Identification, characterization of a flavin-containing monooxygenase MoA and its function in a
|
|
- Anna Bailey
- 6 years ago
- Views:
Transcription
1 1 Applied Microbiology and Biotechnology 2 Supplementary Material 3 4 Identification, characterization of a flavin-containing monooxygenase MoA and its function in a specific sophorolipid molecule metabolism in Starmerella bombicola Running title: Identification, characterization of a flavin-containing monooxygenase Jiashan Li 1, Hui Li 1, Weiwei Li 1, Chengqiang Xia 1, Xin Song 1, 2, * State Key Laboratory of Microbial Technology, School of Life Science, Shandong University, Shan Da Nan Road 27, Jinan, Shandong , P. R. China National Glycoengineering Research Center, Shandong University, Shan Da Nan Road 27, Jinan, Shandong , P. R. China *Corresponding author 15 songx@sdu.edu.cn 16 Tel/Fax:
2 Electronic Supplementary Material Contents 1. Primers used in the construction of deletion cassettes 2. Primers used in identification of deletion mutants 3. Primers used in the construction of overexpression cassette 4. Primers used in construction of recombinant plasmid 5. Identification of total sophorolipids from oleic acid as hydrophobic carbon source 6. Identification of total sophorolipids from linoleic acid as hydrophobic carbon source 7. Identification of sophorolipid substrates by HPLC-MS 2
3 Primers used in the construction of deletion cassettes Electronic supplementary material Table S1 Primers used in the construction of the moa and mob deletion cassettes Gene Primers Sequence (5 to 3 ) moa-5 flankingfor moa-5 flankingrev AAGCTTACGAATGTCAGGTGAA GATTACAGGAATGATACAACAGGCCTCTCGGCATGACGAC moa mob moa-3 flankingfor moa-3 flankingrev moa-gfor moa-grev mob-5 flankingfor mob-5 flankingrev mob-3 flankingfor mob-3 flankingrev mob-gfor mob-grev AGCT GATAATGATTCCGCAGCACAAGCAATATCAGGGTACTTGTG CTT GTCCCATGCTTTATGCTGTG AACAGGTGAGCCCTTCGTGGT AAGTCGCGGTGCAGCAATCA GCTGAGAATCGTACTCGCTGA GATTACAGGAATGATACAACAGGCCAGAAGGCTCTATCTG GAGTATGG GATAATGATTCCGCAGCACAAGCCGCTCGCATATCATGTGG TA TGGATGGAAGACGGCACA TTGATACTGTCATCGAAGGCATAGGA TGCCCTATCCGAGTCTCCAAAC hph hphexfor GGCCTGTTGTATCATTCCTGTA hphexrev GCTTGTGCTGCGGAATCATTA 3
4 Primers used in identification of deletion mutants Electronic supplementary material Table S2 Primers of the deleted coding sequences used in identification of deletion mutants Gene Primers Sequence (5 to 3 ) moa mob moa-cds-for moa-cds-rev mob-cds-for mob-cds-rev GAATAGCTGCAGTCAGAGCCCT TCTCTCTAGCCCCAAGCGAC CTTGTCAGCGAGCCCTATGAT CATGTGCATGTACTCAACATCCG 4
5 Primers used in the construction of overexpression cassette Electronic supplementary material Table S3 Primers used in the construction of Peno::moA overexpression cassette Primers Sequence (5 to 3 ) shph-for shph-rev Peno-for Peno-rev moa-for moa-rev Ttrpc-for Ttrpc-rev 5 flankingfor 5 flankingrev 3 flankingfor 3 flankingrev P-for T-rev OE-nest-for OE-nest-rev GTTAACTAGACGTGCATACATGCGAGTT GAGAGAGTGATTTCTAGCGGCGGCCGCTATGGTTTCCACGTGCACTTACA GCGGCCGCCGCTAGAAATCACTCTCTCGTTTC GGCCCGGGAACGGCCATTTCTAATAGATGTTT TTAGAAATGGCCGTTCCCGGGCCTAGGATGGGCCGCAGGGTTGTT TTCAGTAACGTTAAGTGGATCGGATCCCTAATTGGTGCTGAGTCTCTTCTCT GGATCCGATCCACTTAACGTTACTGAAATCA GTTTAAACAACCCAGGGGCTGGTGAC CAGAAACGGGAATAATGGACATT CTCGCATGTATGCACGTCTAGTTAACGTATGGTCCAGTGGTTTCAAAGGTT GTCACCAGCCCCTGGGTTGTTTAAACTTCTGCAGGAGCGGTTTTG AGCTGTTGAGGCTGATGATAAATC TCCATTACACCCTCGCGGCTCTCTC CAAGAGCGGATTCCTCAGTCT ATGTCACTTCACCGCACACTATTTC TTACTGAAAAATTTCTTGCACCCT 5
6 Primers used in construction of recombinant plasmid Electronic supplementary material Table S4 Primers used in construction of recombinant plasmid pmal-c2x-moa Gene Primers Sequence (5 to 3 ) moa pmal-moa-for TATGGATCCATGGGCCGCAGGGTTGTT pmal-moa-rev TATTCTAGACTAATTGGTGCTGAGTCTCTTCTCT 6
7 Identification of total sophorolipids from oleic acid as hydrophobic carbon source Electronic supplementary material Table S5 Identification of total sophorolipids from oleic acid as hydrophobic carbon source based on m/z peaks of protonated molecular ion No RT (min) MW Sophorolipid analogs Non-acetylated acidic SL with a C 18:2 fatty acid Mono-acetylated acidic SL with a C 18:1 fatty acid Di-acetylated acidic SL with a C 18:2 fatty acid Di-acetylated lactonic SL with a C 18:2 fatty acid Di-acetylated lactonic SL with a C 18:1 fatty acid 7
8 6. Identification of total sophorolipids from linoleic acid as hydrophobic carbon source Electronic supplementary material Table S6 Identification of total sophorolipids from linoleic acid as hydrophobic carbon source based on m/z peaks of protonated molecular ion No RT (min) MW Sophorolipid analogs * Di-acetylated acidic SL with a C 18:2 fatty acid* Mono-acetylated acidic SL with a C 18:0 fatty acid Mono-acetylated acidic SL with a C 18:2 fatty acid Di-acetylated acidic SL with a C 18:2 fatty acid Di-acetylated lactonic SL with a C 18:2 fatty acid Di-acetylated lactonic SL with a C 18:1 fatty acid 8
9 7. Identification of sophorolipid substrates by HPLC-MS Electronic supplementary material Table S7 Identification of sophorolipid substrates by HPLC-MS SL structure M+H-H 2 O M+H M+NH 4 M+Na M+K C18:1 DASL C18:2 DASL C18:1 DLSL
10 Electronic supplementary material Fig. S1 Construction of monooxygenase genes knock-out mutants moa and mob. (a) schematic illustration of the construction of moa/mob gene deletion cassette using double-joint PCR method, (b) schematic illustration of the construction of moa mutant by homologous recombination, (c) schematic illustration of the construction of mob mutant by homologous recombination 10
11 Electronic supplementary material Fig. S2 Construction of monooxygenase A overexpressed mutant (a) schematic illustration of the construction of overexpression cassette through three times of double-joint PCR, (b) the non-coding region was replaced by the overexpression cassette containing hygromycin (hyg) resistance gene sequence homologously 11
12 Electronic supplementary material Fig. S3 The specific MS chromatogram of purified peak 1 and peak 4 from the crude sophorolipids produced by moa. (a) the MS and MS/MS chromatogram of peak 1 [M+H] + = (b) the MS and MS/MS chromatogram of peak 4, [M+H] + = , [M+NH 4 ] + = , [M+K] + = The MS/MS fragments of [M+H] + = 705 were the same between that from peak 1 and peak 4 12
13 Electronic supplementary material Fig. S4 Identification of sophorolipid substrates by HPLC-MS (a) C18:1 DASL, (b) C18:2 DASL, (c) C18:1 DLSL 13
14 Electronic supplementary material Fig. S5 Identification of the products catalyzed by MoA when C18:2 DASL was used as substrates by MS. (a) specific chromatogram of fragments from sophorose with no acetyl [M+H] + = , [M-H 2 O+H] + = ; sophorose with one acetyl [M+H] + = , [M-H 2 O+H] + = ; sophorose with two acetyls [M-H 2 O+H] + = , [M-2H 2 O+H] + = , [M-3H 2 O+H] + = (b) specific chromatogram of fragments from hydroxylated linoleic acid [M+H] + = , [M-H 2 O+H] + =
Research & Reviews: Journal of Microbiology and Biotechnology
Research & Reviews: Journal of Microbiology and Biotechnology e-issn:2320-3528 Alkane Utilization, the Expression and Function of Cytochrome P450 in Sophorolipid Synthesis in Starmerella bombicola CGMCC
More informationStructural determination and chemical esterification of the sophorolipids. produced by Candida bombicola grown on glucose and α- linolenic acid
Structural determination and chemical esterification of the sophorolipids produced by Candida bombicola grown on glucose and α- linolenic acid Reetika Gupta and Asmita A. Prabhune* Division of Biochemical
More informationList of Figure. Figure 1.1. Selective pathways for the metabolism of arachidonic acid
List of Figure Figure 1.1. Selective pathways for the metabolism of arachidonic acid Figure 1.2. Arachidonic acid transformation to ω and ω-1 hydroxylase 14 19 reaction mediated by cytochrome P450 enzyme
More informationSupplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted. residues are colored red. Numbers indicate the position of each residue.
Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted residues are colored red. Numbers indicate the position of each residue. Supplementary Figure 2. SDS-PAGE analysis of purified recombinant
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationProperty control of sophorolipids: influence of fatty acid substrate and blending
Biotechnol Lett (28) 3:193 11 DOI 1.17/s1529-8-9653-1 ORIGINAL RESEARCH PAPER Property control of sophorolipids: influence of fatty acid substrate and blending Richard D. Ashby Æ Daniel K. Y. Solaiman
More informationQuaternary ammonium sophorolipids as renewable based antimicrobial products
Quaternary ammonium sophorolipids as renewable based antimicrobial products E.I.P. Delbeke 1, B.I. Roman 1, S.L.K.W. Roelants 2,3, I.N.A. Van Bogaert 2, G.B. Marin 4, K.M. Van Geem 4 and C.V. Stevens 1,
More informationOrganic Chemistry Laboratory Fall Lecture 3 Gas Chromatography and Mass Spectrometry June
344 Organic Chemistry Laboratory Fall 2013 Lecture 3 Gas Chromatography and Mass Spectrometry June 19 2013 Chromatography Chromatography separation of a mixture into individual components Paper, Column,
More informationSupporting Information. 58 Pages. 6 Figures 4 Tables
Light-Source-Dependent Effects of Main Water Constituents on Photodegradation of Phenicol Antibiotics: Mechanism and Kinetics Linke Ge, Jingwen Chen, * Xianliang Qiao, Jing Lin, Xiyun Cai Key Laboratory
More informationSupporting Information
Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,
More informationSUPPLEMENTARY DATA. Materials and Methods
SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters
More informationThe Impact of a Transposon Insertion in phzf2 on the Specialized Metabolite. Production and Interkingdom Interactions of Pseudomonas aeruginosa
1 2 3 Supplemental Material The Impact of a Transposon Insertion in phzf2 on the Specialized Metabolite Production and Interkingdom Interactions of Pseudomonas aeruginosa 4 5 6 7 Vanessa V. Phelan a, Wilna
More informationSupporting Information
Supporting Information For Heterologous production of thiostrepton A and biosynthetic engineering of thiostrepton analogs Chaoxuan Li, Feifei Zhang, and Wendy L. Kelly* Table of Contents Figure S1. PCR
More informationInhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS
SUPPLEMENTARY MATERIALS Inhibitory Effect of Methotrexate on Rheumatoid Arthritis Inflammation and Comprehensive Metabolomics Analysis Using UPLC-Q/TOF-MS Zhiqiang Pang 1, Guoqiang Wang 1, Nan Ran 1, Hongqiang
More informationAnalysis of Limonin in Citrus Juice Using QuEChERS and LC-MS/MS
Analysis of Limonin in Citrus Juice Using QuEChERS and LC-MS/MS UCT Part Numbers ECQUEU7-MP Mylar pouch containing 4g MgSO4, 1g NaCl, 1g Na3Cit 2H2O and 0.5g Na2Cit 1.5H2O CUMPSC1875CB2CT 2mL dspe tube
More informationMALDI Activity 4 MALDI-TOF Mass Spectrometry: Data Analysis
MALDI Activity 4 MALDI-TOF Mass Spectrometry: Data Analysis Model 1: Introduction to Triacylglycerides (TAGs) In MALDI Activity 3 you learned how to open your raw mass spectrum data and use the MMass program
More informationA New Look at Old Stuff. Molecular Heterogeneity of Polysorbates and Its Implications Studied with LC-MS.
Slide 1 A New Look at Old Stuff. Molecular Heterogeneity of Polysorbates and Its Implications Studied with LC-MS. Oleg Borisov 9th Symposium on the Practical Applications of Mass Spectrometry in the Biotechnology
More informationThe growth analysis of ylsnf1 gene deletion mutant of Yarrowia lipolytica on hydrophobic substrate media
The growth analysis of ylsnf1 gene deletion mutant of Yarrowia lipolytica on hydrophobic substrate media Napapol Poopanitpan 1,*, Threesara Lertvatasilp 1, Narisa Poonsub 1, Prapasiri Jantanee 1, Sasimanas
More informationIon fragmentation of small molecules in mass spectrometry
Ion fragmentation of small molecules in mass spectrometry Jeevan Prasain jprasain@uab.edu 6-2612 Nomenclature: the main names and acronyms used in mass spectrometry Molecular ion: Ion formed by addition
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationUnraveling and engineering the production of 23,24-bisnorcholenic steroids in sterol metabolism
Unraveling and engineering the production of 23,24-bisnorcholenic steroids in sterol metabolism Li-Qin Xu, Yong-Jun Liu, Kang Yao, Hao-Hao Liu, Xin-Yi Tao, Feng-Qing Wang*, Dong-Zhi Wei* State Key Laboratory
More informationSupplementary Figure 1
Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR
More informationRe-configuring Yarrowia lipolytica lipogenesis platform towards free fatty acid and biofuel production
Re-configuring Yarrowia lipolytica lipogenesis platform towards free fatty acid and biofuel production Yonghong Meng, Ali Abghari, Rishikesh Ghogare, Xiaochao Xiong, GuokunWang, and Shulin Chen Bioprocessing
More informationIdentification & Confirmation of Structurally Related Degradation Products of Simvastatin
Identification & Confirmation of Structurally Related Degradation Products of Simvastatin Power of QTRAP Systems for Identification and Confirmation of Degradation Products Dilip Reddy 1, Chandra Sekar
More informationSupporting information
Supporting information Figure legends Supplementary Table 1. Specific product ions obtained from fragmentation of lithium adducts in the positive ion mode comparing the different positional isomers of
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationResistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
More informationSupplementary Figure 1. Chemical structures of activity-based probes (ABPs) and of click reagents used in this study.
Supplementary Figure 1. Chemical structures of activity-based probes (ABPs) and of click reagents used in this study. In this study, one fluorophosphonate (FP, 1), three nitrophenol phosphonate probes
More informationSulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms
Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli
More informationPhosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans
SUPPLEMENTARY INFORMATION Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans Sebastian Boland, Ulrike Schmidt, Vyacheslav Zagoriy, Julio L. Sampaio, Raphael Fritsche,
More informationSolid State Fermentation (SSF) for the Production of Sophorolipids from Starmerella bombicola NRRL Y using glucose, wheat bran and oleic acid
Solid State Fermentation (SSF) for the Production of Sophorolipids from Starmerella bombicola NRRL Y-17069 using glucose, wheat bran and oleic acid Vishal J. Parekh and Aniruddha B. Pandit * Department
More informationSupplementary Information
Supplementary Information Using the pimeloyl-coa synthetase adenylation fold to synthesise fatty acid thioesters Menglu Wang 1a ; Lucile Moynié 2a, Peter J. Harrison 1, Van Kelly 1, Andrew Piper 1, James
More informationSupporting Information. Transformation Pathways of the Recalcitrant Pharmaceutical Compound
Supporting Information Transformation Pathways of the Recalcitrant Pharmaceutical Compound Carbamazepine by the White-Rot Fungus Pleurotus ostreatus: Effects of Growth Conditions Naama Golan-Rozen 1 ;
More informationIdentification of Structural Isomers of Methylated Flavonoids by UHPLC Coupled with High Resolution Q-TOF Mass Spectrometry
Identification of Structural Isomers of Methylated Flavonoids by UHPL oupled with High Resolution Q-TF Mass Spectrometry pplication Note uthors hengying Ma, Haipeng Lv, Xinzhong Zhang, Zongmao hen, Jiang
More informationSupplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
More informationLC-MS Analysis of Botanicals
Botanical workshop UAB, Sept 11, 26 LC-MS Analysis of Botanicals Jeevan K. Prasain, Ph.D. Department of Pharmacology & Toxicology, UAB Purdue-UAB Botanicals Center for Age-related Disease Applications
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 17084 Metabolic anticipation in Mycobacterium tuberculosis Hyungjin Eoh, Zhe Wang, Emilie Layre,
More informationDirect Regioselective Esterification at O-2 of β- Cyclodextrin and Hydrolysis by Neighboring-group Participation
ISSN: 0973-4945; CDEN ECJHA E- Chemistry http://www.ejchem.net 2012, 9(3), 1562-1568 Direct Regioselective Esterification at -2 of β- Cyclodextrin and Hydrolysis by Neighboring-group Participation ZHI-ZHNG
More informationTandem mass spectrometry analysis of prostaglandins and isoprostanes
Tandem mass spectrometry analysis of prostaglandins and isoprostanes Jeevan Prasain jprasain@uab.edu 6-2612 verview Introduction to PGs and their synthesis Mass spectrometry characterization of PGs and
More informationInvestigations of Pactamycin Biosynthesis Andrew Osborn
Investigations of Pactamycin Biosynthesis Andrew Osborn Research Mentors: Dr. Taifo Mahmud, Dr. Kerry McPhail A Bioresource Research Thesis Seminar Presentation Streptomyces pactum produces the antitumor
More informationPost-PKS tailoring steps of the spiramycin. macrolactone ring in Streptomyces ambofaciens
Post-PKS tailoring steps of the spiramycin macrolactone ring in Streptomyces ambofaciens Hoang-Chuong NGUYEN, Emmanuelle DARBN, Robert THAI, Jean-Luc PERNDET, Sylvie LAUTRU SUPPLEMENTARY DATA 1 Figure
More informationglpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda
PvuI 2.0 k PvuI PvuI Rv1101c Rv1100 glpx fum 4.4 k PvuI PvuI ΔglpX Rv1101c Rv1100 HygR fum ΔglpX 5 k 4 k 3 k c 75 kda 50 kda 37 kda GLPX Δ Δ/C GLPX 2 k 1.5 k 25 kda 20 kda PRCB 1 k 0.5 k Supplementary
More informationDevelopment of production processes for new-to-nature biosurfactants
Development of production processes for new-to-nature biosurfactants Tiago José Sequeira Albano a,b Under Supervision of Professor Nuno Mira a and Doctor Sophie Roelants b a Department of Bioengineering,
More informationReviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author:
Reviewers' comments: Reviewer #1 (expert in lipid metabolism) Remarks to the Author: In the manuscript by Ohno et al, the authors set out to identify the enzyme responsible for the ester bond formation
More informationSupplementary Note 1: Interpretation of the proposed mechanisms for the main dissociative
Supplementary Note 1: Interpretation of the proposed mechanisms for the main dissociative pathways of the activated lipoamino acid ions. In this study, dissociations of deprotonated N-acyl aminoacids and
More informationPreparation and Characterization of Cysteine Adducts of Deoxynivalenol
Preparation and Characterization of Cysteine Adducts of Deoxynivalenol Ana Stanic, Silvio Uhlig, Anita Solhaug, Frode Rise, Alistair L. Wilkins, Christopher O. Miles S1 Figure S1. 1 H spectrum of 1 (DON)
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationLecture 10: MS Interpretation Part 4 Postulation of Molecular Structures
Lecture 10: MS Interpretation Part 4 Postulation of Molecular Structures CU- Boulder CHEM 5181 Mass Spectrometry & Chromatography Prof. Jose-Luis Jimenez Postulation of Molecular Structures There are several
More informationAutomated Purification and Analytical Reinjection of a Small Molecule Drug, Probenecid, on a Gilson LC/MS Dual Function System
Automated Purification and Analytical Reinjection of a Small Molecule Drug, Probenecid, on a Gilson LC/MS Dual Function System Keywords Introduction Application Note PHA0413 High Pressure Liquid Chromatography
More informationKazusa DNA Res Inst. Daisuke Shibata
Workshop Argentina-Japan Bioscience and Biotechnology for the promotion of Agricutulure and Food Production August 3 rd to 7 th 2009- Metabolite Metabolomics Databases approaches for Plant for Agro-Biotechnology
More informationapplication Natural Food Colorants Analysis of Natural Food Colorants by Electrospray and Atmospheric Pressure Chemical Ionization LC/MS
application LC/MS Natural Food Colorants Analysis of Natural Food Colorants by Electrospray and Atmospheric Pressure Chemical Ionization LC/MS Introduction Many kinds of natural colors are used in beverages,
More informationBioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation
Bioactivity Based Molecular Networking for the Discovery of Drug Lead in Natural Product Bioassay-Guided Fractionation Louis-Félix Nothias,,, Mélissa Nothias-Esposito,, # Ricardo da Silva,, Mingxun Wang,,,
More informationSupporting Information
Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per
More informationSupporting Information. Enzymatic synthesis of electrospinnable poly(butylene succinate-co-dilinoleic. succinate) thermoplastic elastomer
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Supporting Information Enzymatic synthesis of electrospinnable poly(butylene succinate-co-dilinoleic
More informationCHAPTER 2 Non-Volatile Floral Oils of Diascia spp. (Scrophulariaceae)*
CHAPTER 2 (Scrophulariaceae)* Summary The floral oils of Diascia purpurea, D. vigilis, D. cordata, D. megathura, and D. integerrima (Scrophulariaceae) have been selectively collected from trichome elaiophores.
More informationDevelopment of a Bioanalytical Method for Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid
Development of a Bioanalytical Method for Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid Joanne ( 乔安妮 ) Mather Senior Scientist Waters Corporation Data courtesy of Erin Chambers and Mary
More informationGlycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationChapter 12 Nutrition
Chapter 12 Nutrition Nutrients macronutrients: large required daily quantities carbohydrates, lipids, proteins micronutrients: small required daily quantities vitamins, minerals Also required: water and
More informationSupporting Information
Supporting Information Developing Activity Localization Fluorescence Peptide Probe Using Thiol-Ene Click Reaction for Spatially Resolved Imaging of Caspase-8 in Live Cells Wei Liu,, Si-Jia Liu,, Yong-Qing
More informationTopic 6 Structure Determination Revision Notes
1) Introduction Topic 6 Structure Determination Revision Notes Mass spectrometry, infrared spectroscopy and NMR spectroscopy can be used to determine the structure of unknown compounds 2) Mass spectrometry
More informationDetermination of red blood cell fatty acid profiles in clinical research
Application Note Clinical Research Determination of red blood cell fatty acid profiles in clinical research Chemical ionization gas chromatography tandem mass spectrometry Authors Yvonne Schober 1, Hans
More informationSupplementary Material
Supplementary Material Mechanisms for the formation of secondary organic aerosol components from the gasphase ozonolysis of α-pinene, Yan Ma, Andrew T. Russell and George Marston*. Mass spectral data of
More informationAnalysis of FAMEs Using Cold EI GC/MS for Enhanced Molecular Ion Selectivity
APPLICATION NOTE Gas Chromatography/ Mass Spectrometry Author: Adam Patkin PerkinElmer, Inc. Shelton, CT Analysis of FAMEs Using GC/MS for Enhanced Molecular Ion Selectivity Introduction Characterization
More informationBiomolecular Mass Spectrometry
Lipids ot different than other organic small molecules Carbohydrates Polymers of monosaccharides linked via glycosidic bonds (acetals/ ketals) many different combinationsvery interesting no time ucleic
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/0/493/eaal54/dc Supplementary Materials for A systems approach for discovering linoleic acid derivatives that potentially mediate pain and itch Christopher E.
More informationIron depletion enhances production of antimicrobials by Pseudomonas
Iron depletion enhances production of antimicrobials by Pseudomonas aeruginosa. Angela T. Nguyen 1, Jace W. Jones 1, Max A. Ruge 1, Maureen A. Kane 1, and Amanda G. Oglesby-Sherrouse 1,2 * University of
More informationSupporting Information. Nitrodibenzofuran: a One- and Two-Photon Sensitive Protecting Group that is Superior to
Supporting Information Nitrodibenzofuran: a One- and Two-Photon Sensitive Protecting Group that is Superior to Brominated Hydroxycoumarin for Thiol Caging in Peptides M. Mohsen Mahmoodi, Daniel Abate-Pella,
More informationDr. Erin E. Chambers Waters Corporation. Presented by Dr. Diego Rodriguez Cabaleiro Waters Europe Waters Corporation 1
Development of an SPE-LC/MS/MS Assay for the Simultaneous Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid in Support of Alzheimer s Research Dr. Erin E. Chambers Waters Corporation Presented
More informationNuclear Magnetic Resonance (NMR) Application Note Spectroscopy applied to the analysis of Pulsar 002 Unsaturated Fat content in Seed Oils
Nuclear Magnetic Resonance () Application Note Spectroscopy applied to the analysis of Pulsar 002 Unsaturated Fat content in Seed ils Background The constituents of plant derived oil fall under the general
More informationSupplementary Materials. Fast direct detection of natural dyes in historic and prehistoric textiles by Flowprobe -ESI- HRMS
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Supplementary Materials Fast direct detection of natural dyes in historic and prehistoric textiles
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationChapter 6 IDENTIFICATION AND CHARACTERIZATION OF FLAVONOIDS BY HPLC AND LC-MS/MS ANALYSIS
Chapter 6 IDENTIFICATION AND CHARACTERIZATION OF FLAVONOIDS BY HPLC AND LC-MS/MS ANALYSIS 6.1 Introduction This chapter discusses the method development carried out for the identification and characterization
More informationMetabolite identification in metabolomics: Metlin Database and interpretation of MSMS spectra
Metabolite identification in metabolomics: Metlin Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu Outline Introduction
More informationPreparation of 20-HETE using multifunctional enzyme type 2-negative Starmerella bombicola
methods Preparation of 20-HETE using multifunctional enzyme type 2-negative Starmerella bombicola Inge Van Bogaert, 1, * Guodong Zhang, 1,2,, Jun Yang, Jun-Yan Liu, Yonghao Ye, ** Wim Soetaert, * and Bruce
More informationElementary tetrahelical protein design for diverse oxidoreductase functions
Title: Elementary tetrahelical protein design for diverse oxidoreductase functions Authors: Tammer A. Farid 1,4, Goutham Kodali 1,4, Lee A. Solomon 1,4, Bruce R. Lichtenstein 1,2, Molly M. Sheehan 1, Bryan
More informationWe have changed the manuscript in accordance with the reviewer s suggestions, and have addressed the reviewer s comments as follows:
Author s response to reviews Title: Widespread hepatitis B virus genotype G (HBV-G) infection during the early years of the HIV epidemic in the Netherlands among men who have sex with men Authors: Marion
More informationQuantification of PtdInsP 3 molecular species in cells and tissues by mass spectrometry
Nature Methods Quantification of PtdInsP 3 molecular species in cells and tissues by mass spectrometry Jonathan Clark, Karen E Anderson, Veronique Juvin, Trevor S Smith, Fredrik Karpe, Michael J Wakelam,
More information2-more complex molecules (fatty acyl esters) as triacylglycerols.
** Fatty acids exist in two forms:- 1-free fatty acids (unesterified) 2-more complex molecules (fatty acyl esters) as triacylglycerols. ** most tissues might use fatty acids as source of energy during
More informationSupporting Information for Manuscript es w. The Effect of Solvent on the Analysis of Secondary Organic Aerosol Using
Supporting Information for Manuscript es200801226w The Effect of Solvent on the Analysis of Secondary Organic Aerosol Using Electrospray Ionization Mass Spectrometry Adam P. Bateman 1, Maggie L. Walser
More informationMass Spectrometry Infrastructure
Mass Spectrometry Infrastructure Todd Williams, Ph.D. Director KU Mass Spectrometry and Analytical Proteomics Laboratory Mass Spectrometry Lab B025 Malott Hall Mission The Mass Spectrometry and analytical
More informationTHE JOURNAL OF ANTIBIOTICS. Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1. II. Structure Determination
THE JOURNAL OF ANTIBIOTICS Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1 II. Structure Determination ISAO MOMOSE, WEI CHEN, HIKARU NAKAMURA, HIROSHI NAGANAWA, HIRONOBU IINUMA and TOMIO
More informationMethods in Mass Spectrometry. Dr. Noam Tal Laboratory of Mass Spectrometry School of Chemistry, Tel Aviv University
Methods in Mass Spectrometry Dr. Noam Tal Laboratory of Mass Spectrometry School of Chemistry, Tel Aviv University Sample Engineering Chemistry Biology Life Science Medicine Industry IDF / Police Sample
More informationChap 3 Metabolism and Growth
Chap 3 Metabolism and Growth I. Metabolism Definitions: Metabolism includes two parts: anabolism and catabolism Catabolism: Anabolism: Aerobic metabolism: catabolism anabolis m catabolis anabolis m Anaerobic
More informationCh. 9 Cell Respiration. Title: Oct 15 3:24 PM (1 of 53)
Ch. 9 Cell Respiration Title: Oct 15 3:24 PM (1 of 53) Essential question: How do cells use stored chemical energy in organic molecules and to generate ATP? Title: Oct 15 3:28 PM (2 of 53) Title: Oct 19
More informationSteps Towards Deciphering the Post-Polyketide Synthase Tailoring Steps in the Phoslactomycin Biosynthesis Pathway
Portland State University PDXScholar Dissertations and Theses Dissertations and Theses Spring 7-23-2015 Steps Towards Deciphering the Post-Polyketide Synthase Tailoring Steps in the Phoslactomycin Biosynthesis
More informationSupporting Information:
Supporting Information: ESI-MS Studies and Calculations on 2 nd Generation Grubbs and on Hoveyda-Grubbs thenium Olefin Metathesis Catalysts Hao-Yang Wang a, Wai-Leung Yim b, Yin-Long Guo a, and Jürgen
More informationMS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine
Application Note: 346 MS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine Gargi Choudhary and Diane Cho, Thermo Fisher Scientific, San Jose, CA Wayne Skinner and
More informationMetabolite identification in metabolomics: Database and interpretation of MSMS spectra
Metabolite identification in metabolomics: Database and interpretation of MSMS spectra Jeevan K. Prasain, PhD Department of Pharmacology and Toxicology, UAB jprasain@uab.edu utline Introduction Putative
More informationMS1 and MS2 crosstalk in label free quantitation of mass spectrometry data independent acquisitions
MS1 and MS2 crosstalk in label free quantitation of mass spectrometry data independent acquisitions MS1 528.18 +++ m/z 568.98 ++ m/z 678.34 ++ m/z MS2/SWATH June 9th, 2013 Matthew J. Rardin SIRT3 regulated
More informationIdentification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66
SUPPORTING INFORMATION belonging to the manuscript: Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66 by Changsheng Wu 1, 2, Gilles P. van Wezel 1, *, and Young Hae
More informationSupplemental Data Functional characterization of core components of the Bacillus subtilis c- di-
Supplemental Data Functional characterization of core components of the Bacillus subtilis c- di- GMP signaling pathway Xiaohui Gao 1,3, Sampriti Mukherjee 2, Paige M. Matthews 1, Loubna A. Hammad 1, Daniel
More informationAutomated Lipid Identification Using UPLC/HDMS E in Combination with SimLipid
Automated Lipid Identification Using UPLC/HDMS E in Combination with SimLipid Giorgis Isaac, Stephen McDonald, Giuseppe Astarita Waters Corporation, Milford, MA, USA A P P L I C AT ION B E N E F I T S
More informationSupplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
More informationApplying Molecular Networking for the Detection of
Supporting Information Applying Molecular Networking for the Detection of Natural Sources and Analogues of the Selective Gq Protein Inhibitor FR900359 Raphael Reher, Markus Kuschak, Nina Heycke, Suvi Annala,
More informationSupplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
More informationAnalysis of fatty acid metabolism using Click-Chemistry and HPLC-MS
Analysis of fatty acid metabolism using Click-Chemistry and HPLC-MS Alexander J. Pérez and Helge B. Bode -Supporting Information- Contents Experimental section Supplementary figures NMR spectra Page S2
More informationAnalysis of Sphingosine Kinase Activity in Single Natural Killer Cells from Peripheral Blood
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information: Analysis of Sphingosine Kinase Activity in Single
More informationSCS Mass Spectrometry Laboratory
SCS Mass Spectrometry Laboratory Contact Information Staff 31 Noyes Laboratory (8:00-5:00 M-F) 217-333-2545 http://scs.illinois.edu/massspec/ Furong Sun (frs@illinois.edu) Furong Sun Director Training
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Artepillin C, is it a good marker for quality control of Brazilian Green Propolis? Cui-ping Zhang 1, Xiao-ge Shen 1, Jia-wei Chen 1, Xia-sen Jiang 1, Kai Wang 2, Fu-liang Hu 1 *
More information