PRODUCTION OF RECOMBINANT BACULOVIRUS EXPRESSING WSSV VP28 AND EGFP IN SF-9 INSECT CELL

Transcription

1 PRODUCTION OF RECOMBINANT BACULOVIRUS EXPRESSING WSSV VP28 AND EGFP IN SF-9 INSECT CELL Kittipong Thanasaksiri 1, Triwit Rattanarojpong 2 and Kanokwan Poomputsa 3 Abstract White spot syndrome virus (WSSV) is a pathogen that causes a high mortality which affects the shrimp aquaculture industry worldwide. At present, information on WSSV and shrimp interaction to understand the role of WSSV proteins involved in viral pathogenesis in shrimps is still limited. Here, we attempted to produce the recombinant baculovirus in insect cells (Sf-9) for using as a gene delivery system for study WSSV genes involved in viral pathogenesis in shrimps. The recombinant baculovirus was constructed to express VP28 of WSSV on the surface of viral particle. The aim was to mimic natural infection of WSSV since VP28 is response for virus infection. EGFP gene was also inserted downstream of IE1 promoter in this recombinant baculovirus genome as a reporter gene to detect viral infection in shrimps. Upon recombinant baculovirus infection into its insect cells host, VP28 mrna transcript and VP28 protein could be detected in both cell lysates and culture supernatant by RT-PCR and Western blot analysis, respectively. Keywords White spot syndrome virus (WSSV), baculovirus, VP28, EGFP S I. INTRODUCTION hrimp cultivation is attacked by several types of pathogens particularly viruses. White spot syndrome virus (WSSV) is one of the major pathogen in penaeid shrimp and other crustaceans that affects enormous economic losses worldwide [1]. High mortality occurs within 2 10 days post infection [2]-[4]. WSSV belongs to a family Nimaviridae under the genus Whispovirus [5]. It is a large double stranded DNA with around 184 ORFs, some of the ORFs have been confirmed to be involved in WSSV infection. Some are DNA binding proteins containing nuclear localization signal or to be the components of viral particle [6]-[8]. The virions contain at least five major structural proteins: VP15 (nucleocapsid), VP24 and VP26 (tegument), VP19 and VP28 (viral envelope) [8]-[10]. Envelope proteins play vital roles in initiating virus infection, including binding to the receptors or penetrating into KITTIPONG THANASAKSIRI 1 is with the Division of Biotechnology, School of Bioresources Technology, King Mongkut's University of Technology Thonburi, Bangkok (phone: ; kittipong.tha@gmail.com). TRIWIT RATTANAROJPONG 2 is with the Department of Microbiology, Faculty of Sciences, King Mongkut's University of Technology Thonburi, Bangkok ( triwit.rat@kmutt.ac.th). KANOKWAN POOMPUTSA 3 is with the Division of Biotechnology, School of Bioresources Technology, King Mongkut's University of Technology Thonburi, Bangkok ( kanokwan.poo@kmutt.ac.th). host cells by membrane fusion [11], [12]. VP28 protein is one of the major envelope protein displays on WSSV surface and is believed to involve in viral infection by binding specifically with shrimp protein, PmRab7 [11]-[13]. It was previously reported that VP28 expressed and recombinant protein localized on the plasma membrane of infected insect cells under the control of WSSV immediate early promoter 1(IE1) was found localized on the baculovirus surface at high level [14]. However, till date, many other ORFs s function have not yet been determined. Baculovirus has been known as an effective tool for in vivo gene expression in several model organisms such as mammalian cells and insect cells [15], [16]. Therefore, baculovirus is used in this study by construction of baculovirus with WSSV gene(s) that are essential for shrimp infection to mimic WSSV infection in shrimp. This recombinant baculovirus developed will be used for functional analysis of unknown ORFs of WSSV. In this study, the recombinant baculovirus expressing WSSV VP28 and EGFP was constructed. VP28 was under the control of polyhedrin promoter whereas EGFP of IE1 promoter. The IE1 promoter is a strong promoter in both insect cell and mammalian cell [17]-[19]. The expression of EGFP determines the success of baculovirus infection in shrimp. II. MATERIALS AND METHODS A. Construction of Recombinant Baculovirus Transfer Plasmids To generate recombinant baculovirus, A transfer plasmid containing VP28 and EGFP, the full length of VP28 (615 bp) must be first constructed. The VP28 and EGFP were amplified from pbacsurf-1 plasmid (a recombinant plasmid containing WSSV IE1 promoter controlled EGFP and VP28 fused with gp64 signal sequence) using the primers VP28-Rsr-II- BacF5 CGCCGGTCCGAAACCATGGATCTTTCTTTCAC CTTTC-3 and VP28- HindIII-BacR 5 -CCC AAG CTT TAC TCG GTC TCA GTG CCA GAG-3. The VP28 was inserted into a multi clone gene site of the baculovirus transfer plasmid, pfastbachta (Invitrogen, San Diego, CA, USA). Additional multi cloning site (MCS) from pgadt7 (Clontech) (245 bp) was amplified and subsequently cloned into the pfastbachta to facilitate the cloning of WSSV IE1 promoter and EGFP. WSSV IE1 promoter fused with EGFP fragment (918 bp) was amplified from pbacsurf-1 plasmid 243

2 using IE1-EGFP-NdeI-F 5 GGA ATT CCA TAT GGG CTG TTT GAA TCA TGT TAA GGA A 3 and IE1-EGFP-Cla I-R 5 GGAT CG ATT TAC TTG TAC AGC TCG TCC ATG CCG AGA GT 3 and then inserted into pfastbachta containing the new MCS. The recombinant baculovirus without VP28 gene (BV-wt) is also constructed with the same strategy mentioned above and served as negative control. B. Generation of Recombinant Baculoviruses The recombinant transfer plasmid containing VP28 and EGFP was transformed into E.coli DH10 Bac to generate recombinant bacmid DNA by site-specific transposition according to the protocol of Bac-To-Bac system (Invitrogen). The VP28 and EGFP under their prompters will be transposed into the baculovirus DNA (Bacmid) at lacz gene. White colony was selected and recombinant bacmid was extracted and characterized by PCR analysis using specific primers for each gene and M13 primers which specific to the lacz gene. The recombinant bacmid was then transfected into SF-9 insect cells to generate recombinant baculoviruses. The recombinant baculoviruses were propagated by seeding the virus with multiplicity of infection (MOI) of 0.1 into the T-flask containing 1x10 6 Sf-9 cells/ml in Graces s insect medium (invitrogen) and incubation at 27 C for 5 days. The viral titers were determined by end point dilution assay and the viral stock was stored at 4 C until used. Expression of VP28 To assess the expression of VP28, RT-PCR was performed. Briefly, total RNA was extracted from transfected Sf-9 cell by TRIZOL reagent (Invitrogen, USA) and cdna synthesis was performed with a VP28 specific primer following the manufacturer s protocol (Promega, USA). The synthesized cdna was amplified using VP28-RsrII-BacF and VP28- HindIII-BacR primers. Recombinant VP28 protein Infected or transfected Sf-9 insect cell were lysed and the cell pellet and culture supernatant containing recombinant baculvirus particles were analyzed by Western blot analysis for the recombinant VP 28 protein detection[20]. Recombinant VP28 protein purified from E.coli BL21 D3expression system (Charoen Pokphand Foods PCL. and CPF Group) was served as a control while BV-wt (baculovirus expressing only EGFP) was included as a negative control. The anti-rabbit VP28 polyclonal antibodies at a dilution of 1:5000 (a gift from Prof. Lo, Chu-Fang, Institute of Zoology, National Taiwan University (NTU) ) was used as primary antibody and goat anti-rabbit IgG conjugated with horseradish peroxidase (HRP) (Centex shrimp) at a dilution of 1:5000 were used as secondary antibody. III. RESULTS AND DISCUSSION A. Generation of Recombinant bacmid DNA The recombinant baculovirus transfer plasmid containing VP28 and EGFP and the recombinant baculovirus containing only EGFP were successfully constructed (Fig.1, a). Each recombinant baculovirus transfer plasmid was then transposed to E.coli DH10 Bac to generate recombinant baculovirus DNA (bacmid) by site specific transposition of the flanking region, Tn7R and Tn7L, according to the Bac-to-Bac system (Invitrogen). Colony PCR analysis was performed using specific primers to ensure the insertion of the target genes in the baculovirus genome. PCR products with the estimated amplicon size according to the size of VP28 PCR product and EGFP were shown in Fig. 1, b and c. (a) (b) kbp M pfastbachta- VP28-EGFP pfastbachta-egfp IE1-EGFP (918 bp) VP28 (615 bp) 0.7 MCS (245 bp) VP28-RsrII-BacF VP28 (615 bp) VP28- HindIII-BacR MCS of pgadt7-avrii-r MCS (245 bp) MCS of pgadt7-avrii-r IE1-EGFP-NdeI-F IE1-EGFP (918 bp) kbp M 1 2 IE1-EGFP-ClaI-R 918 bp 615 bp Fig. 1 (a) Recombinant baculovirus transfer plasmids. (b) 1.2% agarose gel electrophoresis of amplification of PCR product using specific primers for each part and (c) % of agarose gel electrophoresis of PCR of recombinant bacmid using primers specific to VP28 (lane 1) and IE1-EGFP (lane 2). (c) 244

3 In order to prove the succesful of transposition and correct orientation of transposed genes into the recombinant bacmid. The recombinant bacmid DNA was extracted from E.coli DH10 Bac and subjected to PCR analysis by using M13 primers. The results showed that recombinant bacmid containing only EGFP as indicated by a PCR product with the size of 3,843 bp corresponding to the size of tranposition region combined with the inserted gene in the tranfer plasmid(fig. 2, a and b lane 1). The same result was observed when recombinant bacmid containing both VP28 and EGFP. A PCR product with the size of 4,119 bp was generated corresponding to the tranposition region combined with inserted gene (Fig. 2, a and b lane 2). The results indicated that both recombinant bacmid DNA contained the inserted genes at its expected positions. Hence, they were sequentially used to generate recombinant baculoviruses by transfection into Sf-9 insect cells. (a) The extracted recombinant bacmid DNA were transfected into Sf-9 cells for generation of recombinant baculovirus. B. Recombinant Baculoviruses B.1 EGFP Detection The EGFP was expressed at 72 h post-transfection in the transfected cells by both recombinant bacmid (Fig. 3). No EGFP was observed in the non-transfected Sf-9 cell (Fig. 3, c). The successful of recombinant baculovirus production could be observed the morphology of infected cell. a 1,755 bp P pol P IE1 VP28-RsrII-BacF IE1-EGFP-Nde I-F 222 bp VP28 (615 bp) IE1-EGFP (918 bp) VP28- HindIII-BacR IE1-EGFP-Cla I-R b c (b) kbp M ,119 bp 3,483 bp Fig. 2 (a) Transposition of VP28 and EGFP in expression cassettes under the control of promoter. M13 reverse and forward primers bind to upstream and downstream regions of the LacZ gene, respectively. (b) 1.2% agarose gel electrophoresis of recombinant bacmid DNA containing transposed gene (EGFP (lane 1)), (VP28 and EGFP (lane 2)) between flanking region, Tn7R and Tn7L. 2 Fig. 3 EGFP expression at 72 h in transfected Sf-9 cell with (a) recombinant bacmid containing only EGFP and (b) recombinant bacmid containing both VP28 and EGFP. (c) Non-transfected Sf-9 cell with recombinant bacmid DNA. B.2 VP28 and EGFP Expression The expression of WSSV VP28 gene and EGFP in recombinant baculovirus were also detected at the transcriptional level. RT-PCR was used for mrna expression in Sf-9 cell transfected with recombinant bacmid expressing VP28 and EGFP. The results revealed the transcription of VP28 and EGFP in Sf-9 cell transfected with recombinant bacmid expressing VP28 and as shown by a specific band of PCR product at 615 bp (Fig. 4). A PCR product at approximate the same size was also detected in the control group, Sf-9 cell transfected with recombinant bacmid expressing only EGFP. The amplified PCR product from RT- PCR from both samples were analysed by restriction endonuclease analysis with StuI. It was found that the PCR fragment from lane 1 was actually VP28 but the product from lane 2 was an artifact as revealed by their RE pattern (data not shown). 245

4 kbp M 1 2 and Ms. Irisa Trianti for assistance in animal cell culture. REFERENCES Fig % of Agarose gel electrophoresis of reverse transcriptase PCR using a VP28 specific primer for detection of VP28 expression in transfected cell with (lane 1) recombinant bacmid expressing VP28 and EGFP gene, and (lane 2) recombinant bacmid expressing only EGFP. B.3 Recombinant VP28 protein Western blot analysis was performed to detect recombinant VP28 protein. The recombinant baculoviruses in culture supernatant was subjected to Western blot analysis using VP28 specific antibody. The result showed that the infected cell culture supernatant and infected cell lysates exhibited specific bands at approximate 28 kda approximated the same size of the purified VP28 control (Fig. 5). However, there is a more intense band observed at lower position. This may be resulted from the protease enzymes in Sf-9 cell degraded the recombinant VP28 protein in both infected cell lysate and culture supernatant. This degradation will be further investigated Fig. 5 Western blot analysis of recombinant VP28. M broad range protein molecular weight marker; purifed WSSV recombinant VP28 protein from E.coli (lane 1); Culture supernatant from insect cells infected with recombinant baculovirus expressing VP28 and EGFP (lane 2) and cell lysate (lane 3); Culture supernatant from insect cells infected with recombinant baculovirus expressing only EGFP (lane 4) and cell lysate (lane 5); Culture supernatant of insect cell culture (lane 6) and cell lysate (lane 7). ACKNOWLEDGMENT 615 bp kda M Recombinant VP28 (28 kda) The authors are grateful for the financial support received from Thailand Research Fund (TRF-MAG). We thank Dr. Rapeepat Mavichak for providing purifed WSSV recombinant VP28 protein. We are also thankful for Ms. Marlita H. Eklesia [1] T.W. Flegel, Detection of major penaeid shrimp viruses in Asia, a historical perspective with emphasis on Thailand, Aquaculture, pp. 1-33, [2] C.H. Wang, C.F. Lo, J.H. Leu, C.M. Chou, P.Y. Yeh, H.Y. Chou, Tung, M.C., C.F. Chang, M.S. Su, G.H. Kou, Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon, Diseases of Aquatic Organisms, Vol. 23, pp , [3] H.Y. Chou, C.Y. Huang, C.H. Wang, H.C. Chiang and C.F. Lo, Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan, Diseases of Aquatic Organisms, Vol. 23, pp , [4] T.W. Flegel, Special topic review: Major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand, World Journal of Microbiology and Biotechnology, Vol. 13, pp , [5] International Committee on Taxonomy of Viruses [online], Available: [2011, February 18] [6] M.C. Van Hulten, J. Witteveldt, S. Peters, N. Kloosterboer, R. Tarchini, M. Fiers, H. Sandbrink, R.K. Lankhorst and J.M. Vlak, The White Spot Syndrome Virus DNA Genome Sequence, Virology, Vol. 286, No. 1, pp. 7-22, 2001a. [7] M.C. Van Hulten, M. Westenberg, S.D. Goodall and J.M. Vlak, Identification of Two Major Virion Protein Genes of White Spot Syndrome Virus of Shrimp, Virology, Vol. 266, pp , 2000b. [8] L.L. Chen, J.H. Leu, C.J. Huang, C.M. Chou, S.M. Chen, C.H. Wang, C.F. Lo and G.H. Kou, "Identification of a Nucleocapsid Protein (Vp35) Gene of Shrimp White Spot Syndrome Virus and Characterization of the Motif Important for Targeting VP35 to the Nuclei of Transfected Insect Cells", Virology, Vol. 293, No. 1, pp , 2002a. [9] J.M. Tsai, H.C. Wang, J.H. Leu, A.H. Wang, Y. Zhuang, P.J. Walker, G.H. Kou and C.F. Lo, Identification of the Nucleocapsid, Tegument, and Envelope Proteins of the Shrimp White Spot Syndrome Virus Virion, Journal of Virology, Vol. 80, pp , [10] X. Xie, L. Xu and F. Yang, Proteomic Analysis of the Major Envelope and Nucleocapsid Proteins of White Spot Syndrome Virus, Journal of Virology, Vol. 80, No. 21, pp , [11] G. Yi, Z. Wang, Y. Qi, L. Yao, J. Qian and L. Hu, Vp28 of Shrimp White Spot Syndrome Virus Is Involved in the Attachment and Penetration into Shrimp Cells, Journal of Biochemistry Molecular Biology, Vol. 37, pp , [12] M.C. Van Hulten, J. Witteveldt, M. Snippe and J.M. Vlak, White Spot Syndrome Virus Envelope Protein Vp28 Is Involved in the Systemic Infection of Shrimp, Virology, Vol. 285, No. 2, pp , 2001b. [13] K. Sritunyalucksana, W. Wannapapho, C.F. Lo and T.W. Flegel, Pmrab7 Is a Vp28-Binding Protein Involved in White Spot Syndrome Virus Infection in Shrimp, Journal of Virology, Vol. 80, No. 21, pp , [14] S. Syed Musthaq, S. Madhan, A.S. Sahul Hameed and J. Kwang, Localization of Vp28 on the Baculovirus Envelope and Its Immunogenicity against White Spot Syndrome Virus in Penaeus Monodon, Virology, Vol. 391, pp [15] H. Gao, Y. Wang, N. Li, W.P. Peng, Y. Sun, G.Z. Tong and H.J. Qiu, Efficient Gene Delivery into Mammalian Cells Mediated by a Recombinant Baculovirus Containing a Whispovirus Ie1 Promoter, a Novel Shuttle Promoter between Insect Cells and Mammalian Cells, Journal of Biotechnology, Vol. 131, No. 2, pp , [16] F. He, Y. Ho, L. Yu and J. Kwang, WSSV Ie1 Promoter Is More Efficient Than CMV Promoter to Express H5 Hemagglutinin from Influenza Virus in Baculovirus as a Chicken Vaccine, BioMed central Microbiology, Vol. 8, No. 1, p. 238, [17] W.J. Liu, Y.S. Chang, C.H. Wang, G.H. Kou and C. F. Lo, Microarray and RT-PCR Screening for White Spot Syndrome Virus Immediate- Early Genes in Cycloheximide-Treated Shrimp, Virology, Vol. 334, No. 2, pp , [18] L. Lu, H. Wang, I. Manopo, L. Yu and J. Kwang, Baculovirus- Mediated Promoter Assay and Transcriptional Analysis of White Spot Syndrome Virus Orf427 Gene, Virology Journal, Vol. 2, p. 71, [19] H. Gao, Y. Wang, N. Li, W.P. Peng, Y. Sun, G.Z. Tong and H.J. Qiu, Efficient Gene Delivery into Mammalian Cells Mediated by a Recombinant Baculovirus Containing a Whispovirus Ie1 Promoter, a 246

5 Novel Shuttle Promoter between Insect Cells and Mammalian Cells, Journal of Biotechnology, Vol. 131, No. 2, pp , [20] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature, Vol. 227, pp ,