusion for upper gastrointestinal bleeding: A metaanalysis of randomized controlled trials. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: org/ /wjg.v19.i October 28, 2013 Volume 19 Issue 40

232 Wang J et al. Transfusion for UGIB INTRODUCTION Acute upper gastrointestinal bleeding is a common cause for emergency hospitalization with a relatively high annual incidence of / population and a mortality of 10%-30% [1-3]. Red blood cell transfusion is often required in such patients due to the reduction of tissue perfusion after acute blood loss [4-6]. Current international consensus on the management of upper gastrointestinal bleeding recommends that the threshold for initiating blood transfusion is a hemoglobin level of 70 g/l or less in patients with nonvariceal upper gastrointestinal bleeding [5] and a hemoglobin level of 80 g/l or less in patients with variceal bleeding [6]. However, these recommendations are largely based on expert opinions or international guidelines regarding transfusion requirement in critically ill patients without upper gastrointestinal bleeding [7-9]. Accordingly, the grade of evidence for these recommendations is low [5,6]. A previous Cochrane Collaboration systematic review of three randomized controlled trials has shown a tendency in decreasing the mortality of patients with upper gastrointestinal bleeding after restrictive transfusion [10,11]. But a small number of participants and a high proportion of missing data limit the significance of these findings [10,11]. These authors concluded that their review might not provide useful data regarding outcomes following red blood cell transfusion for acute upper gastrointestinal bleeding [10,11]. Recently, several large-scale observational studies demonstrated that blood transfusion after nonvariceal upper gastrointestinal bleeding might increase the rate of mortality and rebleeding [12,13]. More recently, a large and well-organized randomized controlled trial showed a significant benefit of restrictive transfusion strategy in improvement of outcome in patients with upper gastrointestinal bleeding [14]. Herein, we performed an updated meta-analysis of randomized controlled trials to compare the outcome of upper gastrointestinal bleeding between patients treated with restrictive and liberal transfusion. Primary outcomes were death and rebleeding. Secondary outcomes were length of hospitalization, amount of blood transfused, and hematocrit and hemoglobin at discharge or after expansion. MATERIALS AND METHODS This work was performed according to the PRISMA statement for reporting systematic reviews and meta-analyses of studies that evaluate health care interventions [15]. Eligibility criteria (1) randomized controlled trials were included, if they compared the outcome of upper gastrointestinal bleeding between patients treated with restrictive and liberal blood transfusion; (2) no publication date, publication language, or publication status was restricted; (3) basic studies were excluded; (4) comments, editorials, or letters were excluded; (5) introductions for Cochrane groups were excluded; (6) narrative reviews, systematic reviews, or meta-analyses were excluded; (7) study design reports, case reports, noncomparative case series were excluded; (8) non-randomized comparative studies were excluded; and (9) randomized controlled trials unrelated to our topics were excluded. Literature selection Studies were identified using a search strategy in the PubMed, EMBASE, and Cochrane Library databases. Search items were listed as follows: ( gastrointestinal [All Fields] OR digestive [All Fields] OR peptic [All Fields] OR alimentary tract [All Fields] OR esophageal [All Fields] OR esophagus [All Fields] OR gastric [All Fields] OR stomach [All Fields] OR duodenal [All Fields] OR duodenum [All Fields]) AND ( hemorrhage [All Fields] OR haemorrhage [All Fields] OR bleeding [All Fields] OR bleed [All Fields] OR melena [All Fields] OR melaema [All Fields] OR hematemesis [All Fields] OR haematemesis [All Fields]) AND ( transfusion [All Fields]) AND ( blood [All Fields] OR red cell [All Fields]) AND ( randomized [All Fields] OR randomized [All Fields] OR randomly [All Fields]). The last search was performed on January 5, Study eligibility was independently judged by two authors. In cases of disagreement between the two authors, they would be discussed with another author. When two or more studies were conducted by one affiliation, only the studies with more complete data and more extensive interval of enrollment were included in the meta-analysis. Data extraction We developed a data extraction sheet, including the authors, journal, publication year, whether articles were published in peer-reviewed journals or not, regions where the study was conducted, period of enrollment, study design, target population, study endpoints, eligibility criteria, sample size, and demographic data (age and sex), source of upper gastrointestinal bleeding, hematocrit, and hemoglobin of two groups. Data were independently extracted by two authors. In cases of disagreement between the two authors, they would be discussed with another author. We used Google to translate the information in the non-english language full-texts. Assessment of study quality Quality of included randomized controlled trials was scored by Jadad composite scale [16,17], in which the description of randomization, blinding, and withdrawals were assessed. The quality scale ranged from 0 to 5 points. If the score was 2 or less, the quality of the study would be considered lower. If the score was beyond 2, the quality of the study would be high. Statistical analysis Data were collected, using Microsoft Office Excel For the dichotomous variables (i.e., incidence of death and rebleeding), number of events and total patients were extracted from these included studies. Then, OR with 95%CI was calculated. For the continuous variables (i.e., length of hospitalization, amount of blood transfu October 28, 2013 Volume 19 Issue 40

233 Wang J et al. Transfusion for UGIB Articles identified via databases (n = 881) PubMed datebase (n = 301) EMBASE datebase (n = 62) Cochrane library datebase (n = 518) Excluded (n = 202) Duplicates among the databases (n = 202) Articles screened for retrieval (n = 679) Articles met the eligibility criteria (n = 6) Excluded (n = 673) Basic studies (n = 19) Comments, editorials, or letters (n = 4) Cochrane groups (n = 6) Narrative reviews, systematic reviews, or meta-analyses (n = 314) Study design (n = 3) Case reports (n = 3) Non-comparative studies (n = 13) Non-randomized comparative studies (n = 38) Irrelevant randomized studies (n = 273) Excluded (n = 2) Same data from one institution (n = 2) Articles were finally included (n = 4) Figure 1 Flowchart of study inclusion. sion, and hematocrit and hemoglobin), mean value and standard deviation were extracted from these included studies. Then, standard mean difference with 95%CI was calculated. Finally, the OR and standard mean difference of each study were pooled, using both fixed-effects (Mantel-Haenszel method) [18] and random-effects model (DerSimonian-Laird method) [19]. When heterogeneity was not significant, the pooled data using fixed-effects model were considered appropriate. When significant heterogeneity was observed, only the pooled data using randomeffects model were considered appropriate. Heterogeneity between studies was assessed by using the I 2 statistic (I 2 > 50% was considered as having substantial heterogeneity) and the χ 2 test (P < 0.10 was considered to represent significant statistical heterogeneity) [20]. Funnel plots were not performed due to a small number of included studies. Sensitivity analyses were done to assess the reliability of meta-analysis. All analyses were conducted using the statistical package Review Manager version 5.1 (Copenhagen, The Nordic Cochrane Center, The Cochrane Collaboration, 2011). RESULTS Literature selection Overall, 881 papers were initially identified by the search strategy. Among them, six papers met eligibility criteria [14,21-25]. Of note, three papers were reported by the same one affiliation [14,21-22]. Among them, two papers with a smaller number of patients were excluded [21,22]. Thus, four randomized controlled trials were finally included in the meta-analysis [14,23-25] (Figure 1), in which 982 patients with upper gastrointestinal bleeding were treated with restrictive or liberal blood transfusion. Description of these included studies All of four randomized controlled trials were single-center studies, and were published in peer-reviewed journals between 1986 and 2013 (Table 1). Three randomized controlled trials were published in three English-language priority journals [14,24,25], and another one was published in one Spanish-language journal [23]. Target population was patients with upper gastrointestinal bleeding from variceal or non-variceal source. Of note, a total of 60 patients were randomized in one study [23], but only 27 patients were finally observed (restrictive transfusion, n = 14, and liberal transfusion, n = 13). The detailed eligibility criteria of these studies were described in Table 2. The baseline characteristics were comparable between the two groups (Table 3). Quality of these included studies In the four studies, double-blinding technique was not feasible due to the nature of interventions. Two studies were scored as 3 points and considered to be of higher 6921 October 28, 2013 Volume 19 Issue 40

234 Wang J et al. Transfusion for UGIB Table 1 Characteristics of included studies Ref. Design Regions Target population Intervention Outcome measures Blair et al [25] Single center RCT London, United Kingdom Acute severe UGIB; no esophageal varices Early transfusion group (liberal Observed results: coagulation results transfusion): at least 2 units of blood (impedance clotting time, kaolin cephalin No transfusion group (restrictive transfusion): clotting time); haematological results no blood transfusion unless hemoglobin fell (hematocrit); eventual blood transfused; below 8 g/dl or they were shocked number of rebleed; number of death Elizalde et al [24] Single center RCT Barcelona, Spain Liver cirrhosis with an acute variceal bleeding episode PRC group (liberal transfusion): 2 units of packed red cells PPL group (restrictive transfusion): 500 ml of a 5% plasma protein solution Observed items: hemodynamic measurements (cardiopulmonary pressures, cardiac output, wedged and free hepatic venous pressures, mean arterial blood pressure, systemic vascular resistance); hormonal measurements (plasma renin activity, aldosterone levels, norepinephrine); rheological parameters (plasma volume, blood viscosity) Villarejo et al [23] Single center RCT Buenos Aires, Argentina Acute digestive hemorrhage with stable haemodynamics Treatment group (restrictive transfusion): Observed results: organ failure, hospital patients underwent normovolemic hemodilution with crystalloid solutions, and the fused, hematocrit, haemoglobin stay, APACHE Ⅱ score, red cell trans- hematocrit value was maintained as 21% and < 28%; red cell transfusion was given if angina, shock, hemodynamic instability, or hematocrit < 21% Control group (liberal transfusion): the target of transfusion in these patients was the hematocrit value of 28% Villanueva et al [14] Single center RCT Barcelona, Spain Upper gastrointestinal bleeding Liberal transfusion: the hemoglobin threshold for transfusion was 9 g/dl, with a target range for the post-transfusion hemoglobin level of 9-11 g/dl Restrictive transfusion: the hemoglobin threshold for transfusion was 7 g/dl, with a target range for the post-transfusion hemoglobin level of 7-9 g/dl Primary endpoints: the rate of death from any cause within the first 45 d Secondary endpoints: the rate of further bleeding and the rate of in-hospital complications PPL: Plasma protein solution; PRC: Packed red cells; RCT: Randomized controlled trial; UGIB: Upper gastrointestinal bleeding. Table 2 Eligibility criteria of included studies Ref. Blair et al [25] Elizalde et al [24] Villarejo et al [23] Villanueva et al [14] Eligibility criteria Consecutive patients with acute severe upper gastrointestinal haemorrhage were prospectively randomized on arrival to receive during their first 24 h in hospital Only known cases of oesophageal varices were excluded as they frequently have abnormal coagulation due to liver disease The study population consisted of patients with cirrhosis of the liver admitted for the management of an acute variceal bleeding episode Only patients in whom hemostasia had been achieved within the previous h by means of endoscopic sclerotherapy, and who were still anemic (hematocrit < 30%) and normovolemic as defined by clinical parameters (systolic pressure > 100 mmhg, right atrial pressure > 2 cm H 2O, heart rate < 100 beats/min, and urine output > 0.5 ml/kg per hour) were eligible for the study Age < 18 or > 80 yr, renal failure as defined as serum creatinine > 2 mg/dl, portal thrombosis, diffuse or multinodular hepatocellular carcinoma, arterial hypertension, peripheral vasculopathy, previous surgical or transjugular intrahepatic portosystemic shunt, bacterial infection, and use of vasoactive drugs to prevent or treat portal hypertension-related bleeding were considered exclusion criteria Inclusion criteria: acute high digestive haemorrhage with stable haemodynamics and any aetiology; age > 15 yr old Exclusion criteria: history of angina; shock not responsive to volume expansion; requirement of surgery; established renal insufficiency; poliglobulina; bleeding diathesis; acute or chronic liver dysfunction; chronic anemia; pregnancy; sepsis; acute or chronic respiratory failure; haematocrit < 20% on admission; religious objection to transfusion Patients older than 18 yr of age who had hematemesis (or bloody nasogastric aspirate), melena, or both, as confirmed by the hospital staff, were considered for inclusion Patients were excluded if they declined to undergo a blood transfusion Additional exclusion criteria: massive exsanguinating bleeding, an acute coronary syndrome, symptomatic peripheral vasculopathy, stroke, transient ischemic attack, or transfusion within the previous 90 d; a recent history of trauma or surgery; lower gastrointestinal bleeding; a previous decision on the part of the attending physician that the patient should avoid specific medical therapy; and a clinical Rockall score of 0 with a hemoglobin level > 12 g/dl quality, and another two studies were scored as 1 point and considered to be of lower quality (Table 4). Death Three studies reported the incidence of death in two 6922 October 28, 2013 Volume 19 Issue 40

235 Wang J et al. Transfusion for UGIB Table 3 Baseline characteristics of patients in included studies Ref. Groups No. Patients Age (yr) Sex (male: female) Source of bleeding Hematocrit at admission Hemoglobin at admission (g/dl) Blair et al [25] Restrictive transfusion ± 4.5 2:1 Gastric ulcer (n = 4); duodenal ulcer (n = 13); carcinoma (n = 2); Mallory-Weiss tear (n = 3); not visualized (n = 4) Liberal transfusion ± 3.6 2:1 Gastric ulcer (n = 2); duodenal ulcer (n = 17); carcinoma (n = 1); Mallory-Weiss tear (n = 2); not visualized (n = 2) Elizalde [24] Restrictive transfusion 8 60 ± 4 5/3 Bleeding from esophageal varices (n = 7); bleeding from gastric varices in the fundus of the stomach (n = 1) Liberal transfusion 8 64 ± 2 4/4 Bleeding from esophageal varices (n = 7); bleeding from gastric varices in the fundus of the stomach (n = 1) 29 ± 1.6 NA 28 ± 1.2 NA 27.0 ± ± ± ± 3.96 Villarejo Restrictive transfusion ± /5 Mallory Weiss (n = 2); erosive gastritis 26.9 ± ± 2.47 et al [23] Liberal transfusion ± /4 (n = 14); erosive gastroduodenitis (n = 28.3 ± ± ); Forrest gastric ulcer (n = 10); Forrest duodenal ulcer (n = 10); erosive duodenitis (n = 1) Villanueva Restrictive transfusion 444 NA NA Peptic ulcer (n = 228); gastroesophageal NA 9.6 ± 2.2 et al [14] varices (n = 101); Mallory-Weiss tears (n = 25); erosive gastritis or esophagitis (n = 38); neoplasms (n = 16); other (n = 36) Liberal transfusion 445 NA NA Peptic ulcer (n = 209); gastroesophageal varices (n = 109); Mallory-Weiss tears (n = 30); erosive gastritis or esophagitis (n = 29); neoplasms (n = 20); other (n = 48) NA 9.4 ± 2.4 Table 4 Quality assessment of included studies Ref. Randomization Blinding Withdrawals Jadad and dropouts Score Blair et al [25] Yes (inadequate) No Unclear 1 Elizalde et al [24] Yes (inadequate) Unclear Unclear 1 Villarejo et al [23] Yes (adequate) Unclear Clear 3 Villanueva et al [14] Yes (adequate) Unclear Clear 3 groups [14,23,25]. One study did not observe any death during the study period in both groups [23], so the OR of this study was not estimable. Another two studies showed a higher incidence of death in patients receiving liberal transfusion [14,25]. Heterogeneity among the three studies was not significant (I 2 = 0%; P = 0.47). Using a fixedeffect model, the pooled OR was significant (OR = 0.52, 95%CI: , P = 0.01) (Figure 2A). Rebleeding Two studies reported the incidence of rebleeding in two groups [14,25]. Both studies showed a higher incidence of rebleeding in patients receiving liberal transfusion. Heterogeneity among the two studies was significant (I 2 = 74%; P = 0.05). Using a random-effect model, the pooled OR was not significant (OR = 0.26, 95%CI: , P = 0.21) (Figure 2B). Length of hospitalization Two studies reported the length of hospitalization in two groups [14,23]. Heterogeneity among the two studies was not significant (I 2 = 0%; P = 0.99). Using a fixed-effect model, the pooled standard mean difference was significant (standard mean difference: -0.17, 95%CI: , P = 0.009) (Figure 2C). Amount of blood transfused Four studies reported the amount of blood transfused in two groups [14,23-25]. Heterogeneity among the four studies was significant (I 2 = 54%; P = 0.09). Using a randomeffect model, the pooled standard mean difference was significant (standard mean difference: -0.74, 95%CI: , P = ) (Figure 2D). Hematocrit Three studies reported the value of hematocrit at discharge or after expansion in two groups [23-25]. Heterogeneity among the three studies was significant (I 2 = 85%; P = 0.001). Using a random-effect model, the pooled standard mean difference was not significant (standard mean difference: -1.07, 95%CI: , P = 0.10) (Figure 2E). Hemoglobin Three studies reported the hemoglobin concentration at discharge or after expansion in two groups [14,23,24]. Heterogeneity among the three studies was significant (I 2 = 56%; P = 0.10). Using a random-effect model, the pooled standard mean difference was significant [standard mean difference: -1.12, 95%CI: , P = ] (Figure 2F). Sensitivity analysis Sensitivity analyses were performed after one study with 6923 October 28, 2013 Volume 19 Issue 40

236 Wang J et al. Transfusion for UGIB A B C Restrictive transfusion Liberal transfusion Odds ratio Odds ratio Study or subgroup Events Total Events Total Weight M-H, fixed, 95%CI Yr M-H, fixed, 95%CI Blair (1986) % 0.17 [0.01, 3.72] 1986 Villarejo (1999) Not estimable 1999 Villanueva (2013) % 0.54 [0.32, 0.91] 2013 Total (95%CI) % 0.52 [0.31, 0.87] Total events Heterogeneity: χ 2 = 0.52, df = 1 (P = 0.47); I 2 = 0% Test for overall effect: Z = 2.50 (P = 0.01) Restrictive transfusion Liberal transfusion Odds ratio Odds ratio Study or subgroup Events Total Events Total Weight M-H, fixed, 95%CI Yr M-H, random, 95%CI Blair (1986) % 0.07 [0.01, 0.58] 1986 Villanueva (2013) % 0.59 [0.40, 0.89] 2013 Total (95%CI) % 0.26 [0.03, 2.10] Total events Heterogeneity: Tau 2 = 1.79; χ 2 = 3.85, df = 1 (P = 0.05); I 2 = 74% Test for overall effect: Z = 1.26 (P = 0.21) Restrictive transfusion Liberal transfusion Std. mean difference Std. mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, fixed, 95%CI Yr Ⅳ, fixed, 95%CI Villarejo (1999) % [-0.92, 0.59] 1999 Villanueva (2013) % [-0.31,-0.04] 2013 Total (95%CI) % [-0.30,-0.04] Heterogeneity: χ 2 = 0.00, df = 1 (P = 0.99); I 2 = 0% Test for overall effect: Z = 2.62 (P = 0.009) Favours restrictive Favours liberal Favours restrictive Favours liberal Favours restrictive Favours liberal D Restrictive transfusion Liberal transfusion Std. mean difference Std. mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, random, 95%CI Yr Ⅳ, random, 95%CI Blair (1986) % [-1.39, -0.23] 1986 Elizalde (1998) % 0.18 [-0.80, 1.16] 1998 Villarejo (1999) % [-2.37, -0.63] 1999 Villanueva (2013) % [-0.84, -0.56] 2013 Total (95%CI) % [-1.15, -0.32] Heterogeneity: Tau 2 = 0.09; χ 2 = 6.46, df = 3 (P = 0.09); I 2 = 54% Test for overall effect: Z = 3.50 (P = ) Favours restrictive Favours liberal E F Restrictive transfusion Liberal transfusion Std. mean difference Std. mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, random, 95%CI Yr Ⅳ, random, 95%CI Blair (1986) % 0.00 [-0.55, 0.55] 1986 Elizalde (1998) % [-4.06, -1.19] 1998 Villarejo (1999) % [-1.85, -0.22] 1999 Total (95%CI) % [-2.36, 0.21] Heterogeneity: Tau 2 = 1.06; χ 2 = 13.20, df = 2 (P = 0.001); I 2 = 85% Test for overall effect: Z = 1.64 (P = 0.10) Restrictive transfusion Liberal transfusion Std. mean difference Std. mean difference Study or subgroup Mean SD Total Mean SD Total Weight Ⅳ, random, 95%CI Yr Ⅳ, random, 95%CI Elizalde (1998) % [-3.44, -0.84] 1998 Villarejo (1999) % [-1.98, -0.33] 1999 Villanueva (2013) % [-0.95, -0.68] % [-1.73, -0.51] Heterogeneity: Tau 2 = 0.17; χ 2 = 4.54, df = 2 (P = 0.10); I 2 = 56% Test for overall effect: Z = 3.62 (P = ) Favours restrictive Favours liberal Favours restrictive Favours liberal Figure 2 Forest plots comparing the incidence of death (A), incidence of rebleeding (B), length of hospitalization (C), amount of blood transfused (D), and hematocrit (E) and hemoglobin (F) level at discharge or after expansion between patients treated with restrictive and liberal transfusion. Studies are arranged by publication year. a high proportion of loss to follow-up was excluded [23]. Results of all meta-analyses were consistent with those of previous meta-analyses. For death, the pooled OR was 0.52 (95%CI: , P = 0.01). For length of hospitalization, the pooled standard mean difference was (95%CI: , P = 0.01). For amount of blood transfused, 6924 October 28, 2013 Volume 19 Issue 40

237 Wang J et al. Transfusion for UGIB the pooled standard mean difference was (95%CI: , P = ). For hematocrit, the pooled standard mean difference was (95%CI: , P = 0.35). For hemoglobin, the pooled standard mean difference was (95%CI: , P = 0.04). DISCUSSION This updated meta-analysis of randomized controlled trials showed the following important findings. First, restrictive transfusion could significantly decrease the incidence of death in patients with upper gastrointestinal bleeding. The survival benefit of restrictive transfusion might be attributed to a lower incidence of further bleeding and transfusion-related adverse events. Second, two randomized controlled trials were included in our meta-analysis and unanimously supported the effectiveness of restrictive transfusion in decreasing the incidence of rebleeding. Our meta-analysis demonstrated a trend in decreasing the incidence of rebleeding in patients treated with restrictive transfusion, but it did not reach any statistical significance. This unexpected finding could be explained by the fact that a random-effect model was employed due to a significant heterogeneity among studies, and the number of patients included in the two randomized controlled trials was substantially different. Third, patients treated with restrictive transfusion had a significantly shorter length of hospitalization and a smaller amount of blood transfused, although the value of hematocrit and hemoglobin at discharge or after expansion was lower in patients treated with restrictive transfusion than in those with liberal transfusion. Generally, these findings accorded with the current international consensus recommendation in which restrictive transfusion should be employed in patients with upper gastrointestinal bleeding. However, we should acknowledge that the threshold of restrictive transfusion strategy was various among these included studies. Accordingly, further studies should be warranted to elucidate the accurate threshold of transfusion in these patients. The strengths of our study were as follows. First, only randomized controlled trials were included into our metaanalysis. Second, a comprehensive literature search was performed by searching three databases. Third, no publication language was restricted. One Spanish-language full text paper was retrieved by contacting the journal secretary and was translated by Google [23]. Fourth, a randomeffect model was employed to produce a conservative result with wider confidence intervals, as the heterogeneity among studies was significant [19]. Several limitations of our study should be fully emphasized. First, the publication date of the four studies spanned from 1986 to This was a relatively long time during which many diagnostic techniques and treatment modalities had been improved. But it should be noted that heterogeneity among studies was not significant for death. Second, three earlier randomized controlled trials had a relatively small sample size [23-25]. By comparison, the latest randomized controlled trial had a larger number of participants included [14]. Therefore, the weight of this trial was larger than that of other studies in meta-analyses. In future, more randomized controlled trials are needed to perform a further meta-analysis regarding this topic. Third, one randomized controlled trial had a relatively high proportion of loss to followup, thereby increasing the possibility of selection bias [23]. Fourth, one randomized controlled trial primarily aimed to observe the hemodynamic effects of an acute increase in blood hemoglobin levels [24]. Thus, the data regarding the survival and rebleeding could not be extracted. Fifth, results of one large randomized controlled trial were partially published in two previously published abstracts [21,22]. A total of 277 patients with cirrhosis with acute variceal bleeding were enrolled in this study [14]. By contrast, the outcome of 147 participants with cirrhosis with acute variceal bleeding was described in one abstract, and the outcome of 214 participants was reported in another abstract [21,22]. Importantly, no interim analysis or so called early stopping rule was planned in the study. Accordingly, the misbehavior that the authors looked at the data and reported the partial results before the study was completed would introduce the chance of falsely rejecting the null hypothesis (i.e., type I error). Finally, we could not do a meta-analysis according to the different source of bleeding due to a small number of studies included. In conclusions, this meta-analysis provides preliminary evidence to support that the restrictive transfusion should be employed in patients with upper gastrointestinal bleeding, although the limitation of our study is obvious. Further well designed and conducted randomized controlled trials should be warranted to confirm whether or not restrictive transfusion should be beneficial in different sources of upper gastrointestinal bleeding. ACKNOWLEDGEMENTS We are indebted to Mariela García Muñoz (Secretary Acta Gastroenterológica LatinoAmericana, Organo oficial de la Sociedad Argentina de Gastroenterología) for literature retrieval. COMMENTS Background Acute upper gastrointestinal bleeding is a common cause for emergency hospitalization with a relatively high morbidity and mortality. Red blood cell transfusion is often required in such patients due to the reduction of tissue perfusion after acute blood loss. Current international consensus recommends restrictive transfusion for upper gastrointestinal bleeding. However, this recommendation is largely based on expert opinions. Research frontiers Recently, several large-scale observational studies demonstrated that blood transfusion after nonvariceal upper gastrointestinal bleeding might increase the rate of mortality and rebleeding. More recently, a large and well-organized randomized controlled trial showed a significant benefit of restrictive transfusion strategy in improvement of outcome in patients with upper gastrointestinal bleeding. Innovations and breakthroughs A previous Cochrane Collaboration systematic review of three randomized 6925 October 28, 2013 Volume 19 Issue 40

238 Wang J et al. Transfusion for UGIB controlled trials has shown a tendency in decreasing the mortality of patients with upper gastrointestinal bleeding after restrictive transfusion. But a small number of participants and a high proportion of missing data limit the significance of these findings. These authors concluded that their review might not provide useful data regarding outcomes following red blood cell transfusion for acute upper gastrointestinal bleeding. Thus, authors performed an updated meta-analysis of randomized controlled trials to compare the outcome of upper gastrointestinal bleeding between patients treated with restrictive and liberal transfusion. Results of their meta-analysis demonstrated that patients receiving restrictive transfusion had a lower incidence of death and rebleeding, a shorter length of hospitalization, and a smaller amount of blood transfused than those receiving liberal transfusion. Applications Evidence suggested that restrictive transfusion should be employed in patients with upper gastrointestinal bleeding. Peer review Restrictive transfusion for acute upper gastrointestinal bleeding will become a hot topic in recent years. This study is very interesting. It is valuable to be published. REFERENCES 1 Lewis JD, Bilker WB, Brensinger C, Farrar JT, Strom BL. Hospitalization and mortality rates from peptic ulcer disease and GI bleeding in the 1990s: relationship to sales of nonsteroidal anti-inflammatory drugs and acid suppression medications. Am J Gastroenterol 2002; 97: [PMID: DOI: /j x] 2 Sung JJ, Tsoi KK, Ma TK, Yung MY, Lau JY, Chiu PW. Causes of mortality in patients with peptic ulcer bleeding: a prospective cohort study of 10,428 cases. Am J Gastroenterol 2010; 105: [PMID: DOI: /ajg ] 3 Laine L, Yang H, Chang SC, Datto C. Trends for incidence of hospitalization and death due to GI complications in the United States from 2001 to Am J Gastroenterol 2012; 107: ; quiz 1196 [PMID: DOI: / ajg ] 4 Gralnek IM, Barkun AN, Bardou M. Management of acute bleeding from a peptic ulcer. N Engl J Med 2008; 359: [PMID: DOI: /NEJMra ] 5 Barkun AN, Bardou M, Kuipers EJ, Sung J, Hunt RH, Martel M, Sinclair P. International consensus recommendations on the management of patients with nonvariceal upper gastrointestinal bleeding. Ann Intern Med 2010; 152: [PMID: DOI: / ] 6 de Franchis R. Revising consensus in portal hypertension: report of the Baveno V consensus workshop on methodology of diagnosis and therapy in portal hypertension. J Hepatol 2010; 53: [PMID: DOI: / j.jhep ] 7 Dellinger RP, Levy MM, Carlet JM, Bion J, Parker MM, Jaeschke R, Reinhart K, Angus DC, Brun-Buisson C, Beale R, Calandra T, Dhainaut JF, Gerlach H, Harvey M, Marini JJ, Marshall J, Ranieri M, Ramsay G, Sevransky J, Thompson BT, Townsend S, Vender JS, Zimmerman JL, Vincent JL. Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic shock: Crit Care Med 2008; 36: [PMID: DOI: /01. CCM ] 8 Hébert PC, Wells G, Blajchman MA, Marshall J, Martin C, Pagliarello G, Tweeddale M, Schweitzer I, Yetisir E. A multicenter, randomized, controlled clinical trial of transfusion requirements in critical care. Transfusion Requirements in Critical Care Investigators, Canadian Critical Care Trials Group. N Engl J Med 1999; 340: [PMID: DOI: /NEJM ] 9 Lacroix J, Hébert PC, Hutchison JS, Hume HA, Tucci M, Ducruet T, Gauvin F, Collet JP, Toledano BJ, Robillard P, Joffe A, Biarent D, Meert K, Peters MJ. Transfusion strategies for patients in pediatric intensive care units. N Engl J Med 2007; 356: [PMID: DOI: /NEJ- Moa066240] 10 Hearnshaw S, Brunskill S, Doree C, Hyde C, Travis S, Murphy MF. Red cell transfusion for the management of upper gastrointestinal haemorrhage. Cochrane Database Syst Rev 2009; (2): CD [PMID: DOI: / CD pub2] 11 Jairath V, Hearnshaw S, Brunskill SJ, Doree C, Hopewell S, Hyde C, Travis S, Murphy MF. Red cell transfusion for the management of upper gastrointestinal haemorrhage. Cochrane Database Syst Rev 2010; (9): CD [PMID: DOI: / CD pub3] 12 Hearnshaw SA, Logan RF, Palmer KR, Card TR, Travis SP, Murphy MF. Outcomes following early red blood cell transfusion in acute upper gastrointestinal bleeding. Aliment Pharmacol Ther 2010; 32: [PMID: DOI: /j x] 13 Restellini S, Kherad O, Jairath V, Martel M, Barkun AN. Red blood cell transfusion is associated with increased rebleeding in patients with nonvariceal upper gastrointestinal bleeding. Aliment Pharmacol Ther 2013; 37: [PMID: DOI: /apt.12170] 14 Villanueva C, Colomo A, Bosch A, Concepción M, Hernandez-Gea V, Aracil C, Graupera I, Poca M, Alvarez-Urturi C, Gordillo J, Guarner-Argente C, Santaló M, Muñiz E, Guarner C. Transfusion strategies for acute upper gastrointestinal bleeding. N Engl J Med 2013; 368: [PMID: DOI: /NEJMoa ] 15 Moher D, Liberati A, Tetzlaff J, Altman DG. Preferred reporting items for systematic reviews and meta-analyses: the PRISMA statement. Ann Intern Med 2009; 151: , W64 [PMID: ] 16 Jadad AR, Moore RA, Carroll D, Jenkinson C, Reynolds DJ, Gavaghan DJ, McQuay HJ. Assessing the quality of reports of randomized clinical trials: is blinding necessary? Control Clin Trials 1996; 17: 1-12 [PMID: ] 17 Moher D, Pham B, Jones A, Cook DJ, Jadad AR, Moher M, Tugwell P, Klassen TP. Does quality of reports of randomised trials affect estimates of intervention efficacy reported in meta-analyses? Lancet 1998; 352: [PMID: DOI: /S (98)01085-X] 18 Mantel N, Haenszel W. Statistical aspects of the analysis of data from retrospective studies of disease. J Natl Cancer Inst 1959; 22: [PMID: ] 19 DerSimonian R, Laird N. Meta-analysis in clinical trials. Control Clin Trials 1986; 7: [PMID: ] 20 Higgins JP, Thompson SG, Deeks JJ, Altman DG. Measuring inconsistency in meta-analyses. BMJ 2003; 327: [PMID: DOI: /bmj ] 21 Colomo A, Hernandez-Gea V, Madoz P, Carles A, Alvarez- Urturi C, Poca M, Concepcion M, Gordillo J, Soriano G, Torras X, Sainz S, Guarner-Argente C, Garcia-Planella E, Gallego A, Guarner C, Villanueva C. Hemodynamic changes and transfusion strategies in cirrhotic patiens with acute variceal bleeding. Hepatology 2009; 50: 403A. Available from: URL: http: //onlinelibrary.wiley.com/o/cochrane/clcentral/articles/718/ CN /frame.html 22 Colomo A, Hernandez-Gea V, Muñiz-Diaz E, Madoz P, Aracil C, Álvarez-Urturi C, Jordi G, Soriano G, Torras X, Sáinz S, Guarner-Argente C, Garcia-Planella E, Gallego A, Villanueva C, Guarner C. Transfusion strategies in patients with cirrhosis and acute gastrointestinal bleeding. Hepatology 2008; 48: 413A. Available from: URL: http: //onlinelibrary.wiley. com/o/cochrane/clcentral/articles/965/cn / frame.html 23 Villarejo F, Rizzolo M, Lópéz E, Domeniconi G, Arto G, Apezteguia C. Acute anemia in high digestive hemorrhage. Margins of security for their handling without transfusion 6926 October 28, 2013 Volume 19 Issue 40

239 Wang J et al. Transfusion for UGIB of red globules. Acta Gastroenterol Latinoam 1999; 29: [PMID: ] 24 Elizalde JI, Moitinho E, García-Pagán JC, Cirera I, Escorsell A, Bandi JC, Jiménez W, Bosch J, Piqué JM, Rodés J. Effects of increasing blood hemoglobin levels on systemic hemodynamics of acutely anemic cirrhotic patients. J Hepatol 1998; 29: [PMID: ] 25 Blair SD, Janvrin SB, McCollum CN, Greenhalgh RM. Effect of early blood transfusion on gastrointestinal haemorrhage. Br J Surg 1986; 73: [PMID: ] P- Reviewers Pan WS, Yan SL S- Editor Gou SX L- Editor A E- Editor Wang CH 6927 October 28, 2013 Volume 19 Issue 40

240 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. CASE REPORT Angiotensin-Ⅱ inhibitor (olmesartan)-induced collagenous sprue with resolution following discontinuation of drug Jennifer A Nielsen, Anita Steephen, Matthew Lewin Jennifer A Nielsen, Division of Research, ProPath Laboratory, Dallas, TX 75247, United States Anita Steephen, Texas Digestive Disease Consultants, Southlake, TX 76092, United States Matthew Lewin, Division of Gastrointestinal Pathology, ProPath Laboratory, Dallas, TX 75247, United States Author contributions: Nielsen JA, Steephen A and Lewin M contributed to the conception, design and acquisition of data, and approved the final version to be published; Steephen A analyzed and interpreted the endoscopy; Lewin M analyzed and interpreted the gastrointestinal pathology; Nielsen JA and Lewin M drafted the article and revised it critically for important intellectual content. Correspondence to: Matthew Lewin, MD, Division of Gastrointestinal Pathology, ProPath Laboratory, 1355 River Bend Dr., Dallas, TX 75247, United States. matthew.lewin@propath.com Telephone: Fax: Received: June 6, 2013 Revised: July 31, 2013 Accepted: August 17, 2013 Published online: October 28, 2013 Abstract Collagenous sprue (CS) is a pattern of small-bowel injury characterized histologically by marked villous blunting, intraepithelial lymphocytes, and thickened sub-epithelial collagen table. Clinically, patients present with diarrhea, abdominal pain, malabsorption, and weight loss. Gluten intolerance is the most common cause of villous blunting in the duodenum; however, in a recent case series by the Mayo Clinic, it has been reported that olmesartan can have a similar effect. In this case report, a 62-year-old female with a history of hypothyroidism and hypertension managed for several years with olmesartan presented with abdominal pain, weight loss, and nausea. Despite compliance to a gluten-free diet, the patient s symptoms worsened, losing 20 pounds in 3 wk. Endoscopy showed thickening, scalloping, and mosaiform changes of the duodenal mucosa. The biopsy showed CS characterized by complete villous atrophy, lymphocytosis, and thickened sub-epithelial collagen table. After 2 mo cessation of olmesartan, the patient s symptoms improved, and follow-up endoscopy was normal with complete villous regeneration. These findings suggest that olmesartan was a contributing factor in the etiology of this patient s CS. Clinicians should be aware of the possibility of druginduced CS and potential reversibility after discontinuation of medication Baishideng. All rights reserved. Key words: Collagenous sprue; Celiac disease; Olmesartan; Patient-drug interaction; Duodenum Core tip: Collagenous sprue (CS) is a pattern of smallbowel injury characterized histologically by marked villous blunting, intraepithelial lymphocytes, and thickened sub-epithelial collagen table. Clinically, patients present with diarrhea, abdominal pain, malabsorption, and weight loss, which raises suspicion of celiac disease. Clinicians should be aware of the possibility of drug-induced CS and potential reversibility after discontinuation of medication. Nielsen JA, Steephen A, Lewin M. Angiotensin-Ⅱ inhibitor (olmesartan)-induced collagenous sprue with resolution following discontinuation of drug. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6928.htm DOI: org/ /wjg.v19.i INTRODUCTION Collagenous sprue (CS) is a pattern of small-bowel injury characterized histologically by marked villous blunting, increased intraepithelial lymphocytes, and thickened collagen table. Clinically, patients present with diarrhea, abdominal pain, malabsorption, and subsequent weight 6928 October 28, 2013 Volume 19 Issue 40

241 Nielsen JA et al. Olmesartan-induced collagenous sprue A A B B Figure 1 Scalloped mucosa (A) and normal duodenum (B) (endoscopy). loss. Gluten intolerance is the most common cause of villous blunting in the duodenum; however, in contrast to celiac disease, many patients with CS do not respond to a gluten-free diet [1]. Recently, the Mayo Clinic reported in a series of 22 cases that olmesartan can cause a similar severe spruelike enteropathy [2]. We report one such case of a woman who had been managing her hypertension with olmesartan for the previous couple years. CASE REPORT Figure 2 Complete duodenal villous blunting (A) and villous regeneration (B) (hematoxylin and eosin, 400). A 62-year-old female with a history of hypothyroidism and hypertension presented with abdominal pain, weight loss, change in bowel habits, nausea, and increased bloating/gas; she denied any new medications or nonsteroidal antiinflammatory drugs use. Initial endoscopy was normal; however, the histologic findings showed a CS characterized by complete villous atrophy, up to 100 intraepithelial lymphocytes per 100 epithelial cells, and focally thickened sub-epithelial collagen table. Immunohistochemical stains showed prevalent CD3 positive intraepithelial lymphocytes with no evidence of lymphoma. Celiac markers and anti-enterocyte antibodies were negative; however, histocompatibility leukocyte antigen (HLA)- DQ2 was present. Despite compliance to a gluten-free diet, the patient s symptoms worsened, losing 20 pounds in 3 wk. A second esophagogastroduodenoscopy (EGD) showed thickening and scalloping of duodenal mucosa (Figure 1A). Subsequent histology revealed increased thickness of the collagen band, compared to the previous biopsies, persistent complete villous blunting, and intraepithelial lymphocytosis (Figures 2A and 3A). A few days later, the patient was admitted to the Emergency Department for bloody stools and advised to discontinue taking olmesartan because her blood pressure was normotensive. After cessation of olmesartan the patient s symptoms improved, and 3 mo later EGD (Figure 1B) and biopsy findings were normal, with histologic examination demonstrating complete villous regeneration in the duodenum (Figures 2B and 3B). These findings suggest that olmesartan was a contributing factor in the etiology of this patient s CS. DISCUSSION Many authors still regard CS as a part of the spectrum of celiac disease and designate non-responsive patients as being a refractory sprue [3]. Both infectious agents and allergic reactions are speculated to be involved in the mucosal injury for a CS, but the etiology and pathogenesis are still unknown [4]. Previous accounts of non-gluten sensitivity-related small bowel villous flattening have been reported. In one case series, seven patients all experienced symptoms suggestive of gluten sensitivity and had morphologically-similar mucosal injury in their small bowel biopsy specimens. Regardless of their gluten consumption, all patients experienced clinical improvement and mucosal regeneration. The cause and resolution of their injury is unknown, demonstrating that celiac sprue is not the only disease which can cause villous blunting [4]. In a recent study at Mayo Clinic, 22 patients with 6929 October 28, 2013 Volume 19 Issue 40

242 Nielsen JA et al. Olmesartan-induced collagenous sprue A B Figure 3 Thickened collagen table (A) and normal histology (B) (trichrome, 400). unexplained chronic diarrhea and enteropathy and no response to treatments for celiac disease experienced clinical improvement after suspension of olmesartan. All patients had either partial or total duodenal villous atrophy, 6 of which showed a thickened collagen table. Additionally, 7 patients had collagenous or lymphocytic gastritis, and 5 patients had microscopic colitis. Many of these patients were on olmesartan for months or even years before onset of symptoms. Follow-up biopsy confirmed histologic improvement of the duodenum in 18 patients with sprue-like changes [2], demonstrating that CS can be induced by an autoimmune response to drugs and that morphologic pattern of injury is not necessarily indicative of underlying, specific etiology. As in our patient, 68% of these patients had HLA-DQ2, which is significantly higher than the prevalence reported in the general population of 25%-30% [2]. In conclusion, we report a clear case of an angiotensin-Ⅱ inhibitor that caused villous blunting of the duodenum and gastrointestinal symptoms similar to those of celiac disease. Clinicians should be aware of the possibility of olmesartan-induced CS, with potential reversibility after discontinuation of the drug. REFERENCES 1 Freeman HJ. Update on collagenous sprue. World J Gastroenterol 2010; 16: [PMID: DOI: /wjg. v16.i3.296] 2 Rubio-Tapia A, Herman ML, Ludvigsson JF, Kelly DG, Mangan TF, Wu TT, Murray JA. Severe spruelike enteropathy associated with olmesartan. Mayo Clin Proc 2012; 87: [PMID: DOI: /j.mayocp ] 3 Robert ME, Ament ME, Weinstein WM. The histologic spectrum and clinical outcome of refractory and unclassified sprue. Am J Surg Pathol 2000; 24: [PMID: ] 4 Goldstein NS. Non-gluten sensitivity-related small bowel villous flattening with increased intraepithelial lymphocytes: not all that flattens is celiac sprue. Am J Clin Pathol 2004; 121: [PMID: DOI: /10FCNCTC- 56NMN0YE] P- Reviewer Bian ZX S- Editor Zhai HH L- Editor A E- Editor Ma S 6930 October 28, 2013 Volume 19 Issue 40

243 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. CASE REPORT Resolution of an esophageal leak and posterior gastric wall necrosis with esophageal self-expandable metal stents Majid A Almadi, Abdulrahman M Aljebreen, Fahad Bamihriz Majid A Almadi, Abdulrahman M Aljebreen, Division of Gastroenterology, King Khalid University Hospital, King Saud University, Riyadh 11461, Saudi Arabia Majid A Almadi, Division of Gastroenterology, The McGill University Health Center, Montreal General Hospital, McGill University, Montreal, H3G 1A4, Canada Fahad Bamihriz, Division of Surgery, King Khalid University Hospital, King Saud University, Riyadh 11461, Saudi Arabia Author contributions: Almadi MA, Aljebreen AM and Bamihriz F were attending doctors for the patient and contributed in writing and drafting the report and revising it critically for important intellectual content, and final approval of the version to be published. Supported by The Research Group Project, Deanship of Scientific Research at King Saud University, No. RGP-VPP-279 Correspondence to: Dr. Majid Abdularahman Almadi, MBBS, FRCPC, MSc, Assistant Professor of Medicine, Division of Gastroenterology, King Khalid University Hospital, King Saud University, PO Box 2925 (59), Riyadh 11461, Saudi Arabia. maalmadi@ksu.edu.sa Telephone: Fax: Received: June 2, 2013 Revised: July 1, 2013 Accepted: August 4, 2013 Published online: October 28, 2013 both a staple line leak as well as a gastric wall defect. We also review the literature on the use of SEMS in the management of leaks post weight reduction surgeries Baishideng. All rights reserved. Key words: Stents; Self-expandable metal stents; Laparoscopic sleeve gastrectomy; Staple line leak; Esophageal leak; Gastric necrosis Core tip: Management of staple line leaks has incorporated, in recent years, a non-surgical approach which mainly depends on elimination of oral intake, parenteral nutrition, antimicrobial therapy, and drainage procedures and more recently the use of esophageal self-expandable metal stents for sealing of these leaks as well as the induction of tissue hyperplasia that would close these leaks. This case is the first, to our knowledge, that reports the successful use of self-expandable metal stents for the closure of a posterior gastric wall necrosis as a consequence of repeated bariatric surgery. Abstract The use of weight reduction surgeries has increased over the years with a higher proportion of these surgeries being sleeve gastrectomies, this has been associated with some complications including staple line leaks. We report a 32-year-old male who had undergone a laparoscopic gastric band surgery and subsequently a laparoscopic sleeve gastrectomy, this was complicated by both an staple line leak at the gastroesophageal junction as well as a large (> 4 cm) posterior gastric wall defect due to gastric wall necrosis. We used two co-axially inserted self-expandable stents (SEMS) in the management of this patient, 5 stents were used over repeated endoscopy sessions and 20 wk. Both defects had resolved without the need for surgical intervention. This is the first reported case were SEMS are used for Almadi MA, Aljebreen AM, Bamihriz F. Resolution of an esophageal leak and posterior gastric wall necrosis with esophageal self-expandable metal stents. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6931.htm DOI: org/ /wjg.v19.i INTRODUCTION The morbidity and mortality associated with obesity has been well recognized and in some clinical settings the method to curtail such an epidemic is via weight reduction surgeries, such an intervention is associated with some complications of which surgical leaks are one of the most unfavorable as they are associated with considerable morbidity and mortality [1]. The management of 6931 October 28, 2013 Volume 19 Issue 40

244 Almadi MA et al. Use of self-expandable metal stents for gastric wall necrosis these complications has evolved from surgical reintervention to a more conservative approach with elimination of oral intake, parenteral nutrition, antimicrobial therapy, and drainage [1]. A more recent trend has been to use esophageal self-expandable metal stents (SEMS) or self-expandable plastic stents (SEPS) [1] as a method of occluding these leaks. We present an unusual case where SEMS were used in the management of a patient who developed both a staple line leak at the gastroesophageal junction as well as necrosis of the posterior gastric wall. CASE REPORT A 32-year-old male was referred to our institution with a diagnosis of an esophageal leak after a laparoscopic sleeve gastrectomy (LSG). The patient had already undergone a laparoscopic gastric band weight reduction surgery about 5 years before his presentation with a suboptimal weight loss reduction. Subsequently the patient underwent a LSG and in the first postoperative week the patient developed clinical signs of an enteric leak with the development of tachycardia as well as fever. A barium swallow demonstrated a leak at the level of the distal end of the esophagus and a computerized tomography (CT) demonstrated a fluid collection close to the surgical bed. The patient was started on broadspectrum antibiotics and oral intake was stopped. An endoscopic line of management was planned and an esophagogastroduodenoscopy (EGD) was performed and demonstrated an opening in the distal esophagus that corresponded to the leak seen on a barium study, distal to that defect the pouch above the gastric band was seen and a large defect was seen in the posterior wall of the stomach remnant, which through fluid and the drains left post surgery could be seen (Figures 1 and 2). A single A 12 cm fully-covered SEMS, Niti-S (Taewong Medical, Seoul, South Korea), was deployed with the proximal end of the stent left above the level of the leak and the distal end was just proximal to the pylorus. A month latter the patient presented with nausea and vomiting and the stent was found to have migrated, a repeat EGD found that the distal end of the SEMS caused an ulcer in the antrum of the stomach, The stent was removed and the patient was kept on a proton pump inhibitor and 12 d later two 15 cm long partially covered SEMS, Ultraflex (Microvasive, Boston Scientific, United States), were deployed in a co-axial fashion, the proximal end of the first stent lied at 30 cm from the incisors above the level of the leak while the distal end of the second stent lied in the duodenum (Figure 3). A few days after the procedure the patient was started on a liquid diet and subsequently the output from the drains had stopped. After 11 and half weeks a rat-tooth forceps was used for removing both stents but the defects in the lower esophagus and the stomach were still present although they had decreased substantially in size, another two partially covered SEMS esophageal stents (Ultraflex) were inserted in a similar fashion to the initial insertion. After Figure 1 Appearance of a large defect in the posterior wall of the stomach with the post-operative drains seen through it. Figure 2 A closer look at the drains through the defect. Figure 3 Two co-axially inserted partially covered self-expandable esophageal metal stents extending from the esophagus to the duodenum. 4 wk both stents were removed easily (Figure 4) and the defects had resolved. The patient had a subsequent CT scan of the abdomen with oral contrast that demonstrated resolution of both leaks and the drains were removed. DISCUSSION The use of enteric stents has evolved from the management of malignant diseases to benign strictures as well as leaks. LSGs are complicated by leaks in 2.2% [3] -2.4% [4] 6932 October 28, 2013 Volume 19 Issue 40

245 Almadi MA et al. Use of self-expandable metal stents for gastric wall necrosis Figure 4 Self expandable metal stent being removed from the distal aspect with a rat-tooth forceps. of cases based on two systematic reviews with the majority of these leaks (85%-89%) being located in the proximal third of the stomach near the gastroesophageal junction [1,4] and are associated with a non-trivial mortality rate (6%-14.7%) [1]. The management options for this complication vary from repeat surgery to a more conservative management with an attempt to seal these leaks through enteric stenting. Surgical management has been associated with a high morbidity (up to 50%) and mortality (2%-10%) [1], as a result, initial management has moved towards a more conservative endoscopic treatment. Although there are no randomized controlled trials to assess the efficacy of this approach, a systematic review that included 25 studies, incorporating 267 patients showed that the success rate with the use of SEMS was about 85% with no difference in the rate of clinical success between the type of SEMS used weather they were partially or fully-covered SEMS or SEPS (P = 0.97) [5], of note this systematic review included cases who had esophageal anastomotic leaks or a benign rupture of the esophagus [5]. A second meta-analysis for patients who exclusively had leaks post bariatric surgery and were managed by stenting found a success rate of 87.8% (95%CI: 79.4%-94.2%) [6]. The case we present is unique due to the simultaneous presence of a leak at the gastreosophageal junction as well as a large area of necrosis in the posterior wall of the stomach both of which were eliminated using SEMS for a prolonged period of time and the use of a total of 5 stents and five endoscopy sessions spanning a period of 20 wk. SEMS are usually kept in place on average for 6 wk [5]. In the case reported the duration of stenting was 20 wk mainly due to the large defect seen in the gastric wall. Stent migration occurred with the first fully covered SEMS that necessitated its removal and exchange. This complication is acceptable as the rate of migration in general in a meta-analysis was 16.9% (95%CI: 9.3%-26.3%) [6] and van Boeckel et al [5] found that fully covered SEMS had a higher migration rate when compared to partially covered SEMS (26% vs 12% respectively, P 0.001) [5]. Although endoscopic repositioning/removal might suffice in the majority of cases, as in our case, some of these stents passed per-rectum spontaneously or had to be removed surgically [6]. The longer the SEMS are left in place the higher the risk of ingrowth of tissue within the stent and subsequently the more difficult its removal [1]. Removal of these SEMS usually require the insertion of a SEPS within the SEMS to induce ingrowth tissue necrosis and after a few days both the SEMS and SEPS can be removed, successful removal of the SEMS after leak closure is 91.6% (95%CI: 84.2%-96.8%) [6]. We intentionally removed the SEMS after predefined durations to reduce the risk of failure to remove the SEMS. Furthermore, due to the initial use of fully covered and then partially covered SEMS they were removed without requiring the insertion of SEPS. This case is the first to our knowledge where both a staple line leak post LSG and posterior gastric wall necrosis were simultaneously treated using SEMS without the need for repeated surgery. REFERENCES 1 Kumar N, Thompson CC. Endoscopic management of complications after gastrointestinal weight loss surgery. Clin Gastroenterol Hepatol 2013; 11: [PMID: ] 2 Márquez MF, Ayza MF, Lozano RB, Morales Mdel M, Díez JM, Poujoulet RB. Gastric leak after laparoscopic sleeve gastrectomy. Obes Surg 2010; 20: [PMID: DOI: /s ] 3 Parikh M, Issa R, McCrillis A, Saunders JK, Ude-Welcome A, Gagner M. Surgical strategies that may decrease leak after laparoscopic sleeve gastrectomy: a systematic review and meta-analysis of 9991 cases. Ann Surg 2013; 257: [PMID: DOI: /SLA.0b013e31826cc714] 4 Aurora AR, Khaitan L, Saber AA. Sleeve gastrectomy and the risk of leak: a systematic analysis of 4,888 patients. Surg Endosc 2012; 26: [PMID: DOI: / s ] 5 van Boeckel PG, Sijbring A, Vleggaar FP, Siersema PD. Systematic review: temporary stent placement for benign rupture or anastomotic leak of the oesophagus. Aliment Pharmacol Ther 2011; 33: [PMID: ] 6 Puli SR, Spofford IS, Thompson CC. Use of self-expandable stents in the treatment of bariatric surgery leaks: a systematic review and meta-analysis. Gastrointest Endosc 2012; 75: [PMID: DOI: /j.gie ] P- Reviewer Regimbeau JM S- Editor Zhai HH L- Editor A E- Editor Zhang DN 6933 October 28, 2013 Volume 19 Issue 40

246 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. CASE REPORT Adjuvant surgery for advanced extrahepatic cholangiocarcinoma Yukio Oshiro, Kazuhiro Takahashi, Ryoko Sasaki, Tadashi Kondo, Shingo Sakashita, Nobuhiro Ohkohchi Yukio Oshiro, Kazuhiro Takahashi, Ryoko Sasaki, Tadashi Kondo, Nobuhiro Ohkohchi, Department of Surgery, Division of Gastroenterological and Hepatobiliary Surgery, and Organ Transplantation, University of Tsukuba, Tsukuba , Japan Shingo Sakashita, Department of Pathology, Faculty of Medicine, University of Tsukuba, Tsukuba , Japan Author contributions: All authors made substantial contributions to the acquisition, analysis, and interpretation of data and participated in writing the paper; Ohkohchi N gave final approval of the version to be published. Correspondence to: Yukio Oshiro, MD, PhD, Department of Surgery, Division of Gastroenterological and Hepatobiliary Surgery, and Organ Transplantation, University of Tsukuba, Tennodai, Tsukuba , Japan. oshiro@md.tsukuba.ac.jp Telephone: Fax: Received: June 27, 2013 Revised: August 4, 2013 Accepted: August 16, 2013 Published online: October 28, 2013 Abstract Patients with Stage Ⅳ cholangiocarcinoma are currently not considered to be surgical candidates and are typically offered systemic chemotherapy. Recently, several novel systemic chemotherapy regimens have allowed an initially unresectable cholangiocarcinoma to be resectable. The aim of this article is to present the usefulness of adjuvant surgery in a case of advanced cholangiocarcinoma that was successfully treated with gemcitabine. A 72-year-old man was diagnosed with distal cholangiocarcinoma with liver metastases (ct2n0m1, Stage Ⅳ). He underwent metal stent placement in the duodenum to alleviate jaundice. After 18 courses of chemotherapy using gemcitabine without severe drug toxicities, a computed tomography scan showed that the liver metastases in S6 and S7 had disappeared. The patient underwent subtotal stomachpreserving pancreaticoduodenectomy and lymph node dissection. The pathological stage was pt2n0m0, Stage ⅠB. The patient underwent 6 cycles of adjuvant chemotherapy using gemcitabine. The patient is alive and well 6 years and 9 mo after the diagnosis Baishideng. All rights reserved. Key words: Extrahepatic cholangiocarcinoma; Adjuvant surgery; Conversion surgery; Chemotherapy; Gemcitabine Core tip: Patients with Stage Ⅳ cholangiocarcinoma are currently not considered to be surgical candidates and are typically offered systemic chemotherapy. Recently, several novel systemic chemotherapy regimens have allowed an initially unresectable cholangiocarcinoma to be resectable. In a patient with advanced extrahepatic cholangiocarcinoma, gemcitabine (GEM) induced a dramatic reduction of the tumor, which led to curative resection and a long-term survival of 6 years and 9 mo. This result suggests the possibility of advantages of using GEM for the treatment of advanced cholangiocarcinoma, and GEM-based chemotherapy could be performed more often for unresectable cholangiocarcinomas. Oshiro Y, Takahashi K, Sasaki R, Kondo T, Sakashita S, Ohkohchi N. Adjuvant surgery for advanced extrahepatic cholangiocarcinoma. World J Gastroenterol 2013; 19(40): Available from: URL: v19/i40/6934.htm DOI: i INTRODUCTION Cholangiocarcinoma continues to exhibit poor survival rates compared with other gastrointestinal malignancies [1-4]. Most cholangiocarcinoma patients are not surgical candidates. Patients with Stage Ⅳ cholangiocarcinoma are currently inoperable and are typically offered systemic chemotherapy. The most promising approaches involve 6934 October 28, 2013 Volume 19 Issue 40

247 Oshiro Y et al. Adjuvant surgery for advanced extrahepatic cholangiocarcinoma the use of single agents such as gemcitabine (GEM), which has been shown to be effective against cholangiocarcinoma in phase Ⅱ trials [5-7]. In these trials, the response rates for GEM ranged from 8% to 36%, and the overall survival (OS) ranged from 6.3 to 16 mo. We describe a rare case of stage Ⅳ cholangiocarcinoma with liver metastases that was initially deemed unresectable and became resectable after GEM chemotherapy and showed a favorable outcome. CASE REPORT The patient was a 72-year-old man referred from a local hospital complaining of jaundice. The laboratory data on admission showed the following elevated values: total bilirubin (T-bil), 6.2 mg/dl (normal range, mg/dl); lactic acid dehydrogenase, 243 U/L ( U/L); alkaline phosphatase 354 U/L ( U/L); and γ-glutamyl transpeptidase, 181 U/L (5-55 U/L). All the tumor markers tested were within the normal limits: carcinoembryonic antigen (CEA), 2.3 ng/ml (normal range, < 5.0 ng/ml), and carbohydrate antigen 19-9, 12.0 U/mL (< 37 U/mL). Abdominal computed tomography (CT) and ultrasonography showed mild dilatation of the common bile duct and bilateral dilation of the intrahepatic bile ducts. Abdominal computed tomography angiography (CTA) detected wall thickening in the distal common bile duct, and the lesion was enhanced by contrast (Figure 1). CT and CTA showed two liver metastases, which measured 8 mm (S6) and 8 mm (S7) in diameter (Figure 2). According to the Union Internationale Contre le Cancer (UICC) guidelines, the patient was diagnosed with lower cholangiocarcinoma (ct2n0m1, Stage Ⅳ) [8]. The patient underwent successful placement of a selfexpandable metal duodenal stent to relieve jaundice. The patient received a total of 18 cycles of GEM. GEM was administered intravenously at a dose of 800 mg/m 2 per day on days 1, 8, and 15 in a 28-d cycle. Adverse events were graded according to the National Cancer Institute Common Toxicity Criteria Grading System (Version 2.0, April 1999) [9]. Severe drug toxicities (grade 3 or 4) were not observed. After 18 cycles of chemotherapy, CT showed that the two liver metastases in S6 and S7 disappeared. The tumor was clinically downstaged to Stage ⅠB (ct2n0m0). Four weeks after the completion of chemotherapy, the operation was successfully performed. Peritoneal lavage cytology demonstrated no cancer cells in the abdominal cavity. No microscopic invasion of the resected bile duct stump was observed in an intraoperative frozen specimen. The patient underwent curative resection consisting of SSPPD with D2 lymphadenectomy without resecting any other organs. Tumor cells were detected in the distal bile duct upon microscopic examination (Figure 3). According to the UICC guidelines, the pathological classification of the tumor was ct2n0m0 Stage ⅠB. The patient was discharged on postoperative day 61 in good condition. Figure 1 Abdominal computed tomography angiography image of the common bile duct. Thickening of the wall of the distal common bile duct, which enhances with contrast, was observed (arrowhead). The patient subsequently received six cycles of adjuvant GEM chemotherapy similar to the preoperative regimen. The patient is alive at 6 years and 9 mo after the diagnosis and 5 years after the surgery. DISCUSSION The prognosis of patients with cholangiocarcinoma is poor, with a five-year survival rate of approximately 25% to 55% [1-4]. To overcome this clinical challenge, several strategies, including adjuvant chemotherapy, adjuvant radiotherapy, and adjuvant chemoradiotherapy have been considered for treating cholangiocarcinoma [10-13]. Few randomized clinical trials have evaluated the utility of adjuvant therapy following R0 resection of cholangiocarcinoma, and most of the current studies are small and retrospective. Therefore, no standard adjuvant modalities have been universally adopted for the treatment of cholangiocarcinoma, and the role of chemotherapy for unresectable cholangiocarcinoma has not been established. Although there has been no standard chemotherapy for cholangiocarcinoma, GEM has been the most actively used agent against cholangiocarcinoma. We treated a patient with advanced extrahepatic cholangiocarcinoma with liver metastases. The patient showed a dramatic response to GEM, which led to curative resection and long-term survival of more than 6 years. GEM may be an effective chemotherapeutic agent for treating cholangiocarcinoma, and a randomized clinical trial needs to be performed. The feasibility of adjuvant surgery for cholangiocarcinoma has not been determined. Recently, in colorectal, gastric, and pancreatic cancer, several authors have reported conversion surgery or adjuvant surgery [14-16]. Suzuki et al [14] demonstrated that adjuvant surgery was effective in 20 advanced gastric cancer patients (Stage Ⅳ) based on liver or distant lymph node metastasis. The overall survival of patients in the partial response and curative resection groups was prolonged. The survival of patients with H or N factor was also prolonged when they received curative surgery. However, the survival of 6935 October 28, 2013 Volume 19 Issue 40

248 Oshiro Y et al. Adjuvant surgery for advanced extrahepatic cholangiocarcinoma A B C D Figure 2 Abdominal computed tomography and computed tomography angiography images at two different levels are shown. A: Computed tomography (CT) showed a low-density mass measuring 8 mm in diameter located in segment 7 of the liver (arrowhead); B: CT showed a low-density mass measuring 8 mm in diameter in segment 6 (arrowhead); C: Computed tomography angiography (CTA) demonstrated an enhancing mass lesion at the same location as in Figure 2A (arrowhead); D: CTA demonstrated an enhancing mass lesion at the same location as in Figure 2B (arrowhead). Figure 3 Histopathologic appearance of the cholangiocarcinoma (hematoxylin and eosin, 200). Tumor cells were detected in the distal bile duct on microscopic examination. patients with P factor was not prolonged. Locally advanced pancreatic cancer may be a good indication for adjuvant surgery after sustained favorable responses to chemotherapy, even in patients with initially unresectable disease [16]. In 2013, Kato et al [17] reported that eight patients with initially unresectable advanced biliary tract cancer who underwent adjuvant surgery had significantly longer survival than 14 patients who were unable to undergo surgery. Of the eight patients in the surgery group, four patients had gallbladder carcinoma and four patients had intrahepatic cholangiocarcinoma. To our knowledge, from 1983 to 2013, in the field of bile duct cancer, only 16 cases in nine reports underwent adjuvant surgery, including the cases in the report [17-25] (Table 1). Of the 16 patients, 10 patients received GEM, 3 received S-1, 2 received GEM and S-1, 1 received GEM combined with cisplatin and fluorouracil, and 1 received cisplatin/interferon α-2b/doxorubicin/fluorouracil-combination chemotherapy. None of the 16 cases involved extrahepatic cholangiocarcinoma. To the best of our knowledge, this is the first report of adjuvant surgery for extrahepatic cholangiocarcinoma. Medical oncologists and surgeons have identified surgical candidates among patients with initially unresectable colorectal and gastric cancer who responded favorably to multimodal treatment [14,15]. In some cases, the addition of surgery resulted in increased long-term survival. Surgical resection coupled with multimodal treatment is called adjuvant surgery. Surgical resection can be classified as curative (no evidence of remaining disease after surgery) or palliative (remaining disease after surgery). Therefore, adjuvant surgery aims to be curative and not palliative after the response to chemotherapy [14]. In a strategy involving adjuvant surgery, adjuvant chemotherapy is considered necessary after the operation. In our patient, the liver metastases showed a surprising complete response without severe toxicity after GEM chemotherapy. Additionally, the patient received adjuvant chemotherapy using GEM as an outpatient and developed no adverse reactions. In previous phase Ⅱ studies using single-agent GEM, major adverse reactions included 6936 October 28, 2013 Volume 19 Issue 40

249 Oshiro Y et al. Adjuvant surgery for advanced extrahepatic cholangiocarcinoma Table 1 Cases of advanced bile duct cancer treated with adjuvant surgery following effective chemotherapy Ref. Diagnosis Metastasis/invasion Chemotherapy regimen Response Slupski et al [18] IntraHepatic cholangiocarcinoma Lung metastases CDDP, 5-FU, IFN, doxorubicin PR Shirabe et al [19] Gallbladder cancer Para-aortic LNs GEM, CDDP, 5-FU PR Kitajima et al [20] Gallbladder cancer Dissemination S-1 CR Morimoto et al [21] Gallbladder cancer Liver metastasis GEM CR Kanaji et al [22] IntraHepatic cholangiocarcinoma Dissemination S-1 CR Kim et al [23] IntraHepatic cholangiocarcinoma Portal vein invasion GEM PR Ohno et al [24] Ampulla of vater cancer Liver metastasis GEM, S-1 CR Hasegawa et al [25] Gallbladder cancer Hepatic invasion S-1, para-aortic LN PR Kato et al [17] Intrahepatic cholangiocarcinoma Hepatic vein invasion GEM SD Intrahepatic cholangiocarcinoma Hepatic vein invasion GEM PR Intrahepatic cholangiocarcinoma Arterial invasion GEM SD Intrahepatic cholangiocarcinoma Insufficient remnant liver volume GEM PR Gallbladder cancer Arterial invasion GEM SD Gallbladder cancer Arterial invasion GEM PR Gallbladder cancer Arterial invasion portal vein invasion GEM SD Gallbladder cancer Arterial invasion GEM SD CDDP: Cisplatin; 5-FU: Fluorouracil; IFN: Interferon; PR: Partial response; CR: Complete response; GEM: Gemcitabine; LN: Lymph node; SD: Stable disease. Cholangiocarcinoma: thirty-one-year experience with 564 patients at a single institution. Ann Surg 2007; 245: [PMID: DOI: /01.sla d3] 3 Sasaki R, Takahashi M, Funato O, Nitta H, Murakami M, Kawamura H, Suto T, Kanno S, Saito K. Prognostic significance of lymph node involvement in middle and distal bile duct cancer. Surgery 2001; 129: [PMID: DOI: /msy ] 4 Oshiro Y, Sasaki R, Kobayashi A, Murata S, Fukunaga K, Kondo T, Oda T, Ohkohchi N. Prognostic relevance of the lymph node ratio in surgical patients with extrahepatic cholangiocarcinoma. Eur J Surg Oncol 2011; 37: [PMID: DOI: /j.ejso ] 5 Penz M, Kornek GV, Raderer M, Ulrich-Pur H, Fiebiger W, Lenauer A, Depisch D, Krauss G, Schneeweiss B, Scheithauer W. Phase II trial of two-weekly gemcitabine in patients with advanced biliary tract cancer. Ann Oncol 2001; 12: [PMID: ] 6 Tsavaris N, Kosmas C, Gouveris P, Gennatas K, Polyzos A, Mouratidou D, Tsipras H, Margaris H, Papastratis G, Tzima E, Papadoniou N, Karatzas G, Papalambros E. Weekly gemcitabine for the treatment of biliary tract and gallbladder cancer. Invest New Drugs 2004; 22: [PMID: DOI: /B: DRUG ] 7 Okusaka T, Ishii H, Funakoshi A, Yamao K, Ohkawa S, Saito S, Saito H, Tsuyuguchi T. Phase II study of single-agent gemcitabine in patients with advanced biliary tract cancer. Cancer Chemother Pharmacol 2006; 57: [PMID: DOI: /s ] 8 Union Internationale Contre le Cancer. TNM classification of malignant tumours. 7th ed. New York, NY: Wiley-Liss, National Institute of Health. NCI: Common Toxicity Criteria, Version 2.0. Available from: URL: gov/reporting/ctc.html 10 Gerhards MF, van Gulik TM, González González D, Rauws EA, Gouma DJ. Results of postoperative radiotherapy for resectable hilar cholangiocarcinoma. World J Surg 2003; 27: [PMID: DOI: /s ] 11 Todoroki T, Ohara K, Kawamoto T, Koike N, Yoshida S, Kashiwagi H, Otsuka M, Fukao K. Benefits of adjuvant radiotherapy after radical resection of locally advanced main hepatic duct carcinoma. Int J Radiat Oncol Biol Phys 2000; 46: [PMID: DOI: / S (99) ] 12 Kelley ST, Bloomston M, Serafini F, Carey LC, Karl RC, Zervos E, Goldin S, Rosemurgy P, Rosemurgy AS. Cholangiocarneutropenia, leukopenia, and anemia were observed with little severe toxicity [5-7]. The results suggests that GEM is suitable for outpatients because of its mild toxicity. The UK ABC-02 study defined the standard of care for unresectable advanced biliary tract cancer [26]. Valle et al [26] reported that cisplatin with GEM (GEMC) was associated with a significant survival advantage compared with GEM alone. The median OS was 11.7 mo for GEMC and 8.1 mo for GEM alone [26]. A Japanese trial of 83 patients using the same treatment regimens as UK ABC-02 showed the median survival and overall response rate of GEMC vs GEM alone were 11.2 mo vs 7.7 mo and 19.5% vs 11.9%, respectively. These results were consistent with the results of the UK ABC-02 study. GEMC was found to be effective and well tolerated, which indicates that it could also be a standard regimen for Japanese patients [27]. In conclusion, in a patient with advanced extrahepatic cholangiocarcinoma, GEM induced a dramatic reduction of the tumor, which led to curative resection. The patient was still living 6 years and 9 mo after the study. The results suggest possible advantages of using GEM for the treatment of advanced cholangiocarcinoma. GEM-based chemotherapy could be more commonly administered for unresectable cholangiocarcinoma. Furthermore, adjuvant surgery (i.e., R0 resection) may significantly contribute to curing cholangiocarcinoma. An evidence-based consensus should be developed on potentially resectable cholangiocarcinoma with liver metastases in each hospital. REFERENCES 1 Nagorney DM, Donohue JH, Farnell MB, Schleck CD, Ilstrup DM. Outcomes after curative resections of cholangiocarcinoma. Arch Surg 1993; 128: ; discussion [PMID: ] 2 DeOliveira ML, Cunningham SC, Cameron JL, Kamangar F, Winter JM, Lillemoe KD, Choti MA, Yeo CJ, Schulick RD October 28, 2013 Volume 19 Issue 40

250 Oshiro Y et al. Adjuvant surgery for advanced extrahepatic cholangiocarcinoma cinoma: advocate an aggressive operative approach with adjuvant chemotherapy. Am Surg 2004; 70: ; discussion [PMID: ] 13 McMasters KM, Tuttle TM, Leach SD, Rich T, Cleary KR, Evans DB, Curley SA. Neoadjuvant chemoradiation for extrahepatic cholangiocarcinoma. Am J Surg 1997; 174: ; discussion [PMID: DOI: / S (97) ] 14 Suzuki T, Tanabe K, Taomoto J, Yamamoto H, Tokumoto N, Yoshida K, Ohdan H. Preliminary trial of adjuvant surgery for advanced gastric cancer. Oncol Lett 2010; 1: [PMID: ] 15 Power DG, Kemeny NE. Chemotherapy for the conversion of unresectable colorectal cancer liver metastases to resection. Crit Rev Oncol Hematol 2011; 79: [PMID: DOI: /j.critrevonc ] 16 Kato K, Kondo S, Hirano S, Tanaka E, Shichinohe T, Tsuchikawa T, Matsumoto J. Adjuvant surgical therapy for patients with initially-unresectable pancreatic cancer with long-term favorable responses to chemotherapy. J Hepatobiliary Pancreat Sci 2011; 18: [PMID: DOI: / s ] 17 Kato A, Shimizu H, Ohtsuka M, Yoshidome H, Yoshitomi H, Furukawa K, Takeuchi D, Takayashiki T, Kimura F, Miyazaki M. Surgical resection after downsizing chemotherapy for initially unresectable locally advanced biliary tract cancer: a retrospective single-center study. Ann Surg Oncol 2013; 20: [PMID: DOI: /s ] 18 Slupski MW, Szczylik C, Jasinski MK. Unexpected response to systemic chemotherapy in case of primarily nonresectable advanced disseminated intrahepatic cholangiocarcinoma. World J Surg Oncol 2007; 5: 36 [PMID: DOI: / ] 19 Shirabe K, Tomoyuki Abe Kiyoshi Kajiyama, Kazuya Akahoshi. [The Survival Impact of Chemotherapy in the Patients with Gall Bladder Cancer-A pilot study]. J Jpn Biliary Association 2008; 22: Kitajima K, Kobayashi S, Shiba H, Uwagawa T, Ishida Y, Aiba K, Kawakami M, Yanaga K. Successful treatment of advanced gallbladder cancer with an anticancer drug S-1: assessment based on intratumoral gene. Int J Clin Oncol 2008; 13: [PMID: DOI: /s z] 21 Morimoto H, Ajiki T, Takase S, Fujita T, Matsumoto T, Mita Y, Matsumoto I, Fujino Y, Suzuki Y, Kuroda Y, Ku Y. Resection of gallbladder cancer with hepatic metastasis after chemotherapy with gemcitabine. J Hepatobiliary Pancreat Surg 2008; 15: [PMID: DOI: /s ] 22 Kanaji S, Kobayashi I, Fujita T, Ueno K, Tsuchida S, Kawasaki K, Ohno M, Osawa M, Fujino Y, Tominaga M, Nakamura T. [A case of curatively resected biliary tract cancer with peritoneal dissemination through effective response to chemotherapy of S-1]. Gan To Kagaku Ryoho 2009; 36: [PMID: ] 23 Kim SH, Kim IH, Kim SW, Lee SO. Repetitive response to gemcitabine that led to curative resection in cholangiocarcinoma. World J Gastroenterol 2009; 15: [PMID: DOI: /wjg ] 24 Ohno T, Koguchi H, Miura A, Tanaka Y, Endo M, Matsunaga S, Hasegawa I, Kato A, Tokuda Y, Sakakibara K. [A case of advanced ampullary carcinoma successfully resected after primary chemotherapy with s-1 and gemcitabine]. Gan To Kagaku Ryoho 2009; 36: [PMID: ] 25 Hasegawa N, Abei M, Sasaki R, Pak S, Moriwaki T, Minami Y, Fukuda K, Hirai S, Shoda J, Ohkouchi N, Hyodo I. [A case with Stage IVb advanced gallbladder cancer curatively resected following effective S-1 chemotherapy]. J Jpn Biliary Association 2010; 24: Valle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, Madhusudan S, Iveson T, Hughes S, Pereira SP, Roughton M, Bridgewater J. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med 2010; 362: [PMID: DOI: /NEJ- Moa ] 27 Okusaka T, Nakachi K, Fukutomi A, Mizuno N, Ohkawa S, Funakoshi A, Nagino M, Kondo S, Nagaoka S, Funai J, Koshiji M, Nambu Y, Furuse J, Miyazaki M, Nimura Y. Gemcitabine alone or in combination with cisplatin in patients with biliary tract cancer: a comparative multicentre study in Japan. Br J Cancer 2010; 103: [PMID: DOI: /sj.bjc ] P- Reviewer Erichsen R S- Editor Song XX L- Editor A E- Editor Zhang DN 6938 October 28, 2013 Volume 19 Issue 40

251 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. CASE REPORT Isolated gastric variceal bleeding caused by splenic lymphoma-associated splenic vein occlusion Bao-Chung Chen, Hong-Hau Wang, Yu-Chieh Lin, Yu-Lueng Shih, Wei-Kuo Chang, Tsai-Yuan Hsieh Bao-Chung Chen, Yu-Lueng Shih, Wei-Kuo Chang, Tsai- Yuan Hsieh, Division of Gastroenterology, Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan Hong-Hau Wang, Department of Radiology, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan Yu-Chieh Lin, Department of Pathology, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan Author contributions: Chen BC designed the report; Hsieh TY was the attending physician for the patient; Shih YL performed the ultrasound-guided aspiration biopsy; Lin YC performed the pathological examinations; Wang HH performed the imaging diagnosis; Chang WK assisted with editing and proof-reading; Hsieh TY organized the report; and Chen BC wrote the paper. Correspondence to: Tsai-Yuan Hsieh, MD, PhD, Division of Gastroenterology, Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, No.325, Sec. 2, Chenggong Rd., Neihu Dist., Taipei 114, Taiwan. tyh8121@gmail.com Telephone: Fax: Received: May 27, 2013 Revised: August 12, 2013 Accepted: August 16, 2013 Published online: October 28, 2013 Abstract Isolated gastric varices (IGV) can occur in patients with left-sided portal hypertension resulting from splenic vein occlusion caused by thrombosis or stenosis. In left-sided portal hypertension, blood flows retrogradely through the short and posterior gastric veins and the gastroepiploic veins, leading to the formation of an IGV. The most common causes of splenic vein occlusion are pancreatic diseases, such as pancreatic cancer, pancreatitis, or a pseudocyst. However, various other cancers, such as colon, gastric, or renal cancers, have also been known to cause splenic vein occlusion. Our patient presented with a rare case of IGV bleeding induced by splenic lymphoma-associated splenic vein occlusion. Splenectomy, splenic artery embolization, and stenting of the splenic vein are the current treatment choices. Chemotherapy, however, is an alternative effective treatment for splenic vein occlusion caused by chemotherapy-sensitive tumors. Our patient responded well to chemotherapy with a cyclophosphamide, hydroxydaunorubicin, oncovin, and prednisolone regimen, and the splenic vein occlusion resolved after the lymphoma regressed Baishideng. All rights reserved. Key words: Isolated gastric varices; Splenic vein; Lymphoma; Occlusion; Hematemesis Core tip: Isolated gastric varices occur in patients with splenic vein occlusion caused by thrombosis, stenosis, or cancer, such as pancreatic, colon, gastric, or renal cancers. Here, we describe a rare case of an isolated gastric varices in an elderly woman who presented with tarry stool and bloody vomitus. The diagnostic tests revealed a splenic B-cell lymphoma, which caused splenic vein occlusion that resulted in isolated gastric variceal bleeding. Splenectomy, splenic artery embolization, and stenting of the splenic vein are the current treatment choices. In this patient, chemotherapy was an alternative treatment, and the splenic vein occlusion resolved after the lymphoma regressed. Chen BC, Wang HH, Lin YC, Shih YL, Chang WK, Hsieh TY. Isolated gastric variceal bleeding caused by splenic lymphomaassociated splenic vein occlusion. World J Gastroenterol 2013; 19(40): Available from: URL: com/ /full/v19/i40/6939.htm DOI: org/ /wjg.v19.i INTRODUCTION Hematemesis is a medical emergency, and in most cases, it is caused by esophageal varices or peptic ulcers. However, there are other rare, but important and treatable causes of hematemesis, such as isolated gastric vari October 28, 2013 Volume 19 Issue 40

252 Chen BC et al. IGV bleeding caused by splenic lymphoma-associated SVO ces. We report one such case and review the literature, focusing on the unusual entities presenting as isolated gastric variceal bleeding. CASE REPORT A 77-year-old woman was admitted to our hospital due to two episodes of bloody vomitus and three episodes of tarry stool. She did not have a significant medical or surgical history or any known allergies, nor was she taking any medication. The physical examination revealed pale conjunctiva without any jaundice, lymphadenopathy, or pedal edema. An abdominal palpation demonstrated an enlarged spleen, palpable below the left costal margin, and a digital rectal examination showed melena. The remainder of the patient s systemic examination results was unremarkable. The blood pressure was 97/55 mmhg, the pulse rate was 96/min, the hemoglobin level was 8.9 g/dl, the platelet count was /μL, and the stool occult blood test was positive. The patient s biochemistry tests, including those for liver and renal function, were within the normal limits, apart from a high serum lactate dehydrogenase level (1112 U/L). Esophagogastroduodenoscopy demonstrated an isolated gastric varices (IGV) at the cardia and high body of the stomach, with active bleeding (Figure 1); thus, sclerotherapy with cyanoacrylate was successfully performed. Abdominal computed tomography (CT) showed a large mass in the enlarged spleen, with near total occlusion of the splenic vein (Figure 2A). This splenic vein occlusion led to the development of a gastric varices at the fundus (Figure 2B), and the portal and superior mesenteric veins were patent. The laboratory findings indicated the patient s carcinoembryonic antigen and carbohydrate antigen 19-9 levels were normal. The patient underwent ultrasound-guided aspiration biopsy, and histopathology confirmed a high-grade B-cell lymphoma (Figure 3). Thereafter, the patient received chemotherapy with a cyclophosphamide, hydroxydaunorubicin, oncovin, and prednisolone (CHOP) regimen, and the splenic vein occlusion resolved after the lymphoma regressed (Figure 2C). DISCUSSION IGVs are observed in up to 5% of patients with cirrhosis and in up to 10% of patients with non-cirrhotic portal hypertension [1]. Such varices can occur in patients with segmental or left-sided portal hypertension (LSPH), and the incidence has increased over the past three decades because of increased awareness of the entity and advances in diagnostic approaches [2,3]. When a segment of the portal venous bed is obstructed, varices can develop in the area to decompress the blocked segment. In cases of segmental portal hypertension, the blood drains in a retrograde manner through the short and posterior gastric veins and the gastroepiploic veins. This process results in blood flow and a pressure increase, which causes dilation Figure 1 Engorged varices at the cardia and high body of the stomach, with active bleeding. of the submucosal structures, leading to the formation of a gastric varice [4]. LSPH primarily occurs as a result of splenic vein obstruction, most commonly resulting from pancreatic disorders [5]. Because the splenic vein is posterior to the pancreas and in direct contact with it, any type of pancreatic disease, including cancer, pancreatitis, abscess formation, or a pseudocyst, can affect the splenic vein [6-8]. In a study by Moosa et al, pancreatitis, diagnosed by either biopsy or surgery, was part of the LSPH etiology in 87 (60%) of 144 cases, while pancreatic malignancy was detected in only 13 (9%) patients [9,10]. Various disorders other than pancreatic diseases, such as partial gastrectomy, metastatic carcinoma, retroperitoneal fibrosis, or protein S deficiency, have a wide spectrum of mechanisms involved in causing splenic vein occlusion [5,11-13]. Among the metastatic carcinomas, oat cell carcinoma [14], colon cancer [5], gastric cancer [5], renal cancer [12], and rare retroperitoneal liposarcoma [9] have been reported to cause splenic vein occlusion. Primary pancreatic lymphoma, with splenic vein thrombosis and IGV bleeding, has been reported as well [15]. Our patient had a rare case of splenic B-cell lymphoma that caused splenic vein occlusion and IGV bleeding. In general, IGVs are asymptomatic and identified incidentally. In symptomatic cases, the most common clinical manifestation is gastrointestinal bleeding from ruptured gastric varices; statistically, 45%-72% of patients with LSPH present with the above-mentioned symptom [3]. Splenomegaly and abdominal pain are observed in 71% and 25%-38% of patients with LSPH, respectively [5,9], whereas ascites seldom develop [16]. Various radiological examinations can assist in making an IGV diagnosis, including upper gastrointestinal endoscopy, angiography, ultrasonography, contrast-enhanced CT portography, and magnetic resonance imaging. In one study, gastric varices could be accurately diagnosed and localized in nearly 90% of cases by endoscopy [17]. Endoscopic ultrasound (EUS) appears to be a more accurate test than transabdominal ultrasonography, which is useful for evaluating the pancreatic parenchyma and splenic vasculature [18]. Contrast-enhanced CT portography can 6940 October 28, 2013 Volume 19 Issue 40

253 Chen BC et al. IGV bleeding caused by splenic lymphoma-associated SVO A A B B C Figure 3 Pathologic findings (hematoxylin/eosin staining) and immunohistochemical staining. A: The predominant fibrous tissue with necrotic foci and scattered atypical cells characterized by pleomorphic and hyperchromatic nuclei with discohesive arrangement. B: The B-lymphocyte marker (CD20) was strongly positive in the atypical cells. Figure 2 Imaging findings. A: Axial contrast-enhanced abdominal computed tomography (CT) at the level of the splenic hilum shows a large low-attenuation mass in the enlarged spleen. The mass involves the splenic vein with near total occlusion (arrow); B: The development of a gastric varice (arrowhead) at the fundus; C: The 6-mo follow-up CT shows that the splenic mass has almost completely resolved, allowing the splenic vein (arrow) to return to patency. quickly elucidate the portal venous system, but it requires a large amount of iodinated contrast material. Magnetic resonance angiography with gadopentetate dimeglumine is a promising noninvasive test that is being increasingly used to diagnosis patency or thrombosis of the portal venous system [19]. The treatment of IGV bleeding should be directed toward the splenic side of the portal circulation because the pressure increases only on that side [14]. Several choices such as conservative therapy (e.g., pharmacotherapy, balloon tamponade, endoscopic therapy with sclerotherapy or band ligation) and interventional radiologic techniques, are available for bleeding control. Japanese endoscopists have reported using a combination technique of endoscopic variceal ligation injection sclerotherapy to treat acute gastric varice bleeding; when using this procedure, the rebleeding rate was low (0%-8%), the gastric varice eradication rate was 85% at up to 2 years post-treatment, and hemostasis was achieved in 100% of patients [20]. Transcatheter splenic artery embolization has also been attempted with varying degrees of success, but it has not become a preferred approach. If a patient with active bleeding is unresponsive to conservative management, then splenectomy is indicated. A large splenectomy series that included patients with isolated splenic vein thrombosis showed that none of the patients had recurrent bleeding during the 11-mo mean follow-up period after splenectomy [9]. The current case was a rare incidence of IGV bleeding induced by splenic lymphoma-associated splenic vein occlusion. In this patient, chemotherapy was an alternative treatment for splenic vein occlusion caused by chemotherapy-sensitive tumors. Our patient responded well to chemotherapy, and the splenic vein occlusion resolved after the lymphoma regressed. REFERENCES 1 Sarin SK, Jain AK, Lamba GS, Gupta R, Chowdhary A. Isolated gastric varices: prevalence, clinical relevance and natural history. Dig Surg 2003; 20: [PMID: DOI: / ] 2 Ryan BM, Stockbrugger RW, Ryan JM. A pathophysiologic, gastroenterologic, and radiologic approach to the manage October 28, 2013 Volume 19 Issue 40

254 Chen BC et al. IGV bleeding caused by splenic lymphoma-associated SVO ment of gastric varices. Gastroenterology 2004; 126: [PMID: DOI: /j.gastro ] 3 Köklü S, Coban S, Yüksel O, Arhan M. Left-sided portal hypertension. Dig Dis Sci 2007; 52: [PMID: DOI: /s x] 4 Madsen MS, Petersen TH, Sommer H. Segmental portal hypertension. Ann Surg 1986; 204: [PMID: DOI: / ] 5 Köklü S, Yüksel O, Arhan M, Coban S, Başar O, Yolcu OF, Uçar E, Ibiş M, Ertugrul I, Sahin B. Report of 24 left-sided portal hypertension cases: a single-center prospective cohort study. Dig Dis Sci 2005; 50: [PMID: DOI: /s x] 6 Little AG, Moossa AR. Gastrointestinal hemorrhage from left-sided portal hypertension. An unappreciated complication of pancreatitis. Am J Surg 1981; 141: [PMID: DOI: / (81) ] 7 Manenti A. Splenic vein obstruction secondary to pancreatic carcinoma. Acta Chir Belg 1981; 80: [PMID: ] 8 Keith RG, Mustard RA, Saibil EA. Gastric variceal bleeding due to occlusion of splenic vein in pancreatic disease. Can J Surg 1982; 25: [PMID: ] 9 Moossa AR, Gadd MA. Isolated splenic vein thrombosis. World J Surg 1985; 9: [PMID: DOI: / BF ] 10 Ismail FW, Mumtaz K, Chawla T, Jafri W. Gastric variceal bleed in a patient without liver cirrhosis: an unusual cause of haematemesis. Singapore Med J 2007; 48: e171-e173 [PMID: ] 11 Honda Y, Ueda M, Kyoi M, Mizunuma T, Takeda R. An unusual case of portasystemic encephalopathy caused by splenic vein occlusion following gastrectomy. Am J Gastroenterol 1978; 69: [PMID: ] 12 Koehler RE. Case: splenic vein obstruction due to metastatic hypernephroma. Gastrointest Radiol 1981; 6: [PMID: ] 13 Lavender S, Lloyd-Davies RW, Thomas ML. Retroperitoneal fibrosis causing localized portal hypertension. Br Med J 1970; 3: [PMID: DOI: /bmj ] 14 Evans GR, Yellin AE, Weaver FA, Stain SC. Sinistral (leftsided) portal hypertension. Am Surg 1990; 56: [PMID: ] 15 Vida Pérez L, González Galilea A, Fraga Rivas E. [Bleeding from gastric varices as the initial manifestation of primary pancreatic lymphoma]. Gastroenterol Hepatol 2010; 33: [PMID: DOI: /j.gastrohep ] 16 Witte CL, Chung YC, Witte MH, Sterile OF, Cole WR. Observations on the origin of ascites from experimental extrahepatic portal congestion. Ann Surg 1969; 170: [PMID: DOI: / ] 17 Mathur SK, Dalvi AN, Someshwar V, Supe AN, Ramakantan R. Endoscopic and radiological appraisal of gastric varices. Br J Surg 1990; 77: [PMID: DOI: / bjs ] 18 Lewis JD, Faigel DO, Morris JB, Siegelman ES, Kochman ML. Splenic vein thrombosis secondary to focal pancreatitis diagnosed by endoscopic ultrasonography. J Clin Gastroenterol 1998; 26: [PMID: DOI: / ] 19 Erden A, Erden I, Yağmurlu B, Karayalçin S, Yurdaydin C, Karayalçin K. Portal venous system: evaluation with contrastenhanced 3D MR portography. Clin Imaging 2003; 27: [PMID: DOI: /S (02) ] 20 Yoshida H, Onda M, Tajiri T, Mamada Y, Taniai N, Mineta S, Yoshioka M, Hirakata A, Yamashita K. New techniques: combined endoscopic injection sclerotherapy and ligation for acute bleeding from gastric varices. Hepatogastroenterology 2002; 49: [PMID: ] P- Reviewers Chen CY, Garcia-Roca R, Samarasam I S- Editor Qi Y L- Editor A E- Editor Zhang DN 6942 October 28, 2013 Volume 19 Issue 40

255 Online Submissions: doi: /wjg.v19.i World J Gastroenterol 2013 October 28; 19(40): ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. CASE REPORT Laparoscopic treatment of an upper gastrointestinal obstruction due to Bouveret s syndrome Dong Yang, Zhen Wang, Zhi-Jun Duan, Shi Jin Dong Yang, Zhi-Jun Duan, Department of Digestion, The First Affiliated Hospital of Dalian Medical University, Dalian , Liaoning Province, China Zhen Wang, Department of Clinical Laboratory, The First Affiliated Hospital of Dalian Medical University, Dalian , Liaoning Province, China Shi Jin, Department of Laparoscopic Surgery, The First Affiliated Hospital of Dalian Medical University, Dalian , Liaoning Province, China Author contributions: Yang D and Wang Z contributed equally to this work; Yang D, Wang Z and Duan ZJ designed the report; Yang D and Duan ZJ served as attending doctors for the patient; Jin S performed the laparoscopic treatments; Yang D and Wang Z organized and wrote the paper. Correspondence to: Zhi-Jun Duan, MD, Department of Digestion, The First Affiliated Hospital of Dalian Medical University, 222 Zhongshan Road, Dalian , Liaoning Province, China. cathydoctor@yahoo.com Telephone: Fax: Received: July 24, 2013 Revised: August 31, 2013 Accepted: September 15, 2013 Published online: October 28, 2013 Abstract Bouveret s syndrome is an extremely rare type of gallstone-induced ileus with atypical clinical manifestations, such as abdominal distension and pain, nausea and vomiting, fever or even gastrointestinal bleeding, which may easily be misdiagnosed. In the present case, a 55-year-old male was admitted to the hospital with upper gastrointestinal obstructive symptoms but without pain, fever, jaundice or melena. At first, gastrolithiasis and peptic ulcer combined with pyloric obstruction were suspected after gastroscopy revealed a large, hard stone in the duodenal bulb. A revised diagnosis of Bouveret s syndrome was made following abdominal computed tomography. Subsequently, the patient exhibited a good postoperative recovery after laparoscopic duodenotomy for gallstone removal and subtotal cholecystectomy. The condition of the patient remained stable after being followed up for 6 mo. The successful application of laparoscopic therapy to treat Bouveret s syndrome has seldom been reported. Laparoscopic enterolithotomy is safe and effective, with good patient tolerability, rapid postoperative recovery and few wound-related complications. The laparoscopic treatment of Bouveret s syndrome is worth exploring Baishideng. All rights reserved. Key words: Bouveret s syndrome; Gallstone; Gastric outlet obstruction; Laparoscopic therapy; Cholecystoenteric fistula Core tip: Bouveret s syndrome is a rare cause of gastric outflow obstruction and is easily misdiagnosed. In this case, the patient was middle-aged and did not present any chronic systemic disease. The clinical symptoms were atypical, with neither infection nor abdominal pain. The onset suggested peptic ulcer and pyloric obstruction, which was initially suspected as gastrolithiasis. An imaging study from a year prior provided important data regarding the evolution and diagnosis of the disease. The successful application of laparoscopic therapy to treat Bouveret s syndrome has seldom been reported. This patient obtained satisfactory results after laparoscopic duodenotomy for gallstone removal and subtotal cholecystectomy. Yang D, Wang Z, Duan ZJ, Jin S. Laparoscopic treatment of an upper gastrointestinal obstruction due to Bouveret s syndrome. World J Gastroenterol 2013; 19(40): Available from: URL: DOI: INTRODUCTION Bouveret s syndrome is a rare complication of choleli October 28, 2013 Volume 19 Issue 40

256 Yang D et al. A case of Bouveret s syndrome thiasis that was first reported and named by Bouveret in 1896; this condition comprises a series of syndromes caused by a gastric outflow obstruction due to the migration of gallstones to the pylorus and duodenum via a gallbladder-duodenal fistula [1]. We have only rarely encountered this condition in clinical work, and few cases have been reported in the literature. The most common site of gallstone-induced ileus is the terminal ileum, followed by the proximal ileum and jejunum; only 1%-3% of cases occur in the duodenum, and an obstruction caused by incarcerated stones in the pylorus and duodenal bulb is the rarest form encountered in the clinical setting [2]. Gallstone-induced ileus is 3 to 16 times more common in females than in males, and Bouveret s syndrome predominately affects older women [3]. Because it often presents in the elderly and with multiple comorbidities, it is associated with a high rate of mortality. The first treatment choice for this syndrome remains debatable. A B CASE REPORT Figure 1 Abdominal computed tomography. A: Revealing a large calcified mass in the gallbladder (one year prior); B: Indicating the migration of the large stone from the gallbladder to the pylorus and gas shadows seen in the gallbladder (this time). A 55-year-old male was admitted to the hospital with a 2-wk history of upper abdominal distension and vomiting. Nausea and vomiting frequently occurred 4-5 h after a meal. Undigested food was sometimes present in the vomitus. Pain, fever, jaundice and melena were not reported by the patient. Several assays were performed in the outpatient department; the results of the blood analysis, urine analysis, amylase test and lipase test were normal. The patient had experienced a duodenal ulcer 20 years prior. There was a history of acute epigastric pain due to acute cholecystitis and gallbladder stone during the previous year. The pain was relieved by anti-inflammation treatment, and no surgery was performed. Physical examination revealed mild tenderness in the epigastric area. Succession splash and Murphy s sign were negative. Bowel sounds were normal. Gastroscopy was arranged for the following day and indicated that chyme could be observed in the gastric antrum and duodenal bulb. A large yellowish-brown hard stone was observed in the duodenal bulb, and a 1.2-cm-wide ulcer was located on the greater curvature side of the bulb. The diagnosis of gastric retention, gastrolithiasis and duodenal bulb ulcer was considered based on the medical history and gastroscopy results. The symptoms, including abdominal distension, nausea and vomiting, were quickly alleviated following a therapy of liquid diet, antacid, gastric mucosa protectant and supportive treatment and litholytic therapy with oral sodium bicarbonate solution. However, on the third day after admission, computed tomography (CT) of the abdomen revealed a thick gallbladder wall and the presence of gas shadows in the gallbladder. The choledoch was slightly wider, and the walls of the gallbladder and the pylorus were indistinct from each other. Additionally, a calcified mass of approximately 2 cm in diameter was observed in the pylorus. A comparison to the CT scan from one year prior (Figure 1A) revealed an inflammatory perforation of the gallbladder and pylorus, the presence of an internal fistula and the migration of the gallstone from the gallbladder to the pylorus (Figure 1B). The upper gastrointestinal contrast also revealed a large round filling defect with a smooth border in the descending part of duodenum. Therefore, a revised diagnosis of Bouveret s syndrome was made. The patient was transferred to the laparoscopic ward and underwent duodenotomy for gallstone removal, duodenal fistulation and subtotal cholecystectomy using a laparoscope. During the operation, multiple adhesions among the gallbladder, duodenal bulb and omentum were observed. After the adhesions were released, the gallbladderduodenal fistula could be seen. A large stone with a diameter of approximately 3.0 cm 4.0 cm was located below the fistula-duodenal opening. After making an incision in the gallbladder wall, it was observed that the cystic duct and sinus crossings had closed. Subsequently, duodenum incision, stone removal, placement of a drainage tube into the duodenum incision and interrupted suture were performed to close the duodenum. A subtotal cholecystectomy was also performed simultaneously. After postoperative hemostatic and anti-inflammatory treatment, the patient was discharged. Three weeks later, the patient was readmitted to remove the duodenal drainage tube. On the next day after the removal, fever and abdominal pain were observed. However, an abdominal CT revealed no obvious abnormalities. After a 5-d controlled diet and anti-inflammatory treatment, the patient recovered and was discharged without further incident October 28, 2013 Volume 19 Issue 40

257 Yang D et al. A case of Bouveret s syndrome DISCUSSION A gastric outlet obstruction caused by the migration of large gallstones to the pylorus and duodenum via a gallbladder-duodenal fistula, Bouveret s syndrome, is a special type of gallstone-induced ileus that comprises only 1%-3% of cases [2,4]. This syndrome is extremely rare and appears predominately in older women, at an average age of 74.1 years [2]. Most of these patients experience complications, such as hypertension, diabetes, chronic obstructive pulmonary disease or other systemic diseases. Bouveret s syndrome presents with the common symptoms of abdominal distension; abdominal pain; nausea; vomiting; fever; and occasionally gastrointestinal hemorrhage, such as hematemesis or melena [5,6]. Abdominal CT, upper gastrointestinal imaging and endoscopy offer important diagnostic value for diagnosing the disease [7,8]. In this case, the patient was a middle-aged male, rather than a member of the susceptible population, who presented the main manifestations, including abdominal distension, nausea, vomiting undigested food and a past history of duodenal bulb ulcer. As a result, his condition was easily misdiagnosed as duodenal bulb ulcer and pyloric obstruction. After a foreign body was observed in the duodenal bulb through endoscopy, gastrolithiasis was suspected. However, several doubts remained. First, there was no clear predisposition for gastrolith. Second, the foreign body was too large to have passed through the pylorus to arrive at the duodenum. Based on these doubts surrounding the diagnosis, the patient was submitted to further examination during litholytic and acid suppression therapy. The diagnosis was suddenly clearer based on the results of an abdominal CT. Compared with a CT image of the patient taken one year prior, it was apparent that the original large gallstone near the neck of the gallbladder had disappeared, and the gallbladder had shrunk with some gas remaining in it and a gallstone shadow in the pyloric cavity next to the gallbladder. These abdominal CT results suggested that the endoscopic finding was not a gastrolith but rather that the gallstone had penetrated into the duodenal bulb. Consequently, Bouveret s syndrome was diagnosed. Upper gastrointestinal imaging results further supported the diagnosis. The treatment choice for Bouveret s syndrome remains debatable and can include endoscopic treatment, extracorporeal shockwave lithotripsy, intracorporeal electrohydraulic lithotripsy, surgery and laparoscopic treatment [9]. Currently, 1-stage or 2-stage surgery is often adopted [10-12]. One-stage surgery refers to a combination of enterolithotomy plus cholecystectomy and fistula repair within a single surgery. Two-stage surgery entails dividing the enterolithotomy and cholecystectomy into two operations. However, surgery is often associated with significant postoperative complications and mortality [3,13]. With the development of laparoscopic and other minimally invasive techniques, the successful application of laparoscopic treatment as a therapy for Bouveret s syndrome has also been reported [14,15]. In this case, subtotal cholecystectomy, duodenotomy for gallstone removal and duodenal fistulation using a laparoscope were performed, taking into account the large size of the stones, the good general condition of the patient, the closed gallbladder and the duodenum fistula. The patient recovered and was discharged quickly. After the duodenal drainage tube was unplugged, no duodenal fistula was observed, and the condition of the patient remained stable after being followed up for 6 mo. The present case included the following features: (1) The patient was middle-aged, had no chronic systemic disease and did not belong to the usual susceptible population of Bouveret s syndrome; (2) The clinical symptoms were atypical, with neither infection nor abdominal pain. The onset was similar to that of peptic ulcer and pyloric obstruction, which was initially suspected as gastrolithiasis; (3) Imaging data from one year prior provided an important basis to observe the evolution of the disease and make a diagnosis; and (4) Based on the condition of the patient, disposable laparoscopic lithotomy and cholecystectomy were conducted. The effect was satisfactory, and there were no obvious postoperative complications. In conclusion, Bouveret s syndrome is a rare cause of gastric outflow obstruction and is easily misdiagnosed. Therefore, when a patient presents an outbreak of symptoms that are similar to pyloric obstruction with a previous history of gallbladder stones, the clinician should consider Bouveret s syndrome, which can be differentially diagnosed through a combination of endoscopy and abdominal imaging. As laparoscopic technology gradually matures, the advantages of the laparoscopic treatment of this syndrome have been realized in recent years. Laparoscopic enterolithotomy is safe and effective, with good patient tolerability, rapid postoperative recovery and few wound-related complications. REFERENCES 1 Bouveret L. Stenose du pylore adherent a la vesicule. Rev Med (Paris) 1896; 16: Cappell MS, Davis M. Characterization of Bouveret s syndrome: a comprehensive review of 128 cases. Am J Gastroenterol 2006; 101: [PMID: DOI: / j x] 3 Nabais C, Salústio R, Morujão I, Sousa FV, Porto E, Cardoso C, Fradique C. Gastric outlet obstruction in a patient with Bouveret s syndrome: a case report. BMC Res Notes 2013; 6: 195 [PMID: DOI: / ] 4 Langhorst J, Schumacher B, Deselaers T, Neuhaus H. Successful endoscopic therapy of a gastric outlet obstruction due to a gallstone with intracorporeal laser lithotripsy: a case of Bouveret s syndrome. Gastrointest Endosc 2000; 51: [PMID: DOI: /S (00) ] 5 Frattaroli FM, Reggio D, Guadalaxara A, Illomei G, Lomanto D, Pappalardo G. Bouveret s syndrome: case report and review of the literature. Hepatogastroenterology 1997; 44: [PMID: ] 6 Bonfante P, Bianchi C, Magistrelli P, Ansaldo V. A rare case of Bouveret s syndrome presenting with upper gastrointestinal bleeding. Chir Ital 2006; 58: [PMID: ] 7 Tüney D, Cimşit C. Bouveret's syndrome: CT findings. Eur Radiol 2000; 10: [PMID: DOI: / s ] 8 Oikarinen H, Päivänsalo M, Tikkakoski T, Saarela A. Radiological findings in biliary fistula and gallstone ileus. Acta 6945 October 28, 2013 Volume 19 Issue 40

258 Yang D et al. A case of Bouveret s syndrome Radiol 1996; 37: [PMID: DOI: / ] 9 Doycheva I, Limaye A, Suman A, Forsmark CE, Sultan S. Bouveret s syndrome: case report and review of the literature. Gastroenterol Res Pract 2009; 2009: [PMID: DOI: /2009/914951] 10 Rahelić V, Zelić M, Grbas H, Depolo A, Kezele B. Bouveret's syndrome--case report. Zentralbl Chir 2009; 134: [PMID: DOI: /s ] 11 Fancellu A, Niolu P, Scanu AM, Feo CF, Ginesu GC, Barmina ML. A rare variant of gallstone ileus: Bouveret s syndrome. J Gastrointest Surg 2010; 14: [PMID: DOI: /s ] 12 Sharma D, Sood R, Tomar A, Jhobta A, Thakur S, Sood RG. Bouveret s Syndrome: 64-Slice CT Diagnosis and Surgical Management-A Case Report. Case Rep Radiol 2012; 2012: [PMID: DOI: /2012/701216] 13 Gajendran M, Muniraj T, Gelrud A. A challenging case of gastric outlet obstruction (Bouveret s syndrome): a case report. J Med Case Rep 2011; 5: 497 [PMID: DOI: / ] 14 Yau KK, Siu WT, Tsui KK. Migrating gallstone: from Bouveret s syndrome to distal small bowel obstruction. J Laparoendosc Adv Surg Tech A 2006; 16: [PMID: DOI: /lap ] 15 Malvaux P, Degolla R, De Saint-Hubert M, Farchakh E, Hauters P. Laparoscopic treatment of a gastric outlet obstruction caused by a gallstone (Bouveret s syndrome). Surg Endosc 2002; 16: [PMID: DOI: / s ] P- Reviewers Ker CG, Leitman IM, Neri V S- Editor Cui XM L- Editor A E- Editor Zhang DN 6946 October 28, 2013 Volume 19 Issue 40

259 Online Submissions: World J Gastroenterol 2013 October 28; 19(40): I-VI ISSN (print) ISSN (online) 2013 Baishideng. All rights reserved. INSTRUCTIONS TO AUTHORS GENERAL INFORMATION World Journal of Gastroenterology (World J Gastroenterol, WJG, print ISSN , online ISSN , DOI: ) is a peer-reviewed open access (OA) journal. WJG was established on October 1, It is published weekly on the 7 th, 14 th, 21 st, and 28 th each month. The WJG Editorial Board consists of 1352 experts in gastroenterology and hepatology from 64 countries. Aims and scope The primary task of WJG is to rapidly publish high-quality original articles, reviews, and commentaries in the fields of gastroenterology, hepatology, gastrointestinal endoscopy, gastrointestinal surgery, hepatobiliary surgery, gastrointestinal oncology, gastrointestinal radiation oncology, gastrointestinal imaging, gastrointestinal interventional therapy, gastrointestinal infectious diseases, gastrointestinal pharmacology, gastrointestinal pathophysiology, gastrointestinal pathology, evidence-based medicine in gastroenterology, pancreatology, gastrointestinal laboratory medicine, gastrointestinal molecular biology, gastrointestinal immunology, gastrointestinal microbiology, gastrointestinal genetics, gastrointestinal translational medicine, gastrointestinal diagnostics, and gastrointestinal therapeutics. WJG is dedicated to become an influential and prestigious journal in gastroenterology and hepatology, to promote the development of above disciplines, and to improve the diagnostic and therapeutic skill and expertise of clinicians. WJG is published by Baishideng Publishing Group (BPG) in both electronic and online forms. All WJG articles are published in WJG website and PubMed Central. The major advantages of OA journals are faster release and delivery, no page or graph restrictions, and increased visibility, usage and impact. Full-text PDF articles and electronic/online versions are freely available to global readers. After the paper is published, the author(s) can obtain high-quality PDF files, which contain the journal cover, a list of editorial board members, table of contents, text, and back cover of the journal. BPG has a strong professional editorial team composed of editorial board members, editors-in-chief, science editors, language editors, and electronic editors. BPG currently publishes 42 OA clinical medical journals, including 41 in English, has a total of editorial board members or peer reviewers, and is a world first-class publisher. Columns The columns in the issues of WJG will include: (1) Editorial: The editorial board members are invited to make comments on an important topic in their field in terms of its current research status and future directions to lead the development of this discipline; (2) Frontier: The editorial board members are invited to select a highly cited cutting-edge original paper of his/her own to summarize major findings, the problems that have been resolved and remain to be resolved, and future research directions to help readers understand his/her important academic point of view and future research directions in the field; (3) Diagnostic Advances: The editorial board members are invited to write high-quality diagnostic advances in their field to improve the diagnostic skills of readers. The topic covers general clinical diagnosis, differential diagnosis, pathological diagnosis, laboratory diagnosis, imaging diagnosis, endoscopic diagnosis, biotechnological diagnosis, functional diagnosis, and physical diagnosis; (4) Therapeutics Advances: The editorial board members are invited to write high-quality therapeutic advances in their field to help improve the therapeutic skills of readers. The topic covers medication therapy, psychotherapy, physical therapy, replacement therapy, interventional therapy, minimally invasive therapy, endoscopic therapy, transplantation therapy, and surgical therapy; (5) Field of Vision: The editorial board members are invited to write commentaries on classic articles, hot topic articles, or latest articles to keep readers at the forefront of research and increase their levels of clinical research. Classic articles refer to papers that are included in Web of Knowledge and have received a large number of citations (ranking in the top 1%) after being published for more than years, reflecting the quality and impact of papers. Hot topic articles refer to papers that are included in Web of Knowledge and have received a large number of citations after being published for no more than 2 years, reflecting cutting-edge trends in scientific research. Latest articles refer to the latest published high-quality papers that are included in PubMed, reflecting the latest research trends. These commentary articles should focus on the status quo of research, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions. Basic information about the article to be commented (including authors, article title, journal name, year, volume, and inclusive page numbers; (6) Minireviews: The editorial board members are invited to write short reviews on recent advances and trends in research of molecular biology, genomics, and related cutting-edge technologies to provide readers with the latest knowledge and help improve their diagnostic and therapeutic skills; (7) Review: To make a systematic review to focus on the status quo of research, the most important research topics, the problems that have now been resolved and remain to be resolved, and future research directions; (8) Topic Highlight: The editorial board members are invited to write a series of articles (7-10 articles) to comment and discuss a hot topic to help improve the diagnostic and therapeutic skills of readers; (9) Medical Ethics: The editorial board members are invited to write articles about medical ethics to increase readers knowledge of medical ethics. The topic covers international ethics guidelines, animal studies, clinical trials, organ transplantation, etc.; (10) Clinical Case Conference or Clinicopathological Conference: The editorial board members are invited to contribute high-quality clinical case conference; (11) Original Articles: To report innovative and original findings in gastroenterology and hepatology; (12) Brief Articles: To briefly report the novel I October 28, 2013 Volume 19 Issue 40

260 Instructions to authors and innovative findings in gastroenterology and hepatology; (13) Meta-Analysis: Covers the systematic review, mixed treatment comparison, meta-regression, and overview of reviews, in order to summarize a given quantitative effect, e.g., the clinical effectiveness and safety of clinical treatments by combining data from two or more randomized controlled trials, thereby providing more precise and externally valid estimates than those which would stem from each individual dataset if analyzed separately from the others; (14) Case Report: To report a rare or typical case; (15) Letters to the Editor: To discuss and make reply to the contributions published in WJG, or to introduce and comment on a controversial issue of general interest; (16) Book Reviews: To introduce and comment on quality monographs of gastroenterology and hepatology; and (17) Autobiography: The editorial board members are invited to write their autobiography to provide readers with stories of success or failure in their scientific research career. The topic covers their basic personal information and information about when they started doing research work, where and how they did research work, what they have achieved, and their lessons from success or failure. Name of journal World Journal of Gastroenterology ISSN ISSN (print) ISSN (online) Launch date October 1, 1995 Frequency Weekly Editors-in-chief Ferruccio Bonino, MD, PhD, Professor of Gastroenterology, Director of Liver and Digestive Disease Division, Department of Internal Medicine, University of Pisa, Director of General Medicine 2 Unit University Hospital of Pisa, Via Roma 67, Pisa, Italy Myung-Hwan Kim, MD, PhD, Professor, Head, Department of Gastroenterology, Director, Center for Biliary Diseases, University of Ulsan College of Medicine, Asan Medical Center, Pungnap- 2dong, Songpa-gu, Seoul , South Korea Kjell Öberg, MD, PhD, Professor, Department of Endocrine Oncology, Uppsala University Hospital, SE Uppsala, Sweden Matt D Rutter, MBBS, MD, FRCP, Consultant Gastroenterologist, Senior Lecturer, Director, Tees Bowel Cancer Screening Centre, University Hospital of North Tees, Durham University, Stocktonon-Tees, Cleveland TS19 8PE, United Kingdom Andrzej S Tarnawski, MD, PhD, DSc (Med), Professor of Medicine, Chief Gastroenterology, VA Long Beach Health Care System, University of California, Irvine, CA, 5901 E. Seventh Str., Long Beach, CA 90822, United States Editorial office Jin-Lei Wang, Director Xiu-Xia Song, Vice Director World Journal of Gastroenterology Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: wjg@wjgnet.com Publisher Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: bpgoffice@wjgnet.com Production center Beijing Baishideng BioMed Scientific Co., Limited Room 903, Building D, Ocean International Center, No. 62 Dongsihuan Zhonglu, Chaoyang District, Beijing , China Telephone: Fax: Representative office USA Office 8226 Regency Drive, Pleasanton, CA , United States Instructions to authors Full instructions are available online at com/ /g_info_ htm Indexed and abstracted in Current Contents /Clinical Medicine, Science Citation Index Expanded (also known as SciSearch ), Journal Citation Reports, Index Medicus, MEDLINE, PubMed, PubMed Central, Digital Object Identifier, and Directory of Open Access Journals. ISI, Thomson Reuters, 2012 Impact Factor: (34/74 Gastroenterology and Hepatology). SPECIAL STATEMENT All articles published in this journal represent the viewpoints of the authors except where indicated otherwise. Biostatistical editing Statistical review is performed after peer review. We invite an expert in Biomedical Statistics to evaluate the statistical method used in the paper, including t test (group or paired comparisons), chi-squared test, ridit, probit, logit, regression (linear, curvilinear, or stepwise), correlation, analysis of variance, analysis of covariance, etc. The reviewing points include: (1) Statistical methods should be described when they are used to verify the results; (2) Whether the statistical techniques are suitable or correct; (3) Only homogeneous data can be averaged. Standard deviations are preferred to standard errors. Give the number of observations and subjects (n). Losses in observations, such as drop-outs from the study should be reported; (4) Values such as ED50, LD50, IC50 should have their 95% confidence limits calculated and compared by weighted probit analysis (Bliss and Finney); and (5) The word significantly should be replaced by its synonyms (if it indicates extent) or the P value (if it indicates statistical significance). II October 28, 2013 Volume 19 Issue 40

261 Instructions to authors Conflict-of-interest statement In the interests of transparency and to help reviewers assess any potential bias, WJG requires authors of all papers to declare any competing commercial, personal, political, intellectual, or religious interests in relation to the submitted work. Referees are also asked to indicate any potential conflict they might have reviewing a particular paper. Before submitting, authors are suggested to read Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Ethical Considerations in the Conduct and Reporting of Research: Conflicts of Interest from International Committee of Medical Journal Editors (ICMJE), which is available at: ethical_4conflicts.html. Statement of informed consent Manuscripts should contain a statement to the effect that all human studies have been reviewed by the appropriate ethics committee or it should be stated clearly in the text that all persons gave their informed consent prior to their inclusion in the study. Details that might disclose the identity of the subjects under study should be omitted. Authors should also draw attention to the Code of Ethics of the World Medical Association (Declaration of Helsinki, 1964, as revised in 2004). Sample wording: [Name of individual] has received fees for serving as a speaker, a consultant and an advisory board member for [names of organizations], and has received research funding from [names of organization]. [Name of individual] is an employee of [name of organization]. [Name of individual] owns stocks and shares in [name of organization]. [Name of individual] owns patent [patent identification and brief description]. Statement of human and animal rights When reporting the results from experiments, authors should follow the highest standards and the trial should conform to Good Clinical Practice (for example, US Food and Drug Administration Good Clinical Practice in FDA-Regulated Clinical Trials; UK Medicines Research Council Guidelines for Good Clinical Practice in Clinical Trials) and/or the World Medical Association Declaration of Helsinki. Generally, we suggest authors follow the lead investigator s national standard. If doubt exists whether the research was conducted in accordance with the above standards, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. Before submitting, authors should make their study approved by the relevant research ethics committee or institutional review board. If human participants were involved, manuscripts must be accompanied by a statement that the experiments were undertaken with the understanding and appropriate informed consent of each. Any personal item or information will not be published without explicit consents from the involved patients. If experimental animals were used, the materials and methods (experimental procedures) section must clearly indicate that appropriate measures were taken to minimize pain or discomfort, and details of animal care should be provided. SUBMISSION OF MANUSCRIPTS Manuscripts should be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Number all pages consecutively, and start each of the following sections on a new page: Title Page, Abstract, Introduction, Materials and Methods, Results, Discussion, Acknowledgements, References, Tables, Figures, and Figure Legends. Neither the editors nor the publisher are responsible for the opinions expressed by contributors. Manuscripts formally accepted for publication become the permanent property of Baishideng Publishing Group Co., Limited, and may not be reproduced by any means, in whole or in part, without the written permission of both the authors and the publisher. We reserve the right to copy-edit and put onto our website accepted manuscripts. Authors should follow the relevant guidelines for the care and use of laboratory animals of their institution or national animal welfare committee. For the sake of transparency in regard to the performance and reporting of clinical trials, we endorse the policy of the ICMJE to refuse to publish papers on clinical trial results if the trial was not recorded in a publiclyaccessible registry at its outset. The only register now available, to our knowledge, is sponsored by the United States National Library of Medicine and we encourage all potential contributors to register with it. However, in the case that other registers become available you will be duly notified. A letter of recommendation from each author s organization should be provided with the contributed article to ensure the privacy and secrecy of research is protected. Authors should retain one copy of the text, tables, photographs and illustrations because rejected manuscripts will not be returned to the author(s) and the editors will not be responsible for loss or damage to photographs and illustrations sustained during mailing. Online submissions Manuscripts should be submitted through the Online Submission System at: Authors are highly recommended to consult the ONLINE INSTRUC- TIONS TO AUTHORS ( g_info_ htm) before attempting to submit online. For assistance, authors encountering problems with the Online Submission System may send an describing the problem to wjg@wjgnet.com, or by telephone: If you submit your manuscript online, do not make a postal contribution. Repeated online submission for the same manuscript is strictly prohibited. MANUSCRIPT PREPARATION All contributions should be written in English. All articles must be submitted using word-processing software. All submissions must be typed in 1.5 line spacing and 12 pt. Book Antiqua with ample margins. Style should conform to our house format. Required information for each of the manuscript sections is as follows: Title page Title: Title should be less than 12 words. Running title: A short running title of less than 6 words should be provided. Authorship: Authorship credit should be in accordance with the standard proposed by ICMJE, based on (1) substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; (2) drafting the article or revising it critically for important intellectual content; and (3) final approval of the version to be published. Authors should meet conditions 1, 2, and 3. Institution: Author names should be given first, then the complete name of institution, city, province and postcode. For example, Xu-Chen Zhang, Li-Xin Mei, Department of Pathology, Chengde Medical College, Chengde , Hebei Province, China. One author may be represented from two institutions, for example, George Sgourakis, Department of General, Viscer- III October 28, 2013 Volume 19 Issue 40

262 Instructions to authors al, and Transplantation Surgery, Essen 45122, Germany; George Sgourakis, 2nd Surgical Department, Korgialenio-Benakio Red Cross Hospital, Athens 15451, Greece. Author contributions: The format of this section should be: Author contributions: Wang CL and Liang L contributed equally to this work; Wang CL, Liang L, Fu JF, Zou CC, Hong F and Wu XM designed the research; Wang CL, Zou CC, Hong F and Wu XM performed the research; Xue JZ and Lu JR contributed new reagents/analytic tools; Wang CL, Liang L and Fu JF analyzed the data; and Wang CL, Liang L and Fu JF wrote the paper. Supportive foundations: The complete name and number of supportive foundations should be provided, e.g. Supported by National Natural Science Foundation of China, No Correspondence to: Only one corresponding address should be provided. Author names should be given first, then author title, affiliation, the complete name of institution, city, postcode, province, country, and . All the letters in the should be in lower case. A space interval should be inserted between country name and address. For example, Montgomery Bissell, MD, Professor of Medicine, Chief, Liver Center, Gastroenterology Division, University of California, Box 0538, San Francisco, CA 94143, United States. montgomery.bissell@ucsf.edu Telephone and fax: Telephone and fax should consist of +, country number, district number and telephone or fax number, e.g., Telephone: Fax: Peer reviewers: All articles received are subject to peer review. Normally, three experts are invited for each article. Decision on acceptance is made only when at least two experts recommend publication of an article. All peer-reviewers are acknowledged on Express Submission and Peer-review System website. Abstract There are unstructured abstracts (no less than 200 words) and structured abstracts. The specific requirements for structured abstracts are as follows: An informative, structured abstract should accompany each manuscript. Abstracts of original contributions should be structured into the following sections: AIM (no more than 20 words; Only the purpose of the study should be included. Please write the Aim in the form of To investigate/study/ ), METH- ODS (no less than 140 words for Original Articles; and no less than 80 words for Brief Articles), RESULTS (no less than 150 words for Original Articles and no less than 120 words for Brief Articles; You should present P values where appropriate and must provide relevant data to illustrate how they were obtained, e.g., 6.92 ± 3.86 vs 3.61 ± 1.67, P < 0.001), and CONCLUSION (no more than 26 words). Key words Please list 5-10 key words, selected mainly from Index Medicus, which reflect the content of the study. Core tip Please write a summary of less than 100 words to outline the most innovative and important arguments and core contents in your paper to attract readers. Text For articles of these sections, original articles and brief articles, the main text should be structured into the following sections: INTRODUCTION, MATERIALS AND METHODS, RE- SULTS and DISCUSSION, and should include appropriate Figures and Tables. Data should be presented in the main text or in Figures and Tables, but not in both. Illustrations Figures should be numbered as 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each figure on a separate page. Detailed legends should not be provided under the figures. This part should be added into the text where the figures are applicable. Keeping all elements compiled is necessary in line-art image. Scale bars should be used rather than magnification factors, with the length of the bar defined in the legend rather than on the bar itself. File names should identify the figure and panel. Avoid layering type directly over shaded or textured areas. Please use uniform legends for the same subjects. For example: Figure 1 Pathological changes in atrophic gastritis after treatment. A:...; B:...; C:...; D:...; E:...; F:...; G: etc. It is our principle to publish high resolution-figures for the E-versions. Tables Three-line tables should be numbered 1, 2, 3, etc., and mentioned clearly in the main text. Provide a brief title for each table. Detailed legends should not be included under tables, but rather added into the text where applicable. The information should complement, but not duplicate the text. Use one horizontal line under the title, a second under column heads, and a third below the Table, above any footnotes. Vertical and italic lines should be omitted. Notes in tables and illustrations Data that are not statistically significant should not be noted. a P < 0.05, b P < 0.01 should be noted (P > 0.05 should not be noted). If there are other series of P values, c P < 0.05 and d P < 0.01 are used. A third series of P values can be expressed as e P < 0.05 and f P < Other notes in tables or under illustrations should be expressed as 1 F, 2 F, 3 F; or sometimes as other symbols with a superscript (Arabic numerals) in the upper left corner. In a multi-curve illustration, each curve should be labeled with,,,,,, etc., in a certain sequence. Acknowledgments Brief acknowledgments of persons who have made genuine contributions to the manuscript and who endorse the data and conclusions should be included. Authors are responsible for obtaining written permission to use any copyrighted text and/or illustrations. REFERENCES Coding system The author should number the references in Arabic numerals according to the citation order in the text. Put reference numbers in square brackets in superscript at the end of citation content or after the cited author s name. For citation content which is part of the narration, the coding number and square brackets should be typeset normally. For example, Crohn s disease (CD) is associated with increased intestinal permeability [1,2]. If references are cited directly in the text, they should be put together within the text, for example, From references [19,22-24], we know that.... When the authors write the references, please ensure that the order in text is the same as in the references section, and also ensure the spelling accuracy of the first author s name. Do not list the same citation twice. IV October 28, 2013 Volume 19 Issue 40

263 Instructions to authors PMID and DOI Pleased provide PubMed citation numbers to the reference list, e.g., PMID and DOI, which can be found at nlm.nihgov/sites/entrez?db=pubmed and org/simpletextquery/, respectively. The numbers will be used in E-version of this journal. Style for journal references Authors: the name of the first author should be typed in boldfaced letters. The family name of all authors should be typed with the initial letter capitalized, followed by their abbreviated first and middle initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong Pan as Pan BR). The title of the cited article and italicized journal title (journal title should be in its abbreviated form as shown in PubMed), publication date, volume number (in black), start page, and end page [PMID: DOI: /wjg ]. Style for book references Authors: the name of the first author should be typed in boldfaced letters. The surname of all authors should be typed with the initial letter capitalized, followed by their abbreviated middle and first initials. (For example, Lian-Sheng Ma is abbreviated as Ma LS, Bo-Rong Pan as Pan BR) Book title. Publication number. Publication place: Publication press, Year: start page and end page. Format Journals English journal article (list all authors and include the PMID where applicable) 1 Jung EM, Clevert DA, Schreyer AG, Schmitt S, Rennert J, Kubale R, Feuerbach S, Jung F. Evaluation of quantitative contrast harmonic imaging to assess malignancy of liver tumors: A prospective controlled two-center study. World J Gastroenterol 2007; 13: [PMID: DOI: /wjg ] Chinese journal article (list all authors and include the PMID where applicable) 2 Lin GZ, Wang XZ, Wang P, Lin J, Yang FD. Immunologic effect of Jianpi Yishen decoction in treatment of Pixudiarrhoea. Shijie Huaren Xiaohua Zazhi 1999; 7: In press 3 Tian D, Araki H, Stahl E, Bergelson J, Kreitman M. Signature of balancing selection in Arabidopsis. Proc Natl Acad Sci USA 2006; In press Organization as author 4 Diabetes Prevention Program Research Group. Hypertension, insulin, and proinsulin in participants with impaired glucose tolerance. Hypertension 2002; 40: [PMID: PMCID: DOI: /01.HYP ] Both personal authors and an organization as author 5 Vallancien G, Emberton M, Harving N, van Moorselaar RJ; Alf-One Study Group. Sexual dysfunction in 1, 274 European men suffering from lower urinary tract symptoms. J Urol 2003; 169: [PMID: DOI: /01.ju ] No author given 6 21st century heart solution may have a sting in the tail. BMJ 2002; 325: 184 [PMID: DOI: /bmj ] Volume with supplement 7 Geraud G, Spierings EL, Keywood C. Tolerability and safety of frovatriptan with short- and long-term use for treatment of migraine and in comparison with sumatriptan. Headache 2002; 42 Suppl 2: S93-99 [PMID: DOI: /j s2.7.x] Issue with no volume 8 Banit DM, Kaufer H, Hartford JM. Intraoperative frozen section analysis in revision total joint arthroplasty. Clin Orthop Relat Res 2002; (401): [PMID: DOI: / ] No volume or issue 9 Outreach: Bringing HIV-positive individuals into care. HRSA Careaction 2002; 1-6 [PMID: ] Books Personal author(s) 10 Sherlock S, Dooley J. Diseases of the liver and billiary system. 9th ed. Oxford: Blackwell Sci Pub, 1993: Chapter in a book (list all authors) 11 Lam SK. Academic investigator s perspectives of medical treatment for peptic ulcer. In: Swabb EA, Azabo S. Ulcer disease: investigation and basis for therapy. New York: Marcel Dekker, 1991: Author(s) and editor(s) 12 Breedlove GK, Schorfheide AM. Adolescent pregnancy. 2nd ed. Wieczorek RR, editor. White Plains (NY): March of Dimes Education Services, 2001: Conference proceedings 13 Harnden P, Joffe JK, Jones WG, editors. Germ cell tumours V. Proceedings of the 5th Germ cell tumours Conference; 2001 Sep 13-15; Leeds, UK. New York: Springer, 2002: Conference paper 14 Christensen S, Oppacher F. An analysis of Koza s computational effort statistic for genetic programming. In: Foster JA, Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Genetic programming. EuroGP 2002: Proceedings of the 5th European Conference on Genetic Programming; 2002 Apr 3-5; Kinsdale, Ireland. Berlin: Springer, 2002: Electronic journal (list all authors) 15 Morse SS. Factors in the emergence of infectious diseases. Emerg Infect Dis serial online, , cited ; 1(1): 24 screens. Available from: URL: ncidod/eid/index.htm Patent (list all authors) 16 Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee. Flexible endoscopic grasping and cutting device and positioning tool assembly. United States patent US Aug 1 Statistical data Write as mean ± SD or mean ± SE. Statistical expression Express t test as t (in italics), F test as F (in italics), chi square test as χ 2 (in Greek), related coefficient as r (in italics), degree of freedom as υ (in Greek), sample number as n (in italics), and probability as P (in italics). Units Use SI units. For example: body mass, m (B) = 78 kg; blood pressure, p (B) = 16.2/12.3 kpa; incubation time, t (incubation) = 96 h, blood glucose concentration, c (glucose) 6.4 ± 2.1 mmol/l; blood CEA mass concentration, p (CEA) = 8.6 V October 28, 2013 Volume 19 Issue 40

264 Instructions to authors 24.5 mg/l; CO 2 volume fraction, 50 ml/l CO 2, not 5% CO 2 ; likewise for 40 g/l formaldehyde, not 10% formalin; and mass fraction, 8 ng/g, etc. Arabic numerals such as 23, 243, 641 should be read The format for how to accurately write common units and quantums can be found at: g_info_ htm. Abbreviations Standard abbreviations should be defined in the abstract and on first mention in the text. In general, terms should not be abbreviated unless they are used repeatedly and the abbreviation is helpful to the reader. Permissible abbreviations are listed in Units, Symbols and Abbreviations: A Guide for Biological and Medical Editors and Authors (Ed. Baron DN, 1988) published by The Royal Society of Medicine, London. Certain commonly used abbreviations, such as DNA, RNA, HIV, LD50, PCR, HBV, ECG, WBC, RBC, CT, ESR, CSF, IgG, ELISA, PBS, ATP, EDTA, mab, can be used directly without further explanation. Italics Quantities: t time or temperature, c concentration, A area, l length, m mass, V volume. Genotypes: gyra, arg 1, c myc, c fos, etc. Restriction enzymes: EcoRI, HindI, BamHI, Kbo I, Kpn I, etc. Biology: H. pylori, E coli, etc. Examples for paper writing All types of articles writing style and requirement will be found in the link: Info.aspx?id=15. RESUBMISSION OF THE REVISED MANUSCRIPTS Authors must revise their manuscript carefully according to the revision policies of Baishideng Publishing Group Co., Limited. The revised version, along with the signed copyright transfer agreement, responses to the reviewers, and English language Grade A certificate (for non-native speakers of English), should be submitted to the online system via the link contained in the sent by the editor. If you have any questions about the revision, please send to esps@wjgnet.com. Language evaluation The language of a manuscript will be graded before it is sent for revision. (1) Grade A: priority publishing; (2) Grade B: minor language polishing; (3) Grade C: a great deal of language polishing needed; and (4) Grade D: rejected. Revised articles should reach Grade A. Copyright assignment form Please download a Copyright assignment form from Responses to reviewers Please revise your article according to the comments/suggestions provided by the reviewers. The format for responses to the reviewers comments can be found at: com/ /g_info_ htm Proof of financial support For papers supported by a foundation, authors should provide a copy of the approval document and serial number of the foundation. STATEMENT ABOUT ANONYMOUS PUBLICA- TION OF THE PEER REVIEWERS COMMENTS In order to increase the quality of peer review, push authors to carefully revise their manuscripts based on the peer reviewers' comments, and promote academic interactions among peer reviewers, authors and readers, we decide to anonymously publish the reviewers comments and author s responses at the same time the manuscript is published online. PUBLICATION FEE WJG is an international, peer-reviewed, open access, online journal. Articles published by this journal are distributed under the terms of the Creative Commons Attribution Non-commercial License, which permits use, distribution, and reproduction in any medium, provided the original work is properly cited, the use is non commercial and is otherwise in compliance with the license. Authors of accepted articles must pay a publication fee. Publication fee: 1365 USD per article. All invited articles are published free of charge. VI October 28, 2013 Volume 19 Issue 40

265 Published by Baishideng Publishing Group Co., Limited Flat C, 23/F., Lucky Plaza, Lockhart Road, Wan Chai, Hong Kong, China Fax: Telephone: I S S N Baishideng Publishing Group Co., Limited 2013 Baishideng. All rights reserved.