The genetics of heterochromatin. in metazoa. mutations by means of X-ray irradiation" "for the discovery of the production of
|
|
- Hector Floyd
- 5 years ago
- Views:
Transcription
1 The genetics of heterochromatin in metazoa 1 Hermann Joseph Muller 1946 Nobel Prize in Medicine: "for the discovery of the production of mutations by means of X-ray irradiation" 3 4
2 The true meaning of "red eye reduction": White wild-type White mutant Gene behavior can change depending on where on the chromosome the gene lies. = position effect (bar is the most commonly used example) Position effect variegation (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome. Epigenetic phenomenon: Stable change in expression without change in sequence! 6 8
3 2 genes: Su(var)2-5 Enhancer of PEV Su(var)3-9 Suppressor of PEV
4 HP1 (Sarah Elgin) (heterochromatin protein 1) Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin. biochemistry genetics HP1 = Su(var)2-5 Conserved in humans and in mice (both in terms of sequence and intranuclear location!). Why does HP1 go to places that HP1 goes to? Biochemical epistasis (T. Jenuwein) Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the nucleus of mouse cells
5 Who would have thunk it? NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase. Su(var)3-9 is a HISTONE methyltransferase. Calling David Duchovny and Gillian Anderson Su(var)3-9 was given this name because it was the 9 th gene isolated on the 3 rd chromosome in a screen for Su(var)s. It methylates lysine 9 in histone H3. This was discovered 18 years after it was named Histone methylation And finally HP1 preferentially BINDS histone H3 methylated on lysine 9. That s why Su(var)3-9 determines localization of HP1 to heterochromatin (it methylates histones in heterochromatin). At least in fission yeast, and perhaps in worms, this has to do with RNAi
6 21 22 HP1 HP1 = HP1 HP1 = HP1 HP1 = HP1 HP1 HP1 HP
7 Remembrance of things past: chromatin as an epigenetic vehicle Analogy Fission yeast, flies, mammals. Budding yeast Homology (orthologs of heterochomatin proteins in fission yeast, insects, and humans) Nature, October 10, 2002 The polycomb group protein EZH2 is involved in progression of prostate cancer Varambally et al. Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression
8 From egg to embryo? 29 Homeotic mutations (W. Bateson) Genetics Allele Heterozygous Homozygous Not that there has merely been a change, but that something has been changed into the likeness of something else. 31 wt antennapedia 30 32
9 Do you have any idea who I think I am?!! 1. Segment identity is determined by transcription factors. 2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them. 3. Nobody knew how Polycomb and Trithorax do this The segmentation hierarchy 34 How Polycomb and Trithorax work 36
10 extra sex combs enhancer of zeste E(z) does it Posted September 13, 2002 CELL immediate early publication Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Drosophila Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, /S Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, /S Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations. Al Hershey 39 40
11 stimulus + + Regulation of genes occurs via the interaction of transacting factors (proteins) with cis-acting sequences near the genes themselves. 41 Bicoid is the anterior morphogen
12 Boyer and Young Cell Sept. 23, 2005 What democracy, I mean, gene regulation, is really like Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects Most genes in the human genome are under considerable regulatory influence from entities other than simple trans-acting factors; these entities include noncoding RNA and modified histones David Allis: the histone code 47 Fischle, Wang, Allis COCB 2003
13 Henry et al. (11/1/2003) Genes Dev. 17: Genetic information Lac operator gaattgtgagcggataacaattt
14 Genetic information Genetic information +? -
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationA Genetic Program for Embryonic Development
Concept 18.4: A program of differential gene expression leads to the different cell types in a multicellular organism During embryonic development, a fertilized egg gives rise to many different cell types
More informationLecture 8. Eukaryotic gene regulation: post translational modifications of histones
Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationChapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationMidterm 1. Number of students Score. Mean: 73 Median: 75 Top Score: 98
Midterm 1 14 12 Number of students 10 8 6 4 2 0 35-40 41-45 Mean: 73 Median: 75 Top Score: 98 46-50 51-55 56-60 61-65 66-70 71-75 Score 76-80 81-85 86-90 91-95 96-100 Write your name and student ID# on
More informationTranscriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
More informationA balancing act: heterochromatin protein 1a and the Polycomb group coordinate their levels to silence chromatin in Drosophila
Cabrera et al. Epigenetics & Chromatin (2015) 8:17 DOI 10.1186/s13072-015-0010-z RESEARCH Open Access A balancing act: heterochromatin protein 1a and the Polycomb group coordinate their levels to silence
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions In multicellular eukaryotes,
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationGene Regulation. Bacteria. Chapter 18: Regulation of Gene Expression
Chapter 18: Regulation of Gene Expression A Biology 2013 1 Gene Regulation rokaryotes and eukaryotes alter their gene expression in response to their changing environment In multicellular eukaryotes, gene
More informationCampbell Biology 10. A Global Approach. Chapter 18 Control of Gene Expression
Lecture on General Biology 2 Campbell Biology 10 A Global Approach th edition Chapter 18 Control of Gene Expression Chul-Su Yang, Ph.D., chulsuyang@hanyang.ac.kr Infection Biology Lab., Dept. of Molecular
More informationI) Development: tissue differentiation and timing II) Whole Chromosome Regulation
Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during
More informationGene phenotype. Maize (corn) Zea mays. Epigenetics ?!!!
Gene phenotype Other genes epistasis variable expressivity (sickle-cell anemia) The environment norm of reaction variable penetrance (BRCA1-induced breast cancer) Epigenetic effects 1 2 Epigenetics Maize
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationRegulation of Gene Expression
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 18 Regulation of Gene Expression
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationHox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription
More informationPolarity and Segmentation. Chapter Two
Polarity and Segmentation Chapter Two Polarization Entire body plan is polarized One end is different than the other Head vs. Tail Anterior vs. Posterior Front vs. Back Ventral vs. Dorsal Majority of neural
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationChromatin Modifications by Methylation and Ubiquitination: Implications in the Regulation of Gene Expression
Annu. Rev. Biochem. 2006. 75:243 69 First published online as a Review in Advance on February 22, 2006 The Annual Review of Biochemistry is online at biochem.annualreviews.org doi: 10.1146/ annurev.biochem.75.103004.142422
More informationProblem Set 5 KEY
2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature23267 Discussion Our findings reveal unique roles for the methylation states of histone H3K9 in RNAi-dependent and - independent heterochromatin formation. Clr4 is the sole S. pombe enzyme
More informationGene Regulation - 4. One view of the Lactose Operon
Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to
More information'''''''''''''''''Fundamental'Biology' BI'1101' ' an'interdisciplinary'approach'to'introductory'biology' Five'Levels'of'Organiza-on' Molecular'
'''''''''''''''''Fundamental'Biology' BI'1101' ' an'interdisciplinary'approach'to'introductory'biology' Anggraini'Barlian,' Iriawa-' Tjandra'Anggraeni' SITH4ITB' Five'Levels'of'Organiza-on' Molecular'
More informationReview Article Epigenetic Mechanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted Regions in Mammals, Plants, and Insects
Genetics Research International Volume 2012, Article ID 585024, 17 pages doi:10.1155/2012/585024 Review Article Epigenetic echanisms of Genomic Imprinting: Common Themes in the Regulation of Imprinted
More informationPRC2 crystal clear. Matthieu Schapira
PRC2 crystal clear Matthieu Schapira Epigenetic mechanisms control the combination of genes that are switched on and off in any given cell. In turn, this combination, called the transcriptional program,
More information9 th TRR81 PhD Minisymposium Kinases as regulators of chromatin structure and transcription
9 th TRR81 PhD Minisymposium Kinases as regulators of chromatin structure and transcription Friday, 20 th of November 2015, 13:00h Institute of Molecular Biology and Tumor Research (IMT) Philipps-University
More informationBIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Regulation of Gene Expression Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Differential Expression of Genes
More informationCancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
More informationBIOLOGY. Regulation of Gene Expression CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson
CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Regulation of Gene Expression Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick 2014 Pearson Education, Inc.
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationSTEM CELL GENETICS AND GENOMICS
STEM CELL GENETICS AND GENOMICS Concise Review: Roles of Polycomb Group Proteins in Development and Disease: A Stem Cell Perspective VINAGOLU K. RAJASEKHAR, a MARTIN BEGEMANN b a Memorial Sloan-Kettering
More informationChapter 18. Regulation of Gene Expression. Lecture Outline. Overview: Conducting the Genetic Orchestra
Chapter 18 Regulation of Gene Expression Lecture Outline Overview: Conducting the Genetic Orchestra Both prokaryotes and eukaryotes alter their patterns of gene expression in response to changes in environmental
More informationSotos syndrome and the NSD1 gene. Jamie Masliah Gene4cs 564
Sotos syndrome and the NSD1 gene Jamie Masliah Gene4cs 564 What is Sotos syndrome? Impaired Learning (Turkmen, 2003) Euro J Hum Genet NSD1 is mutated in Sotos syndrome 2696 aa Molecular Func4on Zn 2+ GO
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationMBios 401/501: Lecture 12.1 Signaling IV. Slide 1
MBios 401/501: Lecture 12.1 Signaling IV Slide 1 Pathways that require regulated proteolysis 1. Notch and Delta 2. Wnt/ b-catenin 3. Hedgehog 4. NFk-B Our last topic on cell signaling are pathways that
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationHuman Genetics (Learning Objectives)
Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures Campbell Biology: Concepts & Connections, Eighth Edition REECE TAYLOR SIMON DICKEY HOGAN Lecture by Edward J. Zalisko Introduction Well-preserved
More informationRepressive Transcription
Repressive Transcription The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Guenther, M. G., and R. A.
More informationGene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More information2014 Pearson Education, Inc. Select topics from Chapter 15
Select topics from Chapter 15 Overview: Differential Expression of Genes Prokaryotes and eukaryotes alter gene expression in response to their changing environment Multicellular eukaryotes also develop
More informationLecture 10. G1/S Regulation and Cell Cycle Checkpoints. G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint
Lecture 10 G1/S Regulation and Cell Cycle Checkpoints Outline: G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint Paper: The roles of Fzy/Cdc20 and Fzr/Cdh1
More informationEpigenetics and Toxicology
Epigenetics and Toxicology Aline.deconti@fda.hhs.gov Division of Biochemical Toxicology National Center for Toxicology Research U.S.-Food and Drug Administration The views expressed in this presentation
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationGenomic Methods in Cancer Epigenetic Dysregulation
Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics
More informationExample: Colour in snapdragons
Incomplete Dominance this occurs when the expression of one allele does not completely mask the expression of another. the result is that a heterozygous organism has a phenotype that is a blend of the
More informationAlpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More informationProgrammed Cell Death (apoptosis)
Programmed Cell Death (apoptosis) Stereotypic death process includes: membrane blebbing nuclear fragmentation chromatin condensation and DNA framentation loss of mitochondrial integrity and release of
More informationHuman Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur
Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 02 Lecture - 06 Let us test your understanding of Pedigree
More informationTHE ROLE OF POLYCOMB GROUP PROTEIN EZH2 IN CANCER PROGRESSION. Qi Cao
THE ROLE OF POLYCOMB GROUP PROTEIN EZH2 IN CANCER PROGRESSION by Qi Cao A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Pathology) in The University
More informationThis document is a required reading assignment covering chapter 4 in your textbook.
This document is a required reading assignment covering chapter 4 in your textbook. Chromosomal basis of genes and linkage The majority of chapter 4 deals with the details of mitosis and meiosis. This
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationThe Chromosomal Basis of Inheritance
The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these
More informationSEX DETERMINATION AND SEX CHROMOSOMES
Klug et al. 2006, 2009 Concepts of Genetics Chapter 7 STUDY UNIT 5 SEX DETERMINATION AND SEX CHROMOSOMES Some species reproduce asexually Most diploid eukaryotes reproduce sexually Parent (2n) Parent (2n)
More informationDOWNLOAD OR READ : PROTEIN METHYLTRANSFERASES PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : PROTEIN METHYLTRANSFERASES PDF EBOOK EPUB MOBI Page 1 Page 2 protein methyltransferases protein methyltransferases pdf protein methyltransferases N-alpha methyltransferases transfer
More informationBiology 2C03 Term Test #3
Biology 2C03 Term Test #3 Instructors: Dr. Kimberley Dej, Ray Procwat Date: Monday March 22, 2010 Time: 10:30 am to 11:20 am Instructions: 1) This midterm test consists of 9 pages. Please ensure that all
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationThis is a published version of a paper published in PLoS genetics. Access to the published version may require subscription.
Umeå University This is a published version of a paper published in PLoS genetics. Citation for the published paper: Holmqvist, P., Boija, A., Philip, P., Crona, F., Stenberg, P. et al. (2012) "Preferential
More informationProtein methylation CH 3
Protein methylation CH 3 methionine S-adenosylmethionine (SAM or adomet) Methyl group of the methionine is activated by the + charge of the adjacent sulfur atom. SAM S-adenosylhomocysteine homocysteine
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationUNIT 6 GENETICS 12/30/16
12/30/16 UNIT 6 GENETICS III. Mendel and Heredity (6.3) A. Mendel laid the groundwork for genetics 1. Traits are distinguishing characteristics that are inherited. 2. Genetics is the study of biological
More informationProf. R. V. Skibbens
Prof. R. V. Skibbens September 8, 2017 BioScience in the 21 st Century Cell Cycle, Cell Division and intro to Cancer Cell growth and division What are the goals? I Cell Cycle what is this? response to
More informationMeiosis. Prophase I But something else happens: each chromosome pairs up with the other member of its pair... Prophase I Chromosomes become visible...
Thought mitosis was bad? It gets worse... Meiosis Double division, divided into meiosis I and meiosis II, producing four cells at the end. Before meiosis, a cell goes through the G and S phases we talked
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationConstitutive heterochromatin formation and transcription in mammals
Saksouk et al. Epigenetics & Chromatin 2015, 8:3 REVIEW Constitutive heterochromatin formation and transcription in mammals Nehmé Saksouk, Elisabeth Simboeck and Jérôme Déjardin * Open Access Abstract
More informationBiology Developmental Biology Spring Quarter Midterm 1 Version A
Biology 411 - Developmental Biology Spring Quarter 2013 Midterm 1 Version A 75 Total Points Open Book Choose 15 out the 20 questions to answer (5 pts each). Only the first 15 questions that are answered
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-06-1-0093 TITLE: An Epigenetic Link to Prostate Cancer PRINCIPAL INVESTIGATOR: Raphael F Margueron, Ph.D. CONTRACTING ORGANIZATION: University of Medicine and Dentistry of New Jersey
More informationHOW AND WHY GENES ARE REGULATED HOW AND WHY GENES ARE REGULATED. Patterns of Gene Expression in Differentiated Cells
HOW AND WHY GENES ARE REGULATED 5 HOW AND WHY GENES ARE REGULATED 6 Every somatic cell in an organism contains identical genetic instructions. They all share the same genome. So what makes cells different
More informationTesti del Syllabus. Testi in italiano. Resp. Did. SCHOEFTNER STEFAN Matricola: Docente SCHOEFTNER STEFAN, 6 CFU
Testi del Syllabus Resp. Did. SCHOEFTNER STEFAN Matricola: 022775 Docente SCHOEFTNER STEFAN, 6 CFU Anno offerta: 2017/2018 Insegnamento: 676SM - REGOLAZIONE EPIGENETICA Corso di studio: SM53 - GENOMICA
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationMCB140: Second Midterm Spring 2010
MCB140: Second Midterm Spring 2010 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 11 pages including this page. You will have 150 minutes
More informationDevelopment, Stem Cells, and Cancer
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 16 Development, Stem Cells, and Cancer Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationLecture 10. Eukaryotic gene regulation: chromatin remodelling
Lecture 10 Eukaryotic gene regulation: chromatin remodelling Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation sequences Transcriptional
More informationA model for mitotic inheritance of histone lysine methylation
scientificreport A model for mitotic inheritance of histone lysine methylation Mo Xu 1,2,WeixiangWang 2,SheChen 2+ &BingZhu 2++ 1 Graduate Program, Peking Union Medical College and Chinese Academy of Medical
More informationFor a long time, people have observed that offspring look like their parents.
Chapter 10 For a long time, people have observed that offspring look like their parents. Even before we knew about genes, people were breeding livestock to get certain traits in the offspring. They knew
More informationEOG Practice:,Evolution & Genetics [126663]
EOG Practice:,Evolution & Genetics [126663] Student Class Date 1. A particular peach tree produces peaches that are more resistant to disease than other peaches. What method would reproduce these EXACT
More informationLABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMOSTRATION. financed by the program
TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationSystems Analysis Of Chromatin-Related Protein Complexes In Cancer READ ONLINE
Systems Analysis Of Chromatin-Related Protein Complexes In Cancer READ ONLINE If looking for the book Systems Analysis of Chromatin-Related Protein Complexes in Cancer in pdf format, then you have come
More information1/31/2014. Radiation Biology and Risk to the Public
Radiation Biology and Risk to the Public Dr. David C. Medich University of Massachusetts Lowell Lowell MA 01854 Introduction Definition: Radiation Biology is the field of science that studies the biological
More informationChromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationTHE ROLE OF EZH2 IN GENOMIC STABILITY AND TUMORIGENESIS IN BREAST CANCER MATTHEW DUPRIE
THE ROLE OF EZH2 IN GENOMIC STABILITY AND TUMORIGENESIS IN BREAST CANCER MATTHEW DUPRIE 4-19-2010 This thesis has been read and approved by Date: / / 1 ABSTRACT: Enhancer of Zeste Homolog 2 (EZH2) is a
More information