Aberrant expression of multiple hormone receptors in ACTH-independent macronodular adrenal hyperplasia causing Cushing s syndrome

Transcription

1 European Journal of Endocrinology (21) ISSN CLINICAL STUDY Aberrant expression of multiple hormone receptors in ACTH-independent macronodular adrenal hyperplasia causing Cushing s syndrome J W B de Groot 1,2, T P Links 1, A P N Themmen 3, L H Looijenga 4, R R de Krijger 4, P M van Koetsveld 3, J Hofland 3, G van den Berg 1, L J Hofland 3 and R A Feelders 3 Departments of 1 Endocrinology and 2 Medical Oncology, University Medical Centre Groningen, University of Groningen, PO Box 31, 97 RB Groningen, The Netherlands and Departments of 3 Internal Medicine and 4 Pathology, Josephine Nefkens Institute, Erasmus MC-University Medical Centre, PO Box 24, 3 CA Rotterdam, The Netherlands (Correspondence should be addressed to J W B de Groot; j.w.b.de.groot@int.umcg.nl) Abstract Objective: Aberrant adrenal expression of various hormone receptors has been identified in ACTHindependent macronodular adrenal hyperplasia (AIMAH) causing cortisol hypersecretion regulated by hormones other than ACTH. We aimed to determine aberrant expression of multiple hormone receptors in vivo and in vitro in adrenal tissue of a patient with AIMAH. Design: The design of the study includes clinical case description, and biochemical and immunohistochemical analysis to demonstrate aberrant expression of multiple hormone receptors in AIMAH. Methods: The subject of the study is a male diagnosed with Cushing s syndrome because of AIMAH. Directly after laparoscopic removal of the adrenals, adrenal tissue was incubated with and without test substances (ACTH, forskolin, arginine vasopressin (AVP), desmopressin, epinephrine, norepinephrine, purified human chorionic gonadotropin (hcg), metoclopramide and the combinations of AVP with ACTH, epinephrine and metoclopramide). LH/hCG-receptor (hcg-r) immunohistochemistry and RT-PCR analyses were performed to demonstrate aberrant expression of LH/hCG-R and V 1 3 -AVPR. Results: AIMAH was characterized by in vivo cortisol responsiveness to AVP and in vitro cortisol responses to AVP, hcg, epinephrine, and norepinephrine suggesting aberrant adrenal expression of the receptors for AVP (the V 1 3 -AVPRs), catecholamines (the b-ar), and LH (the LH/hCG-R). Incubation with combinations of AVP and ACTH and of AVP with epinephrine induced a stronger cortisol response compared with incubation with the individual agents. Moreover, we demonstrated adrenal V 1 3 -AVPR and LH/hCG-R expression. Conclusions: AIMAH tissue may simultaneously express multiple aberrant hormone receptors, and individual ligands may potentiate each other regarding cell proliferation and cortisol production. European Journal of Endocrinology Introduction Primary adrenal causes of Cushing s syndrome cause w15 2% of cases of endogenous Cushing s syndrome in adults (1). Of them, bilateral adrenal diseases such as primary pigmented nodular adrenocortical disease, bilateral adenomas or carcinomas, or ACTH-independent macronodular adrenal hyperplasia (AIMAH) account for only 1 15% of cases (2, 3). Aberrant adrenal expression of various ectopic or eutopic G-protein-coupled receptors (GPCRs) has been identified in several cases of AIMAH and unilateral adrenal adenomas (2). This aberrant expression of receptors leads to a cortisol hypersecretion regulated by hormones other than ACTH thus escaping the normal cortisol-mediated feedback. We report a male patient with Cushing s syndrome due to AIMAH. The investigation was rendered more complex because a non-functional pituitary incidentaloma was also present. A plasma cortisol response was found after administration of arginine vasopressin (AVP). Unexpectedly, apart from AVP, epinephrine, norepinephrine, and human chorionic gonadotropin (hcg) also induced an aberrant in vitro cortisol response indicating expression of multiple aberrant hormone receptors. q 21 European Society of Endocrinology DOI: 1.153/EJE-1-58 Online version via Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

2 294 J W B de Groot and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) 163 Materials and methods Case report A 6-year-old male was referred for suspected Cushing s syndrome, bilateral nodular adrenal hyperplasia, and a pituitary microadenoma of 6 mm. He had been treated for hypertension and diabetes mellitus for 12 years. Furthermore, he was diagnosed with osteoporosis. Two years earlier, he underwent percutaneous transluminal coronary angioplasty because of a myocardial infarction. During the last couple of years, he had noticed rounding of his face, weight gain (8 kg), fatigue, and easy bruisability. His medication consisted of metformin, rosiglitazone, glimepiride, omeprazol, metoprolol, ciprofibrate, amlodipine, furosemide, irbesartan, acetylsalicylic acid, and calcium/vitamin D. Physical findings revealed facial plethora, moon-face, truncal obesity (weight, 115 kg; height, 188 cm; body mass index, 33), multiple bruises, and atrophic skin without striae. Blood pressure was 18/8 mmhg while recumbent. On laboratory examination, renal function and electrolytes were within the normal range. Non-fasting glucose was 15.9 mmol/l, and HbAlc was 1.2%. ACTH-independent hypercortisolism was established by an increased urinary cortisol excretion (391 nmol/24 h, normal 2 27 nmol/24 h), insufficient cortisol suppression after administration of 1 mg dexamethasone overnight, and suppressed plasma ACTH concentrations (1.3 ng/l, normal 1 1 ng/l). In addition, high-dose (7 mg) i.v. dexamethasone did not suppress plasma cortisol and ACTH, and cortisol did not respond to i.v. CRH (1 mg). The pituitary tumor that was diagnosed elsewhere was considered to be a non-functional microadenoma. Evaluation of anterior pituitary function revealed no abnormalities except for secondary hypogonadism, presumably due to chronic hypercortisolism. To screen for ectopic hormone receptor expression (after cessation of all medication 4 days before testing), the following tests were performed: a standard mixed meal (116 g carbohydrates, 27 g proteins, and 14 g fat), a posture test, tetracosactide (25 mg i.v.), LHRH (1 mg i.v.), TRH (2 mg i.v.), glucagon (1 mg i.v.), cisapride (1 mg orally), AVP (1 IU i.m.), and desmopressin (ddavp, 2.5 mg s.c). A positive response was defined by a 5% increase in plasma cortisol levels as defined by Lacroix et al. (4). Bilateral adrenalectomy was planned for the patient and treated with ketoconazole 2!2 mg daily. However, he had a severe myocardial infarction for which he eventually underwent coronary artery bypass grafting and aortic valve replacement. During this period of over 6 months, he was maintained on ketoconazole, and urinary cortisol levels returned to normal. Eventually, a bilateral adrenalectomy was performed. Both adrenals were diffusely enlarged with multiple nodules. A part of both adrenals was removed for in vitro studies. Microscopic examination revealed nodular hyperplasia extending throughout both glands. Ketoconazole was stopped after surgery. The postoperative course was uncomplicated. The patient was treated with steroid replacement therapy (cortisone acetate mg and fludrocortisone 62.5 mg daily), metformin, omeprazol, sotalol, alendronic acid, acetylsalicylic acid, and calcium. He remains in followup for his pituitary incidentaloma. Control patients Hyperplastic adrenal tissue, serving as control tissue for the in vitro studies, was obtained from two patients who underwent bilateral laparoscopic adrenalectomy; one 62-year-old male with severe Cushing s syndrome due to ectopic ACTH production (control 1) and one 5-year-old male with persistent Cushing s disease after pituitary surgery and radiotherapy (control 2). Normal adrenal tissue was obtained from three patients (controls 3, 4, and 5) who underwent nephrectomy due to renal cell carcinoma. Adrenals were removed because of radical tumor resection, but did not contain tumor cells microscopically. Cell preparation and incubation studies Directly after laparoscopic removal, adrenal cortical tissue of the major part of the adrenals was minced into small pieces and dissociated with collagenase (type I; Sigma Chemical Co.), as described previously (5, 6). Cell viability was determined by trypan blue staining and was more than 8%. Subsequently, the cells were resuspended in incubation medium (DMEM with.2% BSA), and incubated with and without test substances during 2 or 24 h. These incubations were performed in quadruplicate using 5 cells/ml. After 2-h incubation,.5 ml distilled water was added to each tube, and the resulting suspension was stored at K2 8C until the measurement of hormone concentrations, as described previously (5). Cortisol concentrations were measured by a fluorescent immunoassay (Diagnostic Products Corp., Los Angeles, CA, USA). The 2-h incubations were performed with the following substances: ACTH-(1 24) (Synacthen, Novartis; concentrations: 31, 62, 125, 25, and 5 pg/ml), forskolin in a concentration of 1 mm, AVP (Pitressin, Monarch Pharmaceuticals, Bristol, UK;.1,.1,.5, and.1 mm), ddavp (Minrin, Ferring Pharmaceuticals;.1 and.1 mm), epinephrine (.1, 1, and 1 mm), norepinephrine (.1, 1, and 1 mm), purified hcg (Organon, Oss, The Netherlands; 5 miu/ml), metoclopramide (.1, 1, and 1 mm), and the combinations of AVP (.1 mm) with ACTH (62 pg/ml), epinephrine (1 mm), and metoclopramide (1 mm). Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

3 EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) 163 Table 1 Peak plasma cortisol levels as percentage of baseline values. Stimulation test a Receptor RT-PCR of vasopressin receptors After surgery, residual adrenocortical tissues were snapfrozen and stored at K8 8C. For the purpose of mrna analysis, samples were homogenized, and subsequently, RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer s instructions. RNA was reverse transcribed into cdna using previously described methods (7). The following primers were used to detect mrna expression of vasopressin receptors: F: CGGCTTCATCTGCTACAACATC, R: CGAGTCCTTCCACATACCCGT (V 1a -AVPR, 56 bp) (8); F: GTGGCCAAGACTGTGAGGAT, R: CATAGATC- CAGGGGTTGGTG (V 2 -AVPR, 181 bp); F: CAGCAGCAT- CAACACCATCT, R: CCATGTAGATCCAGGGGTTG (V 3 -AVPR, 221 bp) (9). mrna expression of housekeeping gene hypoxanthine phosphoribosyltransferase 1(HPRT1) was detected by: F: TGCTTTCCTTGGTCAGG- CAGTAT, R: TCAAATCCAACAAAGTCTGGCTTATATC. The 25 ml PCR mix contained.1 IU/ml FastStart Taqpol (Roche Applied Science), PCR buffer (Roche), 2 mm dntps, 25 nm primers, 2. mm MgCl 2, and 25 ng cdna. For V 2 -AVPR, the MgCl 2 concentration was 1. mm. Amplification was performed in a GeneAmp PCR system 97 (Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands), starting with 7 min at 95 8C, followed by 4 cycles of 1 min at 95 8C, 1 min at 6 8C, and 1 min at 72 8C, and finally 1 min at 72 8C. Afterwards, the products were stored at 4 8C until electrophoretic separation on a Caliper LabChip (Caliper Life Sciences, Teralfene, Belgium). LH receptor immunohistochemistry Peak value (%) Tetracosactide ACTH 226 Posture V 1 3 -AVP, b-adrenergic, AT-1 8 Standard mixed GIP 6 meal LHRH LH, FSH, GnRH 8 TRH TSH, TRH, prolactin 3 Glucagon Glucagon K6 Vasopressin V 1 3 -AVP 86 Desmopressin V 2 -AVP 7 Cisapride 5HT-4 13 a Tests were considered negative if cortisol levels increased by!25%. A partial response was defined as a 25 49% increase, and a positive test was defined as a more than 5% increase in cortisol levels. The LH receptor-specific antibody (2C3) used in this study was kindly provided by Dr A Funaro (1). The mouse MAB was used for immunohistochemistry on formalin-fixed paraffin-embedded tissue. Normal adult testis was used as a positive control. Tissue sections of 3 mm thickness were deparaffinized, and incubated with the antibody (dilution 1:1 in PBS containing 1% BSA) overnight at 4 8C. Rabbit anti-mouse secondary biotinylated antibodies (DAKO, Glostrup, Denmark) were used in a 1:2 dilution and incubated for 3 min at room temperature. Antibody complex was visualized by avidin biotin conjugated with HRP using 3,3-diaminobenzidine as chromogen and H 2 O 2 as substrate. All slides were counterstained with hematoxylin. Statistical analysis The effects of various test substances on in vitro cortisol production by cultured adrenal cells were tested by ANOVA followed by Newman Keuls test. Results In vivo studies After stimulation with 25 mg tetracosactide i.v., plasma cortisol levels increased from 715 nm to peak levels of 233 nm after 12 min. Administration of 1 IU AVP i.m. was followed by an increase in plasma cortisol levels from 47 to 775 nm after 3 min. Plasma ACTH levels were undetectable during these stimulation tests. No significant cortisol responses were found after a posture test or administration of ddavp, or after a standard mixed meal and administration of LHRH, TRH, glucagon, or cisapride (Table 1). After administration of LHRH, levels of LH (from 3 to 2 IU/l 9 min after LHRH) and FSH (from 8 to 14 E/l 9 min after LHRH) increased. In vitro studies Cultured adrenocortical adenoma cells, obtained from patient and controls 1 and 2, produced 135G2.7, 76G1.9, and 169G5.4 nmol cortisol/tube (mean GS.E.M.) respectively after 2 h. Incubation with ACTH stimulated cortisol production in a dose-dependent A Multiple hormone receptor expression in AIMAH 295 ACTH (pg/ml) Forskolin 1 6 M Fors ACTH (pg/ml) B Controls Control 2 ACTH (pg/ml) Figure 1 In vitro cortisol response of cultured ACTH-independent macronodular adrenal hyperplasia (AIMAH) cells to ACTH and forskolin (2-h stimulated cortisol values as percentage of patient s own control values). AIMAH cells were prepared from hyperplastic adrenal glands of a patient with an AVP-responsive Cushing s syndrome (A), and adrenal adenoma cells of two patients with ectopic ACTH production by a neuroendocrine tumor () and pituitary-dependent Cushing s syndrome (Control 2) respectively served as controls (B). Data are expressed as mean (nz4)gs.e.m. P!.1 compared with patient s own control. Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

4 296 J W B de Groot and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) 163 fashion (Fig. 1). Forskolin, as a stimulator of camp production, induced cortisol production by adrenal cells from the patient (Fig. 1) and controls (maximum increase 588G7. and 456G6.1% respectively compared to own control). AVP strongly stimulated cortisol production by cells from the patient in a dose-dependent manner to maximum values nearly reaching values after maximum ACTH stimulation (Fig. 2A). In cells obtained from control patient 1, AVP induced a modest but significant increase in cortisol secretion (Fig. 2B), whereas in control patient 2, AVP only slightly stimulated cortisol production (Fig. 2C). In contrast, ddavp had no significant effect on cortisol production by cells from the patient or by cells from the controls. Both epinephrine and norepinephrine had a dosedependent effect on cortisol production by cells from the patient (Fig. 3A). hcg also induced a significant increase in cortisol production (Fig. 3A). Epinephrine, norepinephrine, or hcg did not affect cortisol secretion by cells obtained from the control patients (data not shown). Figure 3B shows that incubation with the combinations of AVP and ACTH and of AVP with epinephrine induced a stronger cortisol response compared with incubation with the individual agents Concentration (nm) B C Control A Concentration (nm) AVP ddavp Concentration (nm) Figure 2 In vitro cortisol response of cultured ACTH-independent macronodular adrenal hyperplasia (AIMAH) cells to AVP and ddavp (2-h stimulated cortisol values as percentage of patient s own control values). AIMAH cells were prepared from hyperplastic adrenal glands of a patient with an AVP-responsive Cushing s syndrome (A), and adrenal adenoma cells of two patients with ectopic ACTH production by a neuroendocrine tumor and pituitarydependent Cushing s syndrome respectively served as controls (B and C). Data are expressed as mean (nz4)gs.e.m. P!.1 compared to patient s own control. A Control Control AVP ACTH Epi AVP AVP Epinephrine Norepinephrine hcg ACTH Epi (µm) (µm) (miu/ml) Figure 3 (A) In vitro cortisol response of cultured ACTHindependent macronodular adrenal hyperplasia (AIMAH) cells from a patient with an AVP-responsive Cushing s syndrome to epinephrine, norepinephrine, and hcg (2-h stimulated cortisol values as percentage of patient s own control values). Data are expressed as mean (nz4)gs.e.m. P!.1 compared with patient s own control. (B) In vitro cortisol response of cultured AIMAH cells obtained from the same patient to AVP (1 nm), ACTH (62 pg/ml), epinephrine (1 mm), and to co-incubation of AVP (1 nm) with ACTH (62 pg/ml) and epinephrine (1 mm) respectively. Data are expressed as mean (nz4)gs.e.m. P!.1 compared to incubation with individual agents. Vasopressin receptor mrna expression mrna analysis showed positive expression of all three vasopressin receptors and HPRT1 in adrenal tissue derived from the patient, which is shown in Fig. 4. For V 2 -AVPR, the amplification of both genomic DNA (286 bp) and cdna (181 bp) is visible. Controls also showed positive expression of V 1 and V 2 receptors, but were all negative for V 3 receptor mrna. The expression of V 1 -AVPR in the patient s adrenal tissue seems to be higher compared with control adrenal tissues, whereas the expression of housekeeping gene HPRT1 in these samples did not differ. LH/hCG receptor expression The LH/hCG-receptor (hcg-r)-specific antibody was validated in HEK293 cells, which were transfected with the human LH/hCG-R (data not shown), and in human testis tissue with positive staining of the Leydig cells but not in the somatic component of the seminiferous tubules (Fig. 5, left panel). Hyperplastic adrenal tissue of the patient showed diffuse staining indicating LH/hCG-R expression (Fig. 5, right panel). Discussion We describe a patient with Cushing s syndrome based on bilateral AIMAH, and characterized by in vivo cortisol responsiveness to AVP and in vitro cortisol responses to AVP, hcg, epinephrine, and norepinephrine. AIMAH and, to a lesser extent, unilateral adrenal adenomas are associated with aberrant expression of several eutopic and ectopic GPCRs which are functionally coupled to steroidogenesis (2, 3). This includes receptors for AVP (V 1 3 -AVPR or AVPR1A, AVPR1B, AVPR2) (11 14), gastric inhibitory polypeptide (GIPR) (15, 16), LH B Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

5 EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) V 1 V 2 V 3 HPRT1 Figure 4 All three vasopressin receptors and hypoxanthine phosphoribosyltransferase 1 (HPRT1) are expressed in adrenal tissue derived from the patient. For V 2 -AVPR, the amplification of both genomic DNA (286 bp) and cdna (181 bp) is visible. Controls also showed positive expression of V 1 and V 2 receptors, but were all negative for V 3 receptor mrna. The expression of V 1 -AVPR in the patient s adrenal tissue seems to be higher compared with control adrenal tissues. (LH/hCG-R) (17, 18), catecholamines (b-ar) (19, 2), serotonin (5HT-4R or HTR4) (21, 22), and angiotensin II (AT-1R or AGTR1) (23). AIMAH-dependent Cushing s syndrome can be accompanied by expression of a single GPCR, but often aberrant co-expression of several GPCRs is found, in particular V 1 -AVPR and 5HT-4R (3, 24). In this study, we demonstrate simultaneous aberrant responses suggestive of adrenal expression of the V 1 -AVPR, V 3 -AVPR, b-ar, and LH/hCG-R, a combination which, to our knowledge, has not previously been reported. The V 1 -AVPR is overexpressed in combination with ectopic expression of V 3 -AVPR in this patient with AIMAH, whereas V 2 -AVPR seems to be expressed in normal adrenals as well. In addition, we found that co-incubation of ligands for these GPCRs potentiated the cortisol response of hyperplastic adrenal tissue in vitro. Moreover, we demonstrated adrenal expression of LH/hCG-R immunohistochemically and V 1 3 -AVPR by RT-PCR. The V 1 -AVPR is physiologically expressed in the adrenal gland, and activation of the V 1 -AVPR leads to a modest increase in steroidogenesis. This is illustrated by the dose-dependent in vitro cortisol responses to AVP by adrenal cells obtained from control patient 1. V 2 - and V 3 -AVPR expression has been reported in AIMAH, but the effects of the V 2 -preferential AVPR agonist ddavp have not been extensively examined in vivo (2, 3). The profound cortisol responses, both in vivo and in vitro, to AVP but not to ddavp in our patient point to a V 1 -AVPR- orv 3 -AVPR-mediated effect. The undetectable ACTH levels after AVP administration exclude an indirect effect via the V 3 -AVPR expressed in the pituitary. Since we found increased expression of V 1 -AVPR and ectopic expression of V 3 -AVPR in our patient, the observed embroidered cortisol response to AVP therefore could represent an abnormal response V 1 -orv 3 -AVPR stimulation (3). Although mutations in the V 1 -AVPR gene or its promoter have not been demonstrated in patients with AIMAH and AVPresponsive Cushing s syndrome (3), AVP expression in the adrenal cortex has been reported in AIMAH Multiple hormone receptor expression in AIMAH 297 and may as such regulate cortisol production in an auto- or paracrine manner (25). AVP also increases proliferation of different cell types, including rat adrenocortical cells, through activation of V 1 -Avpr (26), and V 2 - and V 3 -AVPR may also have contributed to the physiopathology of AIMAH by stimulating cell steroidogenesis and mitogenesis. On the other hand, in vivo and in vitro responses to ddavp were absent, and it may be that V 2 - and V 3 -AVPRs are not involved in the vasopressinergic control of steroidogenesis and that V 2 - and V 3 -AVPR mrnas present are not translated into functional proteins in AIMAH, as previously observed for the 5HT-4R (27). Besides AVP responsiveness, our in vitro studies also demonstrated cortisol responses to epinephrine, norepinephrine, and hcg, although these abnormal responses were not observed in vivo. A pharmacological agent may stimulate cortisol secretion through either a direct action on adrenocortical cells or an indirect effect on other intra-adrenal cells that, in turn, may modulate the synthesis of glucocorticoids via a cell-to-cell type of communication. Nonetheless, ectopic expression of b-ars in the adrenal cortex has been reported in vitro in several cases of adrenal Cushing s syndrome, whereas an in vivo cortisol response to catecholamines has been demonstrated in few patients with Cushing s syndrome due to AIMAH (19, 2). An explanation for the absence of an in vivo cortisol response on posture in our patient could have been the use of metoprolol, irbesartan, and amlodipine. Although the medication was stopped 4 days before testing, it might have had an effect on the posture test. In addition, the patient used this medication for more than 4 years while symptoms of Cushing s syndrome worsened. Therefore, we do not believe that aberrant Figure 5 Representative illustration of LH/hCG-R immunohistochemistry. (Left) Adult human testis in which the Leydig cells (indicated by arrows) are positive (dark staining). Upper panel 12! and lower panel 24! magnification. (Right) ACTHindependent macronodular adrenal hyperplasia (AIMAH). Upper panel 25! and lower panel 25! magnification. Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

6 298 J W B de Groot and others EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) 163 expression of the b-ar contributed significantly to the clinical picture. We also found an in vitro cortisol response to hcg and LH/hCG-R protein expression in the patient s adrenal tissue. The LH/hCG-R is thought to be constitutively expressed in the normal adrenal gland, presumably in the zona reticularis, and may regulate synthesis of dehydroepiandrosterone, at least in human fetal adrenal cells (18, 28). LH-responsive Cushing s syndrome could result from an increased LH/hCG-R expression and/or an abnormal coupling between LH/hCG-R and steroidogenesis (2, 18). In AIMAH, co-expression of the LH/hCG-R with other GPCRs (5HT-4R, V 1 3 -AVPR, or GIPR) is observed in a majority of described cases (18, 21, 25, 27). However, this mainly involves detection of LH/hCG-R mrna. One study demonstrated LH/hCG-R protein expression in a case of AIMAH, but in this report, no data were provided on antibody validation (29). We show, with a well-validated LH/hCG-R antibody, LH/hCG-R protein expression in hyperplastic adrenal tissue. LH has been postulated to play a role in the pathogenesis of AIMAH. Transgenic mice with constitutional LH overproduction develop both polycystic ovaries and bilateral adrenal hyperplasia with an increased corticosterone production (3). Furthermore, LH/hCG-dependent Cushing s syndrome caused by AIMAH has primarily been reported in female patients. The initial pathophysiological concept was that LH/hCG levels should reach a certain threshold to exert stimulatory effects on cortisol synthesis as occurs during pregnancy or the postmenopausal state. However, LH/hCG-dependent Cushing s syndrome has also been described in premenopausal women with AIMAH, indicating that LH levels in the lower range may also regulate cortisol production (18). In addition, Mazzuco et al. have recently demonstrated that transplantation of normal adrenal cells with retrovirus-mediated LH/hCG-R expression into adrenalectomized mice is followed by the development of a hyperplastic adrenal mass with concomitant ACTHindependent hypercortisolism, responsive to hcg (31). Thus, supraphysiological LH/hCG levels are not a prerequisite for the development of LH/hCG-dependent AIMAH in the presence of an enhanced adrenal LH/hCG-R expression. Aberrant cortisol responses to LH/hCG in male patients with AIMAH, however, have only been reported in two patients with an overt and subclinical Cushing s syndrome respectively (21, 32). The absence of a cortisol response to LHRH in vivo in our patient may be explained by the concentration and time of exposure to LH/hCG. In one patient with LH/hCGresponsive Cushing s syndrome, the in vitro cortisol response was attenuated with high concentrations of hcg suggesting the occurrence of a desensitization phenomenon of the receptor, as previously shown in Leydig cells (25, 3). The aberrant expression of multiple GPCRs makes it difficult to draw any conclusions on the relative importance of each receptor or the possible co-operation between aberrant GPCRs. Nevertheless, we show for the first time that aberrant stimuli synergize in the stimulation of cortisol production in AIMAH, at least in vitro. AVP-stimulated cortisol production was potentiated by co-incubation with epinephrine or with ACTH. However, the exact mechanism is presently unknown. In this respect, it remains intriguing that the hyperplastic adrenal tissue retains its sensitivity to ACTH, both in vivo and in vitro. Indeed, to date, no (lossof-function) mutations of the ACTH receptor gene have been found in patients with AIMAH (18, 33). In conclusion, the present study additionally demonstrates that AIMAH tissue may simultaneously express multiple aberrant GPCRs. We describe for the first time AIMAH responding to both AVP, (nor)epinephrine, and gonadotropins. The synergizing effects of aberrant stimuli on cortisol production observed in vitro may translate into the pathophysiological mechanism in vivo, with potentiating interactions of these ligands on cell proliferation and cortisol production. Declaration of interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Funding This research did not receive any specific grant from any funding agency in the public, commercial or not-for-profit sector. Acknowledgements We thank Dr A Funaro, Department of Genetics, Biology and Biochemistry, University of Torino, Italy, for providing the LH/hCG-R-specific antibody. References 1 Newell-Price J, Trainer P, Besser M & Grossman A. The diagnosis and differential diagnosis of Cushing s syndrome and pseudo- Cushing s states. Endocrine Reviews Lacroix A, Ndiaye N, Tremblay J & Hamet P. Ectopic and abnormal hormone receptors in adrenal Cushing s syndrome. Endocrine Reviews Lacroix A, Baldacchino V, Bourdeau I, Hamet P & Tremblay J. Cushing s syndrome variants secondary to aberrant hormone receptors. Trends in Endocrinology and Metabolism Lacroix A, Mircescu H & Hamet P. Clinical evaluation of the presence of abnormal hormone receptors in adrenal Cushing s syndrome. Endocrinologist Marzouk HF, Zuyderwijk J, Uitterlinden P, de Jong FH & Lamberts SW. Suramin prevents ACTH-stimulated corticosterone release by dispersed adrenocortical cells. Endocrinology Richardson MC & Schulster D. Corticosteroidogenesis in isolated adrenal cells: effect of adrenocorticotrophic hormone, adenosine 3,5 -monophosphate and 1 24 adrenocorticotrophic hormone diazotized to polyacrylamide. Journal of Endocrinology Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM

7 EUROPEAN JOURNAL OF ENDOCRINOLOGY (21) Hofland J, Timmerman MA, de Herder WW, van Schaik RH, de Krijger RR & de Jong FH. Expression of activin and inhibin subunits, receptors and binding proteins in human adrenocortical neoplasms. Clinical Endocrinology Perraudin V, Delarue C, Lefebvre H, Do Rego JL, Vaudry H & Kuhn JM. Evidence for a role of vasopressin in the control of aldosterone secretion in primary aldosteronism: in vitro and in vivo studies. Journal of Clinical Endocrinology and Metabolism Vezzosi D, Cartier D, Régnier C, Otal P, Bennet A, Parmentier F, Plantavid M, Lacroix A, Lefebvre H & Caron P. Familial adrenocorticotropin-independent macronodular adrenal hyperplasia with aberrant serotonin and vasopressin adrenal receptors. European Journal of Endocrinology Funaro A, Sapino A, Ferranti B, Horenstein AL, Castellano I, Bagni B, Garotta G & Malavasi F. Functional, structural, and distribution analysis of the chorionic gonadotropin receptor using murine monoclonal antibodies. Journal of Clinical Endocrinology and Metabolism Perraudin V, Delarue C, De Keyzer Y, Bertagna X, Kuhn JM, Contesse V, Clauser E & Vaudry H. Vasopressin-responsive adrenocortical tumor in a mild Cushing s syndrome: in vivo and in vitro studies. Journal of Clinical Endocrinology and Metabolism Horiba N, Suda T, Aiba M, Naruse M, Nomura K, Imamura M & Demura H. Lysine vasopressin stimulation of cortisol secretion in patients with adrenocorticotropin-independent macronodular adrenal hyperplasia. Journal of Clinical Endocrinology and Metabolism Daidoh H, Morita H, Hanafusa J, Mune T, Murase H, Sato M, Shibata T, Suwa T, Ishizuka T & Yasuda K. In vivo and in vitro effects of AVP and V1a receptor antagonist on Cushing s syndrome due to ACTH-independent bilateral macronodular adrenocortical hyperplasia. Clinical Endocrinology Arnaldi G, Gasc JM, De Keyzer Y, Raffin-Sanson ML, Perraudin V, Kuhn JM, Raux-Demay MC, Luton JP, Clauser E & Bertagna X. Variable expression of the V1 vasopressin receptor modulates the phenotypic response of steroid-secreting adrenocortical tumors. Journal of Clinical Endocrinology and Metabolism Lacroix A, Bolte E, Tremblay J, Dupré J, Poitras P, Fournier H, Garon J, Garrel D, Bayard F, Taillefer R, Flanagan RJ & Hamet P. Gastric inhibitory polypeptide-dependent cortisol hypersecretion a new cause of Cushing s syndrome. New England Journal of Medicine Reznik Y, Allali-Zerah V, Chayvialle JA, Leroyer R, Leymarie P, Travert G, Lebrethon MC, Budi I, Balliere AM & Mahoudeau J. Food-dependent Cushing s syndrome mediated by aberrant adrenal sensitivity to gastric inhibitory polypeptide. New England Journal of Medicine Lacroix A, Hamet P & Boutin JM. Leuprolide acetate therapy in luteinizing hormone-dependent Cushing s syndrome. New England Journal of Medicine Feelders RA, Lamberts SW, Hofland LJ, van Koetsveld PM, Verhoef-Post M, Themmen AP, de Jong FH, Bonjer HJ, Clark AJ, van der Lely AJ & de Herder WW. Luteinizing hormone (LH)-responsive Cushing s syndrome: the demonstration of LH receptor messenger ribonucleic acid in hyperplastic adrenal cells, which respond to chorionic gonadotropin and serotonin agonists in vitro. Journal of Clinical Endocrinology and Metabolism Lacroix A, Tremblay J, Rousseau G, Bouvier M & Hamet P. Propranolol therapy for ectopic beta-adrenergic receptors in adrenal Cushing s syndrome. New England Journal of Medicine Miyamura N, Tsutsumi A, Senokuchi H, Nakamaru K, Kawashima J, Sakai K, Taguchi T, Tokunaga H, Nishida K, Uehara M, Sakakida M & Araki E. A case of ACTH-independent macronodular adrenal hyperplasia: simultaneous expression of several aberrant hormone receptors in the adrenal gland. Endocrine Journal Cartier D, Lihrmann I, Parmentier F, Bastard C, Bertherat J, Caron P, Kuhn JM, Lacroix A, Tabarin A, Young J, Vaudry H & Lefebvre H. Overexpression of serotonin 4 receptors in cisapride-responsive adrenocorticotropin-independent bilateral macronodular adrenal hyperplasia causing Cushing s syndrome. Journal of Clinical Endocrinology and Metabolism Mannelli M, Ferruzzi P, Luciani P, Crescioli C, Buci L, Corona G, Serio M & Peri A. Cushing s syndrome in a patient with bilateral macronodular adrenal hyperplasia responding to cisapride: an in vivo and in vitro study. Journal of Clinical Endocrinology and Metabolism Nakamura Y, Son Y, Kohno Y, Shimono D, Kuwamura N, Koshiyama H, Sasano H & Matsuda T. Case of adrenocorticotropic hormone-independent macronodular adrenal hyperplasia with possible adrenal hypersensitivity to angiotensin II. Endocrine Reznik Y, Lefebvre H, Rohmer V, Charbonnel B, Tabarin A, Rodien P, Lecomte P, Bardet S, Coffin C, Mahoudeau J & REHOS Study Group. Aberrant adrenal sensitivity to multiple ligands in unilateral incidentaloma with subclinical autonomous cortisol hypersecretion: a prospective clinical study. Clinical Endocrinology Bertherat J, Contesse V, Louiset E, Barrande G, Duparc C, Groussin L, Emy P, Bertagna X, Kuhn JM, Vaudry H & Lefebvre H. In vivo and in vitro screening for illegitimate receptors in adrenocorticotropin-independent macronodular adrenal hyperplasia causing Cushing s syndrome: identification of two cases of gonadotropin/gastric inhibitory polypeptide-dependent hypercortisolism. Journal of Clinical Endocrinology and Metabolism Trejter M, Carraro G, Rucinski M, Hochol A, Rebuffat P, Nussdorfer GG & Malendowicz LK. Arginine-vasopressin regulates proliferative activity of the regenerating rat adrenal cortex. International Journal of Molecular Medicine Louiset E, Contesse V, Groussin L, Cartier D, Duparc C, Barrande G, Bertherat J, Vaudry H & Lefebvre H. Expression of serotonin 7 receptor and coupling of ectopic receptors to protein kinase A and ionic currents in adrenocorticotropin-independent macronodular adrenal hyperplasia causing Cushing s syndrome. Journal of Clinical Endocrinology and Metabolism Pabon JE, Li X, Lei ZM, Sanfilippo JS, Yussman MA & Rao CV. Novel presence of luteinizing hormone/chorionic gonadotropin receptors in human adrenal glands. Journal of Clinical Endocrinology and Metabolism Albiger NM, Occhi G, Mariniello B, Iacobone M, Favia G, Fassina A, Faggian D, Mantero F & Scaroni C. Food-dependent Cushing s syndrome: from molecular characterization to therapeutical results. European Journal of Endocrinology Kero J, Poutanen M, Zhang FP, Rahman N, McNicol AM, Nilson JH, Keri RA & Huhtaniemi IT. Elevated luteinizing hormone induces expression of its receptor and promotes steroidogenesis in the adrenal cortex. Journal of Clinical Investigation Mazzuco TL, Chabre O, Feige JJ & Thomas M. Aberrant expression of human luteinizing hormone receptor by adrenocortical cells is sufficient to provoke both hyperplasia and Cushing s syndrome features. Journal of Clinical Endocrinology and Metabolism Klimek M, Pabian W, Tomaszewska B & Kolodziejczyk J. Levels of plasma ACTH in men from infertile couples. Neuroendocrinology Letters Latronico AC, Reincke M, Mendonca BB, Arai K, Mora P, Allolio B, Wajchenberg BL, Chrousos GP & Tsigos C. No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in human adrenocortical neoplasms. Journal of Clinical Endocrinology and Metabolism Received 18 April 21 Accepted 11 May 21 Multiple hormone receptor expression in AIMAH 299 Downloaded from Bioscientifica.com at 11/15/218 9:37:57PM