Supplementary Information. A Single Amino Acid Switch Alters the Isoprene Donor Specificity in RiPP Prenyltransferases

Transcription

1 Supplementary Information A Single Amino Acid Switch Alters the Isoprene Donor Specificity in RiPP Prenyltransferases Paola Estrada 1,2,#, Maho Morita 3,#, Yue Hao 1,#,+, Eric W. Schmidt 3,*, and Satish Nair 1,2,4* 1 Department of Biochemistry, 2 Institute for Genomic Biology, and 4 Center for Biophysics and Quantitative Biology, University of Illinois at Urbana-Champaign, Illinois 3 Department of Medicinal Chemistry, University of Utah, Salt Lake City, Utah # These authors contributed equally to this work. Table of Contents: Supplementary Materials and Methods TableS1: Primers used for cloning Table S2: Initial survey of C 5 -C 20 carbon-length isoprenoid donors TableS3: Data Collection and Refinement statistics Figure S1: Multiple sequence alignment of cyanobactin prenyltransferases Figure S2: Superposition of structures of cyanobactin prenyltransferases Figure S3: ESI mass spectra for Tyr-Tyr-Tyr reactions Figure S4. Isoprenoid donor interactions. Figure S5. Reactions of modified YF-ProcA1.1. Figure S6: Enzyme reactions with YF-ProcA1.1. Figure S7: Size-exclusion chromatography analysis of PirF and F222G-PagF Supplementary References Page S2 Page S6 Page S7 Page S8 Page S9 Page S10 Page S11 Page S12 Page S13 Page S14 Page S15 Page S16 S1

2 Supplementary Materials and Methods Protein expression and purification Reagents used for molecular biology were purchased from New England BioLabs (Ipswich, MA). Oligonucleotides primers were purchased from Integrated DNA Technologies Inc. (Coralville, IA). PagF and PirF genes were amplified and cloned into pet28a as described elsewhere 1. All mutants were cloned into pet-his6 Sumo TEV LIC cloning vector (2S-T) using primer extention. All sequences were verified using didexoy sequencing by ACGT Inc. (Wheeling, IL). Each of the clones was transformed into E. coli Rosetta2 (DE3) cells and plated on LB agar plates supplemented with chloramphenicol (0.025 mg/ml) and either kanamycin (0.05 mg/ml) or ampicillin (0.1 mg/ml). A single colony was used to inoculate a 6 ml of LB broth supplemented with the appropriate antibiotics, and at 37 C grown for hours. The starter culture was used to inoculate 2L of Luria Bertani broth supplemented with both kanamycin and chloramphenicol for expression of wild type proteins, and ampicillin and chloramphenicol for mutant proteins. Cultures were grown at 37 C until the OD 600 reached Protein expression was induced by addition of IPTG (isopropyl β-d-thiogalactopyranoside) to a final concentration of 0.3 mm. The cells were further incubated with shaking at 18 C for 18 to 20 hours. Cells were harvested by centrifugation, resuspended in 20 mm Tris-HCl (ph 8.0), and 500 mm NaCl buffer, and lysed by sonication. The lysate was centrifuged and the supernatant was loaded into a 5 ml His-Trap nickel column. The column was washed with buffer containing 20 mm Tris-HCl (ph 8.0), 1 M NaCl and 30 mm imidazole. An increasing imidazole concentration gradient was used to elute the protein. The protein was incubated overnight at 4 C with thrombin or TEV protease to remove Hisx6 tag. Size exclusion chromatography (Hiload 16/60 Superdex 200) was used to further purify the protein using a 20 mm Na-HEPES (ph 7.5) buffer with 100 mm KCl for PagF wild type and mutants or 500 mm KCl for PirF. S2

3 YF-ProcA1.1 expression and purification The prsf-duet plasmid containing the procm and proca genes was obtained from the van der Donk laboratory at UIUC. The F91Y mutation was introduced using primer extention. The clone was transformed into E. coli Rosetta2 (DE3) cells and plated on LB agar plates supplemented with chloramphenicol (0.025 mg/ml) and kanamycin (0.05 mg/ml). A single colony was used to inoculate a 6 ml of LB broth supplemented with the appropriate antibiotics, and grown for hours at 37 C. The starter culture was used to inoculate 2 L of Luria Bertani broth supplemented with both kanamycin and chloramphenicol for expression of wild type proteins, and ampicillin and chloramphenicol for mutant proteins. Cultures were grown at 37 C until the OD 600 reached 1. Protein expression was induced by addition of IPTG (isopropyl β-dthiogalactopyranoside) to a final concentration of 0.5 mm. The cells were further incubated with shaking at 18 C for 18 h. The purification of processed ProcA1.1 was done following protocol reported elsewhere 2. YF-ProcA1.1 modification characterization HPLC-purified YF-ProcA1.1 (50 g) was incubated at 50 C for in a solution containing 250 mm 20% v/v ethanol, 200 mm NaOH and 20% -mercaptoethanol (BME) 3. After one hour the solution was dried using a vacuum concentrator. HPLC purified YF-ProcA1.1, with and without treatment with BME, were then incubated with a solution containing 250 mm Tris ph 9, 1 mm TCEP, and 25 mm iodoacetamide at room temperature for 3 hours 4, prior to mass spectral analysis. These results show that the thiols in YF-ProcA1.1 are not modified by IAA treatment, while the BME treated samples are modified. These data are consistent with thioether ring formation in the YF-ProcA1.1 sample. End point analysis of PagF reactions Reaction mixtures contained NaCl (1.1 M), bis-tris-propane, ph 7.5 (100 mm), MgCl 2 (200 mm) and 4% (v/v) DMSO. The reaction mixtures were incubated for 18 h at 37 C. The reactions with trityrosine were stopped by the addition of trifluoroacetic acid to a final concentration of 0.1% in total volume. Precipitated protein was removed by centrifugation before loading the reactions to a C18 analytical column connected to a Shimadzu HPLC. Substrate and products were detected by measuring absorbance at 274 nm. Reactions with ProcA1.1 were S3

4 stopped by the addition of acetonitrile to a final concentration of 40%. Precipitated protein was removed by filtration using 10,000 Da molecular weight cutoff Amicon centrifugal filters before loading the reactions to a C18 analytical column connected to an Agilent 1100 LC/MSD Trap XCT Plus. Substrate and product were detected by single ion detection, F1Y-ProcA1.1 (m/z = ), prenylated F1YprocA1.1 (m/z = ) and geranylated F1Y-ProcA1.1 (m/z = 1937). Crystallization of PirF and F222APagF Initial crystallization conditions were determined by the sparse matrix sampling method using commercial screens. Optimized crystals for PirF were obtained using sitting drop trays by incubating at 9 o C with 0.1 M bis-tris-propane buffer (ph 7.0) and 1 M sodium citrate. Optimized crystals for F222APagF were obtained by hanging drop method. The protein was incubated at 4 o C with lithium sulfate and 16-22% polyethylene glycol The crystals were soaked in precipitant solution supplemented with 25% threitol for PirF and 30% Glycerol for F222APagF prior to vitrification by direct immersion in liquid nitrogen. Structure Determination of PirF and F222APagF Crystallographic data were collected at LS-CAT (Sector 21, Advanced Photon Source, Argonne National Labs, IL) using MAR CCD detectors. All data were integrated and scaled using autoproc 6. Crystallographic phases for both structures were determined using molecular replacement as implemented as implemented in the Phenix suite of programs 7, using the refined coordinates of the unliganded PagF as a search model. The resultant phases were of sufficient quality to permitted most of the main-chain and more than half of the side-chain residues to be automatically built using ARP/wARP 8. This initial model was refined against all of the data for each structure using REFMAC5 9, and further improved through iterative rounds of manual rebuilding using Coot 10. Cross validation, using 5% of the data for the calculation of the free R factor, was utilized throughout the model-building process in order to monitor building bias 11. X-ray diffraction data from crystals of the ligand complexes were collected and processed in a similar manner. The resultant solutions were subject to initial rounds of automated model building using ARP/wARP, followed by subsequent rounds of manual rebuilding using Coot, interspersed with crystallographic refinement using REFMAC5. Kinetic data analysis S4

5 Kinetic parameters for wild type PagF, wild type PirF, F222APagF, and F222GPagF were determined from reactions containing bis-tris-propane, ph 7.5 (50 mm), MgCl 2 (200 mm), Tyr- Tyr-Tyr (1 mm), F enzyme (5 M), and various concentrations of DMAPP (0.25, 0.5, 0.75, 1.0, 1.5, 2.0, 3.5, 5.0, and 7.5 mm) or GPP (0.1, 0.2, 0.4, 0.8, 1.2, 1.6, 2.0, 3.0, and 4.0 mm). Reactions were pre-heated to 37 C in the absence of isoprenoid donors and initiated by addition of DMAPP or GPP. Reaction mix at each time point (1, 2, 4, 6, 8, 10, 15, and 20 min) was quenched by 10-volume of MeOH and analyzed by HPLC using an analytical Agilent Eclipse XDB-C18 column with a linear gradient from 1 to 100% acetonitrile over 24 minutes in water/0.1% TFA at 0.7 ml min -1. Initial rates of the F enzymes were calculated from the linear part of each assay, where product formation was calculated based on an area ratio of the product to the total substrate and product peak areas in HPLC. Kinetic parameters were determined from a plot of turnovers per minute by a single enzyme vs. isoprenoid donor concentration in a serious of reactions using GraphPad Prism7. The lines in Figures 1 and 2 are the best fit to the Michaelis-Menten equation. Size exclusion chromatography analysis of PirF and F222APagF Protein samples were analyzed using a Superdex /300 GL column equilibrated with buffer containing 20 mm Na-HEPES (ph 7.5) and 500 mm KCl (SI Figure S6). The proteins and standard were prepared to a concentration of 1.5 mg/ml. Of this stock, 200 L were loaded and run at a flow-rate of 1 ml/min. UV absorbance was measured at 280 nm. Samples used for analysis include a standard of albumin (molecular weight of 44 kda), PirF, and F222A-PagF. Note that PirF elutes from the column at a position consistent with a dimer in solution, while F222A-PagF is monomeric. S5

6 Table S1. Primers used for cloning Name PagF-f PagF-r PagF-F222A-f PagF-F222G-f PagF-F222-r PirF-f PirF-r ProcA1.1 Forward ProcA1.1 Reverse ProcA1.1-F91Y-F ProcA1.1-F91Y-R Sequence TACTTCCAATCCAATGCAATGATAGTTAATGTAATCCAAAA TTATCCACTTCCAATGTTATTATCAATTTGACTCCATTTTAAA GCTTCAAGTTTATTTGCTACGGGTTTGTCTAAA GCTTCAAGTTTATTTGGTACGGGTTTGTCTAAA AACTGGATTATTATTTGCTTTAGACAAACCCGT ATGCCATATGCTGAAAGAACAACGTATTAAATTT ATGCCTCGAGTTACTCCATTTTGAATGACTT ACAGCCAGGATCCGAATTCGATGAAAAAGCGACTCAAC TTAAGCATTATGCGGCCGCTCAGCACACATTGATAGT GTGTGGCTGGGGAGTATTTCTGTGTGCAGGGTA TACCCTGCACACAGAAATACTCCCCAGCCACAC S6

7 Table S2. Initial survey of C 5 -C 20 carbon-length isoprenoid donors a Enzyme IPP DMAPP GPP FPP GGPP F222APagF b 17% 66% 7% F222GPagF 29% 68% PagF wt 40% PirF wt 80% These represent initial results from single experiments that were followed up with kinetic studies summarized in Table S1. a Yields were calculated based on the area ratio in HPLC. Reactions contained bis-tris-propane ph 7.5 (50 mm), MgCl 2 (200 mm), F enzyme (5 M), Tyr-Tyr-Tyr (1 mm), and isoprenoid donor (1 mm), and were run at 37 C for 3 hours. b, No reaction. S7

8 Table S3. Data Collection and Refinement statistics PirF F222APagF Data collection Space Group C2 P6 5 Cell: a, b, c (Å) / ( o ) 122.9, 93.9, 93.8 / , 116.7, 43.7 Resolution (Å) ( ) ( ) Total reflections 187, ,518 Unique reflections 71,980 29,304 R sym (%) 10.2 (60.1) 9.8 (108.3) I/ (I) 10.9 (2.6) 24.6 (2.7) Completeness (%) 98.2 (77.7) 100 (98.3) Redundancy 5.1 (5.1) 15.6 (15.3) Refinement Resolution (Å) No. reflections 37,000 27,736 R work / R free 2 Number of atoms 22.4/ /21.6 Protein 4,870 2,471 Ligand - 19 Water B-factors Protein Ligand Water R.m.s deviations Bond lengths (Å) Bond angles ( ) Highest resolution shell is shown in parenthesis. 2. R-factor = ( F obs -k F calc )/ F obs and R-free is the R value for a test set of reflections consisting of a random 5% of the diffraction data not used in refinement. S8

9 Figure S1. Multiple sequence alignment of various F-proteins. Structure based alignment of the primary sequences of PirF from the piricyclamide pathway in Microcystis aeruginosa PCC 7005, PagF from the prenylagaramide pathway in Oscillatoria agardhii NIES 596, TruF from the trunkamide pathway in Prochloron sp A, LynF from the aestuaramide pathway in Lyngbya aestuarii, and KgpF from the Kawaguchipeptin pathway in Microcystis aeruginosa NIES-88. Secondary structures are derived from the crystal structure of PagF. Green star shows residue that makes the pocket for the tail of the isoprenoid donor. Red triangles show residues that interact with isoprenoid donor. S9

10 A PagF F222A-PagF F222 B PagF PirF F222 Figure S2. Superposition of prenylating and geranylating enzymes. (A) Superposition of co-crystal structure of wild type PagF (shown in blue) with bound Tyr-Tyr-Tyr and co-crystal structure of F222A- PagF (shown in tan) with GPP. (B) Superposition of co-crystal structure of wild type PagF (shown in blue) with bound Tyr-Tyr-Tyr and DMAPP with PirF (shown in pink/tan). S10

11 % A m/z m/z m/z B C m/z m/z Figure S3. ESI mass spectra for Tyr-Tyr-Tyr reactions. ESI mass spectra after incubating trityrosine with PirF and GPP (A) or PagF with DMAPP (B) or F222A-PagF with GPP (C). single prenylation of Tyr 3 m/z = 576, double prenylation of Tyr 3 m/z = 644, single geranylation of Tyr 3 m/z = 644, double geranylation of Tyr 3 m/z = m/z S11

12 A B His138 Arg288 Mg Arg65 Tyr290 Glu184 His138 Mg Arg288 Tyr290 Arg65 Leu170 Tyr186 Tyr235 Trp271 Tyr1 Phe222 Lys136 Leu170 Tyr235 Tyr186 Trp271 Leu220 Lys136 Ala222 Glu188 Arg140 Figure S4. Isoprenoid donor interactions. LIGPLOT 5 diagram of (A) DMSPP (purple) interacting with PagF residues in its immediate environment and (B) GPP interacting with F222A-PagF residues in its immediate environment. Hydrogen bonds are shown as green lines, and residues in hydrophobic contacts are represented by red semicircles with radiating spokes. S12

13 YF-ProcA1.1 A YF-ProcA1.1 B + Na + + IAA + BME + 2IAA + BME + IAA C Figure S5. Reactions of modified YF-ProcA1.1. (A) MALDI-TOF mass spectrum of HPLC purified YF-ProcA1.1. (B) MALDI-TOF mass spectrum of peptide from (A) that was treated with iodoacetamide (IAA). (C) MALDI-TOF mass spectrum of peptide from (A) treated with beta-mercaptoethanol (BME) and iodoacetamide (IAA). m/z MALDI ions m/z YF-ProcA1.1+ Na YF-ProcA1.1+ IAA YF-ProcA1.1+BME YF-ProcA1.1+ 2IAA YF-ProcA1.1+BME+IAA S13

14 A 1 minute no enzyme 1 minute F222G-PagF minutes no enzyme 10 minutes F222G-PagF minutes no enzyme 60 minutes F222G-PagF minutes no enzyme 60 minutes F222G-PagF Figure S6: Enzyme reactions with YF-ProcA1.1. A) MALDI-TOF mass spectrum of F222G-PagF (2μM) reactions with YF-ProcA1.1 (40μM) and GPP (500μM) stopped at different time points. B) Percent conversion of YF-ProcA1.1 (green) into geranylated YF-ProcA1.1 (magenta). S14

15 Figure S7: Size-exclusion chromatography analysis of PirF and F222A-PagF. Elution profile of albumin standard (green, 66 kda), Carbonic Anhydrase (purple, 29 kda), PirF (red, 35 kda), and F222G- PagF (blue, 35 kda) using a Superdex /300 GL. S15

16 REFERENCES 1. Hao, Y.; Pierce, E.; Roe, D.; Morita, M.; McIntosh, J. A.; Agarwal, V.; Cheatham, T. E., 3rd; Schmidt, E. W.; Nair, S. K., Proceedings of the National Academy of Sciences of the United States of America 2016, 113 (49), Yu, Y.; Mukherjee, S.; van der Donk W. A., J Am Chem Soc (15) Meyer, H. E.; Heber, M.; Eisermann, B.; Korte, H.; Metzger, J. W.; Jung, G., Analytical Biochemistry 1994, 223, Zhang, Q.; Yu, Y.; Vélasquez, J. E.; van der Donk, W. A., Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (45), Wallace, A. C.; Laskowski, R. A.; Thornton, J. M., Protein Eng. 1995, 8, Vonrhein, C., Flensburg, C., Keller, P., Sharff, A., Smart, O., Paciorek, W., Womack, T.,and Bricogne, G. Data processing and analysiswith the autoproc toolbox. Acta Crystallogr D Biol Crystallogr 67, (2011). 7. Adams PD, et al. (2002) PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr D Biol Crystallogr 58: Cowtan, K. The Buccaneer software for automated model building. 1. Tracing protein chains. Acta Crystallogr D Biol Crystallogr 62, (2006). 9. Murshudov GN, Vagin AA, & Dodson EJ (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr 53: Emsley P & Cowtan K (2004) Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60: Kleywegt GJ & Brunger AT (1996) Checking your imagination: applications of the free R value. Structure 4: S16