Direct Response Diagnostics
|
|
- Emmeline Hawkins
- 6 years ago
- Views:
Transcription
1 Direct Response Diagnostics Overview of Point-of-care Systems
2 Introduction Product overview/table of contents In 2003 Sysmex launched the poch-100i. It was the first Sysmex analyser that was made for point-of-care (POC) use. To this day, poch-100i is one of the most used haematology analysers in a POC environment... We are happy to present you an overview of POC products available in the Benelux countries Haematology Haematology Clinical Chemistry Cardialogy Clinical Chemistry Clinical Chemistry and Haematology Blood Gas 2 3
3 XP-300 Automated Haematology Analyser The Sysmex XP-300 was launched in It is an automated 3-part differential haematology analyser and a great choice for laboratories that need robust, reliable service and highquality diagnostic results. Parameters WBC, RBC, HGB, HCT, MCV, MCH, MCHC, PLT, LYM#, LYM%, MXD#, MXD%, NEUT#, NEUT%, RDW-SD, RDW-CV, PDW, MPV, P-LCR, PCT 4 Whole blood 1 minute ~ 50 µl per test 42.0 (W) x 35.5 (D) x 48.0 (H) cm Performs rapid and accurate analysis of a 17-parameter CBC n Same detection method as Sysmex high-end systems n Non-toxic, biodegradable reagents n 5
4 poch-100i Automated Haematology Analyser The poch-100i has been used for analysing blood samples for over a decade. This robust analyser has a closed module and is frequently used in hospitals, laboratories and clinics. Parameter WBC, RBC, HGB, HCT, MCV, MCH, MCHC, PLT, LYM#, LYM%, MXD#, MXD%, NEUT#, NEUT%, RDW-SD, RDW-CV, PDW, MPV, P-LCR Whole blood 2.5 minutes 15 µl per test 18.5 (W) x 46.0 (D) x 35.0 (H) cm n Proven technology for accuracy and results n Closed tube patient and QC sampling n Small and compact analyzer ideal for POCT 6 7
5 Fuji DRI-CHEM NX500 Clinical chemistry Analyser FUJI DRI-CHEM NX500, developed by FUJIFILM, is a dry chemistry system that is particularly flexible due to the test-based parameter selection. The analyser is especially popular in satellite laboratories. Whole blood, Serum or Plasma 1 to 6 minutes ~ 10 µl per test 47.0 (W) x 36.0 (D) x 42.0 (H) cm Parameter Measurement range Measurement time (min.) ALP U/L 4 AMYL U/L 5 CHE U/L 4.5 CKMB U/L 5 CPK U/L 4 GGT U/L 5 GOT/AST U/L 4 GPT/ALT U/L 4 LAP U/L 4 LDH U/L 2 LIP U/L 5 ALB g/l 6 BUN mmol/l 4 Ca mmol/l 4 CRE µmol/l 5 DBIL µmol/l 5 GLU mmol/l 6 HDL-C mmol/l 2 IP mmol/l 5 Mg mmol/l 4.5 NH µmol/l 2 TBIL µmol/l 6 TCHO mmol/l 6 TCO mmol/l 5 TG mmol/l 4 TP g/l 6 UA µmol/l 4 NA mmol/l 1 K mmol/l 1 Cl g/l 1 CRP 3 70 µmol/l 5 n Plasma filter to separate the whole blood within 1 minute n Combine your own test panel with single test slides n Dry chemistry 8 Fuji DRI-CHEM NX500 is a registered product of FUJIFILM Corporation 9
6 PATHFAST A compact immunoanalyser The PATHFAST system combines the accuracy of a fullscale lab analyser with the flexibility of a mobile solution. High precision makes this analyser an adequate satellite of a full-scale lab on a cardiology, intensive care or emergency ward. PATHFAST is also an ideal supplement or back-up system in central labs. Parameter Trop I sensitive, NTproBNP, D-Dimer, hscrp, Myoglobin, HCG, CK-MB mass, Presepsin Whole blood ~ 16 minutes 100 µl 37.5 (W) x 57.0 (D) x 51.0 (H) cm n Superior assay performance n Six results in less than 16 minutes n Improved ease-of-use 10 PATHFAST is a registered product of Mitsubishi Chemical Europe GmbH 11
7 Piccolo Xpress Clinical chemistry analyser Piccolo Xpress, developed by Abaxis, analyses over 30 parameters across 16 complete panels. The analyser is frequently used in pediatric, stroke, geriatric and neonatalogy wards. Other institutions include rehab centers and nursing homes. Parameter Lipid Panel Lipid Panel Plus Liver Panel Plus General Chemistry 6 General Chemistry 13 AmLyte 13 Comprehensive Metabolic Panel Basic Metabolic Panel Basic Metabolic Panel Plus MetLyte 8 Panel MetLac 12 Panel MetLyte Plus CRP Renal Function Panel Kidney Check Hepatic Function Panel BioChemistry Panel Plus Electrolyte Panel ALB n n n n n n n n Albumin ALP n n n n n Alkaline phosphatase ALT n n n n n n n n Alanin aminotransferase AST n n n n n n n n Aspartate aminotransferase BUN n n n n n n n n n n n n Blood Urea Nitrogen * Ca n n n n n n n n Calcium CK n n n Creatin Kinase Cl n n n n n n n n Chloride CRE n n n n n n n n n n n n Creatinine GFR * n n n n n n n n n n n Glomerular Filtration Rate * CRP n n n C-Reactive Protein DBIL n Direct Bilirubin GGT n n n n Gamma glutamyltransferase GLU n n n n n n n n n n n n Glucose K + n n n n n n n n n Potassium LAC n Lactate LDH n Lactate Dehydrogenase Mg n n Magnesium Na + n n n n n n n n n Sodium PHOS n n Phosphorus AMY n n n n Amylase TBIL n n n n n Total bilirubin tco n n n n n n n n 2 Total carbon dioxide Whole blood, Serum or Plasma 12 minutes per disk ~ 100 µl per test 14.9 (W) x 21.0 (D) x 32.5 (H) cm TP n n n n n Total protein UA n n Uric Acid CHOL n n Total cholesterol CHOL/HDL * n n Total cholesterol/hdl ratio * HDL n n High-Density Lipoprotein LDL * n n Low Density Lipoprotein * TRIG n n Triglycerides n Complete test panels n Minimal handling n Wet chemistry VLDL * n n Very Low Density Lipoprotein * nhdlc * n n non-hdl Colesterol * * Calculated value 12 Piccolo Xpress is a registered product of Abaxis Inc
8 CUBE-S The pocket size laboratory Parameter Field of use Sample material Sample volume In 2016 Eurolyser launched the new CUBE-S. This new version has an automatic haematocrit correction and additional parameters. The CUBE-S can be used in hospitals, satellite laboratories and general practitioners offices. This product is distributed by Sysmex in Belgium only. CRP Inflammation Status Serum or Whole blood 5 µl hscrp Cardiological Risk Serum or Whole blood 20 µl HbA 1c Diabetes Monitoring Whole blood 10 µl Cystatin C Diabetes Monitoring / Renal Diagnostics Serum or Whole blood 20 µl PT (INR) Coagulation Monitoring Whole blood 20 µl D-Dimer Coagulation Monitoring/Thrombosis Diagnostics Plasma 20 µl Ferritin Iron deficiency disorders Serum 50 µl Troponin I Cardiological Risk Serum 50 µl Lipoprotein (a) Cardiological Risk Serum or Plasma 10 µl Hb Iron Deficiency Disorders Whole Blood 20 µl LDL Cholestrol Cardiological Risk Serum or Plasma 10 µl ASO Infection Diagnostics Serum or Whole blood 5 µl µalb Diabetes Monitoring/ Renal Diagnostics Urine 20 µl K+ Potassium Cardiological Risk Serum or Plasma 20 µl Whole blood, Serum or Plasma From 1 minute From 5 µl 16.0 (W) x 14.5 (D) x 13.5 (H) cm n Sample tube with capillary n Maintenance free n Android app-based software 14 Eurolyser CUBE is a registered product of Eurolyser Diagnostica GmbH 15
9 OPTI CCA-TS2 Portable Blood Gas Analyser The OPTI CCA-TS2 bloodgas analyser is manufactured by OPTImedical, based in Atlanta (US). The analyser is robust, portable and maintenance-free. It is suitable for daily or irregular use. B-60 B E E-CI E-Ca E-Glu E-BUN B-Lac ph X X X X X X X X pco 2 X X X X X X X X* po 2 X X X X X X X X thb X X X X X X X so2 X X X X X X X Na + X X X X X K + X X X X X CI - X CA ++ Glucose BUN(Urea) Lactate X X X X *Pending FDA 510k clearance Whole blood, Serum or Plasma ~ 2 minutes 125 µl, (60 µl for B-60 casette) 36.2 (W) x 23.0 (D) x 12.0 (H) cm n Low risk on pre-analytical errors n Maintenance free n Optional: Battery operated 16 OPTI CCA-TS2 is a registred product of IDEXX laboratories, Inc
10 Bibliography XP-300 van Dievoet MA, Louagie H & Ghys T. (2016): Performance evaluation of the Sysmex XP-300 in an oncology setting: evaluation and comparison of hematological parameters with the Sysmex XN International Journal of Laboratory Hematology. 38(5), poch-100i Briggs C, Kunka S, Pennaneach C, Forbes L & Machin SJ. (2002): Performance evaluation of a new compact hematology analyzer, the Sysmex poch-100i. Laboratory hematology: official publication of the International Society for Laboratory Hematology. 9(4), Whisler S & Dahlgren C. (2004): Performance evaluation of the Sysmex poch-100i automated hematology analyzer. Laboratory hematology: official publication of the International Society for Laboratory Hematology. 11(2), Fuji DRI-CHEM NX500 Yang JH, Kim JH, Lee JY, Choi KY, Lee SW, Lee YS,... & Kwon SY. (2014): Evaluation of Point-of-Care Testing Devices for Pre-donation Alanine Aminotransferase Test. Korean Journal of Blood Transfusion. 25(2), Piccolo Xpress Park H, Ko DH, Kim JQ & Song SH. (2009): Performance evaluation of the Piccolo xpress Point-of-care Chemistry Analyzer. The Korean journal of laboratory medicine. 29(5), Owen WE, Caron JE & Genzen JR. (2015): Liver function testing on the Abaxis Piccolo Xpress: Use in Ebola virus disease protocols. Clinica Chimica Acta. 446, Simpson P, Jolly L, Tirimacco R, Gill J & Tideman P. (2010): Evaluation of the lipid panel on the Abaxis Piccolo Xpress to determine its potential as a point-of-care instrument in a nonlaboratory setting. Point of Care. 9(1), CUBE-S Brouwer N & van Pelt J. (2015): Validation and evaluation of eight commercially available Point of Care CRP methods. Clinica Chimica Acta. 439, OPTI CCA-TS2 Schlebusch H, Paffenholz I, Zerback R & Leinberger R. (2001): Analytical performance of a portable critical care blood gas analyzer. Clinica chimica acta. 307(1), PATHFAST Kurihara T, Yanagida A, Yokoi H, Koyata A, Matsuya T, Ogawa J,... & Miyamoto D. (2008): Evaluation of cardiac assays on a benchtop chemiluminescent enzyme immunoassay analyzer, PATHFAST. Analytical biochemistry. 375(1),
11 Design and specifications may be subject to change due to further product development. Changes are confirmed by their appearance on a newer document and verification according to its date of issue. Copyright 2017 Sysmex Europe GmbH/Sysmex Nederland BV Distributor The Netherlands: Sysmex Nederland B.V. Ecustraat 11, 4879 NP Etten-Leur, The Netherlands Phone Fax info@sysmex.nl Distributor Belgium: Sysmex Belgium N.V. Park Rozendal, Building A, Terhulpsesteenweg 6a, 1560 Hoeilaart, Belgium Phone Fax info@sysmex.be Distributor: Sysmex Europe GmbH Bornbarch 1, Norderstedt, Germany Phone Fax drd@sysmex-europe.com You will find your local Sysmex representative s address under DRD.EN.C.02/17
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationAbaxis Piccolo xpress TM
Abaxis Piccolo xpress TM A breakthrough in point-of care diagnostics A breakthrough in point of care diagnostics Fast, easy, accurate on-site testing The Piccolo xpress TM is a fully automated system,
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationControls & Calibrators Clinical Chemistry
Controls & Calibrators Clinical Chemistry Clinical Chemistry Controls & Lipids Clinical Chemistry and lipid quality controls have been manufactured from true human serum to ensure they perform the same
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationTotal Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment
Total Cost of Ownership (TCO): An evidence-based approach to compare laboratory equipment P.C.G. Gontard 1, L.I. Stankevich 1, B.G. Gorodetsky 1 SUMMARY Clinical laboratories across the globe operate in
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationWSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:
WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationTo be used for the ease of test requisitioning on select patients only; all components may be ordered separately
Panels Section To be used for the ease of test requisitioning on select patients only; all components may be ordered separately ANEMIA 1(I) PANEL (NMC & UMMC) ANEM1(I) S 8.0 ml Large Tests included are:
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationSerodos and Serodos plus
Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationSpecimen Collection Requirements
The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationCLINICAL CHEMISTRY REAGENTS. Product Profile
Product Profile Why Clinical Chemistry Reagents? Quantitative determination of specific analytes associated with various types of disease. Diagnosis Identifying a disease already present Prognosis Forecasting
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationAlaska Native Medical Center Anchorage, AK
ANMC Lab Test Requirements Key: Room Temp (20-25C), Refrigerated (2-8C), (-15 to -25C), Hr (Hours), D (Days), W (Weeks), Mo (Months), Yr (Years). Basic Processing Instructions: Centrifuge all blood specimens
More informationCTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationTRACEABILITY and UNCERTAINTY
ACP Acid phosphatase total 1-naphthyl phosphate NPP Acid phosphatase, non-prostatic 1-naphthyl phosphate (Inhib.:tartrate) ACP-P Acid phosphatase, prostatic 1-naphthyl phosphate (Inhib.:tartrate) ALB Albumin
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationTEST LIST SAMPLE REQUIREMENT. 1 ml serum None
ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationRoche/Hitachi - PreciControl ClinChem Multi 2
ATRYP Antitrypsin alpha 1 ERM-DA470k/IFCC 9 136 1.36 1.84 0.0184 GPROT Acid glycoprotein alpha 1 CRM 470 2 90.1 0.901 0.890 0.00890 ACP Acid phosphatase total 1-naphthyl phosphate 0.720 43.1 0.00703 0.421
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationTRACEABILITY and UNCERTAINTY
Cat. No. 0 79 0 90 ACP Acid phosphatase total -naphthyl phosphate NPP Acid phosphatase, non-prostatic -naphthyl phosphate (Inhib.:tartrate) ALB Albumin BCG plus ALB Albumin BCP ALP Alkaline phosphatase
More informationGeneral Chemistry Scheme Guide
General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationSpecial issue: Six Sigma metrics Original papers
Special issue: Six Sigma metrics Original papers Risk analysis and assessment based on Sigma metrics and intended use Yong Xia 1, Hao Xue 1, Cunliang Yan 1, Bowen Li 2, ShuQiong Zhang 1, Mingyang Li 1,
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationTypes of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationCROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More informationSetting of quality standards
Setting of quality standards Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney AACB ASM Adelaide October 2014 Setting of Quality Standards - 2013 The 2013 QC workshop revealed
More informationPoint-of-Care Test Products. Article List
Point-of-Care Test Products Article List Version October 31st, 2017 Eurolyser Diagnostica GmbH Bayernstrasse 11a 5020 Salzburg Austria Phone +43 662 432100 Fax +43 662 432100 50 www.eurolyser.com point-of-care
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory
More informationThe analytical phase
The analytical phase Result interpretation Test request Result Sampling Black box: the lab ANALYTICAL PHASE The CASE Uncle Pete, 67 years old Marked abdominal pain 8 pm, ED Acute abdomen? Assessment (+
More informationBS-230. Clinical Chemistry Analyzer
BS-230 Clinical Chemistry Analyzer Flexible loading: 80 sample positions, Up to 80 reagent positions. Up to (40 fixed + 40 interchangeable) μl minimum reaction volume Disposable Cuvettes to avoid contamination
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationDIABETES AND LABORATORY TESTS. Author: Josephine Davis
DIABETES AND LABORATORY TESTS Author: Josephine Davis LAB TESTS Think twice before you test. What is the reason for testing? Laboratory tests are generally requested in primary care for one of the following
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationE#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
More informationColor: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.
5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationLaboratory Medicine Standardization Activity in Japan
JCTLM 15/11/2005 Sevres, Paris oratory Medicine Standardization Activity in Japan National Institute Metrology of Japan (NMIJ) Koichi Chiba Fujirebio Inc. Katsuhiko Yamamoto University of Tsukuba Katsuhiko
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationManufacturer Report for Siemens Unassayed Chemistry Lot Exp 30 Jun 2018
Acetaminophen Enzymatic, colorimetric µg/ml.09 0..0.09 0..0 0. 0. 0. 0. 9.. 9.0 0.9.0..9.. Albumin Bromcresol Purple (BCP) g/dl.0 0.0..0 0.00.. 0.0.. 0.09..9 0.0..9 0.0..0 0.0..0 0.0. Alkaline Phosphatase
More informationUni-Asia Scientific Instrument Company Limited. Stanbio Laboratory Product List
0130-430 Magnesium LiquiColor Test 0140-050 Sodium Test 0150-250 Calcium (CPC) LiquiColor Test 0153-030 Calcium Standard (10 mg/dl) 0155-225 Calcium (Arsenazo) LiquiColor Test 0160-050 Potassium Test 0210-250
More informationMed Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
More informationStandatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry
Lot: 1404137860 (Exp.: 2016/04) Level 1: 137860 (Exp.: 2016/04) Level 2: 137860 (Exp.: 2016/04) C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationThe Use of Tests in Clinical Biochemistry Interpreting Blood Results. Rowland Reece Principal Clinical Biochemist St. Vincent s University Hospital
The Use of Tests in Clinical Biochemistry Interpreting Blood Results Rowland Reece Principal Clinical Biochemist St. Vincent s University Hospital Topic Headlines What is Clinical Biochemistry? How does
More informationCOBAS INTEGRA / cobas c C.f.a.s.
COBAS INTEGRA / cobas c - C.f.a.s. Cat. No. 0 79 30 90 Roche Diagnostics GmbH May 20 Acid phosphatase total -naphthyl phosphate Gen. 2 Integra 00 plus Acid phosphatase total -naphthyl phosphate Gen. 2
More informationConference. Clinical Chemistry 43: (1997) Oak Ridge
Clinical Chemistry 43:9 1744 1748 (1997) Oak Ridge Conference In vitro effects of a novel hemoglobin-based oxygen carrier on routine chemistry, therapeutic drug, coagulation, hematology, and blood bank
More informationTRACEABILITY and UNCERTAINTY 7
Routine Method COBAS INTEGRA systems Acid phosphatase total 1-naphthyl phosphate Integra 00 plus Acid phosphatase total 1-naphthyl phosphate Acid phosphatase, non-prostatic Integra 00 plus Acid phosphatase,
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationStandatrol S-E. 2 niveles. Lyophilized serum for precision control in clinical chemistry
Lot: 1702210520 Level 1: 201920 Level 2: 201930 C Standatrol S-E 2 niveles Lyophilized serum for precision control in clinical chemistry USES Standatrol S-E 2 niveles is adaptable to different uses: -
More information